CN101014609A - Nucleic acid ligands to immunoglobuline e and their use as atopic disease therapeutics - Google Patents

Nucleic acid ligands to immunoglobuline e and their use as atopic disease therapeutics Download PDF

Info

Publication number
CN101014609A
CN101014609A CN 200580021366 CN200580021366A CN101014609A CN 101014609 A CN101014609 A CN 101014609A CN 200580021366 CN200580021366 CN 200580021366 CN 200580021366 A CN200580021366 A CN 200580021366A CN 101014609 A CN101014609 A CN 101014609A
Authority
CN
China
Prior art keywords
fit
sequence
ome
ige
sequence number
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Pending
Application number
CN 200580021366
Other languages
Chinese (zh)
Inventor
莎伦·克洛德
约翰·L·戴纳
萨拉·切斯沃思·克内
马克斯·库尔兹
H·A·丹尼尔·莱加斯
哈罗德·尼古拉斯·马莎
波加·桑霍尼
安东尼·多米尼克·克费
波拉·伯梅斯特
王春华
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Archemix Corp
Original Assignee
Archemix Corp
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Archemix Corp filed Critical Archemix Corp
Publication of CN101014609A publication Critical patent/CN101014609A/en
Pending legal-status Critical Current

Links

Images

Abstract

The invention discloses aptamers capable of binding to Immunoglobulin E (IgE) useful as therapeutics in and diagnostics of atopic disease and/or other diseases or disorders in which IgE has been implicated. The invention further relates to materials and methods for the administration of aptamers capable of binding to IgE.

Description

The specific nucleic acid part of immunoglobulin E and as the application of atopic disease therapeutics
Technical field
[0001] this invention relates generally to the nucleic acid field, especially can binding domain-immunoglobulin E (IgE), be used for the treatment of and diagnosis anaphylactic disease and/or the other diseases relevant or the fit field of discomfort with IgE.This invention further relate to can binding domain-immunoglobulin E (IgE) fit drug material and the method for giving.
Background technology
[0002] fit is nucleic acid molecule, and this quasi-molecule also has special binding affinity by the interaction partners molecule except the Watson-Crick base pairing effect by classics.
[0003] fit, as the peptide or the monoclonal antibody (mABs) of producing by phage display, the target spot that combination that can be special is chosen is also regulated the target spot activity, for example, can hinder target spot performance functionally active by bonded is fit.From oligonucleotide stochastic sequence storehouse by in-vitro screening method create fit, can produce 100 multiple protein, comprising somatomedin, transcription factor, enzyme, immunoglobulin (Ig) and acceptor.One typical fit, and 10-15kDa size (30-45 nucleosides) is arranged, and is attached on the target spot by inferior nmole rice avidity, can repel closely-related other target spot (for example, fit usually can not in conjunction with other albumen of same gene cluster).A series of structural research is represented, the fit keying action (for example, hydrogen bond, static complementation, hydrophobic contact, size exclusion) that can use same type, the specificity of enhancement antigen-antibody complex and affinity.
[0004] fit have a lot of Ideal Characteristics in treatment and diagnostic use, comprising: high specific and high affinity, biological activity and fabulous pharmacokinetics attribute.Compare with other preparation with antibody in addition, they can provide special competitive advantage, such as:
[0005] 1) speed and control are fit produces by complete external process, allows to produce rapidly initial guidance, comprises the guidance of treatment.In-vitro screening method can strictly be controlled fit specificity and avidity, allows to generate guidance, comprises deleterious and guidance non-immunogenic.
[0006] 2) the fit molecule that has proved the few toxicity of a class or nontoxicity or non-immunogenicity of toxicity and immunity.With mouse and duck is experimental subjects, continues not observe toxicity with the fit administration of high dosage (every day 10mg/kg, administration 90 days) by clinical, cytology, biochemical measurement.Yet because to the immunne response of autoantibody, many monoclonal antibody curative effects are severely limited, be difficult to obtain the antibody to fit, most probable reason is that the T cell can't be fit by the MHC submission, and immunne response can not be discerned nucleic acid fragment.
[0007] 3) though the present most of antibody therapies of administration be by intravenous infusion (usually above 2-4 hour) but, (with monkey section is research object in fit subcutaneous injection, subcutaneous administration, fit biological effectiveness＞80%, referring to (people's such as Tucker document J.Chromatography B.732:203-212,1999)) administration.This difference mainly is owing to the relatively low solubleness of antibody, thereby needs large therapeutic mass monoclonal antibody mAbs.It is (fit: 10-50kDa with relative lower molecular weight to have good solubleness (150mg/mL); Antibody: 150kDa) fit, dosage weekly can be with the volume drug administration by injection less than 0.5mL.In addition, micromolecularly fitly can penetrate into the conformation shrinking zone that does not allow the infiltration of antibody or antibody fragment, represent another advantage based on aptamer therapeutics or prevention.
[0008] 4) measurability and cost therapeutic are fit is chemosynthesis, therefore carries out large-scale production according to the demand of producing easily.And the difficulty in the large-scale production has at present limited the production of some biological products, and large-scale protein product plant investment is huge, and the output of single larger nucleotide synthesizer can reach 100 kilograms/year, needs an initial investment of appropriateness relatively.Compare with the antibody of height optimization, the cost of present fit synthesis material calculates about 500 dollars/gram with the kilogram scale, along with updating of technology, estimates that the coming five years raw materials cost is reduced to less than 100 dollars/gram.
[0009] 5) the fit demonstration unreactiveness of stable therapeutic.They self can regain activity after being exposed to and for example being heated or touching factors such as sex change reagent, and fit at room temperature the storage with the lyophilized powder form was more than 1 year.
IgE and allergy
[0010] atopy has the genetic predisposition that produces the special IgE of anaphylactogen, is one of most important factor of bringing out asthma and other anaphylactic diseases.The atopy disease, generally popular and sickness rate rises day by day in the U.S. as allergic rhinitis (pollinosis), asthma, dermatitis.The symptom of anaphylactic disease comprises vasorelaxation, smooth muscle contraction, local inflammation, vascular permeability.Hypersensitive principal feature is that enviromental allergen stimulates the IgE level to increase.Common anaphylactogen comprises ight soil slag, pollen, food, animal scurf, fungal spore.Mastocyte discharges various chemical mediators such as Histidine, triolefin, prostaglandin(PG) by IgE mediation, sends out the main effect of performance in the phase reaction in hypersensitive speed.T lymphocyte, basophilic granulocyte and eosinophilic granulocyte are considered to be responsible for inducing tardy phase reaction.Mastocyte with contact the basophilic granulocyte that has the special IgE of antigenic anaphylactogen and cause immediate hypersensitivity, immediate hypersensitivity is a powerful mammalian immune effect system.These IgE mediated responses can cause disease, as allergic rhinitis, atopic dermatitis, urticaria, food anaphylaxis, asthma and under serious situation, can cause anaphylactic shock and death.
[0011] be not to have a mind to be bound by any theory, the reaction mechanism of irritated mediation IgE is detected.In brief, IgE is incorporated into the α chain of the high-affinity IgE acceptor on mastocyte and the basophilic granulocyte, Fc ε RI.Fc ε RI on these cell types is by a α chain, a β chain, the tetramer that γ chain homodimer is formed.β chain and γ chain are the signal transduction districts of Fc ε RI.Response stimulus Fc ε RI is closed in metamorphosis in conjunction with the IgE of mastocyte, activate a collection of signal transduction pathway, cause the release of a series of inflammatory mediators and cytokine, cytokine comprises segmental bronchus constriction and vaso-active substance, as (see figure 1)s such as histamine, leukotrienes.The effect of IgE, Fc ε RI and mastocyte adds that at animal anaphylaxis model validation: IgE system's transportation (or only with anti-IgE treatment) of specific antigens causes the normal mouse anaphylaxis, but causes systemic reaction immediately in the mouse of mastocyte defective or Fc ε RI defective.
[0012] potential of the methods of treatment of some clinical assessments intervention at present causes supersensitivity pathology immunologic mechanism, such as, the immunoglobulin (Ig) of a kind of anti-IgE, its direct target are in the IgE serum antibody, thus the main mechanism of inhibition immediate hypersensitivity.In addition, people's interest is to develop the allergen specificity immunotherapy method at present, because it has the hypersensitive potentiality of treatment.But that the immunoglobulin (Ig) of anti-IgE still is that the allergen specificity immunotherapy all is subjected to is expensive, the restriction of treatment forever or treatment in each season.
[0013] fit as a kind of novel treatment reagent except having aforesaid advantage, also because fit be nucleic acid, thereby can combine with some motifs, these motifs have the satisfied immune-stimulating effect of other people aspect treatment allergy and other immunological disease.These motifs comprise having immunoregulation effect CpG motif, as suppressing the auxiliary lymphocyte (T of II type T H2) Jie Dao transformation reactions studies show that CpG rapid induction when the purifying bone-marrow-derived lymphocyte expresses the amount (being published in Nature Immun.VoI 4 referring to people such as Liu 2003, no.7, the document of p.687-693 going up) of T-bet mMA.
[0014] therefore, acquisition can destroy the material of biological function of IgE and method will be of value on the treatment pathogeny and the IgE diseases associated.The invention provides material and method to satisfy these demands and other demand.
Summary of the invention
[0015] the invention provides treatment, prevention and/or alleviate hypersensitive material and method, in one embodiment, provide with PEG group bonded and comprise following sequence: mGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-dGm CmU's (sequence number 298) is fit.In some embodiments, polyoxyethylene glycol (PEG) group is selected from by 60kDa, 40kDa, the group that 30kDa and 20kDa form.In some embodiments, polyoxyethylene glycol (PEG) subregion is a branch-like, and is linear in other embodiments.
[0016] in some special embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600131
Wherein
～～～expression joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0017] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600141
Wherein
～～～expression joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0018] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600142
Wherein
～～～expression joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s dGmCmU (sequence number 298)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0019] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600151
Wherein
～～～expression joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0020] in some embodiments, the fit non-alkyl joint that comprises of the present invention.In some embodiments, the fit alkyl joint that comprises of the present invention.In some embodiments, the alkyl joint comprises 2 to 18 continuous CH 2Group, particularly 2 to 12 continuous CH 2Group, more especially 3 to 6 continuous CH 2
[0021] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600161
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0022] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600162
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: the dG=deoxy-guanine, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0023] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600171
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0024] in some embodiments, the fit structure that comprises of the present invention is as follows:
Figure A20058002136600172
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
Wherein: mC, mG, mU and mA=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe difference: dG=deoxidation G, dI=deoxidation xanthoglobulin, the s=phosphorothioate backbone replaces, and the reverse deoxythymidine of 3T=3 '.
[0025] in some embodiments, the fit function that adjusting particularly suppresses IgE or its varient that has of the present invention.In some embodiments, fit function of the present invention at vitro inhibition IgE or its varient.In some embodiments, the fit function that suppresses IgE or its varient in vivo of the present invention.In some embodiments, fit inhibition IgE of the present invention is in conjunction with the ability of its acceptor.In some embodiments, provide treatment to prevent and/or improve the method for the disease of IgE mediation, comprised to vertebrates preferred mammal, more preferably fit or its salt of human administration gained of the present invention.
[0026] in some embodiments, the invention provides therapeutic composition, comprise any above-mentioned fit or its salt of effective dose.In some embodiments, therapeutic composition can further comprise pharmaceutically acceptable carrier and thinner.
[0027] in one embodiment, provide the treatment of diseases method of IgE mediation, comprised vertebrates, preferred mammal, more preferably human administration the present invention is fit, particularly therapeutic composition.In some embodiments, the disease of treatment is an anaphylactic disease.In some particular embodiment, the disease of treatment comprises as follows: allergic rhinitis, atopic dermatitis, asthma, acute urticaria, food anaphylaxis, peanut allergy, systemic anaphylaxis, anaphylaxis conjunctivitis, vernal keratoconjunctivitis, atopy keratoconjunctivitis, giant papillary conjunctivitis, Eosinophilic Gastroenteritis.In a special embodiment, the disease of treatment is an asthma.
[0028] in some embodiments, to vertebrates, preferred mammal, more preferably human, use immunostimulatory nucleic acid sequence and the fit drug combination of the anti-IgE of the present invention, described immunostimulatory nucleic acid sequence is second fit such as what comprise the CpG motif.
[0029] in some embodiments, the mode of fit administration has subcutaneous administration, intranasal administration and intravenous injection.In special embodiment, maybe may suffer from hypersensitive patient by subcutaneous administration mode administering therapeutic composition to suffering from.
[0030] in some embodiments, diagnostic method comprises that the fit and doubtful IgE of comprising that will be connected with PEG among the present invention or the composition of its varient contact, and detect the existence or the disappearance of IgE or derivatives thereof.In some embodiments, provide fit, and in some other embodiment, provide fit as the present invention of in-vivo diagnostic as the present invention of in-vitro diagnosis.In some embodiments, provide and be used for the treatment of, prevent and/or to improve in the body the present invention of disease fit.
[0031] in some embodiments, the fit nucleotide sequence that comprises of specific combination IgE is for being selected from by sequence 11-15,18,19,21,29,33,41-44,46,50, any one sequence in the group that 56-96 and 98-102 formed all has 80% homology at least, 90% homology is particularly arranged.
[0032] in some embodiments, the fit nucleotide sequence that comprises of specific combination IgE is for being selected from by sequence 11-15,18,19,21,29,33,41-44,46,50 and the group formed of 56-89 in any one sequence all have 80% homology at least, 90% homology is arranged especially.
[0033] in some embodiments, provide that specific combination IgE's is fit, nucleotide sequences near described fit 30 of comprising be selected from by sequence number 11-15,18,19,21,29,33,41-44,46,50 with group that 56-96 is formed in 30 neighbour nucleotide sequences of any one fit acid sequence be the same.In some special embodiment, provide a kind of fit, the nucleotide sequences near described fit 20 of comprising, it is the same with nucleotide sequences near 20 of the sequences in these fit unique zones: sequence number 11-15,18,19,21,29,33,41-44,46,50,56-96,98-102.In embodiment more specifically, provide a kind of fit, 8 neighbour nucleotide sequences in the sequences in the nucleotide sequences near described fit 8 of comprising and these fit unique zones are the same: sequence number 11-15,18,19,21,29,33,41-44,46,50,56-96,98-102.Preferably, 8 the neighbour nucleotide sequences and the sequence number that comprise are 11-15,18,19,21,29,33,41-44,46,50,56-96,8 are closed on the fit specifically in conjunction with IgE of nucleotide sequences unanimity in fit unique regional sequence of 98-102, preferred human IgE, and regulate IgE in some embodiments, the function of preferred human IgE.In some embodiments, provide a kind of fit, described fit being selected from: 11-15,18 by sequence number, 19,21,29,33,41-44,46,50,56-96,98-102,119-124,126-136,139-157,158-176,178-190,194-201,206-243,247,249-259,261-267,269-290 and 292 groups of being formed.
[0034] in some embodiments, the present invention is fit to be single-chain nucleic acid, and in some embodiments, the present invention is fit and high molecular, and the compound of non-immunogenicity or lipophilic compound link to each other.In some embodiments, the present invention is fit and poly-alkyl glycol group, and especially polyethylene group connects.In some embodiments, polyethylene group is that branch is dendritic, and is straight chain in other embodiments.
[0035] in some embodiments, the present invention is fit comprises that chemically modified, described chemically modified are selected from by the chemistry replacement of glycosyl site, phosphoric acid salt site chemistry replaces, nucleic acid base site chemistry replaces, and 3 ' end has the inverse kernel acid sequence, and 5 ' end has the group that the inverse kernel acid sequence is formed.In some embodiments, the present invention is fit further to comprise the immunostimulatory nucleic acid sequence, as the CpG motif.
[0036] in some embodiments, the aptamer regulated function that particularly suppresses IgE or its varient of the present invention.In some embodiments, fit function of the present invention at vitro inhibition IgE or its varient.In some embodiments, the fit function that suppresses IgE or its varient in vivo of the present invention.In some embodiments, fit inhibition IgE of the present invention and its acceptor combines.In some embodiments, treatment suppresses and/or the method for improving the disease of IgE mediation comprises to vertebrates preferred mammal, more preferably fit or its salt of human administration the present invention.
[0037] in some embodiments, provide a kind of therapeutic composition, comprised fit or its salt of the present invention of effective dose, and acceptable carrier and thinner on the pharmaceutics.In some embodiments, provide the method that is used for treating prevention and/or improves the disease of IgE mediation, comprised vertebrates, preferred mammal, more preferably human administration the present invention is fit, preferred therapeutic composition of the present invention.
[0038] in some embodiment of the present invention, the disease of treatment is an allergy, especially such some diseases: allergic rhinitis, atopic dermatitis, asthma, acute urticaria, food anaphylaxis, peanut allergy, systemic anaphylaxis, anaphylaxis conjunctivitis, vernal keratoconjunctivitis, atopy keratoconjunctivitis, giant papillary conjunctivitis, Eosinophilic Gastroenteritis.
[0039] in some embodiments, the anti-IgE of the present invention is fit and the immunostimulatory nucleic acid sequence, and such as the second fit drug combination that comprises the CpG motif, administration is to liking vertebrates, preferred mammal, more preferably human.In some embodiments, the immunostimulatory nucleic acid sequence is incorporated into or is appended on the anti-IgE of the present invention fit.
[0040] in some embodiments, fit subcutaneous administration, intranasal administration and the intravenous mode passed through of the present invention is to the treatment target administration.
[0041] in some embodiments, provide a kind of diagnostic method, comprised that the composition with the fit and doubtful IgE of comprising of the present invention or its varient contacts, detected the existence or the disappearance of IgE or its varient.In some embodiments, provide fit, and in other embodiments, provide fit as the present invention of in-vivo diagnostic as the present invention of in-vitro diagnosis.In some embodiments, provide and be used for the treatment of, prevent and/or to improve in the body the present invention of disease fit.
[0042] another aspect of the present invention provides the method that increases fit binding affinity to target spot, wherein, fitly can form polymer.In one embodiment, this method may further comprise the steps, the nucleosides that is formed by the blocking-up aggregate replaces the fit nucleosides that forms aggregate, thereby the replacement that makes generation is fit the binding affinity of its target spot binding affinity fit with respect to mother increased to some extent, mother is fit contains identical nucleotide sequence does not still have nucleosides to replace.In some embodiments, selection be used for prevent that the nucleosides that aggregate forms from being modified nucleoside.In some embodiments, modified nucleoside is an xanthoglobulin.
[0043] another aspect of the present invention, provide a kind of increase fit to target spot avidity method, comprise with step, use xanthoglobulin, replace at least a nucleosides in a certain position, with respect to mother fit for same target spot in conjunction with affinity, xanthoglobulin replaces fit increasing to some extent in conjunction with affinity target spot, mother is fit identical nucleotide sequence, modifies but lack xanthoglobulin.In some embodiments of the method that is provided, step of replacing comprises that for four, three, two nucleosides, the xanthoglobulin of replacement is distinguished no more than four, three, two, what obtain therefrom is fit for mother is fit, increased to target spot in conjunction with affinity.In some embodiments, the nucleosides of xanthoglobulin replacement is a purine.In some special embodiments, the Nucleotide that xanthoglobulin replaces is guanosine-, in some other embodiment, method of the present invention comprises second the chemical step of replacing that is selected from following groups: the chemistry in glycosyl site replaces, the chemistry in phosphate site replaces, and the chemistry in base site replaces.Particularly, further replace fit embodiment and comprise, increased except that lacking chemical replace fit of secondary, with the fit corresponding to fit binding affinity of further replacement to target spot.
[0044] in some embodiments, step of replacing comprises with suitable substituent chemosynthesis fit.
[0045] in some embodiments, xanthoglobulin replace fit to target spot in conjunction with affinity, for mother is fit, increase at least 2 times, at least 5 times, at least 10 times, at least 25 times, at least 50 times, at least 75 times, at least 85 times, at least 95 times, at least 100 times, at least 150 times, at least 200 times.In some embodiments, step of replacing comprises that chemosynthesis is fit.
[0046] an aspect of of the present present invention, the method by the present invention replaces provides a kind of fit, this fit to target spot have increase in conjunction with affinity.In a special embodiment, fit comprising, especially Ren Lei IgE to IgE have increase in conjunction with affinity.
The accompanying drawing summary
[0047] Fig. 1 is the signal transduction event synoptic diagram of an IgE mediation.
[0048] Fig. 2 is a synoptic diagram, has represented the fit (SELEX of in-vitro screening from the oligonucleotide stochastic sequence storehouse of being made up of Yeast Nucleic Acid TM) process.Be used for the fit (SELEX of in-vitro screening TM) oligonucleotide stochastic sequence storehouse form by thymus nucleic acid, reverse transcription and transcription step are omitted.
[0049] Fig. 3 shows the branch-like PEG of a 40kDa.
[0050] Fig. 4 shows the branch-like PEG of the fit 5 ' end of being attached to of 40kDa.
[0051] Fig. 5 is an illustration of describing various PEGization strategies, has represented the single Pegylation of standard, poly ethylene glycolization and the dimerisation of finishing by Pegylation.
[0052] Fig. 6 be illustrated sequence library through the 6th take turns with the 7th colony screening of taking turns after to the h-IgE binding ability.
[0053] Fig. 7 has shown direct bonding force curve and the binding affinity to ARC445 (sequence number 101) and derivative thereof, has described the ratio that modified outcome increases the h-IgE binding ability.
[0054] Fig. 8 has described the ion-exchange HPLC trace analysis of the fit ARC445 of anti-IgE (sequence number 101) and its derivative.
[0055] Fig. 9 is presented at NMM fluorescence increase among the ARC445 (sequence number 101), the reduction of NMM fluorescence in ARC445 derivative and ARC909-911 (sequence number 191-193), and ARC909-911 comprises the 7-denitrogenation-G substituent of deoxy-guanine (dG).
[0056] Figure 10 is presented at the increase of (positive control) among the ARC 183, the reduction of (negative control) NMM fluorescence in ARC1346.
[0057] Figure 11 has shown and its derivative comparison, and the direct binding curve of ARC445 (sequence number 101) has been described with 7-denitrogenation-G replacement deoxy-guanine (ARC909-911 (sequence number 191-193)) and significantly reduced and h-IgE bonded ratio.
[0058] Figure 12 has represented with ARC1384 (sequence number 181), comprise 2 '-oxygen-methyl and thiosulphate substituent, but there is not the ARC445 derivative of the xanthoglobulin substituent (sequence number 101) of dG to compare, below fitly in NMM fluorescence, reduce: ARC445 derivative ARC 1641,1642 and 1666 (sequence number is respectively 212,213, with 216), they comprise the xanthoglobulin substituent of dG.
[0059] Figure 13 is a kind of structural representation prediction rRfY, and dRmY and DNA minimize fit secondary structure, and DNA minimizes the high-bond between the fit IgE:Fc of the showing ε R1, and this power is subjected to the inhibition of FACS.Figure 13 (A) shows the rRfY clone according to sequence number 91, residue is 2 '-F, Figure 13 (B) shows ARC445 (sequence number 101), a rRfY clone, the black residue is 2 '-deoxidation, the grey residue is 2 '-OMe, Figure 13 (C) shows ARC475 (sequence number 151), dna clone, underscore be the grey residue be 2 '-deoxidation.
[0060] Figure 14 shows in the SX38 cell, and ARC445 (sequence number 101) and ARC656 (sequence number 157) hinder the release that h-IgE induces Histidine.
[0061] Figure 15 A describes and is present in human and the mice plasma as hatching the ARC1384 of function and the percentage of ARC1666 total length.Figure 15 B describes and is present in human and the mice plasma as the ARC1384 of hatching function, the percentage of ARC1572 and ARC1573 total length.
[0062] Figure 16 is a form, provide to PEGization after 10 milligrams/kilogram of the mouse vein administrations anti--the fit ARC1785 of IgE (sequence number 295), ARC1787 (sequence number 293), ARC1788 (sequence number 294), and the design of the pharmacokinetics of ARC1790 (sequence number 296).
[0063] Figure 17 is to after 10 milligrams/kilogram of mouse vein (IV) administrations, and PEGization resists-the fit ARC1785 of IgE (sequence number 295), ARC1787 (sequence number 293), ARC1788 (sequence number 294), the pharmacokinetics figure of ARC1790 (sequence number 296).
[0064] Figure 18 is to behind 10 milligrams/kilogram of the mouse subcutaneous administrations, PEGization resists-the fit ARC1785 of IgE (sequence number 295), ARC1787 (sequence number 293), ARC1788 (sequence number 294), and form is summarized in the design of the pharmacokinetic of ARC1790 (sequence number 296).
[0065] Figure 19 is to after 10 milligrams/kilogram of mouse subcutaneous (SC) administrations, PEGization is anti--and IgE is fit ARC 1785 (sequence number 295), ARC1787 (sequence number 293), the pharmacokinetics figure of ARC1788 (sequence number 294) and ARC1790 (sequence number 296).
[0066] Figure 20 is a table, summed up after 10 milligrams/kilogram of mouse vein (IV) and subcutaneous (SC) administrations, PEGization resists-the fit ARC1785 of IgE (sequence number 295), ARC1787 (sequence number 293), the non-division PK parameter estirmation of ARC1788 (sequence number 294) and ARC1790 (sequence number 296).
Embodiment
The details of [0067] one or more embodiments of the present invention has been carried out complete description below.Though similar or identical method any and described herein or material can be used for realizing or detect the present invention that described herein is preferable methods and material.Other characteristics of the present invention, object and advantage are apparent from specification sheets.In specification sheets, unless the literary composition meaning spells out in addition, singulative also comprises the form of plural number.Unless otherwise prescribed, the common sense of all scientific and technical terminologies used herein and the technical field of the invention those of ordinary skill has equal meaning.If clash, be as the criterion with the explanation of this specification sheets.
