CN101014614A - Plants having improved growth characteristics and method for making the same - Google Patents

Abstract

The present invention concerns a method for improving the growth characteristics of plants by increasing activity in a plant of a YIPPEE-like polypeptide or a homologue thereof. One such method comprises introducing into a plant a YIPPEE-like nucleic acid or variant thereof. The invention also relates to transgenic plants having introduced therein a YIPPEE-like nucleic acid or variant thereof, which plants have improved growth characteristics relative to corresponding wild type plants. The present invention also concerns constructs useful in the methods of the invention.

Description

Has plant of improvement growth characteristics and preparation method thereof

Technical field

Relate generally to biology field of the present invention, and relate to the method that improves plant growth characteristics.More specifically, the present invention relates to improve the especially method of productive rate of plant growth characteristics by the activity of YIPPEE sample polypeptide or its homologue in the increase plant.The invention still further relates to the plant with the active YIPPEE sample polypeptide of increase or its homologue, these plants have the growth characteristics of improvement with respect to corresponding wild type plant.The present invention also is provided at construct useful in the inventive method.

Technical background

The continuous growth of world population and be used for the minimizing of tilled the land supplys of agricultural promotes farming research and develops towards the direction of raising farm efficiency.The ordinary method of farm crop and gardening improvement is the plant that utilizes breeding technique to identify to have desired characteristic.Yet this breeding technique has several shortcomings, and promptly these technology are normally labor-intensive, and produces the plant that contains the allogeneic heredity component usually, and these hereditary components are not always to produce the desirable proterties of transmitting from mother plant.Molecular biological progress has allowed the germplasm (germplasm) of human reconstruction animal and plant.Plant genetic engineering need separate and operate genetic material (common form with DNA or RNA) and subsequently this genetic material be imported plant.This techniques enable is enough sent the farm crop or the plant of economy, agricultural or gardening proterties with multiple improvement.A proterties with special economic interests is a productive rate.Productive rate is generally defined as the output measured from the farm crop economic worth.It can define according to quantity and/or quality.Productive rate directly depends on several factors, for example: the quantity of organ and size, plant structure (for example branch amount), seed production and more factors.The growth of root, dietetic alimentation and stress tolerance also are the important factors of decision productive rate.Can increase the productive rate of farm crop by optimizing one of above-mentioned factor.

The ability of improvement plant multiple growth characteristics will such as: the fields such as production, arboriculture (aboriculture), Horticulture and forestry that strengthen farm crop, plant breeding, ornamental plant have many application.The growth characteristics of improvement, as productive rate, the algae that also can be used for using at bio-reactor produces (be used for the biotechnology production such as medicine, antibody or vaccine substance, or be used for the bio-transformation of organic waste) and other this class field.

Have now found that, compare that the activity that strengthens YIPPEE sample polypeptide in the plant makes plant have the growth characteristics of improvement with corresponding wild-type plant.

The YIPPEE gene is found first in fruit bat, and has been disclosed at eukaryote the camber conservative new family of inferring zinc-binding protein matter (Roxstrom-Lindquist K. and Faye I. (2001) Insect Mol Biol.10 (1): 77-86).YIPPEE protein is characterized, and find that it contains a zinc of inferring and refers to sample melts combine structural domain.It is first member who is characterized in this conservative gene family protein, and described conservative gene family protein is present in the multiple eukaryote from cellular slime mould to the mankind.The YIPPEE gene generally is expressed in the different developmental phases of fruit bat.The high conservative of YIPPEE sample sequence in extensive species scope shows the general importance of YIPPEE protein in eukaryote.

Summary of the invention

According to the present invention, the method for improvement plant growth characteristics is provided, it comprises the activity that increases YIPPEE sample polypeptide in the plant or its homologue.

Advantageously, carry out method of the present invention and make plant have the growth characteristics of multiple improvement, especially the productive rate of Zeng Jiaing, particularly seed productive rate.

Term defined herein " productive rate of increase " means with respect to corresponding wild type plant, increase in following arbitrary or many aspects: (i) one or more parts of plant, particularly the biomass (weight), the root biomass that increases or any other that increase of (can gather in the crops) part can be gathered in the crops the biomass that part increases on the ground; (ii) the seed productive rate of Zeng Jiaing comprises the increase of seed biomass (seed weight), and can be every strain plant seed weight or based on the increase of single seed; The (iii) full seed quantity of Zeng Jiaing; The (iv) seed size of Zeng Jiaing, it also may influence the composition of seed; (the v) seed volume of Zeng Jiaing, it also may influence the composition of seed; (the vi) harvest index of Zeng Jiaing, it is expressed as the productive rate that can gather in the crops part (as seed) and the ratio of total biomass; (the vii) thousand seed weight of Zeng Jiaing (TKW), it is to infer from full seed number of being counted and their gross weight.The TKW that increases may be derived from the seed size and/or the seed weight of increase.

With the corn is example, and the increase of productive rate can show as following one or more: the increase of per hectare or every acre of plant quantity, the increase of every strain plant spike number, increase of line number, a row grain number, grain weight, thousand seed weight, fringe length/diameter or the like.With the rice is example, and the increase of productive rate can show as following one or more: the quantity of per hectare or every acre of plant, the panicle number of every strain plant, each paniculiform spikelet number, each paniculiform number of spending, the increase of the full rate of seed, increase of thousand seed weight or the like.The increase of productive rate is the mutagenic structure of possibility also, and the result who perhaps can be used as the structure of change takes place.

According to preferred aspect, carry out the plant that method of the present invention produces the productive rate (particularly seed productive rate) with increase.Therefore, the invention provides the method that increases plant yield (particularly seed productive rate), this method comprises the activity that increases YIPPEE sample polypeptide in the plant or its homologue.

Because transgenic plant of the present invention have the productive rate of increase, for the growth velocity of their life cycle respective stage, these plants may present the growth velocity (in life cycle of their parts at least) of increase with respect to corresponding wild-type plant.The growth velocity that increases may be specific to one or more parts (comprising seed) of plant, perhaps may spread all over whole plants basically.Have the plant that increases growth velocity even may present early flowering.The increase of growth velocity may appear at one or more stages in plant life cycle, perhaps appears in the process of whole plants life cycle basically.At the commitment in plant life cycle, the growth of growth velocity may show as the enhanced vigor.The increase of growth velocity can change the harvest cycle of plant, makes the plant can be than other possible situation more late sowing kind and/or faster results.If growth velocity fully increases, may allow to sow the more seed of kindred plant species (for example sow and gather in the crops rice plants, subsequently in sowing in vegetative period of a routine and gather in the crops more rice plants).Same, if growth velocity increases fully, may allow to sow the more seed of different plant species (for example sow and gather in the crops rice plants, subsequently, as sowing and optional results soybean, potato or any plant that other is fit to).Also may be under the situation of some plants from the number of times of same rhizome results increase.The harvest cycle that changes plant may cause every acre year biomass yield increase (this be because (for example in 1 year) any specified plant can be grown and the increase of harvesting frequency).Compare with wild type counterparts, the increase of growth velocity also may allow to more wide region cultivation transgenic plant because the region restriction of plantation farm crop during usually by plantation when (season early) or results (season in evening) hostile environment condition determined.If the shortening harvest cycle can be avoided this class unfavourable condition.Can determine growth velocity by the multiple parameter from growth curve, this class parameter can be: T-Mid (plant reaches 50% required time of its largest amount) and T-90 (plant reaches its largest amount 90% required time) or the like.

Carry out method of the present invention and give the growth velocity that plant increases.Therefore, the invention provides the method that increases plant growth rate, this method comprises the activity that increases YIPPEE sample polypeptide in the plant or its homologue.

Be under the no stress conditions plant, or plant is exposed to the multiple increase that issues productivity and/or growth velocity of coercing with respect to control plant.Usually plant is replied to be exposed to by growth more slowly and coerces.Under the severe stress conditions, plant even can stop growing fully.On the other hand, moderate is coerced to be defined as in this article when plant and is exposed to this, and it does not cause the plant forfeiture that stops growing fully to restart any of energy for growth and coerce.Because the development of the farming method (irrigation, fertilising, pesticide treatments), the crop plants of cultivation usually can not run into severe and coerce.Therefore, by the impaired key element of not expecting in the agricultural that is grown to serve as of moderate stress-inducing.It is that the typical case that plant may contact coerces that moderate is coerced.These coerce can be the plant daily biology that is exposed to it and/or abiotic (environment) coerce.The coercing of typical abiotic or environment comprises by the temperature that the heat of abnormality or cold/freezing temperature produces coerces; Salt stress; Water is coerced (arid or excessive water).Abiotic stress also can be caused by pharmaceutical chemicals.Biological coercing generally is that those that caused by pathogenic agent such as bacterium, virus, fungi and insect are coerced.

Can in any plant, advantageously modify above-mentioned growth characteristics.

Term used herein " plant " comprises ancestors of whole plants, plant and the part of offspring and plant, comprise seed, bud, stem, leaf, root, flower (comprising stem tuber) and tissue and organ, wherein above-mentioned every kind (preferably at YIPPEE sample locus) comprises goal gene/nucleic acid and/or genetic modification.Term " plant " also comprises suspension culture, callus, embryo, meristematic zone, gametophyte, sporophyte, pollen and sporule, and equally wherein above-mentioned every kind (preferably at YIPPEE sample locus) comprises goal gene/nucleic acid and/or genetic modification.

Useful especially in the method for the invention plant comprises the whole plants that belong to vegitabilia (Viridiplantae) superfamily, particularly unifacial leaf and dicotyledons comprise the feed or feed leguminous plants, ornamental plant, food crop, arbor or the shrub that are selected from following species; Acacia species (Acaciaspp.), maple species (Acer spp.), Actinidia species (Actinidia spp.), Aesculus species (Aesculus spp.), New Zealand kauri (Agathis australis), Albiziaamara, Alsophila tricolor, Andropogon species (Andropogon spp.), Arachis species (Arachis spp.), betel nut (Areca catechu), Astelia fragrans, Astragaluscicer, Baikiaea plurijuga, Betula (Betula spp.), Btassica (Brassica spp.), Bruguiera conjugata (Bruguiera gymnorrhiza), Burkea africana, palas (Butea frondosa), Cadaba farinosa, Zhu Ying Pittosporum species (Calliandra spp.), daye tea (Camelliasinensis), Canna generalis Bailey (Canna indica), Capsicum species (Capsicum spp.), Cassia species (Cassia spp.), apart from pea (Centroema pubescens), Chaenomeles species (Chaenomeles spp.), Chinese cassia tree (Cinnamomum cassia), fruitlet coffee (Coffeaarabica), Colophospermum mopane, variation coronule flower (Coronillia varia), Cotoneaster serotina, hawthorn species (Crataegus spp.), Cucumis species (Cucumisspp.), Cupressus species (Cupressus spp.), Cyathea dealbata Quinces Quince (Cydoniaoblonga), Japanese cypress (Cryptomeria japonica), Cymbopogon species (Cymbopogonspp.), Cynthea dealbata Quinces Quince (Cydonia oblonga), Dalbergia monetaria, Da Ye Rhizome of Fortune's Drynaria (Davallia divaricata), mountain horseleech species (Desmodium spp.), coarse freshwater mussel shellfish fern (Dicksonia squarosa), Diheteropogon amplectens, Dioclea spp, sickle Dolichos species (Dolichos spp.), Dorycnium rectum, Echinochloapyramidalis, Ehrartia spp. Finger-millet (Eleusine coracana), Herba Eragrostidis pilosae species (Eragrestis spp.), Erythrina species (Erythrina spp.), eucalyptus species (Eucalyptusspp.), Euclea schimperi, Eulalia villosa, Fagopyrum species (Fagopyrum spp.), feijoa (Feijoa sellowiana), Fragaria species (Fragaria spp.), Moghania species (Flemingia spp), Freycinetia banksii, Geranium thunbergi, ginkgo (Ginkgobiloba), Glycine javanica, Gliricidia spp, upland cotton (Gossypium hirsutum), Grevillea species (Grevillea spp.), Guibourtia coleosperma, rock Astragalus species (Hedysarum spp.), Hemarthria compressa (Hemarthia altissima), turn round Huang Mao (Heteropogoncontortus), barley (Hordeum vulgare), Hyparrhenia rufa, Herba Hyperici Erecti (Hypericumerectum), Hyperthelia dissoluta, spend front yard indigo plant (Indigo incarnata) in vain, Jris species (Iris spp.), Leptarrhena pyrolifolia, lespedeza species (Lespediza spp.), Lettuca spp., Leucaena leucocephala, Loudetia simplex, sieve beans (Lotonusbainesii) that pause, Lotus species (Lotus spp.), Macrotyloma axillare, Malus species (Malus spp.), Manihot esculenta, alfalfa (Medicago sativa), metasequoia (Metasequoia glyptostroboides), powder bajiao banana (Musa sapientum), Nicotiana species (Nicotianum spp.), donkey food Macroptilium species (Onobrychis spp.), Ornithopus spp., Oryza species (Oryza spp.), Peltophorum africanum, Pennisetum species (Pennisetumspp.), Persea gratissima, green winter Solanum species (Petunia spp.), Phaseolus species (Phaseolus spp.), betel nut bamboo (Phoenix canariensis), Phormium cookianum, Photinia species (Photinia spp.), white spruce (Picea glauca), Pinus species (Pinusspp.), pea (Pisum sativum), alpine totara (Podocarpus totara), Pogonarthria fleckii, Pogonarthria squarrosa, Populus species (Populus spp.), algarroba (Prosopis cineraria), Pseudotsuga menziesii (Mirbel) Franco (Pseudotsuga menziesii), Pterolobiumstellatum, European pear (Pyrus communis), oak species (Quercus spp.), Rhaphiolepsis umbellata, delicious rod is spent palm fibre (Rhopalostylis sapida), Rhusnatalensis, Europe gooseberry (Ribes grossularia), currant species (Ribes spp.), acacia (Robinia pseudoacacia), rose species (Rosa spp.), rubus species (Rubus spp.), Salix species (Salix spp.), Schyzachyrium sanguineum, parasol pine (Sciadopitys verticillata), sequoia sempervirens (Sequoia sempervirens), big tree (Sequoiadendron giganteum), dichromatism chinese sorghum (Sorghum bicolor), spinach species (Spinacia spp.), Sporobolus fimbriatus, Stiburus alopecuroides, Stylosanthos humilis, Triquetrous Tadehagi Herb species (Tadehagi spp.), southern cypress (Taxodiumdistichum), Arabic Herba Themedae japonicae (Themeda triandra), Clover species (Trifoliumspp.), Triticum species (Triticum spp.), tsuga heterophylla (Tsuga heterophylla), genus vaccinium species (Vaccinium spp.), Vetch species (Vicia spp.), grape (Vitisvinfera), the fertile gloomy flower (Watsonia pyramidata) of awl fringe, common calla (Zantedeschiaaethiopica), Zea mays (Zea mays), Amaranthus, arithoke, asparagus, cabbage, brassica oleracea var gemmifera, Caulis et Folium Brassicae capitatae, rape, Radix Dauci Sativae, Cauliflower, celery, the green wild cabbage of the garment or robe made of feathers, flax, kale; root of Szemao crotalaria; oil grain rape; gumbo; onion; potato; rice; soybean; strawberry; sugar beet; sugarcane; Sunflower Receptacle; tomato; pumpkin; tea tree and algae or the like.According to the preferred embodiment of the invention, described plant is a crop plants, as soybean, Sunflower Receptacle, rape, clover, Semen Brassicae campestris, cotton, tomato, potato or tobacco.Further preferred plant is a monocotyledons, as sugarcane.Preferred plant is a cereal, as rice, corn, wheat, barley, grain, rye, Chinese sorghum or oat.