SELEX TMMethod
[0068] generating fit a kind of suitable method is to be named as " Fas lignand system of index concentration is evolved " (" SELEX TMThe process of ") has mainly been described the Yeast Nucleic Acid screening (use the screening in DNA sequence storehouse, dispense the description of reverse transcription and transcription step among Fig. 2) of this method in Fig. 2.SELEX TMProcess is the method that a kind of and target molecule have the external evolution of nucleic acid molecule of high specific combination ability, at document, for example submit to June 11 nineteen ninety, No. the 07/536th, 428, existing resigned U.S. Patent application, the U.S. the 5th, 475, described in No. the 5th, 270,163, the patent of No. 096 by name " nucleic acid ligands " and the U.S. (also can referring to WO91/19813) " nucleic acid ligands " patent by name.Every kind of SELEX TMThe nucleic acid ligands of identifying, as every kind fit, all be a kind of sepcific ligands of given target spot compound or molecule.SELEX TMProcess is based on a kind of so unique viewpoint, and promptly nucleic acid enough can form multiple two dimension or three-dimensional structure, and monomer whose has enough multifunctionalities, can be as various chemical compounds almost, no matter be monomer or polymeric part.The molecule of any size or composition all can be used as target spot.
[0069] SELEX TMDepend on the starting point on the single stranded oligonucleotide storehouse that comprises the random nucleic acid sequence.Oligonucleotide can be modified or not adorned DNA, the assorted and body of MA or DNA/MA.In some embodiments, the Nucleotide storehouse comprises 100% at random or at random oligonucleotide of part.In further embodiments, the Nucleotide storehouse comprise at random or contain at least one in the part random oligonucleotide and be added into fixed sequence program and/or conserved sequence in the randomized sequence.In further embodiments, the Nucleotide storehouse comprise at random or the part random oligonucleotide 5 ' and/or 3 ' end contain at least one fixed sequence program and/or conserved sequence, in this fixed sequence program or conserved sequence, contain with oligonucleotide library in the identical sequence of other molecules.Fixed sequence program is the common sequence in the oligonucleotide library, in oligonucleotide library, add fixed sequence program and be in order to realize the prescreen purpose, CpG motif as described further below, PCR primer hybridization site, the MA polymerase promoter sequence is (as T3, T4, T7 and SP6), restriction site, or the same poly-sequence of for example poly-A or poly-T tail, catalytic core, the site of selective binding affinity column and other are convenient to oligonucleotide clone's sequence and/or the order-checking of interested with it sequence.Conserved sequence is a kind of with the above-mentioned different sequence of fixed sequence program, is many consensus sequences that can be fit with same targeted integration.
[0070] oligonucleotide in the sequence library preferably includes the randomized sequence part and the necessary fixed sequence program that effectively increases.Typically, the oligonucleotide in homing sequence storehouse comprises fixed 5 ' and 3 ' end sequence, and described end sequence joins the nucleosides side at random at interior region and 30-50.This randomized nucleosides can produce by several different methods, comprises the screening of chemosynthesis and the size from the nucleic acid that is eliminated at random.Detect nucleic acid sequence variation can before repeated screening/amplification or among be introduced into or increase by sudden change.
[0071] stochastic sequence of oligonucleotide part can be a random length, and can comprise Nucleotide and/or deoxynucleotide, also can comprise modification or non-natural nucleoside or nucleoside analog.Referring to United States Patent (USP) the 5th, 958, No. 691; United States Patent (USP) the 5th, 660, No. 985; United States Patent (USP) the 5th, 958, No. 691; United States Patent (USP) the 5th, 698, No. 687; United States Patent (USP) the 5th, 817, No. 635; United States Patent (USP) the 5th, 672, No. 695; With PCT publication WO92/07065 number.Use solid phase oligonucleotide synthetic technology known in the art synthetic random oligonucleotide from the nucleosides that phosphodiester bond connects.The document that people such as document of delivering on Nucl Acid Res.14:5399-5467 (1986) referring to people such as Froehler and Froehler deliver on Tet.Lett.27:5575-5578 (1986).Also can use solution methods as the synthetic random oligonucleotide of three ester synthesis methods.People such as document of delivering on Nucl.Acid Res.4:2557 (1977) referring to people such as for example Sood and Hirose are at Tet.Lett., the document of delivering on the 28:2449 (1978).The synthetic individual independently molecule of 1014-1016 that produced of the classics that carry out in the automatic dna synthesizer device quantitatively enough carries out most of SELEX TMExperiment.The zone that stochastic sequence is enough big in the sequences Design has increased each and has been synthesized the possibility that molecule is represented distinguished sequence.
[0072] by robotics synthetic oligonucleotide homing sequence storehouse on dna synthesizer.For synthetic randomized sequence, in building-up process, dose the mixture that adds four kinds of nucleosides in the step at each nucleosides, make nucleosides add randomization.As mentioned above, in one embodiment, random oligonucleotide comprises whole stochastic sequences; But in other embodiments, random oligonucleotide comprises the prolongation chain of nonrandom or part stochastic sequence.The part stochastic sequence can be synthesized by adding four kinds of nucleosides that add different ratios in the step at each.
[0073] oligonucleotide homing sequence storehouse may be MA, the assorted and body of DNA or MA/DNA.Under the situation of MA storehouse as the homing sequence storehouse, in-vitro transcription DNA and purifying obtain crossing for T7 MA polysaccharase that MA normally passes through in the storehouse or modified T7 MA polysaccharase.Then, MA or dna library and target spot mix under the bonded condition being suitable for, and use same screening scheme through repeatedly combination, separate or amplification to meet binding affinity and ideal standard optionally.More specifically, when beginning with the mixture that comprises nucleic acid homing sequence storehouse, SELEX TMMethod comprises step: (a) mixture and target spot under being suitable for the bonded condition, contact (b) from the nucleic acid of target molecule specific combination isolate not bind nucleic acid; (c) isolating nucleic acid-target spot mixture; (d) amplification produces the nucleic acid mixture of enrichment part from nucleic acid-isolated nucleic acid of target spot mixture; (e) repeatedly circulation repeats combination, and separately, separation and amplification step are to produce the nucleic acid ligands that target molecule is had the high specific high-affinity.Under the fit screened situation of MA, SELEX TMFurther comprise step: (i) before the amplification in the step (d), reverse transcription is isolated nucleic acid from nucleic acid-target spot mixture; The (ii) nucleic acid of amplification in the transcription step (d) before the restart procedure.
[0074] contain many may sequences and the nucleic acid mixture of structure in, to the bonding force of given target spot in a very big scope.As the segmental nucleic acid mixture of the randomization that comprises 20 nucleosides, have 4 20Planting may.There is the most probable of higher affinity constant to be attached on the target spot to target spot.Separately, after division and the amplification, produce another nucleic acid mixture, be enriched in the nucleic acid of higher affinity.Carry out in addition severally taking turns screening and further optimizing aptamers and mainly form by one or minority sequence up to the nucleic acid mixture that produces.These nucleic acid are as pure part or fit can clone, and order-checking also detects its binding affinity one by one.
[0075] repeats screening and amplification cycles up to reaching required purpose.Under the most conventional situation, repeat screening/amplification, until till the not tangible improvement of the bonding strength of circulation gains.This method typically is used near 10 14The sample of individual different nucleic acid species also is used for 10 18The sample of individual different nucleic acid species.Usually, aptamer will be through the screening of 5-20 wheel.In one embodiment, heterogeneously just being introduced at initial screening stage, is not all to take place in whole reproduction process.
[0076] SELEX TMA kind of embodiment in, screening process has the nucleic acid ligands of the strongest binding ability very effective to separating those and selected target spot, therefore only needs a screening or amplification cycles.This effective screening may occur in for example stratographic analysis process, and wherein, the fixed target spot has binding ability on nucleic acid and the post, and by this operating method, pillar effectively separately or separate the nucleic acid ligands with high-affinity.
[0077] under many circumstances, do not need to carry out SELEX TMRepeating step up to identifying single nucleic acid ligands.Target specific nucleic acid ligand solution may comprise nucleic acid construct or motif family, and a lot of conserved sequences and many being replaced or increase and the not obvious sequence that influences nucleic acid ligands and targeted integration are arranged in this family.Finish SELEX in advance TMProcess determines that the sequence of many members in the nucleic acid ligand solution family is possible.
[0078] knownly there are diversified nucleic acid primary structure, secondary structure and a tertiary structure.Interact modal structure or motif of non-Watson-Crick type is called as hairpin loop, symmetrical or asymmetric protrusion, the combination of false kink structure and countless same structures.Nearly all situation that contains this motif shows that all they can form in the nucleotide sequence that is no more than 30 nucleosides.Therefore, with the segmental SELEX of adjacent randomization TMPreferably the randomization fragment by 20-50 nucleosides causes.Be to cause in some embodiments by 30 about 40 nucleosides.In one embodiment, 5 ' and be fixed: at random: the 3 ' sequence that is fixed comprises the stochastic sequence of about 30-50 nucleosides.
[0079] core SELEX TMMethod is modified to obtain many special targets.For example, United States Patent (USP) the 5th, 707 has been described for No. 796 to unite and has been used SELEX TMWith the special nucleic acid molecule of gel electrophoresis screening structure, as, curved DNA.United States Patent (USP) the 5th, 763, No. 177; Described based on SELEX TMMethod, screening contains the nucleic acid ligands of reactive group, this reactive group can binding target molecule, and/or is cross connected to target molecule, and/or activates target molecule.United States Patent (USP) the 5th, 567, No. 588 and the 5th, 861,254 have described based on SELEX TMMethod, high efficiency separation and target spot have the oligonucleotide of high-affinity and low-affinity.United States Patent (USP) the 5th, 496,938 have described SELEX TMAfter carrying out, process obtains the method for improving nucleic acid ligands.United States Patent (USP) the 5th, 705, the method for having described part covalent attachment target spot for No. 337.
[0080] SELEX TMCan be used for obtaining the nucleic acid ligands of an above binding site and the nucleic acid ligands that acquisition comprises non-nucleic acid class and targeted integration are arranged with target molecule.SELEX TMProvide be used to separate and identify can with any method of predicting the nucleic acid ligands of targeted integration, the described target spot of predicting comprises big or little biomolecules, as protein and cofactor and the small molecules of nucleic acid binding protein with their part biological functions of conduct of the unknown.As, United States Patent (USP) the 5th, 580, disclosed for No. 737 and to have passed through SELEX TMThe nucleotide sequence of identifying, SELEX TMCan high-affinity be attached to caffeine and and analogue, closely related as theophylline.
[0081] Counter-SELEX TMThereby be a kind ofly can improve nucleic acid ligands and the specific method of target spot with the nucleic acid ligands sequence of one or more non-target spot molecule generation cross reactions by reducing.Counter-SELEX TMStep comprise step: (a) preparation nucleic acid candidate mixture (b) candidate mixture and targeted integration, wherein with respect to the candidate mixture, target spot is had the nucleic acid of the avidity of increase, may from the residuum of candidate mixture, separate; (c) from the residuum of candidate's mixture, isolate the nucleic acid that avidity increases; (d) from target spot, isolate the nucleic acid that avidity increases; (e) nucleic acid and one or more the non-target molecules that avidity is increased is in contact with one another, and has the nucleic acid ligands of special avidity to be eliminated to non-target spot molecule; (f) amplification only has the nucleic acid of special avidity to produce nucleic acid mixture to target molecule, and being enriched in has relative higher affinity and specific nucleotide sequence to target molecule.As above-mentioned to SELEX TMDescription, the cycle number of screening and amplification constantly is repeated until and achieves the goal.
[0082] use that nucleic acid runs into as medicine and vaccine one may problem be the oligonucleotide of phosphoric acid ester form before the demonstration effect, in body fluid, can be degraded rapidly as nuclear endonuclease and exonuclease by desmo enzyme and perienzyme.So SELEX TMMethod comprises the evaluation of the high affinity nucleic acid part that contains modified nucleoside, and described modified nucleoside can change the part characteristic, such as having changed the body internal stability or having improved transportation characterization.The example of this modification comprises that the chemistry of ribose and/or phosphoric acid and/or base replaces.SELEX TMThe nucleic acid ligands that evaluation contains modified nucleoside all has description, as at United States Patent (USP) the 5th, 660, the oligonucleotide that is described in No. 985 contains in 2 ' in ribose, 5 of pyrimidines, the nucleoside derivates of 8 chemically modifieds of purine is at United States Patent (USP) the 5th, 756, the oligonucleotide described in No. 703 has comprised the various modifications of 2 ' of pyrimidine, at United States Patent (USP) the 5th, 580, that the oligonucleotide of describing in No. 737 can be that the specific nucleic acid part of high-affinity contains is one or more 2 '-amino (2 '-NH 2), 2 '-fluorine (2 '-F) and/or 2 '-OMe (2 '-OMe) nucleosides modifies
[0083] modification of expection nucleic acid ligands includes, but not limited to the modification that those can provide other chemical groups among the present invention, these chemical groups can increase nucleic acid ligands base or the whole additional charge of nucleic acid ligands, polarizability, hydrophobicity, hydrogen bond, electrostatic interaction and flowability.The modification that produces the oligonucleotide mixture of nuclease-resistant comprises the replacement that connects between one or more nucleosides, the glycosyl of modification, the base of modification, or their combination.It is sugar-modified that this modification includes, but not limited to 2 ' position, and 5-position pyrimidine is modified.8-position purine is modified, and exocyclic amino group is modified, and 4-sulphur urine (pyrimidine nuclear) glycosides replaces to be modified, and 5-bromine or 5-iodouracil are modified; Backbone modification, thiophosphoric acid or alkylphosphonic are modified, methide and the combination of improper base pair as etc. different cytidine of base and different guanine.Modify and comprise that also 3 ' and 5 ' modifies as cap.
[0084] in one embodiment, P in the oligonucleotide that provides (O) O group is by P (O) S (" sulfo-"), P (S) S (" butyramide "), P (O) NR 2(" etomidate "), P (O) R, P (O) OR ', CO or CH 2(" formyl radical ") or 3 '-amino (NH-CH 2-CH 2-) replace, wherein R or R ' they are independent H or the alkyl that is replaced or be not replaced.Linking group can be by-O-,-N-, or-S-connects and receives the nucleosides that closes in succession.Be not that connections all in the oligonucleotide all needs identical.
[0085] in further embodiment, oligonucleotide comprises the glycosyl of modification, as, one or more hydroxyls by halogen group, aliphatic group or ester is arranged or the group of amino functional replaces.In one embodiment, 2 ' position the furanose residue by the O-methyl, O-alkyl, O-thiazolinyl, S-alkyl, S-thiazolinyl, or any one replacement of halogen group.The synthetic method of the 2 ' sugar modified is for example, that is, Sproat waits people's document Nucl.Acid Res.19:733-738 (1991); Be described among people's such as people's such as cotton document Nucl.Acid Res.19:2629-2635 (1991) and Hobbs the document Biochemistry 12:5138-5145 (1973).Other are modified those of ordinary skills is known.This modification may be pre-SELEX TMProcess is modified or post-SELEX TMProcess is modified (modification that the unmodified part is identified in the front) or is passed through to SELEX TMModify middle the adding.
[0086] Pre-SELEX TMThe modification of process and to SELEX TMThe nucleic acid ligands that the modification that process adds produces is to SELEX TMThe stability that target spot has special avidity and improved is as stability in vivo.To nucleic acid ligands Post-SELEX TMProcess is modified and also may be improved stability, as the body internal stability, and the nucleic acid ligands binding ability is not had negative impact.
[0087] SELEX TMMethod couples together oligonucleotide and the oligonucleotide and the non-oligonucleotide functional unit of other screenings of screening, as at United States Patent (USP) the 5th, 637, and No. 459 and the 5th, 683, description in No. 867.The SELEX TMMethod further comprise will screening nucleic acid cooperate and diagnosis or treatment in macromolecular compound lipophilic or non-immunogenic couple together, as United States Patent (USP) the 6th, 011, No. 020 and the 6th, 051, narrate in No. 698 and the PCT publication WO98/18480 number.The combination of our different shape of these patents and application guidelines and characteristic, oligonucleotide binding are effectively increased and the characteristic of duplicating and the ideal behavior of other molecules.
[0088] passes through SELEX TMMethod is also studied the evaluation of little flexible peptide nucleic acid ligands.Little peptide have flexibly structure usually in solution the equilibrium state with multiple structure exist, therefore originally think owing to the conformational entropy that reduces in conjunction with flexible peptide can limit binding affinity.But the feasibility of identifying little peptide nucleic acid(PNA) part in solution is at United States Patent (USP) the 5th, 648, explanation arranged in No. 214.In this patent, identified substrate P, a kind of high-affinity MA nucleic acid ligands of 11 amino acid polypeptides.
[0089] target spot of the present invention there be the fit by SELEX described herein of specificity and high affine bonding force TMProcess is screened.Then, as the part of SELEX process, fit optional the minimizing that filters out to define the little sequence of desired combination avidity in conjunction with target spot.Sequence that is selected and/or minimized sequence are by at random or optional the modifying to increase in binding affinity or the definite sequence in conjunction with active essential sequence of rite-directed mutagenesis.In addition, screen so that fit molecule is more stable to intravital degraded by adding modified nucleoside.
2 ' the SELEX that modifies TM
[0090] in order to make the fit treatment that is suitable as, preferred cheap synthetic fit, and make its safety in vivo and stable.Because their susceptibility, easily by nuclease degradation, it is also unstable usually in vivo that wild-type MA and thymus nucleic acid are fit.By modifying 2 ' ability that can increase anti-nucleolysis greatly.
[0091] fluorine-based and amino is successfully incorporated in the oligonucleotide library, subsequently from then in the oligonucleotide library screening fit.But these modification expenses increase the fit cost of synthetic thus greatly.Simultaneously, because in the degraded of modified oligonucleotide with in subsequently with the process of thuja acid as DNA synthetic substrate, modified oligonucleotide may be recycled and enter host DNA together, thereby causes safety problem in some cases.
[0092] provide here contain 2 '-oxygen-methyl (" 2 '-OMe ") nucleosides fit overcome above-mentioned a lot of drawback.The oligonucleotide that contains 2 '-oxygen-methyl nucleoside can resist the ribozyme degraded, and is cheap synthetic.Though 2 '-oxygen-methyl nucleoside ubiquity in biosystem, natural polymerization enzyme are not accepted 2 '-oxygen-methyl N TPs as substrate under physiological condition, therefore round-robin 2 '-oxygen-methyl nucleotide is entered host's DNA after, not have the misgivings on safe.Generation 2 '-modify fit SELEX method to describe, for example, the U.S. Provisional Patent Application that on December 3rd, 2002 proposed is numbered the 60/430th, No. 761, the U.S. Provisional Patent Application numbering 60/487,474 that on July 15th, 2003 proposed; The U.S. Provisional Patent Application numbering 60/517,039 that on November 4th, 2003 proposed; Patent application number 10/729,581; The U.S. Provisional Patent Application that proposed on July 21st, 2004 is compiled 10/873,856 title " in-vitro screening 2 '-method of oxygen-methyl substituted nucleic acid ", and each patent of mentioning is here all incorporated this paper into by quoting as proof at this.
[0093] the present invention includes and to be attached to IgE and to regulate the fit of IgE function, wherein IgE can comprise the nucleosides (if any 2 ' position is modified) of modification, thus make oligonucleotide than the oligonucleotide of unmodified more stable aspect enzyme liberating, chemical degradation, thermal destruction and the mechanical degradation.Though have in the document some comprise 2 '-example that OMe is fit (referring to, for example, people such as Green are at Current Biology 2,683-695, the document of delivering on 1995), these are all transcribed the mixture in-vitro screening by modification and produce, in the modified mixture C and U residue be 2 '-fluorine (2 '-F) replace, A and G residue be 2 '-OH.In case each function sequence is all identified, test each A and G residue to 2 '-tolerance that Ome replaces, synthetic is fit again, described fit all A that contain and G are as 2 '-oxygen-methyl residue, the 2 '-oxygen-methyl substituted of holding.Can the hold replacement of 2 '-oxygen-methyl residue of A that most of two-step approachs generate and G residue is although average 20% can not hold.Therefore this method produces fitly generally contains 2-4 2 '-OH residue, so synthetic stability and cost are more appropriate.By in the responsive transcription that produces the stabilization treatment oligonucleotide, adding modified nucleoside, necessity that method of the present invention has reduced the screened fit oligonucleotide of stabilization treatment (for example, by using the synthetic again fit oligonucleotide of modified nucleoside), the oligonucleotide of stabilization treatment is used to use the oligonucleotide of SELEX screening and enrichment to transcribe mixture (and/or its derivative or improvement product, comprise described here these are fit).
[0094] in embodiments, the invention provides by 2 '-OH, 2 '-F, 2 '-ATP that deoxidation and 2 '-OMe modifies, GTP, CTP, it is fit that the mixture of TTP and UTP Nucleotide is formed.In other embodiments, the invention provides by 2 '-OH, 2 '-F, 2 '-deoxidation, 2 '-OMe, 2 '-NH 2And 2 '-ATP that methyl is modified, GTP, CTP, it is fit that the mixture of TTP and UTP Nucleotide is formed.In another embodiment, the invention provides by 5 6Individual 2 '-OH, 2 '-F, 2 '-deoxidation, 2 '-OMe, 2 '-NH 2With 2 '-ATP that methyl is modified, GTP, CTP, it is fit that TTP and UTP mixture of ribonucleotides are formed.
[0095] 2 of invention ' modification is fit is to be created by the polysaccharase of modified mistake, as, the T7 polysaccharase of modified mistake can be in conjunction with the modified base that furanose 2 ' position is replaced in a large number, and its association rate is than wild-type polysaccharase height.For example, 639 tyrosine residues of mutant T7 polysaccharase (Y639F) sports phenylalanine, and this enzyme is easy to utilize 2 '-deoxidation, 2 '-amino and 2 '-the fluoro-ribonucleoside triphosphote is as substrate, be widely used in synthetic modification MAs, opened up wide application prospect.But, according to existing, this mutant T7 polysaccharase can't utilize (that is, incorporating into) 2 ' position by 2 '-OMe or 2 '-nitrine (2 '-N 3) a large amount of ribonucleoside triphosphotes that replace are as substrate.Mutant T7 polysaccharase (Y639F/H784A) except above-mentioned Y639F sudden change takes place, also sports alanine residue at 784 hyte propylhomoserins.This enzyme has been used to the combination of pyrimidine nucleoside triphosphoric acid under the restricted condition.Referring to Padilla, R. and Sousa, the document Nucleic Acids Res. of R., described mutant T7 polysaccharase (H784A) at 2002,30 (24): 138. sports alanine residue at 784 with Histidine.People Nucleic Acids Research such as Padilla, 2002,30:138.Mutant T7 polysaccharase Y639F/H784A and H784A become littler amino-acid residue in its mutational site.This just variation makes it combine more nucleosides substrate, as the Nucleotide substrate of 2 '-OMe replacement.
[0096] common, under the condition disclosed herein, the Y693F mutant can be used for the ribonucleoside triphosphote NTPs except that GTP in conjunction with 2 '-OMe replacement, and the Y639F/H784A mutant can be used for the NTPs that comprises GTP that all 2 '-OMe replace.Can predict, under the condition disclosed herein, mutant H784A and Y639F and mutant Y639F/H784A similar performance.
[0097] 2 ' oligonucleoside modified can be fully by synthetic through the nucleosides of modifying or with a part modified the synthesizing of nucleosides.Modification can be identical can be different.All nucleosides all can be modified, and all nucleosides all may contain identical modification.All nucleosides all can be modified, but comprise different modifications, such as, all nucleosides that contain identical base all have only a kind of modification, and the nucleosides that contains other bases then has the modification of other type.All purine nucleoside may have only one type modification (or not modified), and all pyrimidine nucleotides then contain the modification of other type, or are not modified.Like this, transcribe carry out or the process of the formation of transcription product in, can utilize any modification combination, for example comprise pyrimidine nucleoside (2 '-OH), deoxidation pyrimidine nucleoside (2 '-deoxidation), 2 '-F and 2 '-oxygen methyl nucleoside.Comprise 2 '-OMe C and U and 2 '-mixture of transcribing of OH A and G is called as " rRmY " mixture, by the fit of its selection thereby to be called " rRmY " fit.Comprise deoxidation A and G and 2 '-transcription complex of OMe U and C is named as " dRmY " mixture, corresponding selected fit called after " dRmY " is fit.Comprise 2 '-OMe A, C and U and 2 '-transcription complex of OH G is named as " rGmH " mixture, and corresponding selected fit called after " rGmH " is fit.Comprise 2 '-OMeA, C, U and G and 2 '-OMe A, U and C and 2 '-transcription complex of F G is named as " alternative blended thing ", corresponding selected fit called after " the alternative blended thing is fit ".Comprise 2 '-OMe A, U, C, and G, wherein the Nucleotide more than 10% is G ' s, and transcription complex is named as " r/mGmH " mixture, and corresponding selected fit called after " r/mGmH " is fit.Comprise 2 '-OMe A, U and C and 2 '-transcription complex of F G is named as " fGmH " mixture, and corresponding selected fit called after " fGmH " is fit.Comprise 2 '-OMe A, the transcription complex of U and C and deoxidation G is named as " dGmH " mixture, and corresponding selected fit called after " dGmH " is fit.Comprise deoxidation A and 2 '-OMe C, the transcription complex of G and U is named as " dAmB " mixture, and corresponding selected fit called after " dAmB " is fit.Only comprise 2 '-transcription complex of OH nucleosides is named as " m " mixture, and corresponding selected fit called after " m " or " rRrY " are fit." mRmY " is fit then be only comprise 2 '-the O-methyl nucleoside, usually from the r/mGmH oligonucleoside by post-SELEX TMDisplacement and obtaining, also can be with 2 '-OH Gs with 2 '-OMe Gs replaces and obtains.
[0098] embodiment preferred comprise 2 of any combination '-OH, 2 '-deoxidation and 2 '-the OMe nucleosides.Better preferred embodiment comprise any combination 2 '-deoxidation and 2 '-the OMe nucleosides.More preferred comprise 2 of any combination '-deoxidation and 2 '-the OMe nucleosides, wherein pyrimidine 2 '-OMe is as (dRmY, mRmY or dGmH).