Can increase the activity of YIPPEE sample polypeptide by the level that improves polypeptide in the plant.Alternatively, when YIPPEE sample polypeptide level does not change, perhaps even when YIPPEE sample polypeptide level reduces, its activity also can increase.When this situation appears at the polypeptide natural characteristics and changes, for example, have more active mutant forms than wild type peptide by preparation.

The term " YIPPEE sample polypeptide or its homologue " of this paper definition refers to such polypeptide, and it comprises: the zinc-binding motif of (i) inferring: 2 * CXXC, and wherein X is an arbitrary amino acid residue; (ii) KYKEGK motif, it allows an aminoacid replacement at an arbitrary position and the aminoacid replacement of guarding arbitrarily; (iii) GRAYLF motif, it allows an aminoacid replacement at an arbitrary position and the aminoacid replacement of guarding arbitrarily.The zinc-binding motif of inferring: find that usually 2 * CXXC exists the interval of about 52 amino-acid residues, that is: CXXC{52 amino acid between first and second CXXC } CXXC.Term " conservative arbitrarily aminoacid replacement " means arbitrary or a plurality of amino-acid residue and can be replaced by conservative replacement.Can easily obtain conservative replacement table in the present technique field.Following table provides the example of conservative aminoacid replacement.

Table 1: the example that conserved amino acid replaces

Residue	The conservative replacement	Residue	The conservative replacement
				Ala	Ser	Leu	Ile、Val
Arg	Lys	Lys	Arg、Gln
				Asn	Gln、His	Met	Leu、Ile
Asp	Glu	Phe	Met、Leu、Tyr
				Gln	Asn	Ser	Thr、Gly
Cys	Ser	Thr	Ser、Val

Glu	Asp	Trp	Tyr
				Gly	Pro	Tyr	Trp、Phe
His	Asn、Gln	Val	Ile、Leu
				Ile	Leu、Val

Can easily identify with well-known routine techniques in this area " YIPPEE sample polypeptide or its homologue ".The motif of above-mentioned definition is a high conservative, and therefore, those skilled in the art can easily identify other YIPPEE sample sequence according to the existence of these motifs.

Based on having found by the nucleic acid encoding of SEQ ID NO:1, the plant YIPPEE sample peptide sequence of SEQ ID NO:2 representative with the homology of fruit bat transcription factor.The polypeptide example that is included into the plant derivation of " YIPPEE sample polypeptide or its homologue " definition comprises: all At3g08990 from Arabidopis thaliana (Arabidopsis thalialiana) (SEQ ID NO:4), At3g11230 (SEQ IDNO:6), At2g40110 (SEQ ID NO:8), At4g27740 (SEQ ID NO:10) and At5g53940 (SEQ ID NO:12); AB061267 (SEQ ID NO:14) from potato; Predicted protein matter AY109711.1 in the corn (SEQ ID NO:16) and AY104347.1 (SEQID NO:18); Predicted protein matter NM_196100.1 in the rice (SEQ ID NO:20), AK121352.1 (SEQ ID NO:22) and AK109500.1 (SEQ ID NO:24).Following table has been showed above-mentioned YIPPEE sample peptide sequence and the SEQ ID NO:2 percent homology based on whole sequence alignment.Accession number 1 to 7 finger protein matter in the table, all the other accession number refer to have the mRNA of the corresponding SEQ ID NO that provides protein prediction.The percentage ratio of identity carries out calculating of default parameter with NCBI comparison program.

Table 2: based on the homology of the YIPPEE sample protein sequence and the SEQ ID NO:2 of whole sequence alignment

	Accession number	SEQ ID NO	Identity % (Blast comparison)	The source
					1	At3G55890(CDS1522)	SEQ ID NO：2		Arabidopis thaliana
2	At3g08990	SEQ ID NO：4	61	Arabidopis thaliana

3	At3g11230	SEQ ID NO：6	62	Arabidopis thaliana
					4	At2g40110	SEQ ID NO：8	66	Arabidopis thaliana
5	At4g27740	SEQ ID NO：10	53	Arabidopis thaliana
					6	At5g53940	SEQ ID NO：12	60	Arabidopis thaliana
7	AB061267	SEQ ID NO：14	63	Potato
					8	AY109711.1	SEQ ID NO：16	63	Corn
9	AY104347.1	SEQ ID NO：18	60	Corn
					10	NM_196100.1	SEQ ID NO：20	50	Rice
11	AK121352.1	SEQ ID NO：22	53	Rice
					12	AK109500.1	SEQ ID NO：24	64	Rice

It should be understood that, the sequence that is included into " YIPPEE sample polypeptide or its homologue " definition is not limited to sequence by SEQ ID NO:2, SEQ ID NO:4, SEQ ID NO:6, SEQ ID NO:8, SEQ ID NO:10, SEQ ID NO:12, SEQ ID NO:14, SEQ ID NO:16, SEQ ID NO:18, SEQ ID NO:20, SEQ ID NO:22 and SEQ ID NO:24 representative, but any polypeptide that meets following standard, described standard comprises: the zinc-binding motif of (i) inferring: 2 * CXXC, and wherein X refers to arbitrary amino acid residue; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, the conservative arbitrarily aminoacid replacement that it allows an aminoacid replacement at an arbitrary position and goes for the inventive method.When polypeptide has at least a above-mentioned (i) to (iii) motif, also can carry out method of the present invention.

The nucleic acid of coding YIPPEE sample polypeptide or its homologue can be any natural or synthetic nucleic acid.More than Ding Yi YIPPEE sample polypeptide or its homologue are by YIPPEE sample nucleic acid/genes encoding.Therefore, the term " YIPPEE sample nucleic acid/gene " of this paper definition is any nucleic acid/gene of YIPPEE sample polypeptide as defined above or its homologue of encoding.The example of YIPPEE sample nucleic acid comprises those sequences of arbitrary representative among SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ IDNO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 and the SEQ ID NO:23.YIPPEE sample nucleic acid/gene and variant thereof may be suitable for implementing method of the present invention.The variant of YIPPEE sample nucleic acid/gene comprise YIPPEE sample nucleic acid/gene part and/or can with the nucleic acid of YIPPEE sample nucleic acid/gene recombination.

The term " part " of this paper definition refers to comprise the dna fragmentation of at least 249 Nucleotide, and this part coding comprises the polypeptide of following arbitrary or a plurality of (preferably owning) motif: the zinc-binding motif of (i) inferring: 2 * CXXC, and wherein X refers to arbitrary amino acid residue; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement.Of course, for example, prepare part by in YIPPEE sample nucleic acid, producing one or more disappearances.Part can be used with isolating form, perhaps they can encode with other (or non-coding) sequence merge with, for example, produce the protein of combination various active.When merging with other encoding sequence, the polypeptide product that translation produces may be disconnected greater than the YIPPEE print of prediction.Preferably, funtion part is the part by following arbitrary representative nucleic acid: SEQ ID NO:1, SEQ ID NO:3, SEQID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:23.

Another YIPPEE sample nucleic acid/genetic mutation be under the stringent condition that reduces (preferably under stringent condition) can with the nucleic acid of defined YIPPEE sample nucleic acid/gene recombination above, this hybridization sequences coding comprises the polypeptide of following arbitrary or a plurality of (preferably owning) motif: (i) zinc-binding motif of inferring: 2 * CXXC, and wherein X refers to arbitrary amino acid residue; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement.Preferably, hybridization sequences can with any nucleic acid array hybridizing by SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 and SEQID NO:23 representative, or with any part hybridization of defined above-mentioned nucleotide sequence above.

The term " hybridization " of this paper definition refers to wherein basic homology complementary nucleotide sequence annealed process each other.Crossover process can take place in solution fully, and promptly complementary nucleic acid is all in solution.Crossover process also can be carried out in this case, and promptly one of complementary nucleic acid is fixed on the matrix, on magnetic bead, sepharose 4B or any other resin.In addition, crossover process also can so be carried out, promptly wherein one of complementary nucleic acid is fixed on solid support such as nitrocellulose or the nylon membrane, perhaps is fixed on (latter is referred to as nucleic acid array or microarray, or is referred to as nucleic acid chip) on the siliceous glass support as photolithograph.For hybridization is taken place, make nucleic acid molecule thermally denature or chemical modification usually, so that two strands is unwind into two strands, and/or remove hairpin structure or other secondary structure in the single-chain nucleic acid.The severity of hybridization is subjected to such as condition effect such as temperature, salt concn, ionic strength and hybridization buffer compositions.

In the situation of nucleic acid hybridization experiment (as Southern and Northern hybridization), " stringent hybridization condition " and " strict hybridization wash conditions " depends on sequence, and different under different environmental parameters.Those skilled in the art know the multiple parameter that can change in hybridization and washing process, thereby keep or the change stringent condition.

T _mBe under ionic strength of determining and pH value, the temperature of 50% target sequence and complete paired probe hybridization.T _mDepend on the based composition and the length of solution condition and probe.For example, than long sequence specific hybrid under comparatively high temps.Be lower than T _mBe worth 16 ℃ to 32 ℃ and obtain maximum hybrid rate.In hybridization solution, exist monovalent cation can reduce Coulomb repulsion effect between two nucleic acid chains, thereby promote heterozygote to form; When na concn during up to 0.4M, this effect is obvious.The methane amide of each percentage point can make the melting temperature(Tm) of DNA-DNA and DNA-RNA duplex reduce by 0.6 to 0.7 ℃, adds 50% methane amide hybridization is finished at 30 to 45 ℃, although this will reduce hybrid rate.Base-pair mismatch reduces the thermostability of hybrid rate and duplex.On average, for big probe, each percentage point base mispairing makes T _mValue descends about 1 ℃.T _mValue can be calculated with the following equation that depends on the heterozygote type:

1, DNA-DNA heterozygote (Meinkoth and Wahl, Anal.Biochem., 138:267-284,1984):

Tm=81.5 ℃+16.6 * log[Na ⁺] ^a+ 0.41 * %[G/C ^b]-500 * [L ^c] ^-1-0.61 * % methane amide

2, DNA-RNA or RNA-RNA heterozygote:

Tm=79.8+18.5(log ₁₀[Na ⁺] ^a)+0.58(％G/C ^b)+11.8(％G/C ^b) ²-820/L ^c

3, few DNA or few RNA ^dHeterozygote:

＜20 Nucleotide: Tm=2 (l _n)

20-35 Nucleotide: Tm=22+1.46 (l _n)

^aOr it is for other monovalent cation, but only accurate in the 0.01-0.4M scope.

^bOnly accurate for the %GC in 30% to 75% scope.

^cThe base pair length of L=duplex.

^dThe widow, oligonucleotide; l _n, the useful length of primer=2 * (G/C number)+(A/T number).

Note: for per 1% methane amide, T _mValue reduces about 0.6 to 0.7 ℃, and the existence of 6M urea can make T _mValue reduces about 30 ℃.

The hybridization specificity is the function of post-hybridization washing normally.In order to remove the background that non-specific hybridization produces, with the salts solution washing sample of dilution.The key factor of this class washing comprises the ionic strength and the temperature of final washing soln: salt concn is low more, wash temperature is high more, and the severity of washing is just high more.Wash conditions is carried out under the stringency being equal to or less than hybridization usually.Usually, the stringent condition that is applicable to nucleic acid hybridization mensuration or gene amplification detecting operation as above is set.Also can select higher or lower stringency.Usually, at ionic strength of determining and the particular sequence under the pH value, select specific heat melting temperature(Tm) (T _m) low 50 ℃ low stringency condition.Medium stringent condition is that temperature compares T _mLow 20 ℃, high stringent condition is that temperature compares T _mLow 10 ℃.For example, stringent condition is at least as strict as condition A-L; The stringent condition that reduces is at least as strict as condition M-R.Can be by the arbitrary non-specific binding of controlling in many known technologies, described technology such as, for example use proteinaceous solution closing membrane, in hybridization buffer, add allos RNA, DNA and SDS and handle with the RNA enzyme.In following table 3, list the example of hybridization and wash conditions.

Table 3: the example of hybridization and wash conditions

Stringent condition	The polynucleotide heterozygote ±	Hybrid length (bp) 	Hybridization temperature and damping fluid 	Wash temperature and damping fluid 
					A	DNA：DNA	＞or equal 50	65 ℃ of 1 * SSC; Or 42 ℃, 1 * ssc and 50% methane amide	65℃； O.3×SSC

B	DNA:DNA	＜50	Tb *；1×SSC	Tb *；1×SSC
					C	DNA:RNA	＞or equal 50	67 ℃ of 1 * SSC; Or 45 ℃, 1 * SSC and 50% methane amide	67℃； 0.3×SSC
D	DNA:RNA	＜50	Td *；1×SSC	Td *；1×SSC
					E	RNA:RNA	＞or equal 50	70 ℃ of 1 * SSC; Or 50 ℃, 1 * SSC and 50% methane amide	70℃； 0.3×SSC
F	RNA:RNA	＜50	Tf *；1×SSC	Tf *；1×SSC
					G	DNA:DNA	＞or equal 50	65 ℃ of 4 * SSC; Or 45 ℃, 4 * SSC and 50% methane amide	65℃； 1×SSC
H	DNA:DNA	＜50	Th *；4×SSC	Th *；4×SSC
					I	DNA:RNA	＞or equal 50	67 ℃ of 4 * SSC; Or 45 ℃, 4 * SSC and 50% methane amide	67℃； 1×SSC
J	DNA:RNA	＜50	Tj *；4×SSC	Tj *；4 ×SSC
					K	RNA:RNA	＞or equal 50	70 ℃ of 4 * SSC; Or 40 ℃, 6 * SSC and 50% methane amide	67℃； 1×SSC
L	RNA:RNA	＜50	T1 *；2×SSC	T1 *；2×SSC
					M	DNA:DNA	＞or equal 50	50 ℃ of 4 * SSC; Or 40 ℃, 6 * SSC and 50% methane amide	50℃； 2×SSC
N	DNA:DNA	＜50	Tn *；6×SSC	Tn *；6×SSC
					O	DNA:RNA	＞or equal 50	55 ℃ of 4 * SSC; Or 42 ℃, 6 * SSC and 50% methane amide	55℃； 2×SSC
P	DNA:RNA	＜50	Tp *；6×SSC	Tp *；6×SSC

Q	RNA:RNA	＞or equal 50	60 ℃ of 4 * SSC; Or 45 ℃, 6 * SSC and 50% methane amide	60℃.； 2×SSC
					R	RNA:RNA	＜50	Tr *；4×SSC	Tr *；4×SSC

^" hybridization length " is the expection length of hybrid nucleic acid.When the nucleic acid hybridization of known array, can and differentiate that conservative region as herein described determines hybrid length by aligned sequences.

^In hybridization and lavation buffer solution, can (1 * SSPE be 0.15M NaCI, 10mM NaH with SSPE ₂PO4 and 1.25mM EDTA pH7.4) replace SSC (1 * SSC is 0.15MNaCl and 15mM Trisodium Citrate); Hybridization was finished after scouring 15 minutes.Hybridization and washing can additionally comprise 5 * Denhardt's reagent, 0.5-1.0%SDS, 100 μ g/ml sex change fragmentation salmon sperm DNA, 0.5% trisodium phosphate and up to 50% methane amide.

^*Tb-Tr: for the heterozygote of expection length less than 50 base pairs, hybridization temperature should be than the melting temperature(Tm) T of heterozygote _mLow 5-10 ℃; Determine T according to aforesaid equation _m

^±The present invention comprises that also the nucleic acid with PNA or modification replaces arbitrary or a plurality of DNA or RNA hybridization mating partner.

In order to define the severity level, can be with reference to the molecular cloning of people such as Sambrook (2001): laboratory manual, the third edition, cold spring harbor laboratory publishes, cold spring port, New York, perhaps CurrentProtocols in Molecular Biology, John Wiley ﹠amp; Sons, N.Y. (1989).

YIPPEE sample nucleic acid or its variant can be from any natural or artificial sources.Nucleic acid/gene or its variant can separate from microbe-derived (as bacterium, yeast or fungi), or separate from plant, algae or animal (comprising the mankind).Can on composition and/or genome environment, modify the natural form of described nucleic acid by careful manual operation.No matter the nucleic acid in preferred plant source derives from same plant species (for example for the species that it is imported into) or derives from different plant species.Can preferably from Cruciferae, more preferably separate described nucleic acid from dicotyledonous species from Arabidopis thaliana.More preferably, isolating YIPPEE sample nucleic acid is expressed as SEQ ID NO:1 from Arabidopis thaliana, and YIPPEE sample aminoacid sequence is expressed as SEQ ID NO:2.

Can be by importing the activity of genetic modification (preferably at YIPPEE sample locus) raising YIPPEE sample polypeptide or its homologue.Locus defined herein means the genome district, and it comprises the 10KB in goal gene and upstream of coding region or downstream.

Can import genetic modification by arbitrary (or a plurality of) following method, described method comprises: TDNA activation, TILLING, site-directed mutagenesis, orthogenesis, homologous recombination or by import and express the nucleic acid of coding YIPPEE sample polypeptide or its homologue in plant.Importing genetic modification step afterwards is to select the active YIPPEE sample polypeptide that increases, and its active increase makes plant have the growth characteristics of improvement.

T-DNA activation tagging (people Science (1992) 1350-1353 such as Hayashi) comprises that the T-DNA that will contain promotor (also can be translational enhancer or intron) usually is inserted in genome district or the gene coding region upstream or the downstream 10KB of goal gene, thereby makes promotor can instruct the expression of target gene in configuration.Usually natural promoter is destroyed to the regulation and control of expression of target gene, and gene is by the promotor control of new importing.Promotor generally is contained among the T-DNA., for example, infect by Agrobacterium (Agrobacterium) and this T-DNA to be inserted Plant Genome at random and cause near the gene overexpression that inserts the T-DNA.The transgenic plant that obtain are owing near the gene overexpression promotor that imports shows the dominant phenotype.The promotor that imports can be arbitrarily can be in desirable organism (being plant in this case) instruct the promotor of genetic expression.For example, composing type, that organize preference, the cell type preference and promotor induction type are applicable to that all T-DNA activates.

Also can genetic modification be imported the YIPPEE locus by TILLING (the local sudden change of fixed point inductive genome) technology.This is a kind of induced-mutation technique, its be used to produce and/or identify, and last separate mutagenesis can present the active YIPPEE sample of YIPPEE sample nucleic acid variant.TILLING also allows to select to carry the plant of this kind mutation variants.These mutation variants even may present higher YIPPEE sample activity than its natural form gene.TILLING combines high-density mutagenesis and high-throughput screening method.The step that TILLING generally follows has: (a) EMS mutagenesis (Redei and Koncz, 1992; People such as Feldmann, 1994; Lightner and Caspar, 1998); (b) DNA preparation and individual the merging; (c) pcr amplification in purpose zone; (d) sex change and annealing are to form assorted duplex; (e) DHPLC, the assorted duplex that wherein exists in the storehouse can detect extra peak on color atlas; (f) evaluation of mutated individual; (g) order-checking of sudden change PCR product.The method of TILLING is (McCallum Nat Biotechnol.2000 Apr well-known in this area; 18 (4): 455-7, by Stemple summary, 2004 (TILLING-a high-throughput harvest for functional genomics.Nat Rev Genet.2004 Feb; 5 (2): 145-50.)).

Site-directed mutagenesis can be used for producing the variant of YIPPEE sample nucleic acid or its part.Can finish site-directed mutagenesis by several method, the method for the modal PCR of being based on (current protocols inmolecular biology.Wiley edits http://www.4ulr.com/products/currentprotocols/index.html).

Orthogenesis also can be used to produce the variant of YIPPEE sample nucleic acid.This comprises the repetition of DNA reorganization, succeeded by suitable screening and/or selection, has the variant of YIPPEE sample nucleic acid of biologically active polypeptides of modification or the variant of its part (people such as Castle, (2004) Science304 (5674): 1151-4 to produce coding; United States Patent (USP) 5,811,238 and 6,395,547).

TDNA activation, TILLING, orthogenesis and site-directed mutagenesis are the examples that can produce the technology of new allelotrope and YIPPEE sample variant.

Homologous recombination allows the appointment selected location in genome to import selected nucleic acid.Homologous recombination is the conventional standard technique of using in the bio-science, and it is used for low organism such as yeast or the small liwan moss (physcomitrella) of waiting.The method of carrying out homologous recombination in plant is described in model plant not only that (people Extrachromosomal homologous recombination andgene targeting in plant cells after Agrobacterium-mediated transformation.1990EMBO such as Offringa J.1990Oct; 9 (10): 3077-84), and at crop plants, as being described (Terada R in the rice, Urawa H, Inagaki Y. Tsugane K, Iida S.Efficient genetargeting by homologous recombination in rice.Nat Biotechnol.2002.Iidaand Terada:A tale of two integrations, transgene and T-DNA:genetargeting by homologous recombination in rice.Curr Opin Biotechnol.2004 Apr; 15 (2): 132-8).The nucleic acid of institute's target (it may be YIPPEE sample nucleic acid or its variant that above defines) does not need target YIPPEE sample locus, but can be imported into for example zone of high expression level.The nucleic acid of institute's target can be the allelotrope of improvement, and it is used for replacing native gene or additionally is incorporated into native gene.

According to the preferred embodiments of the invention,, can improve the growth characteristics of plant by in plant, importing and express the nucleic acid of coding YIPPEE sample polypeptide or its homologue.

The preferred method that imports genetic modification (need not import in the YIPPEE sample locus) in this case is the nucleic acid that imports and express coding YIPPEE sample polypeptide or its homologue in plant.Above-mentioned YIPPEE sample polypeptide or its homologue comprise: the zinc-binding motif of (i) inferring: 2 * CXXC, and wherein X refers to arbitrary amino acid residue; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement.The nucleic acid that imports plant can be the nucleic acid of total length or the part or the hybridization sequences of above-mentioned definition.

Proteinic " homologue " comprises peptide, oligopeptides, polypeptide, protein and enzyme, it has aminoacid replacement, disappearance and/or insertion with respect to the unmodified protein matter of being discussed, and have to its derived from similar biologic activity and the functionally active of unmodified formal protein.In order to produce such homologue, proteinic amino acid is replaced by other amino acid with similar quality (as similar hydrophobicity, wetting ability, antigenicity, form or break the tendency of αLuo Xuanjiegou or β laminated structure).Conservative replacement table is well-known in this area (for example seeing Creighton (1984) Proteins.W.H.Freeman and Company and above-mentioned table 1).

The preferred aspect according to the present invention, the aminoacid sequence of homologue and SEQ ID NO:2 representative has at least 45% sequence identity.Can determine easily that by sequence alignment whether polypeptide has at least 45% sequence identity with the aminoacid sequence of SEQID NO:2 representative.The sequence alignment method that is used for comparison is well-known in this area, and these methods comprise GAP, BESTFIT, BLAST, FASTA and TFASTA.The comparison that GAP application Needleman and Wunsch algorithm (J.Mol.Biol.48:443-453,1970) are searched two complete sequences minimizes maximization of pairing number and room number.The per-cent of BLAST arithmetic calculation sequence identity, and the similarity between two sequences carried out statistical study.The software of carrying out the BLAST analysis can obtain publicly from biotechnology infonation center.By the comparison (opinion) of search sequence (preferred protein sequence) and known YIPPEE sample protein sequence, can differentiate easily that aminoacid sequence with SEQ ID NO:2 representative has YIPPEE sample polypeptide or its homologue of at least 45% sequence identity for example in comparison shown in Figure 1.For example can use VNTI AlignX multiple ratio program to be carried out the comparison (with known YIPPEE sample sequence) of search sequence, it is based on the clustal W algorithm (InforMax of improvement, Bethesda, MD, http://www.informaxinc.com), have the open point penalty in room be 10 and the room extend to 0.05 default setting.

Term " homologue " also comprises the homologue of two kinds of specific forms, and it comprises lineal homologous sequence and collateral line homologous sequence, and it contains the evolution notion that is used to describe the gene ancestral relationship.Term " collateral line homology " relates to the collateral line gene that the gene replication in species gene group inside produces.Term " lineal homology " relates to because species form the homologous gene in the different organisms that produce.

For example can easily find for example lineal homologue in the monocotyledons kind by so-called mutual (reciprocal) blast search.This can realize by using the sequence of studying (for example SEQ IDNO:1 or SEQ ID NO:2) to carry out a blast at any sequence library (such as the public obtainable ncbi database that can find at http://www.ncbi.nlm.nih.gov).For example, if the lineal homologue in the searching rice should carry out in 28,469 full length cDNA clones at rice (Oryza sativa) Japan fine (Nipponbare) that can obtain from NCBI the blast that studies sequence.When Nucleotide begins, using BLASTn or tBLASTX, maybe when when protein begins, using BLASTP or TBLASTN with standard default with standard default.Blast result can be filtered.Then use the full length sequence among filtering result or the unfiltered result to carry out reverse blast (secondary blast) at the sequence of research sequence source organism certainly.The result who compares the first time and second time blast then.For example, when described secondary blast result provides when having the highest similarity sequence with YIPPEE sample nucleic acid or YIPPEE sample polypeptide,, found the collateral line homologue so if one of organism is an Arabidopis thaliana.Can use Clustal W under the situation of extended familys, assist cluster visual succeeded by contiguous threaded tree.

Homologue may be the form of proteinic " replacement variant ", promptly has at least a residue to be removed in aminoacid sequence, and inserts different residues in this position.Aminoacid replacement is the replacement of single residue normally, and still deciding on the functional limitations that puts on polypeptide also may be that cluster replaces; Insert usually at 1 to 10 amino-acid residue order of magnitude.Preferably, aminoacid replacement comprises conservative aminoacid replacement.