[0099] before screening process (as, pre-SELEX TMThe process modification) to finish fit combining in modified base and the invention.In addition, at pre-SELEX TMWhat combine with modified base in the modification of the present invention fitly can also pass through post-SELEX TMModification is further modified (as pre-SELEX TMPost-SELEX after modifying TMProcess is modified).Pre-SELEX TMProduce specific combination in SELEX TMThe nucleic acid ligands of the modified mistake of target spot, and improved stability in vivo.Post-SELEX TMProcess is modified and (containing of previous evaluation to be passed through pre-SELEX TMProcess modify to add the part of nucleosides cut off, knock out, replace or add nucleosides and modify) further improved stability in vivo, do not pass through pre-SELEX and do not have a strong impact on to contain TMProcess is modified the nucleic acid ligands binding capacity of bonded nucleosides.
[00100] accept to modify in order to obtain 2 ' position under the condition of the NTPs that modifies 2 ' position at polysaccharase (for example 2 '-OMe) MA transcription product, the preferred polymeric enzyme is Y693F/H784A mutant or Y693F mutant.The other polysaccharase especially can tolerate a large amount of substituted polysaccharases in 2 ' position and also can be used for the present invention.By detecting the binding ability that can obtain these polysaccharases under the condition in conjunction with the ability of modified nucleoside of transcribing disclosed herein.
[00101] there are many factors to be confirmed as the condition of transcribing that method disclosed herein is used is played an important role.Such as when leading sequence with after the fixed sequence program of transcribing template 5 ' end at DNA combines, observing the modified output of transcribing increases, preceding at least 6 residues of synthetic transcript all are purine.
[00102] influence obtain another important factor in conjunction with the modified nucleoside transcript and be 2 '-existence or its concentration of OH GT.Transcribe and can be divided into two stages: first stage is initial, and in this stage, NTP joins 3 of GTP '-hydroxyl oxygen cardinal extremity (or another replaces guanosine) and generates dinucleotides, extends to 10-12 nucleosides afterwards; Subordinate phase is to prolong, and in this stage, transcription product is considerably beyond the 10-12 that begins to add a most nucleosides.Join a spot of 2 '-oxygen-methyl GTP in the transcription complex that contains excessive 2 '-oxygen-methyl GTP can make completely polysaccharase cause 2 '-transcribing of participating in of OH GTP, but enter stretch-out phase when transcribing, because 2 '-oxygen-methyl and 2 '-difference of OH GTP weakens, 2 '-oxygen-methyl GTP more than 2 '-OH GTP, make that transcribing bonded mainly is 2 '-oxygen-methyl GTP.
[00103] influencing another important factor that 2 '-oxygen-methyl substituted nucleosides infiltrates transcript is the divalence magnesium and the manganese of transcribing in the mixture.Existing find magnesium chloride and Manganous chloride tetrahydrate with different concentration combination influence 2 '-output that oxygen-methyl is transcribed, the optimal concentration of magnesium chloride and manganese depends on that it is containing the concentration of divalent-metal ion with NTPs responsive transcription mixture.In order to obtain 2 ' methylate maximum production (promptly all A of transcript of the oxygen that replaces, C and U and about 90%G nucleosides), when the concentration of every kind of NTP was 0.5mM, the concentration of preferred magnesium chloride approximately was 5mM, and the concentration of preferred Manganous chloride tetrahydrate approximately is 1.5mM.When the concentration of every kind of NTP was 1..0mM, the concentration of preferred magnesium chloride approximately was 6.5mM, and the concentration of preferred Manganous chloride tetrahydrate approximately is 2.0mM.When the concentration of every kind of NTP was 2.0mM, the concentration of preferred magnesium chloride approximately was 9.6mM, and the concentration of preferred Manganous chloride tetrahydrate approximately is 2.9mM.Under any circumstance, still can significantly improve the amount of modifying transcription product under the situation of non-two times of concentration.
[00104] transcribing that GMP or guanosine cause is also very important.This effect is owing to the specificity of polysaccharase to initial nucleosides causes.Thereby this mode produce any transcribe 5 '-terminal nucleosides all may be 2 '-OH G.The preferred concentration of GMP or guanosine is 0.5mM, even more preferably concentration 1mM.Also find in responsive transcription, contain preferably PEG-8000 of PEG, help farthest in conjunction with modified nucleoside.
[00105] for make 2 '-oxygen methyl ATP (100%), UTP (100%), CTP (100%) and GTP (～90%) (" r/mGmH ") at utmost are attached in the transcript, be down optimum condition: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl 25mM (wherein every kind 2 of 6.5mM '-concentration of OMe NTP is 1.0mM), MnCl2 1.5mM (concentration of wherein every kind 2 '-oxygen-methyl N TP of 2.0 mM is 1.0mM), 2 '-oxygen-methyl N TP (every kind) 500 μ M (being more preferably 1.0mM), 2 '-OH GTP 30 μ M, 2 '-OH GMP 500 μ M, pH7.5, Y639F/H784A T7 MA polysaccharase 15units/mL, inorganic pyrophosphatase 5units/mL, at least 8 Allopurinol homing sequences that nucleosides is long.The Y639F/H784A mutant T7 MA polysaccharase of a unit (or at this specific any other T7 MA polysaccharase) is defined as the 1nmole2 '-oxygen methyl N TPs amount in conjunction with needed enzyme in as transcript as used herein.The inorganic phosphate enzyme of a unit is defined as under pH7.2 and 25 ℃ of conditions and discharges the amount that per minute discharges 1.0 moles of required enzymes of inorganic phosphate as used herein.
[00106] for make 2 '-oxygen methyl ATP, UTP and CTP (" rGmH ") at utmost are attached in the transcript, are optimum condition down: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), TritonX-1000.01% (w/v), MgCl 25mM (concentration that 9.6mM works as every kind 2 '-oxygen-methyl N TP is 2.0mM), MnCl 21.5mM (2.9mM when every kind 2 '-concentration of OMeNTP is 2.0mM), 2 '-oxygen-methyl N TP (every kind) 500 μ M (more preferably 2.0mM), pH7.5, Y639F T7 MA polysaccharase 15units/ml, inorganic phosphate enzyme 5units/mL, at least 8 Allopurinol homing sequences that nucleosides is long.
[00107] for make 2 '-oxygen methyl UTP and CTP (" rRmY ") at utmost be incorporated into and transcribe species, classifies optimum condition down as: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-1000.01% (w/v), MgCl 25mM (concentration that 9.6mM works as every kind 2 '-oxygen-methyl N TP is 2.0mM), MnCl 2(1.5mM the concentration that 2.9mM works as every kind 2 '-oxygen-methyl N TP is 2.0mM), 2 '-OMe NTP (every kind) 500 μ M (2.0mM is better), pH7.5, Y639F/H784A T7 MA polysaccharase 15units/mL, inorganic phosphate enzyme 5units/mL, at least 8 Allopurinol homing sequences that nucleosides is long.
[00108] for make deoxidation ATP and GTP and 2 '-oxygen methyl UTP and CTP (" dRmY ") 100% maximum combined be in transcript, preferred following condition: HEPES damping fluid 200mM, DTT 40mM, spermine 2mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl 29.6mM, MnCl 22.9mM, 2 '-oxygen-methyl N TP (every kind) 2.0mM, pH7.5, Y639F T7 MA polysaccharase 15units/mL, inorganic phosphate enzyme 5units/mL, at least 8 Allopurinol homing sequences that nucleosides is long.
[00109] for make deoxidation 2 '-oxygen methyl ATP, UTP and CTP and 2 '-FGTP (" fGmH ") 100% maximum combined is in transcript, preferred following condition: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-8000 10% (w/v), Triton X-100 0.01% (w/v), MgCl 29.6mM, MnCl2 2.9mM, 2 '-OMe NTP (every kind) 2.0mM, pH7.5, Y639F T7 MA polysaccharase 15units/mL, inorganic phosphate enzyme 5units/mL, at least 8 Allopurinol homing sequences that nucleosides is long.
[00110] in order to make deoxidation deoxidation ATP, 2 '-oxygen methyl UTP and GTP and CTP (" dAmB ") 100% maximum combined be in transcript, preferred following condition: HEPES damping fluid 200mM, DTT 40mM, spermidine 2mM, PEG-800010% (w/v), Triton X-100 0.01% (w/v), MgCl 29.6mM, MnCl2 2.9mM, 2 '-oxygen-methyl N TP (every kind) 2.0mM, pH7.5, Y639F T7 MA polysaccharase 15units/mL, inorganic phosphate enzyme 5units/mL contains the Allopurinol homing sequence of 8 nucleosides at least.
[00111] transcribes preferably at 20 ℃ to 50 ℃ for above-mentioned every kind of situation (a), be preferable over 30 ℃ to 45 ℃, more preferably 37 ℃ of double-stranded DNAs that carry out at least two hours (b) 50-300nM are transcribed template and are used (using the 200nM template in order to increase diversity (template of 300nM is used for dRmY and transcribes) in first round reaction), about 50nM in the later several rounds reaction, dilution proportion with 1/10 is used for optimizing the PCR reaction, uses condition described herein.Preferred DNA transcribe template following (wherein ARC254 and ARC256 complete 2 '-transcribe under the condition of oxygen methyl and transcribe under the condition of ARC255 at rRmY).
SEQ ID NO 1 ARC254
5’-CATCGATGCTAGTCGTAACGATCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCGAGAACGTTCTCTCCTCTCCCTATAG
TGAGTCGTATTA-3’
SEQ ID NO 2 ARC255
5’-CATGCATCGCGACTGACTAGCCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAACGTTCTCTCCTCCCTATAGT
GAGTCGTATTA-3’
SEQ ID NO 3 ARC256
5’-CATCGATCGATCGATCGACAGCGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTAGAACGTTCTCTCCTCTCCCTATAGT
GAGTCGTATTA-3’
[00112] transcribe under the condition at m of the present invention, the responsive transcription mixture by 2 '-OH adenosine triphosphate (ATP), 2 '-0H guanosine triphosphate (GTP), 2 '-OH cytidine triphosphate(CTP) (CTP) and 2 '-OH uridine triphosphate (UTP) forms.Use m among the present invention transcribe modified oligonucleotide that mixture produces fully by 2 '-the OH adenosine, 2 '-the OH guanosine, 2 '-the OH cytidine, 2 '-the OH uridine forms.Transcribe in the preferred embodiment at m, the modified oligonucleotide that the present invention produces is formed a sequence, and at least 80% adenosine is 2 '-the OH adenosine, at least 80% guanosine is 2 '-the OH guanosine, at least 80% cytidine is 2 '-the OH cytidine, at least 80% uridine is 2 '-the OH uridine.M transcribes in the more preferred, the modified oligonucleotide that the present invention produces is formed a sequence, and at least 90% adenosine is 2 '-the OH adenosine, at least 90% guanosine is 2 '-the OH guanosine, at least 90% cytidine is 2 '-the OH cytidine, at least 90% uridine is 2 '-the OH uridine.In the more preferred that m transcribes, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 100% is 2 '-the OH adenosine, at least 100% guanosine is 2 '-the OH guanosine, at least 100% cytidine is 2 '-the OH cytidine, at least 100% uridine is 2 '-the OH uridine.
[00113] rRmY of the present invention transcribes under the condition, the responsive transcription mixture by 2 '-OH adenosine triphosphate (ATP), 2 '-OH guanosine triphosphate (GTP), 2 '-oxygen-methylcytidine triphosphoric acid (CTP) and 2 '-oxygen-methyluridine triphosphoric acid (UTP) forms.By among the present invention by rRmY transcribe the modified oligonucleotide that produces in the mixture fully by 2 '-the OH adenosine, 2 '-the OH guanosine, 2 '-oxygen-methylcytidine, 2 '-oxygen-methyluridine forms.The modified oligonucleotide that preferred embodiment produces is formed a sequence, the adenosine of this sequence at least 80% is 2 '-the OH adenosine, at least 80% guanosine is 2 '-the OH guanosine, at least 80% cytidine is 2 '--oxygen-methylcytidine, at least 80% uridine are 2 '--oxygen-methyluridine.In the more preferred, the modified oligonucleotide that produces is formed a sequence, and at least 90% adenosine is 2 '-the OH adenosine, at least 90% guanosine is 2 '-the OH guanosine, at least 90% cytidine is 2 '--oxygen-methylcytidine, at least 90% uridine are 2 '--oxygen-methyluridine.In the more preferred that m transcribes, the modified oligonucleotide that produces is formed a sequence, at least 100% adenosine is 2 '-the OH adenosine, at least 100% guanosine is 2 '-the OH guanosine, at least 100% cytidine is 2 '--oxygen-methylcytidine, at least 100% uridine be 2 '-oxygen-methyluridine.
[00114] dRmY of the present invention transcribes under the condition, the responsive transcription mixture by 2 '-deoxyadenosine triphosphate (ATP), 2 '-deoxyguanosine triphosphate (GTP), 2 '-oxygen-methylcytidine triphosphoric acid (CTP) and 2 '-oxygen-methyluridine triphosphoric acid (UTP) forms.By the modified oligonucleotide that uses dRmY to transcribe among the present invention to produce in the mixture fully by 2 '-Desoxyadenosine, 2 '-pancreatic desoxyribonuclease, 2 '-oxygen-methylcytidine, 2 '-oxygen-methyluridine forms.The modified oligonucleotide that produces in the preferred embodiment is formed a sequence, at least 80% adenosine is 2 '-Desoxyadenosine, at least 80% guanosine is 2 '-pancreatic desoxyribonuclease, at least 80% cytidine is 2 '--oxygen-methylcytidine, at least 80% uridine are 2 '--oxygen-methyluridine.In the more preferred, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 90% is 2 '-Desoxyadenosine, at least 90% guanosine is 2 '-pancreatic desoxyribonuclease, at least 90% cytidine is 2 '--oxygen-methylcytidine, at least 90% uridine are 2 '--oxygen-methyluridine.In the most preferred embodiment, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 100% is 2 '-Desoxyadenosine, at least 100% guanosine is 2 '-pancreatic desoxyribonuclease, at least 100% cytidine is 2 '--oxygen-methylcytidine, at least 100% uridine be 2 '-oxygen-methyluridine.
[00115] rGmH of the present invention transcribes under the condition, the responsive transcription mixture by 2 '-the OH guanosine triphosphate, 2 '-oxygen-methylcytidine triphosphoric acid, 2 '-oxygen-methyluridine triphosphoric acid and 2 '-oxygen-methyladenosine triphosphoric acid forms.By the modified oligonucleotide that uses rGmH to transcribe among the present invention to produce in the mixture fully by 2 '-the OH guanosine, 2 '-oxygen-methylcytidine, 2 '-oxygen-methyluridine and 2 '-oxygen-methyladenosine forms.The modified oligonucleotide that produces in the preferred embodiment is formed a sequence, the guanosine of this sequence at least 80% is 2 '-the OH guanosine, at least 80% cytidine is 2 '--oxygen-methylcytidine, at least 80% uridine is 2 '--oxygen-methyluridine, at least 80% adenosine be 2 '-oxygen-methyladenosine.In the more preferred, the modified oligonucleotide that produces is formed a sequence, the guanosine of this sequence at least 90% is 2 '-the OH guanosine, at least 90% cytidine is 2 '--oxygen-methylcytidine, at least 90% uridine is 2 '--oxygen-methyluridine, at least 90% adenosine be 2 '-oxygen-methyladenosine.In the most preferred embodiment, the modified oligonucleotide that produces is formed a sequence, the guanosine of this sequence at least 100% is 2 '-the OH guanosine, at least 1 00% cytidine is 2 '--oxygen-methylcytidine, at least 100% uridine is 2 '--oxygen-methyluridine, at least 100% adenosine be 2 '-oxygen-methyladenosine.
[00116] r/mGmH of the present invention transcribes under the condition, the responsive transcription mixture by 2 '-oxygen-methyladenosine triphosphoric acid, 2 '-oxygen-methylcytidine triphosphoric acid, 2 '-oxygen-methylguanyl triphosphate and 2 '-oxygen-methyluridine triphosphoric acid forms.By the modified oligonucleotide that uses r/mGmH to transcribe among the present invention to produce in the mixture fully by 2 '-oxygen-methyladenosine, 2 '-oxygen-methylcytidine, 2 '-oxygen-methylguanosine and 2 '-oxygen-methyluridine forms, wherein in the guanosine triphosphate 2 '-maximum level of OH guanosine is 10%.The r/mGmH modified oligonucleotide that produces in the preferred embodiment is formed a sequence, the adenosine of this sequence at least 80% is 2 '-oxygen-methyladenosine, at least 80% cytidine is 2 '--oxygen-methylcytidine, at least 80% guanosine is 2 '--oxygen-methylguanosine, at least 80% uridine is 2 '-oxygen-methyluridine, in all adenylic acid (AMP)s 2 '-the OH adenosine is no more than 10%.In the more preferred, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 90% is 2 '-oxygen-methyladenosine, at least 90% cytidine is 2 '--oxygen-methylcytidine, at least 90% guanosine is 2 '--oxygen-methylguanosine, at least 90% uridine is 2 '-oxygen-methyluridine, in all guanylic acids 2 '-the OH guanosine is no more than 10%.In the more preferred, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 100% is 2 '-oxygen-methyladenosine, at least 100% cytidine is 2 '--oxygen-methylcytidine, at least 100% guanosine is 2 '--oxygen-methylguanosine, at least 100% uridine is 2 '-oxygen-methyluridine, in all guanylic acids 2 '-the OH guanosine is no more than 10%.
[00117] fGmH of the present invention transcribes under the condition, the responsive transcription mixture by 2 '-oxygen-methyladenosine triphosphoric acid, 2 '-oxygen-methyluridine triphosphoric acid, 2 '-oxygen-methylcytidine triphosphoric acid and 2 '-the F guanosine triphosphate forms.By the modified oligonucleotide that uses fGmH to transcribe among the present invention to produce in the mixture fully by 2 '-oxygen-methyladenosine, 2 '-oxygen-methyluridine, 2 '-oxygen-methylcytidine and 2 '-the F guanosine forms.The modified oligonucleotide that preferred embodiment produces is formed a sequence, the adenosine of this sequence at least 80% is 2 '-oxygen-methyladenosine, at least 80% uridine is 2 '--oxygen-methylcytidine, at least 80% cytidine are 2 '--oxygen-methylcytidine, at least 80% guanosine be 2 '-the F uridine.In the more preferred, the modified oligonucleotide that produces is formed a sequence, and the adenosine of this sequence at least 90% is 2 '-oxygen-methyladenosine, at least 90% cytidine is 2 '--oxygen-methyluridine, at least 90% guanosine is 2 '--oxygen-methylcytidine, at least 90% uridine be 2 '-the F guanosine.In the more preferred, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 100% is 2 '-oxygen-methyladenosine, at least 100% cytidine is 2 '--oxygen-methyluridine, at least 100% cytidine is 2 '--oxygen-methylcytidine, at least 100% guanosine be 2 '-the F guanosine.
[00118] dAmB of the present invention transcribes under the condition, the responsive transcription mixture by 2 '-deoxyadenosine triphosphate, 2 '-oxygen-methylcytidine triphosphoric acid, 2 '-oxygen-methylguanyl triphosphate and 2 '-oxygen-methyluridine triphosphoric acid forms.By use among the present invention dAmB transcribe again modified oligonucleotide that mixture produces fully by 2 '-Desoxyadenosine, 2 '-oxygen-methylcytidine, 2 '-oxygen-methylguanosine and 2 '-oxygen-methyluridine forms.The modified oligonucleotide of preferred embodiment is formed a sequence, the adenosine of this sequence at least 80% is 2 '-Desoxyadenosine, at least 80% cytidine is 2 '-oxygen-methyluridine, at least 80% guanosine is 2 '-oxygen-methylguanosine, at least 80% uridine is 2 '--oxygen-methylcytidine.In the more preferred, the modified oligonucleotide that produces is formed a sequence and is formed, the adenosine of this sequence at least 90% is 2 '-Desoxyadenosine, at least 90% cytidine is 2 '-oxygen-methyluridine, at least 90% guanosine is 2 '-oxygen-methylguanosine, at least 90% uridine is 2 '--oxygen-methylcytidine.In the more preferred, the modified oligonucleotide that produces is formed a sequence, the adenosine of this sequence at least 100% is 2 '-Desoxyadenosine, at least 100% cytidine is 2 '-oxygen-methyluridine, at least 100% guanosine is 2 '-oxygen-methylguanosine, at least 100% uridine is 2 '--oxygen-methylcytidine.
[00119] under every kind of situation, transcription product is used for SELEX TMThe mixture of process with identify can with the conservative motif sequence of fit and/or the definite and given target spot specific combination of given target spot specific combination.The sequence that produces is handled by partially stabilizedization, thereby removing this step from process obtains a kind of fit sequence of modification and a kind of more stable fit.2 '-oxygen-methyl SELEX TMAnother advantage of process be have in the sequence that produces still less sequence necessary 2 '-the OH nucleosides, even may not have.During degree that 2 ' OH nucleosides still exists, can pass through post-SELEX TMModification is removed.
[00120] as described below, under other conditions of non-above-mentioned optimal conditions, can obtain to combine fully 2 ' a small amount of useful product that duplicates of the nucleosides that replaces.Above-mentioned change of transcribing condition comprises:
[00121] concentration range of HEPES damping fluid is 0 to 1M.The present invention also considers to use the damping fluid reagent of other pKa values between 5-10.For example, Tris-methylol-aminomethane.
[00122] the DTT concentration range is between 0-400mM.Method of the present invention also provides other to go back the using method of original reagent, comprises mercaptoethanol.
[00123] spermidine and/or spermine concentration range are 0-20mM.
[00124] the PEG-8000 concentration range is 0 to 50% (w/v).Method of the present invention also provides hydrophilic polymeric body using method, comprises PEG or other hydrophilic polyoxyethylene glycol of other molecular weight.
[00125] Triton X-100 concentration range is 0 to 0.1% (w/v).Method of the present invention also provides the use of nonionic washing agent, comprises other washing agents and other Triton-X washing agents.
[00126] MgCl 2Concentration range be that 0.5mM is to 50mM.MnCl 2Concentration range be that 0.15mM is to 15mM.MgCl 2And MnCl 2In must scope described herein, MgCl in preferred embodiments 2: MnCl 2Ratio about about 10 to 3, preferred, MgCl 2: MnCl 2Ratio be about 3-5: 1, more preferably MgCl 2: MnCl 2Ratio be about 3-4: 1.
[00127] 2 '-oxygen-methyl N TP concentration (every kind of NTP) scope is 5 μ M-5mM.
[00128] 2 '-OH GTP concentration range is 0 μ M-300 μ M.
[00129] 2 '-OH GMP concentration range is 0-5mM.
[00130] the pH scope is that pH6 is to pH9.Method of the present invention keeps and can operate in the active pH scope in conjunction with modified nucleoside at most of polysaccharases, and method of the present invention also provides the optional using method at responsive transcription condition chelating reagent, such as EDTA, and EGTA, and DTT.
Fit medical chemistry
[00131] fit medical chemistry is a kind of fit improvement technology, and is fit by the synthetic many group variations of chemical process.These varients owing to introduced single substituting group be different from female fit because substituent position difference is also inequality each other.The relatively difference between these fit varients, and the difference fit with mother.Had very big improvement on the performance, to such an extent as to reach a certain specific treatment standard be necessary single substituting group is incorporated in.
[00132] in addition, from single information that replaces the fit acquisition of variation can be further to design the variation of other groups fit by introducing more than one substituting group simultaneously.Wherein a kind of design is with all mono-substituted fit varient classification, selects preceding four, and with these four fit varients as far as possible with double (6), the combination of the form of three times (4) and four times (1), synthetic composition and detection.In second layout strategy, best list replaces fit varient as parent, synthesizes and detect all possible pair to replace fit varient, comprises the fit varient of the single replacement of the superlative degree.Also can use other strategies, these strategies may repeat to be used, and to the evaluation of the fit varient of further improvement, the number of replacement increases gradually along with constantly.
[00133] fit medical chemistry is particularly useful for probing into local but not all introduce substituted radical.Because fit be transcribe generation sequence library in find any SELEX TMThe substituting group that process is introduced must be whole the introducing.Such as, want between nucleosides to introduce thiophosphatephosphorothioate and connect, can only introduce (the whole replacement) each A (perhaps each G, C, T, U etc.) so.If fitly need in some A (or each G, C, T, U etc.) (the local replacement), introduce thiophosphatephosphorothioate and connect, but do not allow to introduce between other the A, so just can not be by this process realization.
[00134] used replacement kind only is subjected to the restriction that it produces the ability that replaces and be introduced into oligopolymer synthetic schemes ability as the stationary phase synthetic agent in the fit medical chemistry process.This process is not limited only to nucleosides.Fit medical chemistry scheme comprises the introducing size exclusion, hydrophobic nature, wetting ability, hydrophobicity, oleophobic property, positive charge, negative charge, neutral charge, zwitterion, polarizability, nuclease-resistant, conformation rigidity, conformation handiness, protein binding characteristic, groups such as gathering.Fit medical chemistry scheme may comprise base modification, and sugar-modified or phosphoric acid connects to be modified.
[00135] consider useful substituting group kind in therapeutics is fit, one or more substituting groups all can be obtained the ideal effect below introducing.
[00136] substituted radical has appearred in vivo, such as 2 '-deoxidation, 2 '-ribose, 2 '-oxygen methyl purine or pyrimidine or 5-oxygen-methylcystein.
[00137] substituted radical has become the part of approved therapeutical agent, such as the oligonucleotide that is connected with thiophosphoric acid.
[00138] can hydrolysis or be degraded into one of above-mentioned two types substituted radical, for example oligonucleotide that is connected with the first thiophosphoric acid.
[00139] of the present invention anti--IgE is fit be included in this narration pass through the fit of fit medical chemistry formation
Fit with the IgE specific combination
[00140] material of the present invention comprises the aptamer that a series of 20-50 nucleosides are long, energy specific combination IgE, and effectively regulate in some embodiments, as blocking-up, in vivo active of IgE and/or its be in Function detection, as based on the activity in the detection of cell.
[00141] having described here can specific combination and regulate the fit of IgE.These are fit to provide a kind of hypotoxicity, form treats and/or prevents anaphylactic disease or discomfort safely and effectively, known described anaphylactic disease or discomfort are to be caused or relevant with it by IgE, for example: allergic rhinitis (pollinosis), allergic dermatitis, asthma, acute rubella (bubble-and-the red swelling of the skin inflammation), food anaphylaxis and general anaphylaxis reaction.
[00142] provides the specificity that is used for the treatment of and/or diagnoses fit example, comprised following sequence: sequence number 11 to 15,18 to 19,21 in conjunction with IgE, 29,33,41 to 44,46,50,56 to 96,98 to 102,119 to 124,126 to 136,139 to 176,178 to 190,194 to 201,206 to 243,247,249 to 259,261 to 267,269 to 290,292 to 295 and 296; Especially the sequence of from following group, selecting: sequence number 29,33,41 to 44,46,50,98 to 102,157 to 176,178 to 190,194 to 201,206 to 219,293 to 295 and 296; The sequence of from following group, selecting more particularly: sequence number 101,157,181,216,293 to 295 and 296.
[00143] other and IgE bonded are fit as narrating in the embodiment 1-4 example.
[00144] these fitly comprise modification described herein, comprise with lipotropy mixture or PEG high molecular weight component being connected, and add the CpG motif, add closed-end structure, combine the replacement in the phosphoric acid skeleton with modified nucleoside.
[00145] providing in embodiments of the invention can be isolated non-spontaneous fit with the IgE bonded.In some embodiments, this isolating non-ly abiogenously fitly is less than 1 μ M to being less than 100 μ M, is less than 500 μ M, is less than 50nM, is less than 1nM, is less than 500pM, is less than 100pM, and the IgE that is less than 50pM or is less than 1pM has a dissociation constant (" K D").In some embodiments of invention, this dissociation constant depends on the titrating dot hybridization test of end user IgE under embodiment 1 described condition.In a particularly embodiment, this dissociation constant depends on the standard blob cross experiment, at room temperature, (contains Mg at Dulbecco ' s PBS ++And Ca ++) and 0.1mg/mL BSA in titration people IgE 30 minutes.
[00146] in another embodiment, the function of aptamer regulated IgE of the present invention.In another embodiment, fit obstruction IgE performance function of the present invention.Also have in other invention embodiments fit combination and/or the function of regulating the IgE derivative.Here used IgE derivative comprise and with the identical derivative of IgE function, especially comprise the essentially identical derivative of those structures, comprise at least 70% the aminoacid sequence and the derivative of IgE consensus amino acid sequence in some preferred embodiments, 80% sequence unanimity in the more preferred, be more preferably 90% sequence unanimity, even the aminoacid sequence of more preferred at least 95% is consistent with IgE amino acid.In embodiments more of the present invention, determine the consistence of target spot derivative sequence by following BLAST method.
[00147] term about Nucleotide or protein sequence that occurs in the article " sequence identity " or " consistence % " refer to below using a kind of sequence and come relatively or when comparing the maximum goodness of fit to ratio calculating method or by visual observation, its amino acid residue sequence of two or more sequences or subsequence or nucleotide sequence are identical, or have a certain proportion of sequence identical.During the sequence contrast, usually, one of them sequence is as canonical sequence, and other sequences compare with it.When using a kind of ordered series of numbers to ratio calculating method, canonical sequence and detection sequence input computer also can be set the subsequence counterpart if necessary, also can set the parameter in the sequence algorithm program.Sequence contrast algorithm calculate then detect sequence with respect to canonical sequence identical sequence per-cent.Can do best comparison to wanting comparative sequences, as passing through Smith ﹠amp; Waterman, the local homology comparison among the Adv.Appl.Math.2:482 (1981) is by NeedIeman ﹠amp; Homology comparison calculation rule among the Wunsch, J MoI.Biol.48:443 (1970) is by Pearson ﹠amp; Lipman, the similarity method research of Proc.Nat ' l.Acad.Sci.USA 85:2444 (1988) and computerize (the Wisconsm GeneticsSoftware Package of these algorithms, Genetics Computer Group, 575 Science Dr., Madison, the GAP among the Wis, BESTFIT, FASTA, and TFASTA) or by visual observation (referring to people's such as Ausubel document, the same).
[00148] is suitable for determining wherein a kind of algorithm of sequence homology per-cent, be applied to basic local comparison instrument (afterwards being cited as " BLAST "), referring to people's such as people's such as Altschul document J MoI.Biol.215:403-410 (1990) and Altschul document Nucleic Acids Res., 15:3389-3402 (1997).BLAST analyzes used software can obtain (being cited as " NCBI " hereinafter) from NCBI.The software that obtains from NCBI uses default parameters when determining sequence homology.For example, BLASTN (for Nucleotide) and BLASTP (for aminoacid sequence) describe among the 32:W20-W25 (2004) to some extent at people's such as McGmnis document Nucleic Acids Res..
[00149] in another embodiment in the invention, fit and IgE bonded ability and any according to sequence number 11 to 15,18 to 19,21,29,33,41 to 44,46,50,56 to 96,98 to 102,119 to 124,126 to 136,139 to 176,178 to 190,194 to 201,206 to 243,247,249 to 259,261 to 267,269 to 290,292-295 is identical with 296 fit binding ability.In another embodiment of invention, fit structure, and/or with IgE bonded ability with comprise any sequence number 11 to 15,18 to 19,21,29,33,41 to 44,46,50,56 to 96,98 to 102,119 to 124,126 to 136,139 to 176,178 to 190,194 to 201,206 to 243,247,249 to 259,261 to 267,269 to 290,292 to 295 with 296 fit identical.In specific embodiment, provide according to any sequence number 11 to 15,18 to 19,21,29,33,41 to 44,46,50,56 to 96,98 to 102,119 to 124,126 to 136,139 to 176,178 to 190,194 to 201,206 to 243,247,249 to 259,261 to 267,269 to 290,292 to 295 and 296 fit.In some particular embodiment, provide according to any sequence number 101,157 181,216,293 to 295 and 296 sequence.In another embodiment, the fit promoting agent that is used as in the pharmaceutical cpd in the invention.In another embodiment, form the fit fit or composition of the present invention and be used for the treatment of heredity anaphylactic disease or function discomfort, as allergic rhinitis (pollinosis), hereditary allergic dermatitis, asthma, acute rubella, food anaphylaxis, peanut allergy, general anaphylaxis reaction, anaphylaxis conjunctivitis, spring keratoconjunctivitis, the heredity anaphylaxis conjunctivitis, huge nipple conjunctivitis and eosinocyte gastroenteritis.
[00150] in some embodiments, aptamer therapeutics agent of the present invention and target spot have very strong avidity and specificity, and aptamer therapeutics agent simultaneously can be decomposed in patient or study subject body, then can reduce the nucleosides toxic side effect that non-operation of nature replaces.In some embodiments, the therapeutic composition that comprises aptamer therapeutics agent of the present invention is not fluoridized nucleosides, or a spot of nucleosides of fluoridizing is arranged.
[00151] of the present invention fit by using any oligonucleotide synthetic technology synthetic, technology comprise the solid phase oligonucleotide synthetic technology that has been widely known by the people on the technology (referring to people's such as people's such as Froehler document Nucl.Acid Res.14:5399-5467 (1986) and Froehler document Tet.Lett.27:5575-5578 (1986)) and the liquid phase synthesizing method (referring to people's such as people's such as Sood document Nucl.Acid Res.4:2557 (1977) and Hirose document Tet.Lett., 28:2449 (1978)) of Li Siyate synthetic method.
Contain the fit of immune motif
[00152] the invention provides and combine and regulate the fit of its biological function with IgE.The present invention especially provides and can disturb IgE and IgE acceptor, and Fc ε RI bonded is fit, thereby has hindered the anaphylaxis of IgE mediation.The result of treatment that this class is fit can combine with IgE and contains the fit of immunne response or immunomodulatory motif and further reinforcement by screening, also can be attached to fit on the IgE and further be strengthened, combine with immunne response and/or immunomodulatory sequence on the target spot with the fit IgE that links to each other by processing.
[00153] vertebrate immune system is based on identification (" CpG motif ") to the CG dinucleotides that do not methylate under the particular sequence background to the identification of bacillary DNA.An acceptor discerning this motif is Toll sample receptor 9 (" TLR9 "), is one of in the member (about 10 members) of Toll sample receptor family.Toll sample acceptor participates in innate immune responses by the special bacillary composition of identification.TLR9 combines in a kind of sequence specific mode with the oligonucleotide that do not methylate (" ODN ") CpG sequence.The identification of CpG motif has triggered and has caused and the innate immune response defense mechanism finally obtained immunne response.For example, activate that TLR9 will cause the activation that antigen presents cell in the mouse body, the rise of I and II class MHC molecule and importantly regulate the expression that molecule and cell kinase comprise IL-12 and IL-23 etc. altogether.This activation all directly or be situated between to connect and strengthened B and t cell response comprises the strong rise of TH1 cell kinase IFN-γ.All, replying of CpG sequence caused: resist catching, improve immune response,, improve the cell kinase of antibody-dependant cell mediation the asthma effective response to vaccine.Therefore CpG ODNs can resist infectious diseases, play immune booster action or cancer therapy effect (separately therapy with or the other drug conjoint therapy), and can reduce asthma and anaphylaxis.
[00154] fit one or more CpG or other immunity triggering sequence, the SELEX that uses in this narration of comprising of the present invention TMProcess can be identified or generate by multiple strategy.Usually, these strategies can be divided into two groups.For first group, strategy is to contain the fit of CpG motif or other immune sites of triggering sequence and combining with target spot at evaluation or generation.This target spot (being used as " non-CpG target spot " afterwards) is not that known identification CpG motif or other immunity trigger sequences and in case combines the target spot of CpG motif with regard to challenge.In some working of an invention schemes, non-CpG target spot is IgE.First kind of strategy of this group comprises and carries out SELEX TMAcquisition is to specific non-CpG target spot, preference such as IgE target spot fit, wherein immune response is relevant with advancing of disease, what use is that the CpG motif has been added among its each member, as or part as the oligonucleotide library of FX, for example in certain embodiments, oligonucleotide library member's random areas comprises the FX that has added the CpG motif, and identification has comprised the fit of CpG motif.Second kind of strategy of this group comprises and carries out SELEX TMTo obtain to specific non-Cp target spot, preference such as IgE target spot fit, here immunne response is relevant with disease progression, subsequently the CpG motif is selected to be increased to 5 ' and/or 3 ' end-blocking or add the CpG motif to a fit zone, preferred nonessential zone by the engineering science method.The third strategy of this group comprises and carries out SELEX TMTo obtain to specific non-CpG target spot, preferably the IgE target spot is fit, here immunne response is relevant with disease progression, wherein in the process of synthetic library, the mol ratio of different IPs thuja acid is partial to one or more and is planted Nucleotide adding step, so each member's randomization zone enrichment CpG motif in the storehouse, and identification has comprised the fit of CpG motif.The 4th kind of strategy of this group comprises and carries out SELEX TMTo specific non-CpG target spot, preferably the IgE target spot is fit with acquisition, and here immunne response is relevant with disease progression, and identification has comprised the fit of CpG motif.The 5th kind of strategy of this group comprises and carries out SELEX TMAcquisition is to specific non-CpG target spot, preferred IgE target spot fit, here immunne response is relevant with disease progression, and discerns and do not comprise the CpG motif, but after combination, can immune response stimulating fit.
In [00155] second group, strategy be at identify or generate comprise CpG motif and/or other by the acceptor of CpG motif (as, TLR9 or other toll shape acceptors) bonded and trigger sequence fit of immunne response.First kind of strategy of this group comprises and carries out SELEX TMAcquisition can trigger that sequence combine with CpG motif or other immunity and immune stimulatory is replied target fit of generation to known, use the CpG motif be added among each member as or part as the oligonucleotide library of its FX, for example in certain embodiments, oligonucleotide library member's random areas comprises the FX that has added the CpG motif, and identification has comprised the fit of CpG motif.Second kind of strategy of this group comprises and carries out SELEX TMAcquisition is fit to the known target that can combine with CpG motif or other immunity triggering sequences, this combination is in case take place can immune response stimulating, then the CpG motif is added to fit 5 ' and/or 3 ' terminal or with its engineering construction to fit a kind of zone, in the preferred nonessential zone.The third strategy of this group comprises and carries out SELEX TMAcquisition is fit to the known target that combines with CpG motif or other immunity triggering sequences, this combination is in case take place can immune response stimulating, wherein, in the building-up process of oligonucleotide library, the mol ratio of different IPs thuja acid is partial to one or more Nucleotide and is added step, make the randomization zone enrichment CpG motif of each member in the storehouse, and identification has comprised the fit of CpG motif.The 4th kind of strategy of this group comprises and carries out SELEX TMAcquisition triggers the fit of target that sequence combines to known and CpG motif or other immunity, and this combination is in case take place can immune response stimulating, and identification has comprised that CpG's is fit.The 5th kind of strategy should organizing comprises and carries out SELEX TMCombine with the CpG motif or fit with other immunity triggering sequence bonded targets known obtaining, and discern fit, though this fit CpG motif that do not comprise, still, in case combination is replied with regard to immune stimulatory.
[00156] identified many inhomogeneous CpG motifs, as long as each identifiedly will trigger multiple different reaction, the release of cytokine and other molecules, the activation of certain cell type.Referring to document CpG Motifs m Bacterial DNA and Their Immune Effects, Annu.Rev.Immunol.2002,20:709-760, the document is all incorporated this paper by quoting as proof here.The immunity that United States Patent (USP) has subsequently also disclosed other triggers motif, and each document is all incorporated this paper into by quoting as proof at this: United States Patent (USP) the 6th, 207, No. 646; United States Patent (USP) the 6th, 239, No. 116; United States Patent (USP) the 6th, 429, No. 199; United States Patent (USP) the 6th, 214, No. 806; United States Patent (USP) the 6th, 653, No. 292; United States Patent (USP) the 6th, 426, No. 434; United States Patent (USP) the 6th, 514, No. the 6th, 498,148, No. 948 and United States Patent (USP).Any of these CpG motif and other immunity trigger motifs all can be attached to fit in.Fit selection is decided by the disease or the dysfunction of treatment.Preferred immunity triggers motif following (from left to right be 5 ' to 3 '), and wherein " r " refers to purine, and " y " refers to pyrimidine, and " X " refers to nucleosides arbitrarily: AACGTTCGAG (sequence number 4); AACGTT; ACGT, rCGy; RrCGyy, XCGX, XXCGXX, and X 1X 2CGY 1Y 2, X wherein 1Be G or A, X 2Not C, Y 1Not G and Y 2Preferred T.
[00157] in CpG motif and fit bonded embodiment, fitly be attached on the special target spot rather than known and CpG motif bonded target spot (non-CpG target spot), this initiation immunne response, CpG is preferably placed at fit nonessential zone.Rite-directed mutagenesis can be passed through in fit nonessential zone, and deletion is analyzed and/or replaced and analyzes to determine.Yet the localization method of the fit and non-CpG targeted integration of any unconspicuous influence ability all can use.The CpG motif also is increased to 5 except being positioned at fit internal sequence ' and 3 ' or be attached to fit on.As long as the fit ability that is attached to non-CpG target spot is not subjected to significant change, can locatees by any way and adhere to.
[00158] as used herein, the meaning of " stimulation of immunne response " can be (1) special reply induce inducing that (what for example ThI replied induces) or certain molecule produce; Or the prevention or the inhibition of (2) specific reaction (prevention or inhibition Th2 reply) or some molecule.
Pharmaceutical composition
[00159] invention also comprise contain can with the pharmaceutical composition of the fit molecule of IgE bonded.In some embodiments, these compositions are more suitable for interior usefulness, comprise the compound that pharmaceutical activity is arranged of the present invention of effective dose, and independent same or a plurality of pharmaceutical acceptable carriers are used in combination.Especially because the hypotoxicity of compound makes it very useful.
[00160] composition of the present invention can be used for treatment, and prevention and/or improvement pathology such as disease or dysfunction, also can alleviate these diseases patient's symptom.Can be used for treatment such as composition of the present invention, disease or dysfunction that prevention and/or improvement are relevant with the heredity anaphylactic disease, as causing by IgE or relative disease: allergic rhinitis (ragweed fever), heredity supersensitivity allergic dermatitis, asthma, acute rubella, food anaphylaxis, peanut allergy, the general anaphylaxis reaction.
[00161] inventive composition can be used for suffering from patient's administration of (or tending to) certain disease or dysfunction, this disease or dysfunction with specific combination to invent fit target spot relevant or have it to cause.Inventive composition has the patient of pathology or a kind of method of main body as treatment, method relates to that to give one of patient or main body fit or contain fit composition with the IgE bonded, has treated pathology thereby the fit IgE of combining has changed the biological function of target spot.
[00162] patient or the main body of pathology are arranged, that is, patient or main body that inventive method is handled can be vertebrates, especially Mammals, especially people.
[00163] in fact, fit or its medicine salt of holding all is administration under it can be with the dosage of performance biologic activity, suppresses promptly that IgE is fit to be combined with acceptor IgE.
[00164] Fa Ming one side has comprised the fit composition of the present invention that the therapy of the dysfunction that mediates with other treatment IgE is used together.Fit composition may comprise the fit of more than one.In certain embodiments, comprise more than one fit compositions of the present invention with another kind of composition administration, such as anti-inflammatory reagent, immunosuppressor, anti-virus reagent or similar agents.In a word, the available dosage shape of current known treatment reagent is suitable.
[00165] " combination therapy " (or " therapy altogether ") comprises the administration of the administration of the fit compound of the present invention and another kind of at least reagent.This reagent is as a part of specific therapy scheme, and purpose is to provide these pharmaceutical agents coefficient beneficial effect.The beneficial effect of combination therapy comprises but is not to be only limited to owing to pharmaceutical agent is united pharmacokinetics or the drug effect that use causes.These pharmaceutical agent Combined Preparation all carry out in the specified period (normally according to selected combination determine minute, hour, day or week).
[00166] " conjoint therapy " but generally be not to tend to two kinds or above these treatment reagent part as independent therapy scheme, thereby caused combination therapy of the present invention.Combination therapy comprises these treatment reagent administrations in order, that is, every kind of treatment reagent is at different time administrations, or these reagent, at least two kinds of reagent administrations simultaneously.Administration simultaneously can a realization, all is the capsule for preparing according to fixed ratio as giving one every kind treatment of study subject reagent, or gives a plurality of capsules that each capsule contains a kind of treatment reagent.
[00167] the sufficient administration of every kind of treatment reagent successive is subjected to the influence of any suitable pathways, includes but not limited to topical administration, and oral, vein gives, and muscle gives and pass through the direct absorption of mucous membrane tissue.Therapeutic dose can be by identical approach or different administrations.Such as, first kind of treatment reagent cocoa of selected combination is by the injection system administration, and the other treatment reagent of combination can pass through topical.
[00168] in addition, all treatment reagent all may topical administration or is given by injection.The special note unless the order of administration of treatment reagent is not strict." combination therapy " also comprises the administration of above-mentioned treatment reagent and gives uniting of activeconstituents with other biological.When combination therapy also comprised non-drug therapy, non-drug therapy can be implemented in any suitable time, as long as non-drug therapy combination therapy reagent acts on altogether and can produce beneficial effect.Such as, still effective after non-drug therapy is temporarily removed from treatment treatment reagent in certain embodiments, may continue several days even a few week.
[00169] therapeutic component of the present invention or pharmaceutical component generally comprise the activeconstituents of effective dose treatment, are dissolved in or are scattered in the medium that pharmacology can hold.Medium that pharmacology can be held or carrier also comprise any or all solvents, dispersion medium, and the clothing layer, antibacterium or fungi reagent wait a reagent or absorb to prolong reagent, or a class.People understand the medium that is suitable for this pharmacological active substance or the use technology of reagent very much.The activeconstituents that increases also can join in the therapeutic component of the present invention.
[00170] in view of the disclosure here, those skilled in the art be perfectly clear pharmacopedics or pharmacology preparation of compositions.Typically, these compositions can be prepared into injectable, perhaps liquor or suspension; Can dissolve or be suspended in the solid reagent of liquid before being fit to inject; Oral tablet or other solid reagents; Slow releasing capsule; Or other forms of current use, comprise eye drop, emulsion, washing lotion, ointment, inhalation or similar.The surgeon, the use of physician or hygiene and health worker sterilization method is washed such as salt, and handle specific field of operation may be particularly important.Composition also can pass through micro device, and particulate or gauze come administration.
[00171] treatment reagent will according to the corresponding to mode of prescribed dose, administration under the dosage that can play pharmacotoxicological effect.Scheme can as above-mentioned Injectable solution type, but also can be used medicament slow release capsule or similar type at an easy rate with the enforcement of multiple different dosage form.
[00172] under this background, the volume of the amount of activeconstituents and the composition that gives depends on host animal to be processed.The accurate amount that the required active compound of administration needs depends on judgement that the executive does and because of individual different variant.
[00173] uses the composition of the volume of the needed minimum of dispersed activity compound usually.Though suitable dosage regimen is also different, typical dosage regimen is to carry out compound administration and monitoring result earlier and then by further control drug dose on the certain time interval.
[00174] for example, to the oral administration of tablet or capsule (for example gelatine capsule) form, active pharmaceutical ingredient can with ethanol, glycerine, the interior carrier administration together that water or this class can oral non-toxicity pharmacology can be held.And, also can in mixture, add suitable connector, lubricant, disintegrating agent and tinting material as required.Suitable connector comprises starch, manganous silicate aluminium, starch paste, gelatin, methylcellulose gum, Xylo-Mucine and/or polyvinylpyrrolidone, for example natural sugar of glucose and beta-lactose, the corn sweetener, natural or synthetic resins, as gum arabic, tragacanth or sodiun alginate, polyethylene glycol, wax or this type of.Employed lubricant comprises sodium oleate in these formulations, sodium stearate, and Magnesium Stearate, sodium benzoate, sodium-acetate, sodium-chlor, no silhydrite, talcum, stearic acid and magnesium thereof or calcium salt and/or polyoxyethylene glycol, and this type of.Disintegrating agent comprises, but is not limited to, starch, and methylcellulose gum, agar, clay, xanthan resin starch, alginic acid and sodium salt thereof, or give birth to bubble mixt and this type of.Thinner comprises lactose, glucose, sucrose, seminose, mountain plough sugar, Mierocrystalline cellulose and/or Padil.
[00175] inventive composition can be the oral dosage form administration, as timing release and continuous release tablet or capsule, pill, medicinal powder, particle, tincture, suspension, syrup and emulsion.Suppository can prepare from lipomul or suspension.
[00176] there is the composition of pharmacologically active sterilized and/or comprise assistant agent, as sanitas, stablizer, humectant or emulsifying agent, chaotropic agent is regulated the salt and/or the damping fluid of osmotic pressure.In addition, pharmaceutical cpd also comprises other materials that pharmacotoxicological effect is arranged.Pharmaceutical composition mixes by traditional method, granulation, and dressing is prepared, and activeconstituents is typically and accounts for 0.1% to 75%, preferably accounts for 0.1% to 75%.
[00177] liquid, especially Injectable composition can disperse to wait to prepare by for example dissolving.Active composition is dissolved in or is mixed in the neat solvent on the pharmacopedics, as, water, salts solution, Glucose Liquid, glycerine, ethanol etc., thus form Injectable solution or suspension.In addition, also can be made into the solid that is dissolved in before being adapted at injecting in the liquid.
[00178] composition of the present invention can be at intravenously (bolus and inculcate), intraperitoneal, the form administration of subcutaneous or intramuscular injection.These several forms all are pharmaceutically known ordinary skills.Injectable can be prepared with the mode of liquor or the form of suspension in the conventional mode.
[00179] the parenteral administration is generally used for subcutaneous injection, intramuscular injection or intravenous injection and inculcate.In addition, a kind of method of parenteral administration has been used inculcating of slow release or sustained release system, has guaranteed that medicine maintains a constant concentration, and according to United States Patent (USP) the 3rd, 710, No. 795 described, and here this patent is incorporated in full by quoting as proof.
[00180] in addition, preferred composition of the present invention can use the known mode of those of ordinary skills by suitable nose instrument, sucker nose topical, or pass through the transdermal patch form by corium approach intranasal administration.Skin patch all is known skill in this field by the transdermal route administration.Use the form administration of corium haulage system, dosed administration should be successive rather than interruption in the whole dosage.Other preferred topical formulations comprise emulsion, ointment, and lotion, aerosol and gelinite, wherein the activeconstituents typical concn is 0.01% to 15%, in w/w or the w/v scope.
[00181] for solids composition, vehicle comprises seminose, lactose, starch, Magnesium Stearate, saccharification sodium, talcum powder, Mierocrystalline cellulose, glucose, sucrose, magnesiumcarbonate and other.Above defined active composition can use suppository as carrying agent, and polyglycol just uses suppository as carrier, for example propylene glycol.In some embodiments, suppository is easy to prepare from lipid acid emulsion and suspension.
[00182] present composition also can pass through the administration of liposome transfer system, such as little single vesica, and big single vesica, many vesicas.Liposome can form by multiple phosphatide, comprises cholesterol, stearyl alcohol or Yelkin TTS.In some embodiments, the lipid composition film combines with the aqueous solution of medicine and forms the lipid layer packaging medicine, at United States Patent (USP) the 5th, 262, this description is arranged in 564.Such as, the fit molecule described here formation mixture that can link to each other with lipophilic compound by using known method construct or non-immunogenic high-molecular weight compounds.At United States Patent (USP) the 6th, 011, provide the example of a nucleic acid related complex in 020.