Homologue also may be the form of proteinic " insertion variant ", promptly imports one or more amino-acid residues in proteinic predetermined position.Insertion can comprise the fusion of aminoterminal and/or carboxyl terminal, and single or multiple amino acid whose internal sequence inserts.The insertion of general aminoacid sequence inside will be less than the fusion of amino or carboxyl terminal, and the order of magnitude is at about 1 to 10 residue.The example of amino or carboxyl terminal fused protein or peptide is included in binding domains or activation structure territory, bacteriophage coat protein matter, (Histidine) 6 labels, glutathione S-transferase label, a-protein, maltose binding protein, Tetrahydrofolate dehydrogenase, Tag.100 epi-position, c-myc epi-position, FLAG  epi-position, lacZ, CMP (calmodulin binding peptide), HA epi-position, protein C epi-position and the VSV epi-position of the activating transcription factor of using in the yeast two-hybrid system.

The homologue of protein " disappearance variant " form is characterised in that removes one or more amino acid from protein.

Can be by well-known peptide synthetic technology in this area, as the solid phase method of peptide synthesis etc., or by the recombinant DNA processing ease obtain proteinic amino acid variant.The dna sequence dna working method that is used to produce proteinic replacement, insertion or lack variant is well-known in this area.For example, those skilled in the art know the technology that produces the replacement sudden change in the DNA predetermined position, it comprises M13 mutagenesis, T7-Gen vitro mutagenesis (USB, Cleveland, OH), QuickChange site-directed mutagenesis (Stratagene, San Diego, CA), site-directed mutagenesis or other site-directed mutagenesis method of PCR mediation.

YIPPEE sample polypeptide or its homologue can be derivatives." derivative " comprises peptide, oligopeptides, polypeptide, protein and enzyme, protein with natural generation form, for example the aminoacid sequence of SEQ ID NO:2 representative is compared, and it can comprise replacement, disappearance or the natural and amino-acid residue non-natural generation that adds.Proteinic " derivative " comprises peptide, oligopeptides, polypeptide, protein and enzyme; compare with natural generation form amino acid sequence of polypeptide, it can comprise amino-acid residue change, glycosylation, acylations of natural generation or the amino-acid residue that non-natural produces.Derivative can also comprise that the one or more non-aminoacid replacement base with respect to its aminoacid sequence that is derived from (for example is incorporated into reporter molecules or other part of aminoacid sequence covalently or non-covalently, for example be combined with it and be beneficial to the reporter molecules that derivative detects), and the amino-acid residue that non-natural produces for the proteinic aminoacid sequence of natural generation.

YIPPEE sample polypeptide or its homologue may be by the alternative splicing variant codings of YIPPEE sample nucleic acid/gene.Term used herein " alternative splicing variant " comprises wherein the intron of selecting and/or exon is cut, replace or the variant of the nucleotide sequence that adds.Such variant has kept proteinic biological activity, and this may realize by the functional fragment of retaining protein selectively.Such splice variant can be natural or artificial.The method that produces this class splice variant is well-known in this area.Preferred splice variant is the splice variant of the nucleic acid of SEQ ID NO:1 representative.More preferably coding comprises the splice variant of the polypeptide of following arbitrary or a plurality of (preferably owning) motif: the zinc-binding motif of (i) inferring: 2 * CXXC, and wherein X refers to arbitrary amino acid residue; (ii) KYKEGK motif, it allows an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows an aminoacid replacement and conservative arbitrarily aminoacid replacement.

Homologue can also be coded by the allele variant of the nucleic acid of coding YIPPEE sample polypeptide or its homologue, the allele variant of the nucleic acid of preferred SEQ ID NO:1 representative.More preferably by allele variant coding, comprise the polypeptide of following arbitrary or a plurality of (preferably comprising all) motif: the zinc-binding motif of (i) inferring: 2 * CXXC, wherein X refers to arbitrary amino acid residue; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement.The natural existence of allele variant, and these natural allelic purposes are contained in the method for the present invention.Allele variant comprises single nucleotide polymorphism (SNP), and small-sized insertion/deletion polymorphism (INDEL).The size of INDEL is usually less than 100bp.SNP and INDEL form one group of maximum sequence variants in the naturally occurring polymorphism strain of most of organisms.

According to a preferred aspect of the present invention, the expression of YIPPEE sample nucleic acid or its variant increases or increases.The gene that to improve or increase or the method for gene product expression have sufficient record in this area, it comprises, for example by the use of crossing expression, transcriptional enhancer or translational enhancer of suitable promoters driven.Isolating nucleic acid as promotor or enhancer element can be imported the appropriate location (generally being the upstream) of non-allos form polynucleotide, thereby raise the expression of YIPPEE sample nucleic acid or its variant.For example, can and/or replace by sudden change, disappearance, body changes endogenesis promoter interiorly and (sees Kmiec, U.S. Patent No. 5,565,350; People such as Zarling PCT/US93/03868), perhaps import suitable direction and the distance of isolating promotor at gene of the present invention in the vegetable cell, thus the expression of controlling gene.

If the expectation expression of polypeptides will comprise polyadenylation region at the 3 '-end in peptide coding zone usually.Polyadenylation region can be derived from natural gene, multiple other plant gene or T-DNA.For example, 3 ' of adding end sequence can be derived from nopaline synthase or octopine synthase gene or alternatively be derived from other plant gene or less preferred be derived from any other eukaryotic gene.

Also can in the encoding sequence of 5 ' non-translational region or part encoding sequence, add intron sequences, be increased in the quantity of the ripe courier of cumulative in the kytoplasm.Show, but the intron of the montage that comprises in the transcription unit of plant and animal expression construct all can increase genetic expression up to 1000 times, Buchman and Berg, Mol.Cell biol.8:4395-4405 (1988) at mRNA and protein level; People such as Callis, Genes Dev.1:1183-1200 (1987).Common this intron be placed on transcription unit 5 ' terminal near the time, its effect that improves genetic expression reaches maximum.Corn intron A dh1-S introne 1,2 and 6, the use of Bronze-1 intron is well known in the art.Usually see The Maize Handbook, the 116th chapter, Freeling and Walbot edit, Springer, N.Y. (1994).

The present invention also provides genetic constructs and carrier, is used for the importing and/or the expression of the nucleotide sequence of the inventive method with promotion.

Therefore, the gene construct that provides comprises:

(i) YIPPEE sample nucleic acid or its variant;

(ii) one or more control sequences that can drive the expression of (i) amplifying nucleic acid sequence; With optional

(iii) transcription termination sequence.

Can use recombinant DNA technology well known to those skilled in the art to make up the construct that is used for the inventive method.Gene construct can be inserted commercially availablely, be suitable for transforming and enter plant and in cell transformed, express in the carrier of goal gene.

Use comprises that the carrier of aim sequence (being YIPPEE sample nucleic acid or its variant) transforms plant.Aim sequence effectively is connected in one or more control sequences (being connected in promotor at least).Term " controlling element ", " control sequence " and " promotor " all tradable in this article use can influence the regulation and control nucleotide sequence that its catenation sequence is expressed from broadly being meant.Above-mentioned term comprises that being derived from typical eukaryotic gene group gene (comprises the TATA box that has or do not have CCAAT box sequence, it is essential for accurate transcription initiation) transcription regulating nucleotide sequence, and other controlling element (being upstream activating sequence, enhanser and silencer), it is by replying growth stimulation and/or outside stimulus or changing genetic expression by tissue-specific mode.This term has also comprised the transcription regulating nucleotide sequence of classical prokaryotic gene, can comprise-35 box sequences and/or-10 box transcription regulating nucleotide sequences in the case.Term " controlling element " also comprises synthetic fusion molecule or derivative, and it gives, activates or improve the expression of cell, tissue or organ amplifying nucleic acid molecule.Term used herein " effectively connect " refers to the functional connection between promoter sequence and goal gene, transcribes so that promoter sequence can initial goal gene.

Advantageously, can use the expression of the promoters driven nucleotide sequence of any type.Promotor can be an inducible promoter, promptly replys the stimulation of growth, chemistry, environment or physics, has the transcription initiation of inductive or increase.The example of inducible promoter is a stress induced promoter, promptly is exposed to multiple stress conditions activated of following time promotor when plant.In addition or alternative, described promotor can be to organize the promotor of preference, promptly can organize at some, as preferentially initial transcribing in tissues such as leaf, root, seed.Can be only in some tissue initial promotor of transcribing be referred to herein as " tissue-specific ".

Preferably, YIPPEE sample nucleic acid or its variant effectively are connected in constitutive promoter.Constitutive promoter had transcriptional activity, and generally expresses basically in great majority (but need not all) the g and D stage.Preferred constitutive promoter is GOS2 promotor (being derived from rice) (SEQ ID NO:25).Should be clear and definite be the YIPPEE sample nucleic acid that application of the present invention is not limited to SEQ ID NO:1 representative, also be not limited to YIPPEE sample expression of nucleic acids by the GOS2 promoters driven.The example of other constitutive promoter is shown in the following table 4.

Table 4: the example of constitutive promoter

Gene source	Expression pattern	Reference
			Actin muscle	Composing type	People such as McElroy, Plant Cell, 2:163-171,1990
CAMV35S	Composing type	People such as Odell, Nature, 313:810-812,1985
			CaMV19S	Composing type	People such as Nilsson, Physiol.Plant.100:456-462,1997
GOS2	Composing type	People such as de Pater, Plant J Nov; 2 (6): 837-44,1992
			Ubiquitin	Composing type	People such as Christensen, Plant Mol.Biol.18:675-689,1992
The rice cyclophilin	Composing type	People such as Buchholz, Plant Mol Biol.25 (5): 837-43,1994

Corn H3 histone	Composing type	People such as Lepetit, Mol.Gen.Genet.231:276-285,1992
			Actin muscle 2	Composing type	People such as An, Plant be (1) J.10; 107-121,1996

Choose wantonly, can also in the construct that imports plant, use one or more terminator sequences.Term " terminator " comprises control sequence, and it is the dna sequence dna that is positioned at transcription unit's end, 3 ' processing of transmission signal initiation primary transcript and polyadenylation and the termination of transcribing.Other controlling element can comprise the enhanser of transcribing and translating.Those skilled in the art will know the sequence that is suitable for carrying out terminator of the present invention and enhanser.This sequence is conventionally known to one of skill in the art or can easily obtains.

Genetic constructs of the present invention also is included in the starting point of keeping in the particular cell types and/or duplicating required replication sequence.Example be when needs with genetic constructs as additive type genetic elements (as plasmid or clay molecule) when in bacterial cell, keeping.Preferred replication orgin includes, but is not limited to f1-ori and colE1.

Genetic constructs can randomly comprise selectable marker gene.As used herein, term " selectable marker gene " comprises any gene of giving cell phenotype, and the expression of this gene in cell helps identifying and/or selecting through nucleic acid construct transfection of the present invention or cell transformed.Suitable mark can be selected from the mark that has microbiotic or Herbicid resistant.The cell that contains recombinant DNA will thereby can be survived in the presence of microbiotic that kills non-transformed cell concentration or weedicide.The example of selectable marker gene comprises the bar gene that weedicide Basta resistance is provided; Give npt gene at the microbiotic kalamycin resistance; Give the hpt gene of hygromycin resistance.Visual mark, as green fluorescent protein (GFP, people such as Haseloff, 1997), β-glucuronidase (GUS) or luciferase are also as selectable mark.But the example of more selectable marker genes suitably comprises amicillin resistance (Ampr), tetracycline resistance gene (Tcr), phosphinothricin resistant gene, hygromycin gene and E.C. 2.3.1.28 (CAT) gene or the like.

The present invention also comprises by the obtainable plant of the inventive method.Therefore the present invention provides by the obtainable plant of the inventive method, be imported into YIPPEE sample nucleic acid or its variant of this paper in this plant, and/or this plant optimization has genetic modification at YIPPEE sample locus.

The present invention also provides the method that produces the transgenic plant with improvement growth characteristics, and it is included in and imports in the plant and expression YIPPEE sample nucleic acid or its variant, and/or comprises preferably at YIPPEE sample locus importing genetic modification.

More specifically, the invention provides the method that produces the transgenic plant with improvement growth characteristics, this method comprises:

(i) in plant or vegetable cell, import YIPPEE sample nucleic acid or its variant, and/or preferably import genetic modification at YIPPEE sample locus; With

(ii) culturing plants cell under the condition that promotes plant-growth and growth.

Nucleic acid directly can be imported vegetable cell or plant itself (comprising any other parts that import tissue, organ or plant).According to a preferred aspect of the present invention, preferably nucleic acid is imported plant by transforming.

This paper indication term " conversion " comprises exogenous polynucleotide is shifted into host cell, does not consider to shift used method.Take place or the plant tissue of embryogenetic clonal expansion immediately can use genetic constructs of the present invention to transform and from its regeneration whole plants by organ.Concrete tissue is selected and will be changed because of the clonal expansion system of the concrete species that can provide and be suitable for transforming most.Exemplary target tissue comprises the meristematic tissue (for example apical meristem, axillalry bud and root meristematic tissue) and the inductive meristematic tissue (for example cotyledon meristematic tissue and hypocotyl meristematic tissue) of leaf dish, pollen, embryo, cotyledon, hypocotyl, megagamete, callus, existence.Can be with the instantaneous or stable importing host cell of polynucleotide, and can, for example keep nonconformable state as plasmid.Alternatively, it can be integrated into host genome.The transformed plant cells that obtains can be then used in mode well known to those skilled in the art and be regenerated as plant transformed.