[00183] composition of the present invention also can be used as the target medicine carrier and links to each other with soluble polymer.Such polymkeric substance comprises polyvinylpyrrolidone, pyran co-polymer, poly-hydroxypropyl ammonia-Methacrylamide-phenol, the polyethylene Methionin that poly-hydroxy ethylamino phenol residue replaces.In addition, composition of the present invention can be connected on the biodegradable polymkeric substance of class energy, help realizing that controlled delivery of pharmaceutical agents discharges, such as, poly(lactic acid), poly-epsilon-caprolactone, poly-hydroxy butyric acid, poe, polyacetal (resin), poly-dihydroxyl pyrans, polyacrylate and crosslinked or amphoteric gel copolymer.
[00184] pharmaceutical composition of being given also can comprise the material that has no side effect in a small amount, as humectant, and emulsifying agent, the substrate of pH buffer reagent and other for example sodium-acetate and Triethanolamine 99(TEA 99) oleate.
[00185] uses the fit scheme of making up a prescription to select, comprise type, kind, age, weight, sex and patient's health check-up situation according to series of factors; The severity that needs treatment; Route of administration; Patient's liver function and kidney merit; The specific fit and salt that uses.Common doctor who is skilled in technique or animal doctor can be easy to determine and point out treatment, prevention, prediction or delay the effective dose that the state of an illness needs medicine.
[00186] if oral dosage of the present invention is used to show drug effect in the scope of oral 0.05-7500mg every day.Composition preferably provides with the form of mark tablet, wherein contains 0.5,1.0,2.5,5.0,10.0,15.0,25.0,50.0,100.0,250.0,500.0 and the activeconstituents of 1000.0mg.Inculcate consumption, consumption and corium absorb consumption in the 0.05-7500mg/day scope in the nose.Subcutaneous, the consumption of vein and abdominal cavity film is then in the 0.05-3800mg/day scope.
[00187] the effective plasma level level of The compounds of this invention is in 0.002mg/mL to 50mg/mL scope.
[00188] compound of the present invention is with once a day dosage form administration, or with every day total dose be divided into twice, three time or four administrations.
The pharmacokinetics of aptamer therapeutics reagent and bio distribution are regulated
[00189] the very important point is, based on the treatment that comprises fit oligonucleotide, its pharmacokinetic properties should be complementary with the medicinal application of expectation for all.Do not relate to the difficulty that transportation is relevant in the cell (antianaphylaxis and be exactly example based on the treatment of MAi) at extracellular target spot fit, this class is fit still to be scattered in target organ or tissue, or stay in the body in period at one end (not modified), consistent with ideal dosed administration scheme.
[00190] the invention provides influence fit component drugs dynamic (dynamical) material of generation and method, the ability of regulating fit pharmacokinetics particularly is provided.The regulating power of fit pharmacokinetics (that is adjustment capability) can be by being attached to modification group (as the PEG interpolymer) fit and/or obtaining with the chemical ingredients that changes Nucleotide in conjunction with modified nucleoside (as 2 '-fluorine or 2 '-oxygen-methyl).The ability of regulating fit pharmacokinetics is used to improve existing medicinal application, perhaps the novel drugs application and development.For example, in the practical application of some medicines, in the anti-new life or critical care disposal that remove medicine at needs fast, it is in demand reducing the fit residence time in circulation.In addition, in the practical application of some medicines, as, need drug system round-robin supportive care, increase fit in circulation hold time necessary.
[00191] in addition, the regulating power of fit pharmacokinetics also is used to regulate fit medicine in the intravital bio distribution of study subject.For example, in the application of some medicines, need to change fit medicine bio distribution in vivo with target in specific tissue or organ (or one group of organ).In these were used, fit medicine gathered in particular organization or organ.In the application of other medicines, need target in present cell marker or with the target tissue of disease related symptom, the target tissue of cell injury or other pathologies is arranged, help fit medicine like this and in affected tissue, build up.As U.S.'s non-provisional application of No. 60/550790 called after of U.S. Provisional Application " aptamer therapeutics agent pharmacokinetics and chorologic regulating and controlling " that propose on March 5th, 2004 and proposition on March 7th, 2005 number: 10/---, the PEGization product of the fit medicine of description in---" aptamer therapeutics agent pharmacokinetics and the chorologic regulating and controlling " by name (as, connect a polymeric PEGization product of 20kDa PEG) be used for target in inflammatory tissue, thus help the accumulation of fit medicine in inflammatory tissue of PEGization.
[00192] for determining the pharmacokinetics and the bio distribution image of fit medicine (as fit linker or contain the fit of chemically modified taken place, as modified nucleoside), various parameters have been monitored.These parameters comprise, for example, and the transformation period (t of aptamer therapeutics agent 1/2), plasma clearance (Cl), volume of distribution (Vss), area under the concentration-time curve (AUC), maximum serum-concentration or plasma concentration (C Max), and average retention time (MRT).Wherein " AUC " refers to after fit drug plasma concentration-fit administration long-pending below the time image.The AUC value is used to estimate the total body clearance (Cl) (that is the ratio of fit medicine removing from circulation) of the bioavailability (that is the per-cent of fit medicine in circulation behind the fit drug administration) and the fit medicine of giving.Volume of distribution connects fit total amount in fit drug plasma concentration and the body.Vss is big more, easy more in blood plasma, find fit.
[00193] the invention provides with the pharmacokinetics of the fit composition of stabilized processing in the control mode control agent and the material and the method for bioavailability, by fit being connected to regulated on the group, as small-molecule substance, peptide, or polymer end groups, or dose modified nucleoside in fit.This said connection modification group and/or change the nucleosides chemical ingredients aspect basic, changed fit circulation residence time and in tissue.
[00194] few glycosides nucleic acid drug is removed except being modified to remove also to filter by kidney by nuclease.Therefore the normally intravenous injection of administration of the few glycosides nucleic acid of nuclease-resistant is not hindered if filter, and the transformation period was less than 10 minutes in the body of its demonstration.Can make it surpass the renal glomerulus free area to realize hindering filtration by promoting blood flow to be distributed into tissue fast or increase few glycosides nucleic acid molecule surface-area.Following small-molecule drug is connected to (PEGization product) can prolong the fit residence time in circulation significantly on the PEG polymkeric substance, thereby has reduced administration number of times and strengthened effectiveness the blood vessel target spot.
[00195] fitly can connect multiple modification group-high-molecular weight polymer, as, PEG, peptide, Tetanus Antitoxin (proteic 13 amino acid fragment (Vives of HIV Tetanus Antitoxin for example, Deng people (1997), J.Biol.Chem.272 (25): 16010-7)), Ant is (from 16 aminoacid sequence (Pietersz of the 3rd spiral of fruit bat feeler dna homolog albumen, Deng people (2001), Vaccme 19 (11-12): 1397-405)), vaccine 19 (11-12): 1397-405)) and arginine 7 (the permeable peptide of going into cell of the positive electric charge of the band of a weak point, (Arg7) forms by poly arginine) (Rothbard waits people (2000), Nat.Med.6 (11): 1253-7; Rothbard, people such as J (2002), J.Med.Chem.45 (17): 3612-8)), and small molecules, as lipophilic mixture cholesterol.Above-mentioned these multiple connectors are because the compound action of PEG group makes fit characteristic in vivo that very big variation all take place.For example, the fit filtration that hinders kidney that is connected with 20kDa PEG polymkeric substance that 2 ' F and 2 '-oxygen-methyl is modified has promoted the distribution of health tissues and inflammatory tissue.And 20kDa PEG polymkeric substance-fit linker almost is the same with the interception that 40kDa PEG polymkeric substance-fit linker is played when being filtered off through kidney.Although an effect of PEGization product is in the fit removing,, thereby fit distribution in tissue, especially HT organ and inflammatory position have been promoted because the appearance of 20kDa group has prolonged the fit residence time in system.20kDa PEG polymkeric substance linker is transported to the inflammatory position with fit orientation, and fit just being easy to of PEGization gathered in inflammatory tissue.In some instances, the fit connection physical efficiency of 20kDa PEGization arrives cell interior, as kidney cell inside.
[00196] modified nucleoside can be used for regulating fit plasma clearance.As, with not modified fit comparing, combine 2 '-F and 2 '-OMe stablize chemical substance and be not connected fit (owing to all shown very high nuclease stability with external in vivo, be fit typical case's representative of this generation at present) showing can be fast from plasma clearance (promptly, quick plasma clearance) also is distributed into tissue, especially nephridial tissue fast.
PEG deutero-nucleic acid
[00197] as above-mentioned, the nucleic acid derivative that has a non-immunogen polymkeric substance of high-molecular weight the change pharmacokinetics of nucleic acid and the potentiality of drug effect characteristic make it become effective therapeutical agent.Useful variation comprises the ability that has increased the opposing nuclease degradation on the activity, has reduced the filtration of kidney, has reduced the appearance in immunity system, has changed medicine bio distribution in vivo.
[00198] Fa Ming fit composition can be derived from polyethers (" PAG ").Find in No. the 10/718th, 833, the patent application that the example of PAG derivative nucleic acids can propose on November 21st, 2003, this application is incorporated this paper in full by quoting as proof here.Use representative polymers to draw together polyoxyethylene glycol (" PEG ") in the invention, also be considered to polyethylene oxide (" PEO "), and glycol polypropylene (comprising poly-sec.-propyl ethylene glycol).In addition, in multiple application, can be at random or block the multipolymer of different hydrocarbyl oxides (as ethylene oxide and propylene oxide).Modal form, polyglycol (as polyoxyethylene glycol) is a line polymer, each end ends at alkyl: HO-CH 2CH 2O-(CH 2CH 2O) n-CH 2CH 2-OH.This polymkeric substance α-, Ω-dihydroxy polyoxyethylene glycol, available HO-PEG-OH representative, wherein the PEG-form is represented following structure unit :-CH 2CH 2O-(CH 2CH 2O) n-CH 2CH 2-, wherein the span of n is 4 to 10,000.
[00199] the PEG molecule is bifunctional, is called as the PEG glycol sometimes.The relative non-reaction oh group of PEG molecular end part (OH), can be lived by base or is converted into functional group, be convenient to PEG or other compositions reaction site in mixture and connect.This activated PEG glycol is called two PEGs of activation at this.For example, (OH), the end group of PEG glycol is activated, and plays the effect with amino acid group selective reaction activated carbon acid esters to replace relative non-reaction oh group by succinimide active ester group in the use N-hydroxy-succinamide.
[00200] in a lot of the application, need add the PEG molecule that cap makes at the essential non-reactive group end of PEG molecule becomes single function (or single activation).Pharmaceutical grade protein shows a plurality of reaction site usually to activated PEGs, and difunctional activated PEGs causes cross connection widely, produces functional group seldom.For generating single PEGs of activation, the hydroxyl of PEG glycol molecules end is by non-reaction methyl end groups group-OCH 3Replace.The not capped end of PEG molecule is converted into reactive end, can be activated so that the reaction site of protein molecule on the surface connects.
[00201] PAGs has good solubility in the aqueous solution and organic solution, nontoxicity, the polymkeric substance of non-immunogenicity.PAGs can make PAG-molecule linker become soluble to insoluble molecule with polymer is covalently bound.For example, water soluble drug Japanese yew AlcoholBe connected to just become on the PEG water miscible.People such as Greenwald, J.Org.Chem.60:331-336 (1995).The PAG linker not only is used for increasing solvability and stability also is used to prolong the transformation period of molecule in blood circulation.
[00202] the representational size of poly-alkylate of the present invention is between 5-80kDa, although can use any size, and still will be according to fit and should be used for determining.Other PAG mixture sizes of invention are between 10-80kDa.The PAG mixture size that also has other inventions is between 10-60kDa.For example, a PAG polymer size may be 10,20,30,40,50,60 at least, or 80kDa.This polymer can be linearization or ramose.In some embodiments, polymer is PEG.In some embodiments, polymer is the PEG of branch.In other embodiments, as described in Figure 3, polymkeric substance is the side chain PEG of 40kDa.In some embodiments, as described in Figure 4, the side chain PEG of 40kDa is connected to 5 fit ' end.
[00203] compare with biological protein medicament, nucleic acid drug is typically from activated monokaryon glycosidation and learns synthetic.PEG-nucleic acid linker can the monomer synthetic method prepares in conjunction with PEG by using repeatedly.For example, activate PEGs by changing into the deoxynucleoside phosphoramidite form, join then the solid phase oligonucleotide synthetic in.Perhaps, oligonucleotide is synthetic is by add reaction PEG binding site at specific site.Modal be by 5 '-the terminal main free amino acid (in the last Connection Step of solid phase synthesis, use modify deoxynucleoside phosphoramidite add) that adds.In this way, reaction PEG (will form connecting key with the amino acid reaction after the activation) is connected on the oligonucleotide of purifying, and ligation is carried out in solution.
[00204] it is relevant with several factors that the PEG linker changes the chorologic ability of medicine, comprises the surface size (measuring with the term hydraulic radius) of linker.Big linker (＞10kDa) the known kidney that can effectively stop filters, thus increase little polymer plasma half-life (being peptide, the antianaphylaxis oligonucleotide).The PEG linker stops filterable ability to be proved along with the PEG size is increased to about 50kDa and increases (further increase the beneficial effect that has only seldom, the transformation period becomes the removing decision by macrophage-mediated metabolism decision rather than kidney).
[00205] (＞10kDa) generation is difficult to high molecular weight PEGs s, inefficiency, and costing an arm and a leg.As an approach of synthetic macromolecule amount PEG nucleic acid linker, previous work purpose concentrates on and generates higher molecular weight activated PEGs.A kind of method that generates this molecule comprises the formation activated PEG of branch, and wherein two or more PEGs are connected to and have the centronucleus that activates group.The terminal portions of these high molecular weight PEGs molecules (OH), can activate or be converted into functional group, so that one or more PEGs is connected on the reaction site of other compositions as relative non-reaction hydroxyl.Ramose activatory PEGs can be more than two action sites.When two or more ends are activated, this activated high molecular weight PEGs molecule is called the PEGs of activation at this more.In some cases, not all action site all is activated in the ramose PEGs molecule.PEG molecule under the situation about all being activated in any two sites is called as two PEGs of activation.Having only under the site activated situation, this PEG molecule is called as single PEGs of activation.An example of this approach is, prepares activation PEG to the Methionin center by connecting mono methoxy PEGs, and this center is activated and is beneficial to subsequent reaction people such as (, Nature, vol.2:214-221,2003) Harris.
[00206] the invention provides the cost-effective route of another kind of synthetic macromolecule amount PEG-nucleic acid linker (preferred, fit), comprise many PEGization nucleic acid.The present invention also comprises the general-purpose oligonucleotide that PEG-connects, and is fit as dimerization.The present invention is relevant with the high molecular composition, and the group of the stabilized processing of PEG separates according to different ratios fit as joint in the said composition.Be connected in the fit sequence as PEG, the linear combination of the fit composition of high molecular is nucleic acid-PEG-nucleic acid (a PEG-nucleic acid) n, wherein n is more than or equal to 1.
[00207] Fa Ming high molecular composition comprises the molecular weight composition of 10kDa at least.Representational composition molecular weight size is between 10 to 80kDa.The high molecular composition of invention is 10,20,30,40,50,60 at least, or the 80kDa size.
[00208] group of stabilization treatment is the part of a molecule or molecule, has improved fit pharmacokinetics of high molecular of the present invention and pharmacodynamic profiles.In some cases, the group of stabilization treatment is the part of a molecule or molecule, can two or more fit or fit zone is approaching mutually, or total rotational freedom of the fit composition of minimizing invention high molecular.The group of a stabilization treatment can be poly-alkyl ethylene glycol, polyoxyethylene glycol for example, and this polyoxyethylene glycol can be linear or ramose, homopolymer or heteropolymer.The group of other stabilization treatment comprises for example peptide nucleic acid(PNA) (PNA) of peptide.Oligonucleotide can be the group of stabilization treatment; This oligonucleotide can comprise modified nucleoside, and/or the modification of thiophosphoric acid lipid connects.The structure of a stabilization treatment can be the complete part of a fit composition, and is promptly covalently bound on fit.
[00209] inventive composition comprises the fit composition of high molecular, and wherein two or more nucleic acid group is covalently bound at least one poly-alkyl ethylene glycol group.Poly-alkyl ethylene glycol group plays the effect of stablizing group.The poly-any end of alkyl ethylene glycol group is covalently bound to fit in composition, and poly-like this alkyl ethylene glycol group couples together nucleic acid in a molecule.Someone says that poly-alkyl ethylene glycol group is a linking group.In such composition, the basic structure of covalent molecule comprises the nucleic acid-PAG-nucleic acid of linear array.The composition that comprises basic structure nucleic acid-PAG-nucleic acid is exactly an example.Another example is the nucleic acid-PEG one nucleic acid-PEG-nucleic acid of linear array.
[00210] in order to generate nucleic acid-PEG-nucleic acid linker, first nucleic acid so just provides a reaction site (promptly single the activation).In preferred embodiments, this reaction site is a 5 ' terminal amino acid group, and it is introduced by dose the modification deoxynucleoside phosphoramidite in the final step of oligonucleotide solid phase synthesis.Behind deprotection and the purifying modified oligonucleotide, regeneration in the solution that can reduce activated PEG spontaneous hydrolysis of high density.In preferred embodiments, oligonucleotide concentration is 1mM, and regeneration soln concentration comprises 200mM damping fluid and NaHCO 3Damping fluid, the synthetic of pH8.3. linker causes by adding highly purified two PEG of activation slowly.In preferred embodiments, the PEG glycol is by activating deriving of two ends succinimide propionic salt.After the reaction, PEG nucleic acid linker goes out complete linker by gel electrophoresis or liquid chromatography purifies and separates, part linker and disconnected body.Many PAG molecule (at random or block copolymer) or little PAG chain can be connected to obtain different length (or molecular weight).Non-PAG joint can be used between the PAG chain of different lengths.
[00211] 2 '-the O-methyl, 2 '-fluorine and other modified nucleosides modifiers have stablized the ability of fit opposing nuclease degradation, have prolonged the transformation period in the body.3 '-3 '-the dT cap also increased the resistibility of exonuclease.Referring to United States Patent (USP) the 5th, 674, No. 685; The 5th, 668, No. 264; The 6th, 207, No. 816 and the 6th, 229, No. 002, wherein each is all quoted as proof at this and is incorporated in full this paper.
The PAG derivative of reactive nucleic acid
[00212] high molecular PAG-nucleic acid-PAG linker can prepare with the reaction that contains a plurality of reaction site nucleic acid by the PEG of single function activation.In embodiments, nucleic acid be two reactions or two activated contain a plurality of reaction site: by traditional deoxynucleoside phosphoramidite synthetic method be incorporated on the oligonucleotide one 5 '-amino acid group and one 3 '-amino acid group, for example: shown in Figure 53 ', 5 ' two PEGization products.In other embodiments, can introduce reaction site in inside, as the 5th of pyrimidine, the 8th of purine, or main amino acid whose binding site is introduced in 2 ' site of ribose.In these embodiments, nucleic acid can have several activated or reaction site, and the someone says and can be activated more.Behind the synthetic and purifying, also reduced under the condition of spontaneous hydrolysis simultaneously with the reaction of oligonucleotide reaction preference promoting, modified oligonucleotide is connected with unit point activated PEG.In preferred embodiments, single methoxy PEG is activated by the N-Hydroxysuccinimide propionic salt, and ligation is carried out at pH8.3.In order to promote the synthetic of two PEG of replacement, provide with respect to the excessive PEG of oligonucleotide metering.After the reaction, PEG-nucleic acid linker is isolated fully through gel electrophoresis or liquid chromatography, part and disconnected sample.
[00213] for the connecting zone that connects one or more polyglycol groups can be arranged here.This PAGs can have different length, also can be used in the suitable linker to obtain the composition of ideal differing molecular size.
[00214] effect of given joint can be subjected to the influence of its chemical ingredients and length.One is very long, very short or with joint that IgE forms unsuitable space structure and/or ionic linkage be the prerequisite that fit and IgE form complex body.If the distance that joint is longer than between the Nucleotide can reduce connection stability by the effective concentration that reduces part.Therefore, often be necessary to optimize joint composition and length so that fitly farthest be connected on the target spot.
[00215] all are all quoted as proof at this and are all merged and this paper at this patent of quoting and publication, just as each patent document and publication all by clear and definite quoting as proof and be incorporated in this paper one by one respectively.Quote publication and patent document and do not show that it is the prior art document, also do not show the perhaps approval on date in it.The present invention is described by the mode of written description, those skilled in the art will recognize that the present invention can put into practice in multiple different embodiments.The description of front and the following examples all be in order to set forth rather than to the restriction of claims.
Embodiment
Embodiment 1: fit screening and order-checking
Embodiment 1A: the h-IgE screening that " rRfY " IgE is fit
[00216] purifying and the people IgE (after this be " h-IgE ") that comes from human myeloma blood plasma are from Athens Technical Research Center (Athens, GA) purchase.Express and purifying T7MA polysaccharase (Y639F).2 '-F pyrimidine nucleoside and 2 '-OMe purine pyrimidine oligonucleoside all available from TriLmk BioTechnologies (San Diego, CA).Other common response reagent are commercial purchases.Use 2 '-OH purine and 2 '-therefrom filter out in F pyrimidine oligonucleotide (rRfY) storehouse and evaluation and h-IgE bonded fit.Carry out at the screening of h-IgE and to generate the high-affinity of h-IgE fit.
[00217] The sequence library preparation
Use ABI EXPEDITE TMDna synthesizer composition sequence 5 '-GGGAAAAGCGAATCATACACAAGAN4OGCTCCGCCAGAGACCAACCGAGAA-S ' (sequence number 5), adopt standard method to go protection.Template adopts primer 5 ' TAATACGACTCACTATAGGGAAAAGCGAATCATACACAAGA 3 ' (sequence number 6) and 5 ' TTCTCGGTTGGTCTCTGGCGGAGC 3 ' (sequence number 7) to increase, and amplified production uses T7 MA polysaccharase to carry out in-vitro transcription as template (Y639F).The condition of transcribing is 40mM Tris, 40mM DTT, 1mM spermidine, 0.002%TritonX-100,4%PEG-8000,12mM MgCl 2, 3mM 2 '-F-CTP, 3mM 2 '-F-UTP, 3mM GTP, 3mMATP, the template DNA about inorganic nucleotide pyrophosphatase of 0.01units/mL and T7 polysaccharase (Y639F) and 0.5 μ M.
[00218] ScreeningScreening beginning: under the room temperature with 2 * 10 142 of molecule '-ARC212 sequence library (5 ' GGGAAAAGCGAAUCAUACACAAGA-N that the F purine is modified 40-GCUCCGCCAGAGACCAACCGAGAA 3 ') the h-IgE protein of (sequence number 8) and 100 pmoles (1X SHMCK:20mM Hepes, 120mM NaCl, 5mM KCl, 1mM MgCl in final volume 100 μ L screening damping fluid 2, 1mM CaCl 2, pH7.4) cultivated one hour.The MA-protein complex uses 0.45 miniature nitrocotton column spinner (Schleicher﹠amp with the molecule that does not combine MA; Schuell, Keene NH) separates.Pillar will add in pillar and contain mixture: centrifugal 2 minutes of the solution washing of IgE mixture and 1500 * g then in advance with the damping fluid washing of 1mL IXSHMCK.Nutsche filter (is taken turns 2 * 400 μ L IX SHMCK with 400 μ L IXSCHMK washed twice to remove non-specific junction mixture; The back is several takes turns, 2 * 500 μ L IX SCHMK).Add 2 * 200 μ L lavation buffer solutions (3mMEDTA is preheating to 95 ℃ for 7M urea, 100mM sodium-acetate) washing MA.The back is several takes turns, and MA washs with 2 * 100 μ L lavation buffer solutions.
[00219] Xi Di protein is used phenol from the MA mixture: chloroform extraction, precipitation MA storehouse (2 μ L glycogen, 1 volume Virahol).Use 3 ' primer of sequence number 7 to use ThermoScript RT-PCR according to operation instruction TM(Mvitrogen, Carlsbad CA) carry out the MA reverse transcription.Use PCR (20mM Tris pH8.4,50mM KCl, 2mM MgCl 2, 0.5 μ M, 5 ' primer (sequence number 6), 0.5 μ M, 3 ' primer (sequence number 7), every kind of dNTP of 0.5mM, 0.05units/ μ L Taq polysaccharase (New Engl and Biolabs, Beverly, MA)) amplification cDNA.The PCR product uses QIAquick PCR purifying instrument, and (Qiagen, Valencia CA) carry out purifying.Use CX32P ATP to be marked in a large number under 37 ℃ and spend the night, transcribe template (4%PEG-8000,40mM Tris pH8.0,12mM MgCl 2, 1mM spermidine, 0.002%Triton x-100,3mM 2 ' OH purine, 3mM2 '-F CTP and UTP, 25mM DTT, inorganic nucleotide pyrophosphatase, T7MA polysaccharase (Y639F) 5 μ Ci α 32P ATP).(Prmceton Separations, Adelphia NJ) make the reactant desalination, and carry out purifying (8M urea, 10% acrylamide with the denaturing polyacrylamide gel of 1.5mm to use the Centrisep post according to instruction manual; 19: 1 acrylamides: bisacrylamide).
[00220] several methods of taking turns according to the first round subsequently repeat, and screen this step but increased in feminine gender.Before cultivating the protein target spot, the sequence that is connected with nutsche filter is removed through 0.45 micron nitrocotton Filter column in the MA storehouse, and filtrate enters the positive-selecting step.
[00221] when interchangeable wheel, the MA storehouse is through gel-purified.Add 50mM EDTA and finish responsive transcription, ethanol sedimentation uses denaturing polyacrylamide gel to carry out purifying then.(Schleicher and Schuell, Keene NH) remove in the device, and voltage 225V was IX TBE (90mM Tris, 90mM boric acid 0.2mM EDTA) a hour at Elutrap  through gel electrophoresis in the MA storehouse.The material of washing is by adding 300mM sodium-acetate and 2.5 volume of ethanol precipitation.