The conversion of plant species is a kind of quite conventional technology at present.Advantageously, can use the arbitrary of several method for transformation to import goal gene to suitable ancester cell.Method for transformation comprises with the chemical of liposome, electroporation, the picked-up of enhancing dissociative DNA, directly bombards, transforms and microprojection (microprojection) with virus or pollen to plant injection DNA, particle gun.Method can be selected from calcium/polyoxyethylene glycol method (Krens, people such as F.A., 1882, Nature296, the 72-74 that is used for protoplastis; People such as Negrutiu I., June1987, Plant Mol.Biol.8,363-373); The electroporation of protoplastis (people such as Shillito R.D., 1985 Bio/Technol 3,1099-1102); The microinjection of vegetable material (people such as Crossway A., 1986, Mol.Gen Genet 202, the 179-185) particle bombardment of DNA or RNA bag quilt (people such as Klein T.M., 1987, Nature327,70); (nonconformable) virus infection or the like.Any well-known process that produces the transgenosis rice of expressing YIPPEE sample gene/nucleic acid by agrobacterium mediation converted of preferred use, how the method for describing in the document of playing for example in office: disclosed European patent application EP 1198985A1, Aldemita and Hodges (Planta, 199,612-617,1996); People such as Chan (Plant Mol.Biol.22 (3) 491-506,1993), people such as Hiei (PlantJ.6 (2) 271-282,1994), its disclosed content is incorporated this paper into as a reference as the full content of its statement.Transform as for cereal, people such as preferable methods such as Ishida (Nat.Biotechnol.1996,14 (6): 745-50) or people (Plant Physiol.2002 such as Frame, 129 (1): 13-22), its disclosed content is incorporated this paper into as a reference as the full content of its statement.

Usually after transforming, select in the vegetable cell or groups of cells that has one or more marks, described mark is by the expressive gene of plant coding that moves with the goal gene corotation, and the material regeneration of the conversion that continues becomes whole plants.

After DNA transfer and the regeneration, can assess the conversion plant of supposition, for example form with existence, copy number and/or the genome of Southern analysis purposes gene.Alternative or extra, available Northern and/or Western analyze the expression level of the new quiding gene of monitoring, and these two kinds of technology all are that those skilled in the art know.

The conversion plant that produces can breed in several ways, as the breeding technique with clonal propagation or classics.For example, the first-generation (or T1) but the s-generation (or T2) transformant that the plant transformed selfing obtains isozygotying, the T2 plant is further by classical breeding technique breeding.

The inverting biological body that produces can have various ways.For example, they can be the mosaics of transformant and non-transformed cell; Clone's transformant (for example through transforming all cells that comprises expression cassette); The graft of conversion and non-transforming tissue (for example in plant, transforming the rhizome grafting to the scion of non-conversion).

Any vegetable cell or plant that the present invention obviously prolongs and produced by methods described herein, and the part of all plants and its vegetative propagule.The former generation conversion that produced by any aforesaid method or the offspring of cells transfected, tissue, organ or whole plants are also contained in the present invention, and unique requirement of described offspring is that the parent who produces with the inventive method presents same genotype and/or phenotypic characteristic.The present invention also comprises the host cell that contains separative YIPPEE sample nucleic acid or its variant.The preferred host cell of the present invention is a vegetable cell.The part that the present invention also prolongs and plant can be gathered in the crops for example, but is not limited to seed, leaf, fruit, flower, stem culture, rhizome, stem tuber and bulb.

The present invention also comprises the purposes of YIPPEE sample nucleic acid or its variant and the purposes of YIPPEE sample polypeptide or its homologue.

A kind of such purposes relates to the growth characteristics that improve plant, particularly improves productive rate/biomass, especially the seed productive rate.The seed productive rate may comprise following one or more: (full) seed number of increase, the seed weight of increase, harvest index of increase or the like.

Can use YIPPEE sample nucleic acid or its variant in the procedure of breeding, perhaps YIPPEE sample polypeptide or its homologue are wherein identified the dna marker that can be connected in YIPPEE sample gene or its variant hereditarily.Can use YIPPEE sample nucleic acid/gene or its variant, perhaps YIPPEE sample polypeptide or its homologue define molecule marker.Then this DNA or protein labeling can be used in the procedure of breeding, have the plant of the growth characteristics of improvement with selection.For example, YIPPEE sample gene or its variant can be any one nucleic acid by SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ ID NO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 and SEQ ID NO:23 representative.

The allele variant of YIPPEE sample nucleic acid/gene also can be used for the auxiliary procedure of breeding of mark.This class procedure of breeding needs to use sometimes, and for example EMS mutagenesis imports allele variant by the plant mutagenic treatment; Alternative, this program can begin with the allele variant of collecting what is called " natural " origin that is not intended to generation.Identify allele variant by for example PCR then.Be to select step in order to select the better allele variant of the sequence of discussing subsequently, described allele variant is given the growth characteristics of plant improvement.Generally the growth behavior that contains the different allele variant plants of studying sequence to some extent by monitoring is selected, and the different allele variants of described research sequence are arbitrary different allele variants among SEQ ID NO:1, SEQ ID NO:3, SEQ ID NO:5, SEQ ID NO:7, SEQ IDNO:9, SEQ ID NO:11, SEQ ID NO:13, SEQ ID NO:15, SEQ ID NO:17, SEQ ID NO:19, SEQ ID NO:21 and the SEQ ID NO:23 for example.Can in greenhouse or field, monitor growth behavior.More optional step comprise, will contain plant and another plant hybridization of better allele variant through evaluation.For example, can make the combination that produces the purpose phenotypic characteristic in this way.

YIPPEE sample nucleic acid or its variant can also be as probes, be used for it is carried out the mapping of heredity and physics for the gene of a gene part, and as the mark of those gene linkage proterties.These information can be used in plant breeding, to obtain having the strain of desired phenotype.This class of YIPPEE sample nucleic acid or its variant is used the one section nucleotide sequence that only needs at least 15 Nucleotide long.YIPPEE sample nucleic acid or its variant also can be used as restriction fragment length polymorphism (RFLP) mark.Available YIPPEE sample nucleic acid or its variant are surveyed the Southern trace (Maniatis) of the plant genome DNA of restriction digest.The program that uses a computer subsequently such as MapMaker people such as (, 1987) Lander carry out genetic analysis to the banding pattern that produces, to make up genetic map.In addition, can use nucleic acid to survey the Southern trace in the genomic dna that the restriction enzyme that contains one group of individuality is handled, described one group of individuality is the parent of the clear and definite genetic cross of representative and one group of individuality of filial generation.The separation of dna polymorphism is recorded and is used for calculating formerly position people (1980) Am.J.Hum.Genet.32:314-331 such as () Botstein of the genetic map YIPPEE sample nucleic acid that obtains with this colony or its variant.

The generation of the plant derivation probe that uses in genetic mapping and purposes are described among Bematzky and Tanksley (1986) the Plant Mol.Biol.Reporter 4:37-41.Described in a lot of publications with aforesaid method or its flexible form specific cDNA clone was carried out genetic mapping.For example, can use F2 hybridization colony, backcross population, panmictic population, the homogenic system of close relative and the mapping of other group of individuals.These class methods are that those skilled in the art are well-known.

Nucleic acid probe also can be used for physical mapping and (promptly settle sequence on physical map; See people In:Non-mammalian Genomic Analysis:A Practical Guide such as Hoheisel, Academicpress1996,319-346 page or leaf, and the reference of wherein quoting).

In another embodiment, nucleic acid probe is used for direct fluorescence in situ hybridization (FISH) mapping (Trask (1991) Trends Genet.7:149-154) although the method inclination of FISH mapping at present is used for big clone (several hundreds of KB of arriving; See people such as Laan (1995) Genome Res.5:13-20), but the raising of susceptibility allows to use short probe in the FISH mapping.

The multiple method based on nucleic acid amplification that is used for heredity and physical mapping can use described nucleic acid to carry out.Example comprises the polymorphism (CAPS of allele specific amplification (Kazazian (1989) J.Lab.Clin.Med11:95-96) pcr amplified fragment; People such as Sheffield (1993) Genomics16:325-332), allele-specific connects people (1988) Science241:1077-1080 such as () Landegren, Nucleotide extension (Sokolov (1990) Nucleic Acid Res.18:3671), radiation hybridization mapping people (1997) Nat.Genet.7:22-28 such as () Walter and Happy map (Dear and Cook (1989) Nucleic Acid Res.17:6795-6807).For implementing these methods, it is right to use the nucleotide sequence design and produce the primer that is used for amplified reaction or primer extension reaction.This class primer design is that those skilled in that art are well-known.Use the method for the genetic mapping of PCR-based, may need to identify the difference of leap corresponding to dna sequence dna between the parent of nucleotide sequence of the present invention zone mapping.Yet this is dispensable usually to drawing method.

Also find YIPPEE sample nucleic acid or its variant, perhaps YIPPEE sample polypeptide or its homologue are as the purposes of growth regulator.Because it is useful that these molecules have been presented in the promotion plant growth characteristics, so they also are useful growth regulators, as weedicide or growth stimulator.Therefore, the invention provides the composition as growth regulator, it comprises YIPPEE sample nucleic acid/gene or its variant or YIPPEE sample polypeptide or its homologue and appropriate carriers, thinner or vehicle.

The method according to this invention is had the plant of improvement growth characteristics as previously mentioned.These favourable growth characteristics can also make up other favourable economically proterties, as the proterties of further raising productive rate, to multiple tolerance of coercing, change the proterties of various structural attitudes and/or biochemistry and/or physiologic character.

Description of drawings

Refer now to the following drawings and describe the present invention, wherein:

Fig. 1 shows that the multiple ratio of several plant YIPPEE sample polypeptide is right.Cysteine residues among the zinc-binding motif 2 * CXXC that infers represents that with runic wherein X can be an arbitrary amino acid.In the frame KYKEGK motif and GRAYLF motif.At represents Arabidopis thaliana.

Fig. 2 is presented at Arabidopis thaliana YIPPEE sample (confidential reference items CDS1522) is expressed in GOS2 promotor (confidential reference items PRO0129) control down in rice binary vector.

Fig. 3 has described the example of the sequence that is used to carry out the inventive method in detail.

Embodiment

Refer now to following examples and describe the present invention, described embodiment only is intended to illustrate.

DNA operation: unless otherwise indicated, recombinant DNA technology is according to being described in (people (2001) molecular cloning such as Sambrook: laboratory manual, the third edition, cold spring harbor laboratory publishes, CSH, people such as New York or Ausubel (1994), the first roll of the up-to-date guide of molecular biology and second volume) standard method carry out.The standard material of plant molecular operation and method are described in PlantMolecular Biology Labfase (1993) by R.D.D.Croy and are published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications (UK).

Embodiment 1: gene clone

(Invitrogen, Paisley UK) pass through pcr amplification Arabidopis thaliana YIPPEE sample gene (CDS1522) as template to use Arabidopis thaliana seedling cDNA storehouse.The RNA that extracts from seedling clones cDNA among the pCMV Sport6.0 after reverse transcription.This storehouse is on average inserted size and is 1.5kb, and the order of magnitude of original clone's number is 1.59 * 10 ⁷Cfu.6 * 10 ¹¹After the amplification first time of cfu/ml, determine that original titre is 9.6 * 10 ⁵Cfu/ml.Extract after the plasmid, the 200ng template is used for 50 μ lPCR mixtures.Pcr amplification the primer (it comprises the AttB site of Gateway reorganization) is prm03196 (justice, initiator codon is represented with runic, 5 '-GGGGACAAGTTTGTACAAAAAAGCAGGCTTCACAATGGCTGTCGGAGATGAT-3 ') and prm03199 (antisense AttB1 represents with italic in the site:, complementary, terminator codon represents that with runic AttB2 represents with italic in the site: 5 ' GGGGACCACTTTGTACAAGAAAGCTGGGTAATCAAGCATCATCTCCATCACTAAC3 ').Under standard conditions, use Hifi Taq archaeal dna polymerase to carry out PCR.Same PCR fragment with standard method amplification and purifying 366bp.Then carry out the first step of Gateway process, the BP reaction " enters (entry) clone ", p3956 with reorganization in PCR fragment and the pDONR201 plasmid body to produce (according to the Gateway term) during this period.As the plasmid pDONR201 of Gateway  technology part available from Invitrogen.

Embodiment 2: vector construction

Then, be used to the LR reaction with entering clone p3956 with the appointment carrier p0640 that is used for the rice conversion.This carrier comprises in the T-DNA border with the lower section as functional element: the selectable mark of plant; The marker expression box that can screen; Be intended to and be cloned into the aim sequence that enters among the clone and carry out the Gateway expression cassette of the LR of reorganization in the body.Be used for the rice GOS2 promotor (PRO0129) of constitutive expression in the upstream of this Gateway box (people such as De Pater, Plant J.1992Nov; 2 (6): 837-44).

After the LR reconstitution steps, expression vector (Fig. 2) conversion that produces is entered agrobacterium strains LBA4044, subsequent transformation enters rice plants.Make the rice plants growth of conversion and detect the parameter of describing among the embodiment 3 subsequently.

Embodiment 3: assessment and result

15 to 20 independently T0 rice class transformant have approximately been produced.Elementary transformant is transferred to greenhouse growth and results T1 seed by tissue culture room.5 incidents are kept, and wherein separation in 3: 1 of transgenosis existence/shortage take place the T1 offspring.By the expression of monitoring visable indicia, in each incident, select about 10 T1 seedling and about 10 T1 seedling that lack transgenosis (invalid zygote) that contain transgenosis (heterozygote and homozygote).

Statistical study: F-check

Use the statistical model of double factor ANOVA (analysis of variance) as plant phenotype characteristic total evaluation.In all plants, all measuring parameters are carried out the F check by all incidents of gene transformation of the present invention.Carry out F and check the validity of checking gene in all transformation events, and the whole structure of checking gene, whole genetic effect also be called.The threshold setting of real whole genetic effect significance is 5% probability level of F check.Significance F test value points to genetic effect, and it means to be not only the existence of gene or the difference that the position causes phenotype.

3.1 the measurement of seed correlation parameter

Sophisticated former generation panicle gathered in the crops, packing, slug font code, in 37 ℃ of baking ovens dry three days then.Beat panicle then and to all seed collections and counting.With blowing device full shell is separated with ghost.Abandon ghost, and count rest parts once more.Full shell is weighed on analytical balance.Remaining full hull number is defined as the full seed number after separating step.Measure total seed productive rate by weighing from the whole full shell of plant results.Harvest index among the present invention is defined as total seed productive rate and ground area (mm ²) ratio multiply by the factor 106.

3.2 ground area

Sum of all pixels by ground plant part after the calculating eliminating background is determined plant area on the ground.This value is to put the mean value that obtains picture from different perspectives at one time, and is converted into the physical surface value of representing with square millimeter by calibration.Experiment shows that the over-ground part plant area that this method is measured is associated with the biomass that plant shoot divides.

Following table has as a result shown the T1 assessment and has produced the p value of the F check of extra T1 incident.Also shown the percentage ratio difference between transgenosis and the corresponding invalid zygote.For example, for total seed weight, 3 product in 6 strains are total seed weight positive (promptly compare with the seed weight of corresponding invalid zygophyte, total seed weight increases (greater than 32%)).1 strain in 6 strains like this shows that total seed weight significantly increases, and the p value of F check is 0.18.

Show the 5:T1 result in generation

	Show the product coefficient that increases	Difference	Show the product coefficient that significantly increases	The p value of F check
					Total seed weight	In 63	＞32％	In 61	0.18
The seed sum	In 61	＞40％	In 61	0.17
					The full seed number	In 63	＞49％	In 63	0.15
Harvest index	In 62	＞36％	In 62	0.064

Table 6:T1 additional events

	The product coefficient that shows positive difference	Difference	The product coefficient that shows significant difference	The p value of F check
					The total area	In 10 2	＞14％	In 10 2	0.16
Total seed weight	In 10 3	＞44％	In 10 2	0.085
					The seed sum	In 10 3	＞16％	In 10 2	0.082
The full seed number	In 10 5	＞27％	In 10 3	0.088
					Harvest index	In 10 5	＞22％	In 10 2	0.011

Sequence table

＜110〉Cropdesign NV

＜120〉has the plant and preparation method thereof of improvement growth characteristics

<130>CD-118-prio

<150>EP04103303.6

<151>2004-07-12

<150>US60/588,917

<151>2004-07-16

<160>27

<170>PatentIn version 3.3

<210>1

<211>591

<212>DNA

＜213〉Arabidopis thaliana (Arabidopsis thaliana)