[00222] MA concentration will be kept above h-IgE in the whole screening.Protein concn is 1 μ M in beginning 2 is taken turns, and drops to lower concentration (table 1) in wheel subsequently.Beginning in four-wheel concentration is that the competitive tMA of 0.1mg/niL adds in the ligation liquid.When screening carried out 10 take turns after, mixture is divided into two parts.The 11a wheel carries out positive-selecting simultaneously, and the concentration ratio of mixture and h-IgE is 10: 1.The MA of 11b and 12b and h-IgE concentration ratio are 100: 1.Do like this in order to increase severity and filter out the more binding substances of high-affinity.Table 1 has comprised the screening details, the tMA concentration that the concentration that comprises the MA mixture, protein concn and each are taken turns, used feminine gender is screened and is obtained the needed PCR cycle number of single band (Mvitrogen at 4% sepharose, Carlsbad, CA), this band intensity is identical with the band intensity of 100bp dna ladder degree (48ng of DNA mass) contrast 100bp, during last sample according to the operation instruction (New Engl and the Biolabs that recommend, Catalog#N323 IL, Beverly, MA).
[00223] screening process is recently monitored by being determined at the percentage that washs out the MA mixture in the positive-selecting step from nitrocotton filters.
Each takes turns the condition of (rRfY) used table 1 screening
The wheel number The concentration of mixture (μ M) The protein type Protein concn (μ M) TRNA concentration (mg/mL) Negative screening step Eluting rate % Cycle number
1 3.3 h-IgE 1 0 none 2.44 10
2 ～1 h-IgE 1 0 NC 0.35 15
3 0.8 h-IgE 0.75 0 NC 1.02 13
4 ～1 h-IgE 0.75 0.1 NC 0.05 15
5 1 h-IgE 0.75 0.1 NC 3.80 10
6 ～1 h-IgE 0.5 0.1 NC 0.04 12
7 1 h-IgE 0.25 0.1 NC 3.27 8
8 ～0.5 h-IgE 0.125 0.1 NC 0.13 11
9 0.5 h-IgE 0.05 0.1 NC 3.07 8
10 ～0.5 h-IgE 0.05 0.1 NC 0.13 12
11a 11b 0.5 0.5 h-IgE h-IgE 0.05 0.005 0.1 0.1 NC NC 7.24 1.03 8 12
12b ～0.5 h-IgE 0.005 0.1 NC 0.39 12
[00224] The h-IgE binding analysis
Adopt dot hybridization to test in the whole screening and monitor proteinic avidity in the sequence library.Trace 32The MA storehouse of P mark combines with h-IgE, and at room temperature, is to cultivate 30mm among the 1X SHMCK damping fluid of 25 μ L and the 0.1mg/mL tMA in final volume.Mixture is applied to (from top to bottom) nitrocotton is housed, and nylon and gel spot film spot suction seal device (Schleicher and Schuell Mmifold-1 Dot Blot, Acrylic).Can filter acquisition by nitrocotton with the MA of protein bound, the MA with protein bound then filters acquisition on nylon.The positive ratio of MA bonded uses TOPO TA clone instrument (Mvitrogen, Carlsbad, CA) clone's mixture according to operation instruction when existing with respect to no h-IgE when having observed h-IgE and exist.Clone and order-checking 11a wheel sequence library template detect 8 special clones in 1-point dot hybridization (+/-20nM h-IgE).Clone and order-checking 12b mixture detect 4 special clones with protein bound in 1-point dot hybridization (+/-20nM h-IgE).The per-cent (background signal) that combines of each clone who detects and 20nM h-IgE is listed in the table below in the rightest hurdle.Following table 3 has been listed these 12 clones' sequence.Based on 1-point dot hybridization, select several clones and determine K DTranscription product 5 ' end mark γ of clone- 32P ATP.Ligation is to carry out under the condition of above-mentioned detection mixture avidity: trace 32The clone of P mark combines with the h-IgE titration, and at room temperature final volume is to cultivate 30 minutes among the IX SCHMCK damping fluid of 25 μ L and the 0.1mg/mL tMA.Use the dot hybridization test to determine the K of all distinguished sequences DValue, these distinguished sequences are substitution formula (amp1.1/ (1+K in initial detecting D1/ [h-IgE])+amp1.2/ (1+K D2/ [h-IgE]))+background+/-the h-IgE combining ratio is greater than 2; Wherein on behalf of two stages, amp1.1 and amp1.2 soak into structure biphase maintenance level value, every kind of dissociation constant that produces the effect of gained data of KDI and KD2, and the result of protein bound feature makes table 2.
Table 2: the clone is in conjunction with active
SEQ ID NO h-IgE (nM) K D1 h-IgE K D2 (nM) The 1-pt garbled data+/-the combination rate 20nM of h-IgE
11 0.144 12.5 4.08
12 0.057 9.85 4.70
13 0.139 14.6 5.67
14 1.08 99.5 2.57
15 0.115 19.0 3.89
16 N.T. 1.11
17 N.T. 0.76
18 1.14 27.3 4.31
SEQ ID NO h-IgE (nM) K D1 h-IgE K D2(nM) The 1-pt garbled data+/-the combination rate 20nM of h-IgE
22 N.B. 0.80
20 N.T. 1.36
21 0.183 27.1 2.64
19 0.095 17.4 3.55
N.T.=does not detect
N.B.=does not observe tangible combination
[00225] provides the fit nucleotide sequence of having identified of rRfY in the following table 3.The distinguished sequence that each is fit starts from nucleosides 25, the sequence of back be GGGAAAAGCGAAUCAUACACAAGA (sequence number 9) until with 3 ' fixed nucleotide sequence GCUCCGCCAGAGACCAACCGAGAA (sequence number 10).
[00226] unless special note is arranged, each sequence representative of listing below all be 5 ' to 3 ' direction and at rRfY SELEX TMScreen under the condition, wherein purine (A and G) be 2 '-OH, pyrimidine (U and C) is 2 '-fluorine.In some embodiments, invention comprises the nucleotide sequence that following table 3 is described.In other embodiments, the fit nucleotide sequence of describing in the table 3 also comprises 3 ' cap (that is, 3 ' reverse dT (3T)) in addition, and/or a 5 ' amine (NH2) is modified, so that Chemical bond, and/or be connected to high molecular non-immunogenic composition (that is, PEG).
The fit sequence information of table 3:rRfY
H-IgE screens (11a wheel)
SEQ ID NO 11
GGGAAAAGCGAAUCAUACACAAGACGUCGCCAGAUUGAGUGUCGUGGUUCGGGUUGAGGCGGAAGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 12
GGAAAAGCGAAUCAUACACAAGAGUCGCGAUAGAUUGCUUGUGAAUGGUUUUGGUGGAAGCGGGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 13
GGGAAAAGCGAAUCAUACACAAGAGUCGCUAGAUUGCUAGUGUAUGGUUUAUCUAAAGGCGGCCGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 14
GGGAAAAGCGAAUCAUACACAAGAGGUCUUACAGAUCCUGUGUAGUGGUUCGAUACAUGCGGGGCUCCGCCAGAGACCAAC
CGAGAA
SEQ ID NO 15
GGGAAAAGCGAAUCAUACACAAGACGUGAGCAUAUCAUUGAGUGUAGUGGUUCCGGAGUAAGUCGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 16
GGGAAAAGCGAAUCAUACACAAGAGCACCUUGACUGUGAUUCGCGGGUGUGAGUCGUGCGAAGGCUCCGCCAGAGACCAAC
CGAGAA
SEQ ID NO 17
GGGAAAAGCGAAUCAUACACAAGAGUGCAAGAAGUGCAUUGCUGUGUCUGGUUCUUGGCGAUGUGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 18
GGGAAAAGCGAAUCAUACACAAGAUCCGAGGGUGGGCAAUAGGCUCACAAGGGUUUCGCGUGAUGCUCCGCCAGAGACCAA
CCGAGAA
H-IgE screens (12b wheel)
SEQ ID NO 19
GGGAAAAGCGAAUCAUACACAAGAGUGCCGAGGCAUUGCUUGGUAUGGUUCCGGUCUUGUCGGGGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 20
GGGAAAAGCGAAUCAUACACAAGACGUCGCCAGAUUGAGUGUGGUGGUUCGGGUUGAGGCGGAAGCUCCGCCAGAGACCAA
CCGAGAA
SEQ ID NO 21
GGGAAAAGCGAAUCAUACACAAGACGUCAGUAAGAUUGAGUGUAUGGUUCCUGGUGGACAAUAAUGGCUCCGCCAGAGAC
CAACCGAGAA
SEQ ID NO 22
GGGAAAAGCGAAUCAUACACAAGAGAGUGGAGGAGGUAUGUAUGGUUUGUGCGUCU
GGUGCGGUGCUCCGCCAGAGACCAACCGAGAA
The screening that embodiment 1B:dRmY IgE is fit
[00227] screen with evaluation and contain deoxidation-A, G and 2 ' O-methyl C, the IgE of U residue is fit (dRmY composition).This is directly at the h-IgE that is fixed on the centrifugal plate of silication.This screening has produced the mixture (with respect to non-selected mixture) that is enriched in the h-IgE binding in a large number.
[00228] The sequence library preparation
Use ABI EXPEDITE TMDna synthesizer composition sequence 5 '-GGGAGAGGAGAGAACGTTCTACN30CGCTGTCGATCGATCGATCGATG-S ' (sequence number 23), and adopt standard method that it is gone protection.Template use 5 ' primer, 5 ' GGGAGAGGAGAGAACGTTCTAC-3 ' (sequence number 24) and 3 ' end primer 5 '-C ATCGATCGATCGATCGACAGC-S ' (sequence number 25) amplification, and be used as and transcribe template use T7 MA polysaccharase (Y639F) in-vitro transcription.Transcribe and use 200mM Hepes, 40mM DTT, 2mM spermidine, 0.01%TritonX-100,10%PEG-8000,9.6mM MgCl 2, 2.9mM MnCl2,30 μ M GTP, 2mM mCTP, 2mM mUTP, 2mM dGTP, 2mM dATP, 2mM GMP, 2mM spermidine, 0.01units/ul inorganic pyrophosphatase and T7 polysaccharase (Y639F).
[00229] Screening
It all is that (RoChester, NY) caused last one hour on the centrifugal plate of silication surface by under the room temperature 20pmoles 100 h-IgE of μ L in 1 XPBS being fixed in Nunc Maxisorp that each of screening is taken turns.Remove supernatant liquor and wash five times (1 X PBS, 0.1mg/mL tMA and 0.1mg/mL ssDNA) with 120 μ L lavation buffer solutions.In the first round, 100 pmoles MA mixtures (6 * 10 unique molecules) are at connection damping fluid (the 1 X PBS of 100 μ L, 0.1mg/mL tMA and 0.1mg/mL ssDNA) in cultivated 1 hour under the room temperature, connect damping fluid and place the hole of containing the immobilization target protein.Removing supernatant washs the hole five times with 120 μ L lavation buffer solutions.All comprised negative screening step in several wheel the subsequently; The MA mixture was equally at room temperature cultivated 1 hour in the emptying aperture, to remove any combinative sequence from mixture before the positive-selecting step.Take turns since the 3rd, carry out the negative screening second time further to filter out non-specific junction mixture; Mixture was cultivated 1 hour in before with 100 μ l sealing damping fluid (1 X PBS, 0.1mg/mL tMA, 0.1mg/mL ssDNA and 0.1mg/mL BSA) blind hole under room temperature.The 3rd take turns after, before carrying out positive-selecting, the sealing 1 hour under 100 μ l sealing damping fluid (1 X PBS, 0.1mg/mL tMA, 0.1mg/mL ssDNA and 0.1mg/mL BSA) room temperature of target-immobilization hole.Under every kind of situation, (3 ' primer (sequence number 25) and Thermoscript RT Mvitrogen) and at 65 ℃ descend cultivation directly reverse transcriptions on screen plate after 1 hour to the MA mixture that combines with fixed h-IgE adding the RT mixture.The cDNA that produces is used as PCR (Taq polymerase, New Engl and Biolabs) template." Hot start " PCR condition and 68 ℃ of annealing temperatures are used for reducing primer dimer as far as possible.The cycle number that pcr amplification need carry out (following table 4 last hurdles), (Mvitrogen, Carlsbad CA) obtain single band with 4% sepharose.During last sample, according to recommend operation instruction (New England Biolabs, Catalog Number N3231L, Beverly, MA), this band intensity is identical with the intensity in the path of 100 bp dna ladder degree (48 ng of DNA mass) contrast 100 bp.According to recommending working conditions, use Micro Bio-Spm column (Bio-Rad, Hercules, CA) to the mixture template DNA desalination of amplification, the transcribing of the next round MA mixture that the template after the desalination is used to screen.Each is taken turns transcribes mixture purifying on 10% polyacrylamide.Following table 4 has shown that each takes turns the employed condition of the fit screening of dRmY
Table 4: every condition of taking turns the screening use of using the dRmY composition to carry out
The wheel number The concentration of mixture (μ M) The protein type Protein concn (μ M) TRNA, ssDNA concentration (mg/mL) Negative screening step Cycle number
1 1 h-IgE 0.2 0.1 none 18
2 1 h-IgE 0.2 0.1 plate 18
3 1 h-IgE 0.2 0.1 plate，blocking buffer 20
4 1 h-IgE 0.2 0.1 plate，blocking buffer 17
5 1 h-IgE 0.2 0.1 plate，blocking buffer 17
6 1 h-IgE 0.2 0.1 plate，blocking buffer 15
7 1 h-IgE 0.2 0.1 plate，blocking buffer 16
[00230] The h-IgE binding analysis: use interlayer to filter and monitor the screening process in conjunction with test.5 '- 32The MA mixture (micro-concentrations) and the h-IgE of P-mark, IX PBS adds 0.1mg/mL tMA, 0.1mg/mL cultivated 30 minutes under ssDNA and the 0.1mg/mL BSA room temperature, and be applied to nitrocotton and nylon filtration interlayer in the Dot blot device (Schleicher and Schuell).Taking turns the back the 6th and 7 adopts 7 detection methods (1nM, 4nM, 16nM, 64nM and 128nM h-IgE also have non-target spot control for 0.25nM, 0.5nM) back to calculate the MA mixture to be connected to ratio on the nitrocotton.Use above-mentioned protein titration and Dot blot device to measure mixture K DObserved value.
[00231] after screening the 6th was taken turns, with respect to the natural sequence storehouse, dRmY h-IgE enrichment was to be connected with h-IgE.The 6th and 7 take turns after, the K of sequence library DApproach 4nM.Use TOPO TA clone's instrument (Mvitrogen) clone the 6th to take turns mixture, produced 31 sequences.8 and 3 is that wherein two mainly represent sequence and 21 single-pieces in 31 sequences.Fig. 6 shows it is to show that the 6th and 7 take turns the combining ratio figure of mixture with respect to h-IgE concentration.
[00232] Colony screeningIn order to determine K D, each clone's transcription product of 23 distinguished sequences is all at 5 ' end mark γ-32P ATP.In the dot hybridization test (0-300nM h-IgE, 3 times of serial dilutions), use 8 detections to determine K DValue, buffer conditions 1X Dulbecco ' s PBS; 1.0mg/mL tMA; 0.1mg/mL the smart DNA of the toadfish of being pruned; With 0.1mg/mL BSA.With data substitution formula: MA combining ratio=amplitude/ (1+K D/ [h-IgE])+background estimation dissociation constant (K DS).In conjunction with under the condition, there are 20 distinguished sequences not show tangible combination in 23 at these.The clone consistent with sequence number 43 and sequence number 46 sequences shows that dissociation constant is respectively 87.7nM and 109.7nM.
[00233] 23 special clone redeterminates the bonding force with h-IgE subsequently under different experiment conditions.Use the standard chemical synthetic method and strengthen guard method and comprehensively generate the clone.Trace 5 '- 32The IgE that concentration reduces gradually among the fit and people 7 of P-mark combines, with 300nM (3 times of dilutions) begin and do not have protein example at room temperature dPBS (contain Mg ++And Ca ++) and 0.1mg/mL BSA in cultivated 30 minutes.Use as the aforementioned dot hybridization to test to determine the KD value.Each clone's triplicate detects.Every kind of protein concn is calculated on average in conjunction with per-cent, calculate equilibrium dissociation constant among substitution formula ((A+P+K)-sqrt ((A+P+K) ^2-4*A*P))/2A+B, wherein A represents total fit concentration, and P represents total protein concentration, and B represents background signal.
[00234] under these testing conditions, consistent with nucleotide sequence sequence number 43 and sequence number 46 be cloned in the h-IgE bonding force on demonstrate very big improvement.Wherein in 23 distinguished sequences, other has 6 to be cloned in the high-affinity that has shown in the low nanomole scope with h-IgE.The protein bound characterization result is listed among the table 5A, shows among the 5B below 22 clones' of generation sequence is listed in.
Table 5A: (contain Ca at dPBS ++And Mg ++) 0.1mg/mL BSA in dRmY clone in conjunction with vigor
Sequence number Fit K D(nM) Error (nM)
43 ARC1991 2 2
50 ARC1992 10 8
42 ARC1993 9 4
46 ARC1994 5 5
41 ARC1995 4 2
33 ARC2001 18.0 0.1
44 ARC2002 8 6
29 ARC2005 5 3
[00235] each the fit distinguished sequence among the table 5B starts from nucleosides 23, and sequence afterwards is GGGAGAGGAGAGAACGUUCUAC (sequence number 26), until 3 ' fixed nucleic acid sequence C GCUGUCGAUCGAUCGAUCGAUG (sequence number 27).
[00236] unless special note is arranged, each sequence of listing is all represented 5 ' to 3 ' direction down, and at dRmY SELEX TMScreen under the condition, wherein purine (A and G) is deoxidation, and pyrimidine (U and C) is 2 '-oxygen-methylated.In some embodiments, invention comprises and contains the fit of nucleotide sequence described in the following table 5B.In other embodiments, contain that the fit nucleotide sequence of nucleotide sequence has also comprised 3 ' cap (that is, 3 ' reverse dT (3T)) described in the following table 5B, and/or 5 ' amine (NH2) is modified so that Chemical bond, and/or be connected to the non-immunogenic composition of high molecular (that is, PEG).
Table 5B the 6th takes turns the distinguished sequence (all is the dRmY composition) of mixture
SEQ ID NO 28
GGGAGAGGAGAGAACGUUCUACGAUUAGCAGGGAGGGAGAGUGCGAAGAGGACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 29
GGGAGAGGAGAGAACGUUCUACACUCUGGGGACCCGUGGGGGAGUGCAGCAACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 30
GGGAGAGGAGAGAACGUUCUACGAGGUGAGGGUCUACAAUGGAGGGAUGGUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 31
GGGAGAGGAGAGAACGUUCUACCCGCAGCAUAGCCUGNGGACCCAUGNGGGGCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 32
GGGAGAGGAGAGAACGUUCUACUGGGGGGCGUGUUCAUUAGCAGCGUCGUGUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 33
GGGAGAGGAGAGAACGUUCUACGCAGCGCAUCUGGGGACCCAAGAGGGGAUUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 34
GGGAGAGGAGAGAACGUUCUACGGGAUGGGUAGUUGGAUGGAAAUGGGAACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 35
GGGAGAGGAGAGAACGUUCUACGAGGUGUAGGGAUAGAGGGGUGUAGGUAACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 36
GGGAGAGGAGAGAACGUUCUACAGGAGUGGAGCUACAGAGAGGGUUAGGGGUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 37
GGGAGAGGAGAGAACGUUCUACGGAUGUUGGGAGUGAUAGAAGGAAGGGGAGCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 38
GGGAGAGGAGAGAACGUUCUACUUGGGGUGGAAGGAGUAAGGGAGGUGCUGAUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 39
GGGAGAGGAGAGAACGUUCUACGUAUUAGGGGGGAAGGGGAGGAAUAGAUCACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 40
GGGAGAGGAGAGAACGUUCUACAGGGAGAGAGUGUUGAGUGAAGAGGAGGAGUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 41
GGGAGAGGAGAGAACGUUCUACAUUGUGCUCCUGGGGCCCAGUGGGGAGCCACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 42
GGGAGAGGAGAGAACGUUCUACGAGCAGCCCUGGGGCCCGGAGGGGGAUGGUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 43
GGGAGAGGAGAGAACGUUCUACAGGCAGUUCUGGGGACCCAUGGGGGAAGUGCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 44
GGGAGAGGAGAGAACGUUCUACCAACGGCAUCCUGGGCCCCACAGGGGAUGUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 45
GGGAGAGGAGAGAACGUUCUACGAGUGGAUAGGGAAGAAGGGGAGUAGUCACGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 46
GGGAGAGGAGAGAACGUUCUACCCGCAGCAUAGCCUGGGGACCCAUGGGGGGCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 47
GGGAGAGGAGAGAACGUUCUACGGUCGCGUGUGGGGGACGGAUGGGUAUUGGUCGCUGUCNAUCGAUCGAUCGAUG
SEQ ID NO 48
GGGAGAGGAGAGAACGUUCUACGGGGUUACGUCGCACGAUACAUGCAUUCAUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 49
GGGAGAGGAGAGAACGUUCUACUAGCGAGGAGGGGUUUUCUAUUUUUGCGAUCGCUGUCGAUCGAUCGAUCGAUG
SEQ ID NO 50
GGGAGAGGAGAGAACGUUCUACAAGCAGUUCUGGGGACCCAUGGGGGAAGUGCGCUGUCGAUCGAUCGAUCGAUG
The screening that example 1C:rRmY h-IgE is fit
The purpose of [00237] screening be identify contain 2 '-h-IgE of ribo G and A and 2 '-oxygen-methyl C and U residue (rRmY composition) is fit.This is at the direct screening of being fixed in the h-IgE on the hydrophobic plate.With respect to natural unscreened sequence library, screening has obtained being enriched in a large number the sequence library of h-IgE binding.
[00238] The sequence library preparation
Adopt ABI EXPEDITE TMDna synthesizer composition sequence 5 '-GGGAGAGGAGAGAACGTTCTACN3OCGCTGTCGATCGATCGATCGATG-S ' (sequence number 51) and with standard method go the protection.Use 5 ' primer 5 '-GGGAGAGGAGAGAACGTTCTAC-S ' (sequence number 52) and 3 ' primer 5 '-CATCGATCGATCGATCGACAGC-3 ' (sequence number 53) amplification template, amplified production is used as template and uses the in-vitro transcription of T7 MA polysaccharase (Y639F).Transcribe and use 200mM Hepes, 40mM DTT, the inferior essence of 2mM is pressed .01% TritonX-100,10% PEG-8000,5mM MgCl 2, 1.5mM MnCl2,500 μ M rGTP, 500 μ M rATP, 500 μ M mCTP, 500 μ M mUTP, 500 μ M GMP .01 units/ μ L inorganic pyrophosphatase and T7 polysaccharase (Y639F).
[00239] ScreeningScreening each beginning of taking turns all is at room temperature to make 20pmoles h-IgE be fixed in the hydrophobic plate of Nunc Maxisorp two hours in 100 μ L 1X Dulbecco ' s PBS.Remove supernatant then, with 120 μ L lavation buffer solutions (1 X DPBS, 0.2%BSA5 and .05%Tween-20) flushing port MA mixture heating up to 90 ℃ 3 minutes renaturation under the cool to room temperature then.In the first round, to carry out positive-selecting.In brief, 1 * 10 14Molecules (.2 nmoles) 1MA mixture is in planting 100 μ L connection damping fluid (1 X DPBS and .05%Tween-20) under the room temperature and cultivating 1 hour in the hole of immobilization processing albumen target spot.Removing supernatant then also washes with the lavation buffer solution of 120 μ L4 X.Take turns screening in subsequently each and all comprise negative screening.Before the positive-selecting, but in emptying aperture, hatch 30 minutes under the MA mixture room temperature to remove the binding sequence in the mixture.The 4th increases by 2 120 μ l washings (amounting to 6 * 120 μ l washing) after taking turns in addition increases strict degree.In each case, by increasing RT mixed solution (3 ' primer (sequence number 53) and Thermoscript RT, Mvitrogen)) and hatched 1 hour, and directly on screen plate, carry out reverse transcription through immobilized h-IgE bonded MA mixture at 65 ℃.The cDNA that produces is used as pcr template (Taq polysaccharase New Engl and Biolabs).Heat start PCR and 60 ℃ of annealing to reduce the formation of primer dimer.The mixture template DNA of amplification is recommended condition according to the manufacturer, and use Centrisep post (Prmceton Separations) is sloughed salinity and is used to screen next round transcribing with guiding MA mixture.During taking turns, each transcribes mixture at 10% polyacrylamide gel purifying.
Following table 6 has shown that each takes turns rRmY screening mixture usage
The wheel number Use the pmoles of mixture Use the pmoles of h-IgE
1 200 20
2 140 20
3 115 20
4 40 20
5 130 20
6 80 20
7 90 20
[00240] uses interlayer to filter and monitor screening process in conjunction with check.5 '- 32The MA mixture of P mark is 90 ℃ of following renaturation 3 minutes, and at room temperature cools off 10 minutes.Next step was cultivated 30 minutes in the 1 * DPBS of h-IgE and 0.1mg/mL tMA under MA mixture (micro-concentrations) room temperature, carries out nitrocotton and nylon then and filter interlayer (Schleicher and Schuell) in the Dot blot device.Calculate with the per-cent of nitrocotton bonded MA mixture and every three-wheel with single-point detect (+/-25OnMh-IgE) monitor.Measure the K of mixture by using above-mentioned albumen titration and Dot blot device D
[00241] the 4th screens thing after taking turns is enriched on the native sequences storehouse.Proof strength has increased by 2 usefulness 120 μ l washings again, the again two-wheeleds that carried out of screening more.Take turns sequence library KD the 6th and approach 500nM.Use TOPO TA clone's instrument (Mvitrogen) to the sequence library clone, and obtain single clone.The 6th takes turns sequence library comprises an advantage clone.This clone's nucleotide sequence is consistent with sequence number 56, accounts for 71% in 24 clones of order-checking.Use 12 experimental tests (2 times of diluents of 0-250nM h-IgE) to detect this clone and duplicate in the situation that combines of three clones occurring and h-IgE.Though these three are duplicated the clone and have shown the higher bonding force than the advantage clone,, all K DS approaches 500nM.Obtained the family of one group of 96 sequence and other 8 in addition in the unconspicuous sequence of first sequence set family, contained nucleotide sequence and sequence number 56 consistent advantages and clone and account for 40% of these 96 sequences.Other distinguished sequence (+/-200nM h-IgE) is carried out the single-point test.Based on the single-point test, use 12 experimental tests (0-400nM h-IgE, 2 times of serial dilutions) to other 24 K DThe s sequence is determined K DS.Each clone's K DS surpasses 100nM, and further stops these clones.Table 7 has shown screening rRmy clone's nucleotide sequences.