<400>1

acaatttcct ccttctcccg ttataaacta aagactcgat tttgtgttga ttgttcgatt 60

cacgtaatta aggagatttt tggatcaaaa gatgggtagg gtttttatgg ttgatctgga 120

agggaacatc tacatctgca aactctgtaa gacccatctt tctacagacc aagacatcat 180

gtccaagtct tttcaatgca agaacggaag agcttatctt ttcaacaacg ttgtaaacgt 240

atctgttgga gagaaagaag acagaatgat gataactgga ctacacaacg tagttgacat 300

tttctgtgtt ggttgtggat caaacgttgg ctggaaatac gagtttgcac atgaaaagag 360

ccagaagtat aaggaaggaa aatctgttct tgaattatac aagatttcgg gtcctcatga 420

tagcaacgac ttggttagtg atggagatga tgcttgattg aggctttttc cttgtctagt 480

tatctctctc tcagatttct tttaaatttg tacattcttg ggcctagatt ttaattcgtt 540

tcaatatgcg tagtggaaga ccggtttaat aattaggggt tttattttca t 591

<210>2

<211>121

<212>PRT

＜213〉Arabidopis thaliana

<400>2

Met Gly Arg Val Phe Met Val Asp Leu Glu Gly Asn Ile Tyr Ile Cys

1 5 10 15

Lys Leu Cys Lys Thr His Leu Ser Thr Asp Gln Asp Ile Met Ser Lys

20 25 30

Ser Phe Gln Cys Lys Asn Gly Arg Ala Tyr Leu Phe Asn Asn Val Val

35 40 45

Asn Val Ser Val Gly Glu Lys Glu Asp Arg Met Met Ile Thr Gly Leu

50 55 60

His Asn Val Val Asp Ile Phe Cys Val Gly Cys Gly Ser Asn Val Gly

65 70 75 80

Trp Lys Tyr Glu Phe Ala His Glu Lys Ser Gln Lys Tyr Lys Glu Gly

85 90 95

Lys Ser Val Leu Glu Leu Tyr Lys Ile Ser Gly Pro His Asp Ser Asn

100 105 110

Asp Leu Val Ser Asp Gly Asp Asp Ala

115 120

<210>3

<211>630

<212>DNA

＜213〉Arabidopis thaliana

<400>3

ggtaggtggg tttgttcgaa atgggaagac tattcgtgat agacctcgaa ggactggttt 60

atagctgcaa gtattgtcag acacatttcg cagttactaa tgatattatc tcaaagtcat 120

ttcactgcaa acacggaagg gcttatcttt tcgacaatgt tgtcaatgtg acggttggag 180

agaaggagca tcgcgtcatg ataactggtt ggcacactgt agctgacatc ttctgtgtta 240

gctgtggctc tcttgtcggc tggaaatacg aaatcgctta cgataagtct cagaaataca 300

aggaaggaaa attcatctta gaaaggttta aggtgcttgg gccctatgga ggaggatacg 360

acatgaacca gaacgagcct atgactggaa gcgatgatga agaataaaaa tatggtatct 420

ctgttattta acgacccatt ggaaatactt ggaaagtggt caatgcttcg tatagactat 480

cggtgaccgg gaaactcgcc gggaaaaaat tcaacatttt ttcgtgtaag cgttcaaaag 540

aaaccaaata ttcatcatat aagtaacaaa tatagttttt ctatgaattt taaaactcat 600

attataatgc atatcaagtt gttaatcgtt 630

<210>4

<211>128

<212>PRT

＜213〉Arabidopis thaliana

<400>4

Met Gly Arg Leu Phe Val Ile Asp Leu Glu Gly Leu Val Tyr Ser Cys

1 5 10 15

Lys Tyr Cys Gln Thr His Phe Ala Val Thr Asn Asp Ile Ile Ser Lys

20 25 30

Ser Phe His Cys Lys His Gly Arg Ala Tyr Leu Phe Asp Asn Val Val

35 40 45

Asn Val Thr Val Gly Glu Lys Glu His Arg Val Met Ile Thr Gly Trp

50 55 60

His Thr Val Ala Asp Ile Phe Cys Val Ser Cys Gly Ser Leu Val Gly

65 70 75 80

Trp Lys Tyr Glu Ile Ala Tyr Asp Lys Ser Gln Lys Tyr Lys Glu Gly

85 90 95

Lys Phe Ile Leu Glu Arg Phe Lys Val Leu Gly Pro Tyr Gly Gly Gly

100 105 110

Tyr Asp Met Asn Gln Asn Glu Pro Met Thr Gly Ser Asp Asp Glu Glu

115 120 125

<210>5

<211>687

<212>DNA

＜213〉Arabidopis thaliana

<400>5

gtaatatcgt caaagaacac tttatatgat ttttctctat tttaaagttt cttccttttt 60

catctaaaaa tcggcagaaa atcctaactc cagtcttgca ttctgggaat agtttagaga 120

tggggagatt gttcttggtg aatttggaag gcaagtctta cagttgtaag cactgcaaga 180

ccaatcttgc tctctgtgat gatgtcgtct ctaagtcttt tcagtcccga catgggaaag 240

cttacctctt cagtaaggta gtgaatgtgt atgctggcaa gaaagaagat aggatgatga 300

tgacgggaat gcatacggtg gtcgatattt actgtgtcaa atgcggctct tatgttggat 360

ggaaatatga gtttgctttt gagaagaatc aaaagtacaa ggaaggaaaa tctgttctcg 420

aaaggtacaa ggtctggggt ccagatggga acaattattg ggtggctcaa gaagttgaag 480

ccggagacag cgatactgat gatgcttgat tctcatcatt catatctgat ttgtacattc 540

cctccaactc tttcattttt ctttattctt tttcctcatt ttgtaaacca tctatcttac 600

attagaacag cttccgagac caattgtttg gtcattgctg caactacttt ggacacataa 660

gttaaagatc tcattatctt atttgca 687

<210>6

<211>129

<212>PRT

＜213〉Arabidopis thaliana

<400>6

Met Gly Arg Leu Phe Leu Val Asn Leu Glu Gly Lys Ser Tyr Ser Cys

1 5 10 15

Lys His Cys Lys Thr Asn Leu Ala Leu Cys Asp Asp Val Val Ser Lys

20 25 30

Ser Phe Gln Ser Arg His Gly Lys Ala Tyr Leu Phe Ser Lys Val Val

35 40 45

Asn Val Tyr Ala Gly Lys Lys Glu Asp Arg Met Met Met Thr Gly Met

50 55 60

His Thr Val Val Asp Ile Tyr Cys Val Lys Cys Gly Ser Tyr Val Gly

65 70 75 80

Trp Lys Tyr Glu Phe Ala Phe Glu Lys Asn Gln Lys Tyr Lys Glu Gly

85 90 95

Lys Ser Val Leu Glu Arg Tyr Lys Val Trp Gly Pro Asp Gly Asn Asn

100 105 110

Tyr Trp Val Ala Gln Glu Val Glu Ala Gly Asp Ser Asp Thr Asp Asp

115 120 125

Ala

<210>7

<211>798

<212>DNA

＜213〉Arabidopis thaliana

<400>7

aaagtgaata attgaagaaa agacgttata ccttccccat ccacattttc ttgcttaact 60

gcagaacaac accaaattcg accctatcaa gttttgattc gtgtctacat agaaagagtc 120

tcaattgttc tgtccctgga cttttttttg tttcgttttt cttgttaaga tcgaaaactc 180

tgttttggta gatttttgtg ttcttgattt tgattcaaga tggggaggct gtttgtggtg 240

aatcttgaag ggaagatcta tagctgcaaa cactgtaaga ctcatcttgc tacttatgaa 300

gacatcatct ccaagtcttt tcactgcaag catgggaaag cttatctctt caataaggtt 360

gccaatgttt ccattggaga gactgaagaa agactgatga tgactggtaa acatactgtg 420

gctgatattt tctgtgtctc gtgtggatca atcgttggct ggaaatacga gactgctcat 480

gagaagaacc agaagtacaa agaaggaaaa tcagtgcttg aaagatttaa gatatcgggt 540

cctgatggga gcaactattg ggtgagtagc catggaaggc atataggtgg aagtgatgca 600

gatgatgctt gaatcatctc tctctctctc tattctctga tttgaccatt tcatgtaaat 660

gtaaattatt caacctccat tccaatttct tgtaataaga ctaaccaata ctctttcttc 720

tcttgactta ttatgtctca gtaaataaaa aatctgattc tgtctaatga ctatttattg 780

gttttctgtg aaaccatc 798

<210>8

<211>130

<212>PRT

＜213〉Arabidopis thaliana

<400>8

Met Gly Arg Leu Phe Val Val Ash Leu Glu Gly Lys Ile Tyr Ser Cys

1 5 10 15

Lys His Cys Lys Thr His Leu Ala Thr Tyr Glu Asp Ile Ile Ser Lys

20 25 30

Ser Phe His Cys Lys His Gly Lys Ala Tyr Leu Phe Asn Lys Val Ala

35 40 45

Asn Val Ser Ile Gly Glu Thr Glu Glu Arg Leu Met Met Thr Gly Lys

50 55 60

His Thr Val Ala Asp Ile Phe Cys Val Ser Cys Gly Ser Ile Val Gly

65 70 75 80

Trp Lys Tyr Glu Thr Ala His Glu Lys Asn Gln Lys Tyr Lys Glu Gly

85 90 95

Lys Ser Val Leu Glu Arg Phe Lys Ile Ser Gly Pro Asp Gly Ser Asn

100 105 110

Tyr Trp Val Ser Ser His Gly Arg His Ile Gly Gly Ser Asp Ala Asp

115 120 125

Asp Ala

130

<210>9

<211>655

<212>DNA

＜213〉Arabidopis thaliana

<400>9

atgaacgtgg tggttggacc gaagattggg aggaaactga taaccggatc gtatgtagtg 60

gcagatgtga tgtgcagtga gaacttggtt ggagcaattg atcacgcctt gaaagtgttt 120

gataaaatgg ctcaggcaat tggtccaaga ctgtatagtt gctgcaactg cagaaaccat 180

gttggacttc acgatgatat catctctaag gcttttcagg gaagaactgg gcgagccttc 240

ctgttctccc acgcaatgaa cattgtggta ggacctaaag aagaccggaa tcttctaact 300

ggtctacaca ccgtggctga tatatcttgt gttgactgta acgaaccatt gggttggaaa 360

tacgagcgag cttatgagac ctcacagaag tacaaggagg gcaagttcat attcgaaaag 420

gctaagattg tcaaggagga ttggtagagc tgaggaacat gatgaattca ttattggatt 480

ggctcaaaaa tgtatataga taaaatttgg ctttgtgatt tcacaagtca tcatcagcca 540

tttttccagt tcttcattgt ctctctctgt atgttaatta tgtcgtctct tgtgttcaaa 600

ctatggattt gttcgaacaa ggtttctctg ttaataaaga tgttaatagc ttctc 655

<210>10

<211>148

<212>PRT

＜213〉Arabidopis thaliana

<400>10

Met Asn Val Val Val Gly Pro Lys Ile Gly Arg Lys Leu Ile Thr Gly

1 5 10 15

Ser Tyr Val Val Ala Asp Val Met Cys Ser Glu Asn Leu Val Gly Ala

20 25 30

Ile Asp His Ala Leu Lys Val Phe Asp Lys Met Ala Gln Ala Ile Gly

35 40 45

Pro Arg Leu Tyr Ser Cys Cys Asn Cys Arg Asn His Val Gly Leu His

50 55 60

Asp Asp Ile Ile Ser Lys Ala Phe Gln Gly Arg Thr Gly Arg Ala Phe

65 70 75 80

Leu Phe Ser His Ala Met Asn Ile Val Val Gly Pro Lys Glu Asp Arg

85 90 95

Asn Leu Leu Thr Gly Leu His Thr Val Ala Asp Ile Ser Cys Val Asp

100 105 110

Cys Asn Glu Pro Leu Gly Trp Lys Tyr Glu Arg Ala Tyr Glu Thr Ser

115 120 125

Gln Lys Tyr Lys Glu Gly Lys Phe Ile Phe Glu Lys Ala Lys Ile Val

130 135 140

Lys Glu Asp Trp

145

<210>11

<211>574

<212>DNA

＜213〉Arabidopis thaliana

<400>11

agatagaaca gtgaagaaga aatgggaagg atattcacgg tggagcttga aggaagatct 60

tacagatgca ggttctgcag aacccatctc gctcttcccg atgatcttgt ctctcggtcg 120

tttcattgcc gtagaggaaa ggcttacctc ttcaaccgtt cggtgaacat aagtatgggt 180

cctctagagg aaagactgat gctttccggt atgcacaccg tagctgacat tttctgctgc 240

tgttgtggac agaatgttgg ctggaaatac gaatcagcgc acgagaaagc tcagaagtat 300

aaagaaggca aatttgttct ggaaagagga aggatcgtgg atgaaatcga tttatcaact 360

gaggtttata tcgatactca tggtagcaca agcgacacag aagattctta aatgttacct 420

tttttctgtg tgtttgtcaa gagcagagct tgttagtgta gaaatctgta gcatgtttat 480

agagatgtgt atcaaacttg ttgtgttgtt tttatatctc gtagaaattt tatgtgaatt 540

cgaatcttta ttttaaatcc aataaaaact catt 574

<210>12

<211>129

<212>PRT

＜213〉Arabidopis thaliana

<400>12

Met Gly Arg Ile Phe Thr Val Glu Leu Glu Gly Arg Ser Tyr Arg Cys

1 5 10 15

Arg Phe Cys Arg Thr His Leu Ala Leu Pro Asp Asp Leu Val Ser Arg

20 25 30

Ser Phe His Cys Arg Arg Gly Lys Ala Tyr Leu Phe Asn Arg Ser Val

35 40 45

Asn Ile Ser Met Gly Pro Leu Glu Glu Arg Leu Met Leu Ser Gly Met

50 55 60

His Thr Val Ala Asp Ile Phe Cys Cys Cys Cys Gly Gln Asn Val Gly

65 70 75 80

Trp Lys Tyr Glu Ser Ala His Glu Lys Ala Gln Lys Tyr Lys Glu Gly

85 90 95

Lys Phe Val Leu Glu Arg Gly Arg Ile Val Asp Glu Ile Asp Leu Ser

100 105 110

Thr Glu Val Tyr Ile Asp Thr His Gly Ser Thr Ser Asp Thr Glu Asp

115 120 125

Ser

<210>13

<211>741

<212>DNA

＜213〉potato (Solanum tuberosum)

<400>13

ccgaaacaaa aactattacc cctttttgga caagtccttt tccattttgg ttcttcaatt 60

ttcttgtgat ctcaaaaatc tttgatgggg agattatttg tgttgactct tgaaggcaag 120

atctacagct gcaagcactg tggaactcat cttgcccttt ctgaaaacat tgtttccaag 180

tctttccact gcaaacatgg gaaggcatac cttttcagta aagtggtgaa tgtcacttct 240

ggcgagatag aaaatagaat gatgatgact ggtatgcaca ctgtggcaga cattttctgc 300

gtctgttgtg ggtcaattgt tggatggaaa tatgagaccg cccatgagaa gagccaaaag 360

tacaaagaag gaaaatcagt gcttgagcgg tttaagatta ctggacctga tggaagccat 420

tactgggcta gtcatgatac tcatgttgca ggaagtgatg ctgatgatgt ttgatcacca 480

ttcagaacaa aaattctatc caaaaatgta cattctttaa cccaccaccc tattagttct 540

ttatggacca ttggattctt gaatagctta agctctacaa cttctttaag cttgtcctct 600

attgtgtatg atgatatgga agcaccatgt gttgttgcaa actaacacga ccatctgcct 660

gtatttgttt gcaatgacaa gacattacta gtagcaacca ctctgctttc attgcttcga 720

aaaaaaaaaa aaaaaaaaaa a 741

<210>14

<211>129

<212>PRT

＜213〉potato

<400>14

Met Gly Arg Leu Phe Val Leu Thr Leu Glu Gly Lys Ile Tyr Ser Cys

1 5 10 15

Lys His Cys Gly Thr His Leu Ala Leu Ser Glu Asn Ile Val Ser Lys

20 25 30

Ser Phe His Cys Lys His Gly Lys Ala Tyr Leu Phe Ser Lys Val Val

35 40 45

Asn Val Thr Ser Gly Glu Ile Glu Asn Arg Met Met Met Thr Gly Met

50 55 60

His Thr Val Ala Asp Ile Phe Cys Val Cys Cys Gly Ser Ile Val Gly

65 70 75 80

Trp Lys Tyr Glu Thr Ala His Glu Lys Ser Gln Lys Tyr Lys Glu Gly

85 90 95

Lys Ser Val Leu Glu Arg Phe Lys Ile Thr Gly Pro Asp Gly Ser His

100 105 110

Tyr Trp Ala Ser His Asp Thr His Val Ala Gly Ser Asp Ala Asp Asp

115 120 125

Val

<210>15

<211>1032

<212>DNA

＜213〉Zea mays (Zea mays)

<220>

<221>misc_feature

<222>(242)..(249)

＜223〉n is a, c, g or t

<220>

<221>misc_feature

<222>(954)..(978)

＜223〉n is a, c, g or t

<400>15

aagcgtgcag ctattcggtt atttaagagt gacgttggaa ccgaacacac aatacaatgc 60

agatttgtac atactgccct cgcttgacac ccaggtcgac cagacacttg agaaatttac 120

tttacttatt tggtcactag tgcttggcat acaactcaga tggacttata agcaacacag 180

gttacgcaca tatacagcgg taacatctaa tgacttccag aagcaatagg agggatatga 240

tnnnnnnnnc atgtcacctg gaacagcaac aatttacgcc ggcgaattat ttcaatggag 300

caatccccgg ctgtcggctg cctaaagagc aacgccaccc aggttattta caggggatca 360

acgacaggct tgagcttgtt ggatcgtgtt ttatatgtca tcggcgtcgc ttccgcccaa 420

gtgagcatct tgtggaaccc agtattggct tccgtcaggg cccgacacct tgtacctctc 480

cagaataaac ttgccttcct tgtatctctg gcccttctca tgtgccgcat catatttcca 540

cccaactatg gatccacagc caacacagaa gatatcagaa acagtatgca ttcctgtgat 600

catcatgcgg tcttctttta ctccagaagt cacgttgaca accttatgga agaggtacgc 660

cttgccgtgc ttgcactgga aggccttgga gatgatgtcg ctggcaacgc cgaggtgggt 720

cttgcagtgt ttgcagctgt agacgttgcc gtccaggtgc atcaggaaca ggcgccccat 780

cgccgccttc tctcccacct gccgcaactc cgctccaacc cctctctctc ggcttctcgt 840

caattccacc cagcgcacgg cgtcgagggc cactctagcc ccgatcgccg cggctcgaaa 900

tcccctcttc cggcttcctc ggatcggaga ctgggagcgg gagttgttta ttgnnnnnnn 960

nnnnnnnnnn nnnnnnnngc ggcggtggta tctggtatgg tgcgaatgtg cgatgtgtca 1020

gcgagcgtcg tg 1032

<210>16

<211>129

<212>PRT

＜213〉Zea mays

<400>16

Met Gly Arg Leu Phe Leu Met His Leu Asp Gly Asn Val Tyr Ser Cys

1 5 10 15

Lys His Cys Lys Thr His Leu Gly Val Ala Ser Asp Ile Ile Ser Lys

20 25 30

Ala Phe Gln Cys Lys His Gly Lys Ala Tyr Leu Phe His Lys Val Val

35 40 45

Asn Val Thr Ser Gly Val Lys Glu Asp Arg Met Met Ile Thr Gly Met

50 55 60

His Thr Val Ser Asp Ile Phe Cys Val Gly Cys Gly Ser Ile Val Gly

65 70 75 80

Trp Lys Tyr Asp Ala Ala His Glu Lys Gly Gln Arg Tyr Lys Glu Gly

85 90 95

Lys Phe Ile Leu Glu Arg Tyr Lys Val Ser Gly Pro Asp Gly Ser Gln

100 105 110

Tyr Trp Val Pro Gln Asp Ala His Leu Gly Gly Ser Asp Ala Asp Asp

115 120 125

Ile

<210>17

<211>920

<212>DNA

＜213〉Zea mays

<400>17

gcacgagaac aaaccccgca cgactcgttc tcattccact ctccaacgcg caccgggcgg 60

tttttcgttc ctttcttttt ttttcccctc ttccccttcc ccttctcctt ccagcggcgc 120

tcaggccacc gccggccaat cccatcaccc gccggatagg gatcgacccg ttcgttgatt 180

ggcgcgcgcc tgcgatcgat cgattggatt gcagggttag ggcggccgcc gtcgagatag 240

atcgatccat ccatcgatcg aattggtttt gttggtggat cggagatatt cattcgggtc 300

catgggtcgg ctgctgctgg tgagcctccc ggcgacgggc gccgtcatct accgctgcaa 360

gcactgcgac acccacctcg cctacgacac cgacatcatc gcaaggacgt tccgctgcaa 420

gaacggcaag gcctacctct tcaacaggat cgtgaatgtg aatgttggta cgaaggagga 480

ggaccggatg atgacgacgg gcctgcacac cgtgtgcgac atcttctgcg tcgcctgcgg 540

agccatactc ggctggaaat acctcgtcgc cttcgacaag agccagaggt acaaggaagg 600

caagttcatc ctcgacaggt ccaccgcctt ggcagccgct cctggtgatg ccgctgctga 660

ccaccaccac caccacgctc gcgtagcaag ctccgatgac gaagatgacc atatgtgaat 720

gatgatgatg atgaatgtca tctgcattgc attcaccata atcccttgct atctgtaaat 780

actctactcc gcttgttgta gtcgttcgtc gtaaagcacc tatatgtttc catttgttca 840

acctatcaga ctatgatatg atcagcaagt aaggtccatt tgtttggatg cagcgacagt 900

tacaaacaaa aaaattaaaa 920

<210>18

<211>138

<212>PRT

＜213〉Zea mays

<400>18

Met Gly Arg Leu Leu Leu Val Ser Leu Pro Ala Thr Gly Ala Val Ile

1 5 10 15

Tyr Arg Cys Lys His Cys Asp Thr His Leu Ala Tyr Asp Thr Asp Ile

20 25 30

Ile Ala Arg Thr Phe Arg Cys Lys Asn Gly Lys Ala Tyr Leu Phe Asn

35 40 45

Arg Ile Val Asn Val Asn Val Gly Thr Lys Glu Glu Asp Arg Met Met

50 55 60

Thr Thr Gly Leu His Thr Val Cys Asp Ile Phe Cys Val Ala Cys Gly

65 70 75 80

Ala Ile Leu Gly Trp Lys Tyr Leu Val Ala Phe Asp Lys Ser Gln Arg

85 90 95

Tyr Lys Glu Gly Lys Phe Ile Leu Asp Arg Ser Thr Ala Leu Ala Ala

100 105 110

Ala Pro Gly Asp Ala Ala Ala Asp His His His His His Ala Arg Val

115 120 125

Ala Ser Ser Asp Asp Glu Asp Asp His Met

130 135

<210>19

<211>360

<212>DNA

＜213〉rice (Oryza sativa)