[00242] each fit distinguished sequence all starts from nucleosides 22, and the sequence of back is that GGGAGAGGAGAGAACGUUCUA (sequence number 54) is till 3 ' fixed nucleotide sequence CGCUGUCGAUCGAUCGAUCGAUG (sequence number 55).
[00243] unless otherwise specified, each sequence representative of listing below all be 5 ' to 3 ' direction, and at rRmY SELEX TMScreen under the condition, wherein purine (A and G) and pyrimidine (U and C) be 2 '-OMe.In some embodiments, invention has comprised and has contained the fit of nucleotide sequence described in the following table 7.Fit nucleotide sequence also comprises 3 ' cap (3 ' oppositely dT (3T)) described in the table 7 in other embodiments, and/or 5 ' amine (NH2) is modified, be convenient to chemistry after the modification and connect, and/or be connected to the non-immunogen compound of high molecular (for example, PEG).
The unique cloned sequence information of table 7:rRmY
SEQ ID NO 56
GGGAGAGGAGAGAACGUUCUACGAUCUGGGCGAGCCAGUCUGACUGAGGAAGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 57
GGGAGAGGAGAGAACGUUCUACGCGGUCGGGUGUGUGGAGGAAGUAGUUCGUCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 58
GGGAGAGGAGAGAACGUUCUACGACGUUAAUGCAGCGGCUAGGGAUGGGCAGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 59
GGGAGAGGAGAGAACGUUCUACAGGCGUGUUGGUAGGGUACGACGAGGCAUGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 60
GGGAGAGGAGAGAACGUUCUACUGAGGGAUAAUACGGGUGGGAUUGUCUUCCCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 61
GGGAGAGGAGAGAACGUUCUACGAAAAAGAUAUGAGAGAAAGGAUUAAGAGACGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 62
GGGAGAGGAGAGAACGUUCUACGAAGAAGAUAUGAGAGAAAGGAUUAAGAGACGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 63
GGGAGAGGAGAGAACGUUCUACGAAAAAGAUAUGAGAGAAAGGAUUAAGAGACGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 64
GGGAGAGGAGAGAACGUUCUACGAAAAAGAUAUGAGAGAAAGGAUUAAGAGGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 65
GGGAGAGGAGAGAACGUUCUACGAAAAAGACAUGAGAGAAAGGAUUAAGAGACGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 66
GGGAGAGGAGAGAACGUUCUACNAAAAAGUAUAUGAGAGAAAGGAUUAANAGACGCUGUCGAUCGAUCGAUCGAUGAAGG
GCG
SEQ ID NO 67
GGGAGAGGAGAGAACGUUCUACGAAAAAGAUAUGAGAGAAAAGGAUUGAGAGAUGCUGUCGAUCGAUCGAUCGAUGAAGG
GCG
SEQ ID NO 68
GGGAGAGGAGAGCACGUUCUACGAAAAAGAUAUGGAGAGAAAGGAUUAAGAGACGCUGUCGAUCGAUCGAUCGAUGAAGG
GCG
SEQ ID NO 69
GGGAGAGGAGAGAACGUUCUACGAAAAAGAUAUGAGAGAAAGGAUUAAAAGAGACGCUGUCGAUCGAUCGAUCGAUGAAG
GGCG
SEQ ID NO 70
GGGAGAGGAGAGAACGUUCUACGAANAAGAUACAUAGUAGAAAGGAUUAAUAAGACGCUGUCGAUCGAUCGAUCGAUGAA
GGGCG
SEQ ID NO 71
GGGAGAGGAGAGAACGUUCUACAGGCGUGUUGGUAGGGUACGACGAGGCAUGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 72
GGGAGAGGAGAGAACGUUCUACGCAAAAAUGUGAUGCGAGGUAAUGGAACGCCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 73
GGGAGAGGAGAGAACGUUCUACGGACCUCAGCGAUAGGGGUUGAAACCGACACGCUGUCGAUCGAUCGAUCGAUGAAGGGC
G
SEQ ID NO 74
GGGAGAGGAGAGAACGUUCUACAUGGUCGGAUGCUGGGGAGUAGGCAAGGUUCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 75
GGGAGAGGAGAGAACGUUCUACGUAUCGGCGAGCGAAGCAUCCGGGAGCGUUCGCUGUCGAUCGAUCGAUCGAUGAAGGGC
G
SEQ ID NO 76
GGGAGAGGAGAGAACGUUCUACGUAUUGGCGCGCGAAGCAUCCGGGAGCGUUCGCUGUCGAUCGAUCGAUCGAUGAAGGGC
G
SEQ ID NO 77
GGGAGAGGAGAGAACGUUCUACUUAUACCUGACGGCCGGAGGCGCAUAGGUGCGCUGUCGAUCGAUCGAUCGAUGAAGGGC
G
SEQ ID NO 78
GGGAGAGGAGAGAACGUUCUACAUGGUCGGAUGCUGGGGAGUAGGCAAGGUUCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 79
GGGAGAGGAGAGAACGUUCUACACGAGAGUACUGAGGCGCUUGGUACAGAGUCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 80
GGGAGAGGAGAGAACGUUCUACAGAAGGUAGAAAAAGGAUAGCUGUGAGAAGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 81
GGGAGAGGAGAGAACGUUCUACUGAGGGAUAAUACGGGUGGGAUUGUCUUCCCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 82
GGGAGAGGAGAGAACGUUCUACAUUGAGCGUUGAAGUUGGGGAAGCUCCGAGGCCGCUGUCGAUCGAUCGAUCGAUGAAG
GGCG
SEQ ID NO 83
GGGAGAGGAGAGAACGUUCUACGCGGAGAUAUACAGCGAGGUAAUGGAACGCCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 84
GGGAGAGGAGAGAACGUUCUACGAAGACAGCCCAAUAGCGGCACGGAACUUGCGCUGUCGAUCGAUCGAUCGAUGAAGGGC
G
SEQ ID NO 85
GGGAGAGGAGAGAACGUUCUACCGGUUGAGGGCUCGCGUGGAAGGGCCAACACGCGCUGUCGAUCGAUCGAUCGAUGAAGG
GCG
SEQ ID NO 86
GGGAGAGGAGAGAACGUUCUACAUAUCAAUAGACUCUUGACGUUUGGGUUUGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 87
GGGAGAGGAGAGAACGUUCUACAGUGAAGGAAAAGUAAGUGAAGGUGUGCGCUGUCGAUCGAUCGAUCGAUGAAGGGCG
SEQ ID NO 88
GGGAGAGGAGAGAACGUUCUACGGAUGAAAUGAGUGUCUGCGAUAGGUUAAGCGCUGUCGAUCGAUCGAUCGAUGAAGGG
CG
SEQ ID NO 89
GGGAGAGGAGAGAACGUUCUACGGAAGGAAAUGUGUGUCUGCGAUAGGUUAAGCGCUGUCGAUCGAUCGAUCGAUGAAGG
GCG
Embodiment 2: aptamer modified
Embodiment 2A:rRfY IgE clone minimizes
[00244] makes as far as possible that the IgE that describes among the embodiment 1A is fit to minimize, keep simultaneously, preferably improve fit binding affinity.In order to identify that h-IgE in conjunction with necessary core texture element, has determined 3 ' border of wherein several high-affinity h-IgE bindings.The MA transcription product 5 ' terminal with γ- 32P ATP and T4 polynueleotide kinase mark.Radiolabeled ligand moiety basic hydrolysis also optionally was connected to h-IgE 500nM in solution before nitrocotton filters separately.The oligonucleotide that keeps is decomposed on 8% denaturing polyacrylamide gel.Minimum oligonucleotide is connected to the 3 ' end-blocking that is attached to the h-IgE definition.3 ' end-blocking of the clone that process is selected is described in table 8.On the basis of border experiment and the folding visual observation of prediction, the preparation part-structure and from the dna integration technology (Coralville IA) goes up the ordering oligonucleotide fragment.Filter the combination test by aforesaid interlayer and can detect nucleotide sequence and sequence number 11, sequence number 18 has shown tangible protein bound power with the product that minimizes that sequence number 21 consistent mothers clone.Show in the table 8 that small-sized binding data exists, and shown corresponding sequence in the table 9.
Table 8: the foreword row are in conjunction with active
Minimize the clone Female clone Female clone 3 '-border h-IgE K D1 (nM) h-IgE K D2 (nM)
SEQ ID NO 90 SEQ ID NO 11 U49 0.33 28.2
SEQ ID NO 91 SEQ ID NO 11 0.56 36.9
SEQ ID NO 92 SEQ ID NO 11 0.25 22.0
SEQ ID NO 93 SEQ ID NO 18 U55 0.65 17.1
SEQ ID NO 94 SEQ ID NO 18 1.01 26.5
SEQ ID NO 95 SEQ ID NO 21 G47 4.5 117.2
SEQ ID NO 96 SEQ ID NO 21 0.365 39.7
*All measurements all are to operate in 1X SHMCK and 0.1mg/mL tRNA
[00245] unless otherwise specified, each sequence representative of listing below all be 5 ' to 3 ' direction, and at rRmY SELEX TMScreen under the condition, wherein purine (A and G) be 2 '-OH, pyrimidine (U and C) is 2 '-fluorine.In some embodiments, invention has comprised and has contained the fit of nucleic acid described in the following table 9.Fit nucleotide sequence also comprises 3 ' cap (for example, 3 ' oppositely dT (3T)) and/or 5 ' amine (NH described in the table 7 in further embodiments 2) modify, so that the chemistry connection, and/or be connected to the non-immunogenic composition of high molecular (that is, PEG).
Table 9:rRfY minimizes fit sequence
SEQ ID NO 90
GGGAAAAGCGAAUCAUACACAAGACGUCGCCAGAUUGAGUGUCGUGGUU
SEQ ID NO 91
GGAAUCAUACACAAGACGUCGCCAGAUUGAGUGUCGUGGUUCC
SEQ ID NO 92
GGAAUCAUACACAAGACGUCGCCAGAUUGAGUGUCGUGGUU
SEQ ID NO 93
GGAGAUCCGAGGGUGGGCAAUAGGCUCACAAGGGUUU
SEQ ID NO 94
GGAUCCGAGGGUGGGCAAUAGGCUCACAAGGGUCC
SEQ ID NO 95
GGAAUCAUACACAAGACGUCAGUAAGAUUGAGUGUAUGGUUCC
SEQ ID NO 96 GGAAUCAUACACAAGACGUCAGUAAGAUUGAGUGUAUGGUU
Embodiment 2B:dRmY IgE clone minimizes
[00246] as far as possible with fit the minimizing of dRmY IgE of describing among the embodiment 1B, keep simultaneously, preferably improve fit binding affinity.On the basis of the prediction folded situation that detects the clone consistent, designed one group of minimized sequence with nucleotide sequence sequence number 43 and sequence number 46.The molecule of high-affinity, ARC445 (sequence number 101) are one and contain 23 nucleosides and combine with the h-IgE of 22 nMKD.Data are summarised in the table 10.Table 11 has shown the nucleotide sequence of ARC441 to ARC447 (sequence number 97-103), comes from the clone's consistent with nucleotide sequence sequence number 43 and sequence number 46 part fragment.
Table 10: minimize dRmY h-IgE binding
Minmal sequence number Minimum ARC reference number Female cloned sequence number K D h-IgE(nM)
97 ARC441 SEQ ID NO 43 N.B.
98 ARC442 SEQ ID NO 43 174
99 ARC443 SEQ ID NO 43 55
100 ARC444 SEQ ID NO 46 73
101 ARC445 SEQ ID NO 46 22
102 ARC446 SEQ ID NO 46 43
103 ARC447 SEQ ID NO 46 N.B.
K DMeasurement is to contain 0.1mg/mL, carries out 30 minutes among 25 ℃ of the IX PBS of 1mg/mL tMA and 0.1mg/mL ssDNA BSA.
[00247] unless otherwise specified, each sequence representative of listing below all be 5 ' to 3 ' direction, and at rRmY SELEX TMScreen under the condition, wherein purine (A and G) is deoxidation, and pyrimidine (U and C) is 2 '-oxygen-methylpyrimidine.In some embodiments, invention has comprised and has contained the fit of nucleotide sequence described in the following table 11.Fit nucleotide sequence also comprises 3 ' cap (3 ' oppositely dT (3T)) described in the table 7 in other embodiments, and/or 5 ' amino (NH 2) modify, be convenient to chemistry and connect, and/or be connected to the non-immunogenic composition of high molecular (for example, PEG).
The cloned segment fragment that table 11 and nucleotide sequence sequence number 43 and sequence number 46 are consistent.
SEQ ID NO 97(ARC441)
UUCUGGGGACCCAUGGGGGAA
SEQ ID NO 98(ARC442)
GUUCUGGGGACCCAUGGGGGAAC
SEQ ID NO 99(ARC443)
AGUUCUGGGGACCCAUGGGGGAACU
SEQ ID NO 100(ARC444)
GCCUGGGGACCCAUGGGGGGC
SEQ ID NO 101(ARC445)
AGCCUGGGGACCCAUGGGGGGCU
SEQ ID NO 102(ARC446)
UAGCCUGGGGACCCAUGGGGGGCUA
SEQ ID NO 103(ARC447)
GCCUGGGGAACCAUGGGGGGC
Embodiment 2C: hotchpotch screens again: ARC445
[00248] HotchpotchScreening is to be used for probing into active clone or to minimize the necessary sequence of thing again. HotchpotchRescreen and choose, screening is to carry out in the synthetic and the sequence library of degenerating, and sequence library is based on the simple sequence design.Deterioration level is in the scope of wild-type nucleosides 70% to 85%.Generally, observe the neutral mutation body, but the variation of sequence can cause the change of avidity in some cases.The information of composition sequence can be used for identifying minimum binding motif, and is also helpful to fit medical chemistry.
[00249], use the hotchpotch mixture to screen to identify the more binding of high-affinity based on minimized h-IgE binding sequence ARC445 (sequence number 101) (describing among the embodiment 2B).Screening is at being fixed in the lip-deep h-IgE of hydrophobic plate, and utilizes and promote to screen the more fit technology of high-affinity, as the mixture (for example, 30 minutes, 60 minutes, spending the night) of some longer washes.
[00250] The sequence library preparationUse ABI EXPEDITE TMDna synthesizer synthetic and with standard method go to protect sequence 5 '-GGGAGAGGAGAGAACGTTCTACAGCCTGGGGACCCATGGGGGGCTGGTCGATCGAT CGATCATCGATG-S ' (sequence number 104).The nucleosides 85% of runic may be pointed residue, 5% may be of other three nucleosides.Template use 5 ' primer 5 '-GGGAGAGGAGAGAACGTTCTAC-3 ' (sequence number 52) and 3 ' primer 5 '-CATCGATGATCGATCGATCGACC-3 ' (sequence number 105) increases, amplified production as template use T7 MA polysaccharase (Y639F) in in-vitro transcription.Used 200mM Hepes in transcribing, 40mM DTT, 2mM spermidine, 0.01%TritonX-100,10% PEG-8000,9.6mM MgCl 2, 2.9mM MnCl 2, 30 μ M GTP, 2mM mCTP, 2mM mUTP, 2mM dGTP, 2mM dATP, 2mM GMP, 2mM spermidine, 0.01urits/ μ l inorganic pyrophosphatase and T7 polysaccharase (Y639F).
[00251] ScreeningIt all is in 100 μ L 1X Dulbecco ' s PBS 20 pmoles h-IgE to be fixed in Nunc Maxisorp hydrophobic plate last 1 hour of surface and initiation under the room temperature that each of screening is taken turns.Remove supernatant then, with 120 μ L, 1 X DPBS lavation buffer solution hole flushing.Adding 100 μ L sealing damping fluid (1 X Dulbecco ' s PBS, 0.1mg/mL tMA, smart DNA of 0.1mg/mL toadfish and 0.1mg/mL BSA) with the hole sealing, cultivated 1 hour under the room temperature.Remove supernatant then, with 120 μ L lavation buffer solution flushing ports.Take turns beginning second, the MA storehouse need be negative in conjunction with cultivating 1 hour in emptying aperture, and feminine gender is in conjunction with cultivating in the BSA blind hole.Carry out positive-selecting in the wad cutter by in 1 X of 100 μ L Dulbecco ' s PBS, 100 pmoles MA mixtures being joined.Add the smart DNA of 0.1mg/mL tMA and 0.1mg/mL toadfish again in positive selection.Cultivate under the room temperature after one hour and remove supernatant, lavation buffer solution (1 X DPBS) the 120 μ L washing holes of listing with table 12 five times.The 3rd and 4 mixtures of taking turns screening are separately increased extra screening.The washing of longer time can increase the strict degree of screening.
[00252] uses ThermoScript RT-PCR TMSystem (Mvitrogen) carried out reverse transcription 30 minutes to MA under 100 μ l reaction solutions, 65 degree, use 3 ' primer consistent with sequence number 5, pcr amplification cDNA, pcr amplification condition 20mM Tris pH8.4,50mM KCl, 2mM MgCl 20.5 μ M 5 ' primer (sequence number 52), 0.5 μ M 3 ' primer (sequence number 105), 0.5mM every kind of dNTP, 0.05units/ μ L Taq polysaccharase (New Engl and Biolabs) uses PCR cycle number (last hurdle of table 12) to need to obtain a band (Mvitrogen in 4% sepharose, Carlsbad, CA), according to recommending (48ng DNA) (New Engl and Biolabs, Catalog Number N3231L, Beverly MA) uses, and its intensity is identical with 100bp marker on the 100bp dna ladder degree during last sample.The PCR product uses Centrisep Spm post (Prmceton Separations) to carry out desalination.Template is transcribed under 37 degree and is spent the night, and uses 200mM Hepes, 40mM DTT, 2mM spermidine, 0.01% TritonX-100,10% PEG-8000,9.6mM MgCl 2, 2.9mM MnCl2,30 μ M GTP, 2mM mCTP, 2mM mUTP, 2mM dGTP, 2mM dATP, 2mM GMP, 2mM spermidine, 0.01units/ μ l inorganic pyrophosphate, T7 polysaccharase (Y639F).With purifying on the polyacrylamide of the MA in the later several rounds 10%.Following table 12 shows the summary of screening scheme again of ARC445 (sequence number 101) hotchpotch.
Table 12.ARC445 (sequence number 101) hotchpotch is screening scheme again
Normal condition
The wheel number RNA concentration Negative step Target level Washing The PCR cycle number
1 100 none 20 120μl/quick 19
2 100 well， BSA 20 120μl/quick 10
3a 100 well， BSA 20 120μl/quick 10
4a 80.64 well， BSA 20 120μl/quick 10
5a 100 well， BSA 20 120μl/quick 10
Start from the 3rd length of taking turns and wash (take turns the template from the 3rd and separate)
The wheel number RNA concentration Negative step Target level Washing The PCR cycle number
1 100 none 20 120μl/quick 19
2 100 well， BSA 20 120μl/quick 10
3b 30.67 well， BSA 20 120μl/30min 10
4b 100 well， BSA 20 120μl/ON 12
Start from the 4th length of taking turns and wash (take turns the template from the 4th and separate)
The wheel number RNA concentration Negative step Target level Washing The PCR cycle number
1 100 none 20 120μl/quick 19
2 100 well， BSA 20 120μl/quick 10
3a 100 well， BSA 20 120μl/quick 10
4c 80.64 well， BSA 20 120μl/30min 10
5c 100 well， BSA 20 120μl/ON 12
[00253] (last is taken turns under the different condition and obtains in the non-strict screening in the 2nd and 3 take turns in screening for Mvitrogen, CarlsbadCA) cloned DNA, these DNA to use TOPO TA clone instrument.Synthetic filter out 7 sequences and use narrate among dot hybridization test and the embodiment 1B condition detect the special avidity of itself and h-IgE.The clone who detects does not show the tangible combination with h-IgE.Following table 13 has shown the cloned sequence that screens again from the ARC445 hotchpotch.
[00254] unless otherwise specified, each sequence representative of listing below all be 5 ' to 3 ' direction, and at dRmY SELEX TMScreen under the condition, wherein purine (A and G) is the deoxidation purine, and all pyrimidines (U and C) are 2 '-oxygen-methylpyrimidines.In some embodiments, invention has comprised and has contained the fit of nucleotide sequence described in the following table 13.In other embodiments, fit nucleotide sequence also comprises 3 ' cap (that is, 3 ' oppositely dT (3T)) described in the table 13, and/or 5 ' amino (NH 2) modify, be convenient to chemistry and connect, and/or be connected to the non-immunogen compound of high molecular (as, PEG).
The sequence of table 13. ARC445 hotchpotch screening and cloning
SEQ ID NO 106 ARC664
AGCCUGGGGACCCAUGGGGGCU
SEQ ID NO 107 ARC665
CGCCUGGGGACCCAGGGGGGGCU
SEQ ID NO 108 ARC666
AGCCUGGUGGCCCAUGGGGUGCU
SEQ ID NO 109 ARC667
AGCCUGGGGACCCAUGGGGGGUGGU
SEQ ID NO 110 ARC668
AGUCUGGGGACAGAUGGAUGGCU
SEQ ID NO 111 ARC669
AGCUGUGGAGUCGUGUGGGGCU
SEQ ID NO 112 ARC670
AAGCCUGGGGACCCAUGGGGGGGCU
The hotchpotch that embodiment 2D:DNA IgE is fit screens again
[00255] based on h-IgE binding sequence D17.45 '-GGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCC-3 ' (sequence number 113) (US 5,686,592 incorporate reference in this integral body) uses the hotchpotch sequence library to screen to identify the more binding of high-affinity.Screening is at the h-IgE that is fixed in hydrophobic plate surface, and the technology of use is that more high-affinity is fit in order to promote to screen, as the multiple different time mixture (promptly 30 minutes, 60 minutes, spend the night) of washing down.Experiment has produced many D17.4 derivatives that increase with h-IgE avidity.
[00256] The Ku Lieku preparationThe dna profiling (ARC273) that contains sequence 5 ' gatcccttgttcagtccGGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCCtt aagccacaggactccaaa-3 ' (sequence number 114) wherein primer binding site is represented with lowercase, the nucleosides of runic have 85% may represent pointed residue, 5% in other 3 nucleosides one of them may represented arranged.Use ABI EXPEDITE TMDna synthesizer synthesizes template and goes protection with standard method.Use standard conditions with mixture adopt 5 ' primer 5 '-GATCCCTTGTTCAGTCCG-3 ' (sequence number 115) and 3 ' primer 5 '-(wherein rA represents the ribose adenosine to GGAGTCCTGTGGCTTArA-3 ' (sequence number 116), primer is separated behind PCR, template is separated on gel with the mixture band) increase.Product carry out basic hydrolysis (200mMNaOH, 90 ℃, 15mm) and use isopropanol precipitating.Polyacrylamide gel 8% separates double-stranded, and the ssDNA mixture has very low mobility, and it is severed from gel.
[00257] to take turns all be at room temperature in 100 μ L screening damping fluid (1 X SCHMK to Shai Xuan each; Referring to embodiment 1A) in 20 pmoles h-IgE are fixed on the hydrophobic plate of the Nunc Maxisorp surface cultivated 1 hour and cause.Remove supernatant then, with 120 μ L lavation buffer solutions (1 X SCHMK, 0.2% BSA and 0.5% Tween-20) flushing port four times.(1 X SHMCK, 1% BSA 0.5%Tween-20) cultivate under the room temperature and the hole were sealed in 1 hour to add 100 μ L sealing damping fluid.Remove supernatant then, with 120 μ L lavation buffer solution washing holes four times.In the first round, 80pmoles mixture D NA (1.5 * 1013 special molecular) was cultivated 1 hour in blank well under room temperature at 100 μ L screening damping fluid, screen step to remove non-special binding as feminine gender.Remove supernatant, add 12 μ L of 9.1mg/mL toadfish sperm DNAs in 1 X SCHMK, mixture is transferred in the hole of containing target protein.Cultivate and remove supernatant under the room temperature after 1 hour, repeatedly use 120 μ L lavation buffer solution washing holes.Following table 14 has shown the screening conditions that hotchpotch screens again.
The function that the strict degree of table 14 screening is taken turns and washed as each
The wheel number Initial wash Cultivate washing 15 minutes in the damping fluid Cultivating washing in the damping fluid spends the night Damping fluid is cultivated after scouring
1 6 - - -
2 6 - - -
3 6 - - -
4 6 2 - -
5 6 2 1 1
[00258] in all cases, the mixture D NA that is connected to the h-IgE that handles through immobilization adds isopropanol precipitating, pcr amplification then with the hot elution damping fluid washings of 2 * 150 μ L (7M Urea, 100mM NaOAc pH5,3mM EDTA).The DNA of elution increases and purifying according to the method described above after the screening first round.Under standard conditions, use 5 ' and 3 ' primer sequence numbers 115 and sequence number 116, carry out the amplification of initial DNA hotchpotch sequence library.The the 2nd to 4 takes turns, the DNA of elution with 5 ' and 3 ' primer sequence numbers 115 5 '-(5-biotm-T) (5-biotm-T) (5-biotm-T) GGAGTCCTGTGGCTTAA-3 ' (sequence number 117).PCR product phenol extraction, ethanol sedimentation.In 5-10 μ l of IX SCHMK damping fluid, add 300 pmoles neutravidin (Pierce, Rockford IL) suspends DNA, cultivates 30 minutes under the room temperature, add 10 μ l methane amides then and upload dye liquor, on the polyacrylamide of 8% sex change, separate.In the whole denaturation process, vitamin H-neutravidin mixture is kept perfectly, and the movability of antianaphylaxis DNA chain significantly reduces with respect to irritated DNA chain.Chain is separated like this, and the purpose ssDNA mixture member than higher mobility is arranged, and scales off the next round that enters screening from glue.