<400>19

atggggctgc tgttcgtgga gctgctcccg cggcacggcg acgggggagg ccccgcgtcg 60

gcggtgctca agtgccgccg gtgccgcgtc gacgccgcct ccgccgacgc catcctctca 120

cgggacttcc gcggccgatt cggccgcgcc tacctcttcg accacgtggt gaatatatcc 180

ttagggccta atgaggatcg gtatctgatg accggactgc atacggtgaa agatatctac 240

tgtagctgtt gccagcaaat tctcggctgg agatatgaga aagcatacga agagagcgag 300

aagtacaagg aaggcaagtt catcctggag aaggccagga tgtggaaaga agcccggtga 360

<210>20

<211>119

<212>PRT

＜213〉rice

<400>20

Met Gly Leu Leu Phe Val Glu Leu Leu Pro Arg His Gly Asp Gly Gly

1 5 10 15

Gly Pro Ala Ser Ala Val Leu Lys Cys Arg Arg Cys Arg Val Asp Ala

20 25 30

Ala Ser Ala Asp Ala Ile Leu Ser Arg Asp Phe Arg Gly Arg Phe Gly

35 40 45

Arg Ala Tyr Leu Phe Asp His Val Val Asn Ile Ser Leu Gly Pro Asn

50 55 60

Glu Asp Arg Tyr Leu Met Thr Gly Leu His Thr Val Lys Asp Ile Tyr

65 70 75 80

Cys Ser Cys Cys Gln Gln Ile Leu Gly Trp Arg Tyr Glu Lys Ala Tyr

85 90 95

Glu Glu Ser Glu Lys Tyr Lys Glu Gly Lys Phe Ile Leu Glu Lys Ala

100 105 110

Arg Met Trp Lys Glu Ala Arg

115

<210>21

<211>836

<212>DNA

＜213〉rice

<400>21

gatttttctt ctcccaaact ccggcgactc ctccgctaat cccctccggc gccgcctcct 60

ctccgctccc cgcgcccccc acctccggtc acgcccgatc ggattggttg agttgcctcg 120

agggattttt gctctcgagg tatggtgttc atggcggagc tggtgggtcc gcgggtgtac 180

agctgctgca actgccggaa ccacgtctgc ctccacgacg acatcatctc caaggctttt 240

caggggagga atggccgtgc ctttctgttc tctcatgcca tgaatgttgt tgtgggcgcg 300

aaggaggaca ggcaacttat gacggggctt cacactgttg ctgatatcta ttgcaatgat 360

tgccgggagg tgttgggctg gaagtacgag agagcctatg aggaaacaca gaagtacaag 420

gaagggaagt tcatatttga gaagtcaaaa atcgtcaaag agaactggta gaatccaaaa 480

gattaggcac tccaaacttt ctttagagga tgaaacattc actgttccaa ggttatcagt 540

gtgttctggt tctttatgtc tttgtaaata tcagtcatcc acaagtttta atcttaagtc 600

tgcctgttct tgccttgccg tgaagtgtaa attgttcttg ctcccgtttc tttctgtgaa 660

taacatatgg cctgtgggta tttgttcttg aaccatgtgt gctaatgtgc gtaattttat 720

aggtactaaa agaatgtttg tatctttctc ctgcacaaga ataccgcgtg gagatttaca 780

gtcaaatata atctgacatg atttaatcaa aatttgttgg gaagttgtga agtaag 836

<210>22

<211>109

<212>PRT

＜213〉rice

<400>22

Met Val Phe Met Ala Glu Leu Val Gly Pro Arg Val Tyr Ser Cys Cys

1 5 10 15

Asn Cys Arg Asn His Val Cys Leu His Asp Asp Ile Ile Ser Lys Ala

20 25 30

Phe Gln Gly Arg Asn Gly Arg Ala Phe Leu Phe Ser His Ala Met Asn

35 40 45

Val Val Val Gly Ala Lys Glu Asp Arg Gln Leu Met Thr Gly Leu His

50 55 60

Thr Val Ala Asp Ile Tyr Cys Asn Asp Cys Arg Glu Val Leu Gly Trp

65 70 75 80

Lys Tyr Glu Arg Ala Tyr Glu Glu Thr Gln Lys Tyr Lys Glu Gly Lys

85 90 95

Phe Ile Phe Glu Lys Ser Lys Ile Val Lys Glu Asn Trp

100 105

<210>23

<211>913

<212>DNA

＜213〉rice

<400>23

gctgcttttg cttcggtcac ccggtcagtg ctgcagacaa gccaccccct tcctcgcgta 60

gactgctccc cccacaaaca aaagcaatcc taatctcgga ttcgaggcga acgagcggcg 120

gcgagggagg gggactagcg gcgatcgcga ttggagtcgg gtggacaccg atcgcggcgg 180

cgctctgggg gatcggggtg tggaatcgag ggggagggag gaggagacgg aggcgatggg 240

gcggctgttc gtgatgcacc tggaagggaa ggtgtacagc tgcaagcact gccacacgca 300

cctcggcctc tcctccgaca tcatctccaa gtccttccat tgcaagcacg ggaaggcgta 360

cctcttcaat aaggttgtca atgtgacttc tggagtaaaa gaggatcgca tgatgataac 420

cggaatgcat actgtgtctg atatcttctg tgttggctgc ggatccattg ttggatggaa 480

atatgaagct gcacatgaga agagccagag gtacaaggaa gggaaattta ttttagagag 540

gtataaggtg tctggtcctg atggcagcca ctactttgtt acacatgatg ctcatgttgg 600

gggaagcgac gtggacgacg tatgaagcac aactcgacat gctcaagcct tatccatgta 660

atccatgtaa ataacccaag tgtttgttgg tcttagttac ccggggattt gcttccattc 720

agagcaaccc cagcgtaatt gttgtcctag atgacctaat atcctatcat cttccttcag 780

gagttcaggt tattattggg tgttaccgtc tgtatatgca tgtaaccagt gatgcctgta 840

gtagccccct aaaagctgtt gtaatcctgg aatgtatctc aggccctaat gactaaataa 900

aattctgctt ctc 913

<210>24

<211>129

<212>PRT

＜213〉rice

<400>24

Met Gly Arg Leu Phe Val Met His Leu Glu Gly Lys Val Tyr Ser Cys

1 5 10 15

Lys His Cys His Thr His Leu Gly Leu Ser Ser Asp Ile Ile Ser Lys

20 25 30

Ser Phe His Cys Lys His Gly Lys Ala Tyr Leu Phe Asn Lys Val Val

35 40 45

Asn Val Thr Ser Gly Val Lys Glu Asp Arg Met Met Ile Thr Gly Met

50 55 60

His Thr Val Ser Asp Ile Phe Cys Val Gly Cys Gly Ser Ile Val Gly

65 70 75 80

Trp Lys Tyr Glu Ala Ala His Glu Lys Ser Gln Arg Tyr Lys Glu Gly

85 90 95

Lys Phe Ile Leu Glu Arg Tyr Lys Val Ser Gly Pro Asp Gly Ser His

100 105 110

Tyr Phe Val Thr His Asp Ala His Val Gly Gly Ser Asp Val Asp Asp

115 120 125

Val

<210>25

<211>2193

<212>DNA

＜213〉rice

<400>25

aatccgaaaa gtttctgcac cgttttcacc ccctaactaa caatataggg aacgtgtgct 60

aaatataaaa tgagacctta tatatgtagc gctgataact agaactatgc aagaaaaact 120

catccaccta ctttagtggc aatcgggcta aataaaaaag agtcgctaca ctagtttcgt 180

tttccttagt aattaagtgg gaaaatgaaa tcattattgc ttagaatata cgttcacatc 240

tctgtcatga agttaaatta ttcgaggtag ccataattgt catcaaactc ttcttgaata 300

aaaaaatctt tctagctgaa ctcaatgggt aaagagagag atttttttta aaaaaataga 360

atgaagatat tctgaacgta ttggcaaaga tttaaacata taattatata attttatagt 420

ttgtgcattc gtcatatcgc acatcattaa ggacatgtct tactccatcc caatttttat 480

ttagtaatta aagacaattg acttattttt attatttatc ttttttcgat tagatgcaag 540

gtacttacgc acacactttg tgctcatgtg catgtgtgag tgcacctcct caatacacgt 600

tcaactagca acacatctct aatatcactc gcctatttaa tacatttagg tagcaatatc 660

tgaattcaag cactccacca tcaccagacc acttttaata atatctaaaa tacaaaaaat 720

aattttacag aatagcatga aaagtatgaa acgaactatt taggtttttc acatacaaaa 780

aaaaaaagaa ttttgctcgt gcgcgagcgc caatctccca tattgggcac acaggcaaca 840

acagagtggc tgcccacaga acaacccaca aaaaacgatg atctaacgga ggacagcaag 900

tccgcaacaa ccttttaaca gcaggctttg cggccaggag agaggaggag aggcaaagaa 960

aaccaagcat cctcctcctc ccatctataa attcctcccc ccttttcccc tctctatata 1020

ggaggcatcc aagccaagaa gagggagagc accaaggaca cgcgactagc agaagccgag 1080

cgaccgcctt cttcgatcca tatcttccgg tcgagttctt ggtcgatctc ttccctcctc 1140

cacctcctcc tcacagggta tgtgcccttc ggttgttctt ggatttattg ttctaggttg 1200

tgtagtacgg gcgttgatgt taggaaaggg gatctgtatc tgtgatgatt cctgttcttg 1260

gatttgggat agaggggttc ttgatgttgc atgttatcgg ttcggtttga ttagtagtat 1320

ggttttcaat cgtctggaga gctctatgga aatgaaatgg tttagggtac ggaatcttgc 1380

gattttgtga gtaccttttg tttgaggtaa aatcagagca ccggtgattt tgcttggtgt 1440

aataaaagta cggttgtttg gtcctcgatt ctggtagtga tgcttctcga tttgacgaag 1500

ctatcctttg tttattccct attgaacaaa aataatccaa ctttgaagac ggtcccgttg 1560

atgagattga atgattgatt cttaagcctg tccaaaattt cgcagctggc ttgtttagat 1620

acagtagtcc ccatcacgaa attcatggaa acagttataa tcctcaggaa caggggattc 1680

cctgttcttc cgatttgctt tagtcccaga attttttttc ccaaatatct taaaaagtca 1740

ctttctggtt cagttcaatg aattgattgc tacaaataat gcttttatag cgttatccta 1800

gctgtagttc agttaatagg taatacccct atagtttagt caggagaaga acttatccga 1860

tttctgatct ccatttttaa ttatatgaaa tgaactgtag cataagcagt attcatttgg 1920

attatttttt ttattagctc tcaccccttc attattctga gctgaaagtc tggcatgaac 1980

tgtcctcaat tttgttttca aattcacatc gattatctat gcattatcct cttgtatcta 2040

cctgtagaag tttctttttg gttattcctt gactgcttga ttacagaaag aaatttatga 2100

agctgtaatc gggatagtta tactgcttgt tcttatgatt catttccttt gtgcagttct 2160

tggtgtagct tgccactttc accagcaaag ttc 2193

<210>26

<211>59

<212>DNA

＜213〉artificial sequence

<220>

＜223〉forward primer prm03198

<400>26

ggggacaagt ttgtacaaaa aagcaggctt cacaatgggt agggttttta tggttgatc 59

<210>27

<211>55

<212>DNA

＜213〉artificial sequence

<220>

＜223〉reverse primer prm03199

<400>27

ggggaccact ttgtacaaga aagctgggta atcaagcatc atctccatca ctaac 55

Claims (28)

1. improve the method for plant growth characteristics, comprise that step (A) increases the activity of YIPPEE sample polypeptide in the plant or its homologue, described YIPPEE sample polypeptide or its homologue comprise following arbitrary or a plurality of motif, preferably comprise all motifs: the zinc-binding motif of (i) inferring: 2 * CXXC, wherein X is an amino-acid residue arbitrarily; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (B) randomly select to have the plant of the growth characteristics of improvement.

2. realize that by preferably importing genetic modification the activity of described increase is according to the process of claim 1 wherein at the locus of coding YIPPEE sample polypeptide or its homologue.

3. according to the method for claim 2, arbitrary or a plurality of in wherein activating and realize described genetic modification by the nucleic acid that in plant, imports and express coding YIPPEE sample polypeptide by directed mutagenesis, orthogenesis, homologous recombination, TILLING, T-DNA.

4. improve the method for plant growth characteristics, be included in and import and express YIPPEE sample nucleic acid or its variant in the plant, described YIPPEE sample nucleic acid or its variant coding comprise that following arbitrary or a plurality of motif preferably includes YIPPEE sample polypeptide or its homologue of all motifs: the zinc-binding motif of (i) inferring: 2 * CXXC, and wherein X is an arbitrary amino acid residue; (ii) KYKEGK motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement; (iii) GRAYLF motif, it allows at an arbitrary position an aminoacid replacement and conservative arbitrarily aminoacid replacement.

5. according to the method for claim 4, wherein said variant be YIPPEE sample nucleic acid part or can with the sequence of YIPPEE sample nucleic acid hybridization.

6. according to the method for claim 4 or 5, wherein said YIPPEE sample nucleic acid or its variant are crossed in plant and are expressed.

7. according to each method in the claim 4 to 6, wherein said YIPPEE sample nucleic acid or its variant are plant origins, preferably from dicotyledons, further preferably from Cruciferae (Brassicaceae), are more preferably nucleic acid from Arabidopis thaliana.

8. according to each method in the claim 4 to 7, wherein said YIPPEE sample nucleic acid or its variant are connected in constitutive promoter effectively.

9. method according to Claim 8, wherein said formation type promotor is the GOS2 promotor.

10. according to each method in the claim 1 to 9, the plant growth characteristics of wherein said improvement is the productive rate of increase for corresponding wild type plant.

11. according to each method in the claim 1 to 10, the plant growth characteristics of wherein said improvement is the phytomass that increases.

12. according to the method for claim 10, the output of wherein said increase is the seed production that increases.

13. according to the method for claim 12, the seed productive rate of wherein said increase is selected from following any or a plurality of: (i) the seed biomass of Zeng Jiaing; (ii) (full) seed number of Zeng Jiaing; The (iii) seed size of Zeng Jiaing; The (iv) seed volume of Zeng Jiaing; (the v) harvest index of Zeng Jiaing; (the vi) thousand seed weight of Zeng Jiaing (TKW).

14. according to each method in the claim 1 to 13, the plant growth characteristics of wherein said improvement is the growth velocity that increases.

15. can be according to the plant of each method acquisition in the claim 1 to 14.

16. construct comprises:

(i) YIPPEE sample nucleic acid or its variant;

(ii) can drive one or more control sequences of the nucleotide sequence expression of (i); With optional

(iii) transcription termination sequence.

17. according to the construct of claim 16, wherein said promotor is a constitutive promoter.

18. according to the construct of claim 17, wherein said promotor is the GOS2 promotor.

19. use according to each construct plant transformed in the claim 16 to 18.

20. produce the method for the transgenic plant with improvement growth characteristics, this method comprises:

(i) in plant, import YIPPEE sample nucleic acid or its variant and/or import genetic modification at YIPPEE sample locus;

(ii) culturing plants cell under the condition that promotes plant-growth and growth.

21. have the transgenic plant of improvement growth characteristics, it produces and/or produces by importing genetic modification at YIPPEE sample locus by YIPPEE sample nucleic acid or its variant being imported described plant.

22. according to claim 15,19 or 21 transgenic plant, wherein said plant is a monocotyledons, as sugarcane, perhaps wherein said plant is a cereal, as rice, corn, wheat, barley, grain, rye, oat or Chinese sorghum.

23. the part gathered in the crops according to each plant in the claim 15,19,21 or 22.

24. according to the part gathered in the crops of claim 23, wherein said gather in the crops the part be seed.

25. from according to each the direct deutero-product of plant the claim 15,19,21 or 22, and/or from according to the direct deutero-product of the part gathered in the crops of claim 23 or 24.

26.YIPPEE sample nucleic acid/gene or its variant or YIPPEE sample polypeptide or its homologue are particularly improved productive rate/biomass, especially the purposes in the seed productive rate at the improvement plant growth characteristics.

27. according to the purposes of claim 25, wherein said seed productive rate comprises following one or more: (full) seed number of increase, the seed weight of increase, the harvest index of increase and the TKW of increase.

28.YIPPEE sample nucleic acid/gene or its variant or YIPPEE sample polypeptide or its homologue are as the purposes of molecule marker.

Images