[00259] after screening the 3rd to the 5th is taken turns, use TOPO TA clone instrument (Mvitrogen) and 5 ' and 3 ' primer sequence numbers 115 and 5 '-GGAGTCCTGTGGCTTAA-3 ' (sequence number 118) (not adorned fully DNA) carries out having generated 84 sequences at the t that increases to the mixture template.The no primer binding sequence of each preparation clone, and use the dot hybridization test of setting up and the condition detection among the embodiment 1A of front to clone and 5 and the combining of 50nM h-IgE.Do not show with h-IgE with the clone of following sequence number consensus nucleic acid sequence in the initial monitoring and to combine: sequence number 125, sequence number 137 and sequence number 138.Use titration h-IgE (30pM to 30nM, 3 times of dilutions) (table 15), determine K DS is to identify best binding substances in initial monitoring.Wherein several clones compare the bonding force D17.4 (sequence number 113) that has shown through improving with auxiliary sequence.The clone who contains nucleotide sequence sequence number 140 is demonstrating maximum improvement with respect to auxiliary sequence D17.4 (sequence number 113) aspect the avidity.What is interesting is that the clone and the difference between the clone D17.4 (sequence number 113) that contain sequence nucleotide sequence numbers 140 are very faint.Change and to comprise and contain the annular zone that Watson/Crick skeleton that being cloned in of nucleotide sequence sequence number 140 proposed directly approaches D17.4 fit (sequence number 113).Nearly allly rescreen the special clone who chooses (comprise and contain the consistent clone of nucleotide sequence and sequence number 140) to obtain and all on the G8-C30 of D17.4 base pair, obtained to have become A8-T30 or C8-G30, effectively changed the functional group that occurs in the coiled strand major groove, this functional group 5 of base pair G8-C30 '-chain-carbonyl/3 '-chain-amino and base pair A8-T30 and C8-G30 5 '-chain-amino/3 '-chain-carbonyl between.The clone of avidity maximum (except the clone consistent with sequence SEQ DD NO 140) is according to ring sequence (residue 9-29) redesign of himself, and based on the skeleton with nucleotide sequence number 140 (residue 1-8 and 30-37) clone that sequence is consistent it is optimized.C4-C34 with mispairing on the skeleton that sequence number 140 is optimized changes into G4-C34.Following table 15 has shown nucleosides length and the fit avidity of selected DNA.Table 16 has shown the nucleotide sequences that selected DNA is fit.
The length that Table 15 selected DNA are fit be connected avidity
Sequence number Length K D (nM)
113 37 0.5-2
132 37 0.4
119 37 0.6
139 36 0.4
133 37 0.7
147 37 0.5
128 37 0.5
140 36 0.2
149 38 0.8
131 37 0.3
150 37 0.7
151 37 0.5
152 37 0.2
153 37 0.6
154 37 0.4
155 37 0.4
156 37 0.2
[00260] during the DNA that describes below was fit, all nucleosides (A, T, C and G) all were deoxidations.Unless special note is arranged, the representative of each sequence all be 5 ' to 3 ' direction.In some embodiments, invention comprises and contains the fit of the described nucleotide sequence of table 16.In other embodiments, the fit nucleotide sequence of describing in the table 16 has also comprised has increased by 3 ' cap (promptly, 3 ' oppositely dT (3T)) and 5 ' end amido modified, be convenient to the chemistry connection and/or be connected on the composition of a high molecular non-immunogenic (as PEG).
Table 16 DNA h-IgE hotchpotch is selected fit sequence information (cloned sequence of listing does not comprise the primer zone) again
SEQ ID NO 113 D17.4
GGGGCACGTTTATCCGTCCCTCCTAGTGGCGTGCCCC
SEQ ID NO 119
GGGGCACATTTATCCGTCCCTCCTAGTGGTTGTGCCCC
SEQ ID NO 120 GGGGTACCTTTATCCGTCCCTCCTAGTGGGGTGCCCC
SEQ ID NO 121 GGGGTACCTTTATCCGTCCCTCCTAGTGGGGTACCCC
SEQ ID NO 122 GGGGCAAATTTATCCGTCCCTCCTAGTGGTTTGCCCC
SEQ ID NO 123 GGGGCATATTTATCCGTCCCTCCTAGTGGTATGCCCC
SEQ ID NO 124 GGGGCACATTTATCCGTTCCTCCTAGTGGTGTGCCCC
SEQ ID NO 125
GGGGTACATTTATCCGTCCCTCCTAGTGGCATGCCCC
SEQ ID NO 126
GGGGCATGTTTATCCGTCCCTCCTAGTGGCATGCCCC
SEQ ID NO 127 GGGGCAACTTTATCCGTTCCTCCTAGTGGGTTGCCC
SEQ ID NO 128
GGGGCACATTCATCCGTCCCTCCTAGTGGTGTGCTCC
SEQ ID NO 129
GGGGTACCTTGATCCGTCCCTCCTAGTGGGGTGCCCC
SEQ ID NO 130
GGGGCATGTTTATCCGTTCCTCCTAGTGGCATGCCCC
SEQ ID NO 131
GGGGCAGCTTTATCCGTTCTCCTAGTGGGCTGCCTC
SEQ ID NO 132
GGGGTACCTTTATCCGTTTCTCCTAGTGGGGTGCCCC
SEQ ID NO 133 GGGGTATGTTGATCCGTCCCTCCTAGTGGCATGCCCC
SEQ ID NO 134 GGGGCATGTTCATCCGTTCCTCCTAGTGGCGTGCCCC
SEQ ID NO 135
GGGACACATTTATCCGTTACTCTTAGTGGTGTGCCCC
SEQ ID NO 136 GGGGCACATTTATCCGTTACTCTTAGTGGTGTGCCCC
SEQ ID NO 137
GGGGCACGTTTACAGTCCCTCCTATCGCCTCCC
SEQ ID NO 138
GGGGCACGTTTACAGTCCCTCCTTATCGCCTCCC
SEQ ID NO 139 GGGCAACTTTATCCGTTCCTCTTAGTGGGTTGCCCC
SEQ ID NO 140 GGGCTACTTTATCCGTCCCTCCTAGTGGGTAGCCCC
SEQ ID NO 141
GGCACCTTTATCCGTCCCTCCTAGTGGGGTGCCCC
SEQ ID NO 142 GGGGCACCTTTATCCGTCCCTCCTAGTGGGGTGCCCC
SEQ ID NO 143 GGGCACATTCATCCGTTCCTCCTAGTGGTGTGCCCC
SEQ ID NO 144 GGCACCTTTATCCGTTCCTTCTAGTGGGGTGCCC
SEQ ID NO 145 CGGCACCTTTATCCGTTACTCTTAGTGNGGTGCCCC
SEQ ID NO 146 GGCACCTTGATCCGTTCCTCCTAGTGGGGTGCCCC
SEQ ID NO 147 GCGGGCAAATTCATCCGTCCCTCCTAGTGGTTTGCCC
SEQ ID NO 148
GGGCACTTTATCCGTTCCTTCTAGTGGGTGTCCC
SEQ ID NO 149
GGCGGCAGCTTTATCCGTACCTCCCAGTGGGCTGCTCC
SEQ ID NO 150 ARC474
GGGGCAGCTTTATCCGTACCTCCCAGTGGGCTGCCCC
SEQ ID NO 151 ARC475 GGGGCTACTTTATCCGTCCCTCCTAGTGGGTAGCCCC
SEQ ID NO 152 ARC476
GGGGCTACTTTATCCGTACCTCCCAGTGGGTAGCCCC
SEQ ID NO 153 ARC477 GGGGCTACTTGATCCGTCCCTCCTAGTGGGTAGCCCC
SEQ ID NO 154 ARC478 GGGGCTACTTCATCCGTCCCTCCTAGTGGGTAGCCCC
SEQ ID NO 155 ARC479 GGGGCTACTTTATCCGTTCCTCTTAGTGGGTAGCCCC
SEQ ID NO 156 ARC480 GGGGCTACTTTATCCGTTCCTCCTAGTGGGTAGCCCC
SEQ ID NO 157 ARC656
GGGGCTACTTTATCCGTTCCTCCTAGTGGGTAGCCCC-3T
Embodiment 2: in order to the ARC445 of stability and external avidity in the increase blood plasma Fit medical chemistry
[00261] comprise by system's synthetic method fit synthetic heterogeneous, purifying and identify the highly stable and effective varient of ARC445 (sequence number 101) in conjunction with vigor detects.Modify, such as contain 2 with containing the displacement of 2 '-O-methyl residue '-system's substitution method of deoxidation residue is a kind of basic skills that is used for significantly increasing blood plasma nuclease resistibility and overall stability.
[00262] in clone's monitoring that generates ARC445 (sequence number 101) and minimization process, fit relative binding ability (the dot hybridization test of stating previously obtains), ELISA, FACS, Histidine release test (following embodiment 3 describes) is all very consistent.Therefore, most experiment derivative has all detected and h-IgE bonded avidity, and is used for representing relative binding ability.Use denaturing polyacrylamide gel electrophoresis, 5 ' end-labelled γ-P ATP comes the fit of purifying chemosynthesis, to determine K DAnd test the fit situation that directly combines with people h-IgE of these chemosynthesis.8 albumen titres are used for aforesaid dot hybridization in conjunction with test (i.e. { 100nM, 30nM, 10nM, 3nM, 1nM, 300pM, 100pM, 0pM} or { 10nM, 3nM, 1nM, 300pM, 100pM, 30pM, 10pM 0pM}) (contains Mg at the Dulbecco ' s PBS that contains 0.1mg/ml BSAD ++And Ca ++) in room temperature following half an hour.Use KaleidaGraph (KaleidaGraph v.3.51, Synergy Software) to come calculating K D value by substitution formula y=(max/ (1+K/protem))+ymt.Below list synthetic in the table 17, purifying, detection and sequence and protein binding characteristic h-IgE bonded ARC445 derivative.
[00263] with 2 '-the first step that O methyl residue is replaced deoxidation residue process be synthetic and detect ARC 1250-ARC 1264 (sequence number 158-172) in conjunction with vigor, wherein each all with increased by 3 '-oppositely-dT (3T) and with 2 '-O-methyl residue replaced 2 '-that the ARC445 of deoxidation residue combines activity is suitable.Binding data from table 17 as can be seen, some positions hold 2 easily '-O-methyl residue replaces the deoxidation residue, other positions then are not.What is interesting is, in the site 10 (ARC1256) (sequence number 164) with 2 '-O-methyl residue replaces 2 '-the deoxidation residue significantly improves avidity.
[00264] based on the fit medical chemistry process 1 structure-activity relationship result who produces mutually, our design, synthetic, the another series of purifying fit, and the combining of detection and h-IgE.To these molecules and all derived molecules, avidity (K DThe molecule of)＜1nM or better molecule are used for further fit layout strategy.In the phase 2 that produces ARC1332-ARC1337 (sequence number 173-178), only use 2 '-the O-methyl replaces method, and the data in 1 are used to design the composition molecule of more senior modification mutually.Thiophosphatephosphorothioate fit also detected that has added the stabilization treatment that contains connection.Simple avidity the best is ARC1335 (sequence number 176) among these.
[00265] in the phase 3 (ARC1382-ARC1384, sequence number 179-181) of fit medical chemistry process and 4 (ARC1572-1573, sequence number 182-183) mutually, in ARC1335 (sequence number 176), further detects the thiophosphatephosphorothioate modification.ARC1384 (sequence number 181) is this limited average number and the molecule of the equilibrated between the maximum avidity (referring to Fig. 7) that can break thiophosphatephosphorothioate in fit.
[00266] in the building-up process of ARC445 and its derivative, observed peak is consistent with many polymeric subunits of ARC445 body in the high-effect liquid chromatography of ion-exchange.Fig. 8 is the embodiment of ARC445 and the high-effect liquid chromatography trace analysis of several derivative, because fit set shows multiplet.ARC445 has comprised 2 string guanosine residues at position 6-9 and 16-21.Although be not bound by any theory, any one in this 2 string or both may cause fit set.According to report, in same substantially mode, combine double-stranded MA and DNA bromination second pyridine fluorescence has just increased, combine G-tetrad (G-quartet) structure after N-methyl mesoporphyrin IX (NMM) fluorescence also increase.(people such as Arthanari, Nucleic Acids Research, 26 (16): 3724 (1996); People such as Marathais, Nucleic Acids Research, 28 (9): 1969 (2000); People such as Joyce, Applied Spectroscopy, 58 (7): 831 (2004)).As showing among Fig. 9, we use the NMM fluorescence to set up theoretical ARC445 and have in fact adopted the G-quarte structure.According to the document scheme, it is about 2 micromolar fit to use SpectraMaX Gemmi XS fluorescent plate reader to analyze among the Dulbecco ' s PBS that contains about 1 micromole NMM100 microlitre reactant and contain magnesium and calcium.Collect the 550 fluorescent emission chromatograms that arrive under 750nm and the stimulation of 405nm wavelength.The G-quartet structure of the fit ARC183 of anticoagulation enzyme dna is set up in document people such as (, Proc.Natl.Acad.Sci., 90:3745 (1993)) Macaya, therefore can be used as positive control (Figure 10) in this experiment.Figure 10 has shown and the similar fit predicted G-quartet of the containing structure that do not have of the ARC445 similar nucleosides composition of size, therefore has been used as negative control (Figure 10) in this experiment.From Fig. 9 and 10 as can be seen, compare with respect to the independent effect of NMM, the NMM fluorescence of ARC183 and ARC445 obviously increases, and ARCl 346 does not then increase.
[00267] except " the G-tetrad " in the NMM fluorescent test minimized with dG analogue replacement dG and monitoring, also (Dulbeccos PBS (contained Ca in the association reaction condition of preceding narration with the dot hybridization test ++" and Mg ++) added 0.1mg/mL BSA room temperature following 30 minutes) whether check dG analogue improved with the avidity of h-IgE and to the effect of h-IgE.The analogue of first test is deoxidation-7-denitrogenation G.Nitrogen the 7th of purine radicals is replaced by carbon, and G in the G-tetrad: G matches needed hydrogen bond receptor and effectively removed.Each G of ARC445 is replaced by 7-denitrogenation G in phase 5.1 (sequence number 184-201).As can be seen, observe in HPLC and the NMM fluorescence from Fig. 8 and 9, position 18-20 (ARC909-911, sequence number 191-193) has then removed fully by observed fit set among the HPLC after removing G N-7.These replace has also removed and the combining of h-IgE fully, has shown that as the binding curve as shown in Figure 11 this point is (referring to the K of report in the table 17 DValue).In HPLC, also observe the fit set of ARC912 (sequence number 194) and also significantly reduce, and kept to a certain extent and the combining of h-IgE.Based on ARC912 (sequence number 194) in conjunction with result and its HPLC, 3: 21 the mC in position: dG pairing is replaced by another Watson/Crick pairing base, to reduce many subunits set.This pairing does not have dG on position 21.In ARC1244-ARC1249 (sequence number 195-200), all carried out such operation, but do not produced any fit suitable of avidity with ARC445 (sequence number 101).Therefore this modification is abandoned as the ARC445 mode of modifying.
[00268] although do not wish to be subjected to theoretic restriction, the test that replaces dG with 7-denitrogenation-G has proposed a kind of viewpoint: 16 to 21 long G-sequence strings may be the reasons that causes collective phenomenon, the N-7 position of many residues of test is to combine necessary with the h-IgE high-affinity, by direct interaction of hydrogen bond or by and fit in the interaction of other residues, promotes fit functional folding.
[00269] in the phase 5.2 of fit medical chemistry process (sequence number 201-211), containing the fit following of ARCl 335 (sequence number 176), dG is replaced by the deoxidation xanthoglobulin.Because the deoxidation xanthoglobulin lacks the exocyclic amino group acid of finding in the pancreatic desoxyribonuclease, the hydrogen bond between single amino and the N7 is got rid of from each dG is replaced by the G-tetramer of dI.ARCs 1548, and 1552-1555 and 1562-1567 (sequence is respectively corresponding sequence number 201-211) have disclosed the SAR relation that dG is replaced by dI in conjunction with test, and almost to replace to the relation of 7-denitrogenation-G opposite with dG.The replacement of can not holding on the 6-9 of position in dI series then can be held on the 16-21 of position in various degree.
[00270] 5.2 result has caused under the ARC1384 condition containing the design that a plurality of dG replace with the composition molecule of dI replacement mutually.5.3 the result of (sequence number 212-219) has produced a large amount of fit, these are fit significantly to have improved avidity with respect to ARC445 (sequence number 101) and ARC1384 (sequence number 181).For example, Figure 12 describes, and detects ARC1666 (sequence number 216) by the NMM fluorescent test and has obviously reduced the tetrameric formation of G-.
[00271] in some embodiments, invention has comprised and contains table 17 and describe the fit of nucleotide sequence.In some embodiments, also comprise and contain 3 ' cap that table 17 is described fit nucleotide sequence, as reverse dT cap (3T)), and/or 5 ' amino (NH2) is modified, and there are not these modifications in the table 17, so that Chemical bond or be connected to the non-immunogenic composition of high molecular (that is, PEG) on.In other embodiments, the nucleotide sequence of table 17 description does not have 3 represented ' cap (that is 3 ' oppositely dT caps (3T)).Lowercase " f ', " m " and " d " represents 2 '-fluorine respectively, and 2-O-methyl and deoxidation are modified, and thiophosphoric acid replaces between nucleosides of " s " expression, and " I " expression xanthoglobulin replaces guanosine.
The sequence and the binding affinity of the adorned derivative of table 17:ARC445
Sequence number ARC# Sequence (5 '-3 '), (the reverse dT of 3T=), (T=dT), (s=thiophosphatephosphorothioate), (the mN representative contains 2 '-O Methyl residue) (the dI=representative contains the residue of Hypoxanthine deoxyriboside) (the X=representative contains the residue of the guanine of denitrogenation) K D (nM)
101 ARC445 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGdGmCmU 3
158 ARC1250 mAdGmCmCmUdGdGdGdGdAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 11
159 ARC1251 dAmGmCmCmUdGdGdGdGdAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 7
160 ARC1252 dAdGmCmCmUmGdGdGdGdAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 98
161 ARC1253 dAdGmCmCmUdGmGdGdGdAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 2
162 ARC1254 dAdGmCmCmUdGdGmGdGdAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 24
163 ARC1255 dAdGmCmCmUdGdGdGmGdAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 8
164 ARC1256 dAdGmCmCmUdGdGdGdGmAmCmCmC dAmUdGdGdGdGdGdGmCmU-3T 0.4
165 ARC1257 dAdGmCmCmUdGdGdGdGdAmCmCmC mAmUdGdGdGdGdGdGmCmU-3T 6
166 ARC1258 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUmGdGdGdGdGdGmCmU-3T 15
167 ARC1259 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGmGdGdGdGdGmCmU-3T 5
168 ARC1260 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGmGdGdGdGmCmU-3T 102
169 ARC1261 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGmGdGdGmCmU-3T 63
170 ARC1262 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGmGdGmCmU-3T 32
171 ARC1263 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGmGmCmU-3T 64
172 ARC1264 mAmGmCmCmUdGdGdGdGdAmCmCmC dAmUdGdGdGdGmGmGmCmU-3T 47
173 ARC1332 dAmGmCmCmUdGdGdGdGmAmCmCmC mAmUdGdGdGdGdGdGmCmU-3T 0.5
174 ARC1333 dAmGmCmCmUdGmGdGdGdAmCmCmC dAmUdGmGdGdGdGdGmCmU-3T 1.5
175 ARC1334 dAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGmGdGdGdGdGmCmU-3T 0.3
176 ARC1335 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGmGdGdGdGdGmCmU-3T 0.3
177 ARC1336 dA-s- mGmCmCmUdGmGdGdGmAmCmCmCm AmU-s-dG-s-mGdGdGdG-s-dGmCmU-3T No Binding
178 ARC1337 dA-s-mGmCmCmUdGmGdGdG-s- mAmCmCmCmAmU-s-dG-s-mGdG-s- dGdG-s-dGmCmU-3T 0.2
179 ARC1382 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmUdGmGdG-s-dGdG- s-dGmCmU-3T 1.1
180 ARC1383 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmU-s-dGmGdG-s- dGdG-s-dGmCmU-3T 1
181 ARC1384 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmU-s-dG-s-mGdG-s- dGdG-s-dGmCmU-3T 0.5
182 ARC1572 mAmGmCmCmU-s-dGmG-s-dG-s- dGmAmCmCmCmAmU-s-dGmG-s-dG-s- dG-s-dG-s-dGmCmU-3T 0.3
183 ARC1573 mAmGmCmCmU-s-dG-s-mG-s-dG-s- dGmAmCmCmCmAmU-s-dG-s-mG-s-dG- s-dG-s-dG-s-dG-s-mCmU-3T 0.4
184 ARC902 dAXmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGdGmCmU 9
185 ARC903 dAdGmCmCmUXdGdGdGsAmCmCmCd AmUdGdGdGdGdGdGmCmU 14
186 ARC904 dAdGmCmCmUdGXdGdGdAmCmCmCd AmUdGdGdGdGdGdGmCmU 8
187 ARC905 dAdGmCmCmUdGdGXdGdAmCmCmCd AmUdGdGdGdGdGdGmCmU 9
188 ARC906 dAdGmCmCmUdGdGdGXdAmCCmCd AmUdGdGdGdGdGdGmCmU 88
189 ARC907 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUXdGdGGdGdGmCmU 22
190 ARC908 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGXdGdGdGdGmCmU 3
191 ARC909 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGXdGdGdGmCmU No Binding
192 ARC910 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGXdGdGmCmU No Binding
193 ARC911 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGXdGmCmU No Binding
194 ARC912 dAdGmCmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGXmCmU 9
195 ARC1244 dAdGdGmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGmCmCmU 450
196 ARC1245 dAdGmGmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGmCmCmU 198
197 ARC1246 dAdGmUmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGdAmCmU 34
198 ARC1247 dAdGmUmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGmAmCmU 192
199 ARC1248 dAdGdAmCmUdGdGdGdGdAmCmCmGd AmUdGdGdGdGdGmUmCmU 38
200 ARC1249 dAdGmAmCmUdGdGdGdGdAmCmCmCd AmUdGdGdGdGdGmUmCmU 130
201 ARC1548 mAdImCmCmUdGmGdGdGmAmCmCmC mAmUdGmGdGdGdGdGmCmU-3T 3.3
202 ARC1552 mAmGmCmCmUdImGdGdGmAmCmCm CmAmUdGmGdGdGdGdGmCmU-3T No Binding
203 ARC1553 mAmGmCmCmUdGdIdGdGmAmCmCmC mAmUdGmGdGdGdGdGmCmU-3T No Binding
204 ARC1554 mAmGmCmCmUdGmGdIdGmAmCmCm CmAmUdGmGdGdGdGdGmCmU-3T No Binding
205 ARC1555 mAmGmCmCmUdGmGdGdImAmCmCm CmAmUdGmGdGdGdGdGmCmU-3T No Binding
206 ARC1562 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdImGdGdGdGdGmCmU-3T 0.6
207 ARC1563 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGdIdGdGdGdGmCmU-3T 2.2
208 ARC1564 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGmGdIdGdGdGmCmU-3T 0.5
209 ARC1565 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGmGdGdIdGdGmCmU-3T 1.4
210 ARC1566 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGmGdGdGdIdGmCmU-3T 0.1
211 ARC1567 mAmGmCmCmUdGmGdGdGmAmCmCm CmAmUdGmGdGdGdGdImCmU-3T 3.5
212 ARC1641 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmU-s-dG-s-mGdG-s- dGdI-s-dGmCmU-3T 0.4
213 ARC1642 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmU-s-dI-s-mGdG-s- dGdI-s-dGmCmU-3T 0.4
214 ARC1643 mAmGmCmCmU-s-dGmG-s-dG-s- dGmAmCmCmCmAmU-s-dGmG-s-dG-s- dG-s-dI-s-dGmCmU-3T 1.1
215 ARC1644 mAmGmCmCmU-s-dGmG-s-dG-s- dGmAmCmCmCmAmU-s-dImG-s-dG-s- dG-s-dI-s-dGmCmU-3T 1.7
216 ARC1666 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmU-s-dI-s-mGdI-s- dGdI-s-dGmCmU-3T 0.035
217 ARC1667 mAmGmCmCmUdGmGdG-s- dGmAmCmCmCmAmU-s-dG-s-mGdI-s- dGdI-s-dGmCmU-3T 0.4
218 ARC1728 mAmGmCmCmU-s-dGmG-s-dG-s- dGmAmCmCmCmAmU-s-dGmG-s-dI-s- dG-s-dI-s-dGmCmU-3T 2.3
219 ARC1729 mAmGmCmCmU-s-dGmG-s-dG-s- dGmAmCmCmCmAmU-s-dImG-s-dI-s- dG-s-dI-s-dGmCmU-3T 1
The fit medical chemistry of embodiment 2F:ARC656
[00272] by system's synthetic method, comprise fit heterogeneous syntheticly, purifying and in conjunction with activation analysis is discerned the ARC656 varient (sequence number 157) (describing as embodiment 2D) of the high potentiality of high stability.With contain the displacement of 2 ' of residue-O-methyl contain 2 of residue '-system's substitution method of deoxidation is a kind of basic skills that is used for significantly increasing blood plasma nuclease resistibility and overall stability.
[00273] in clone's monitoring that generates ARC656 (sequence number 157) and minimization process, fit relative binding ability (dot hybridization experiment measuring as described previously), ELISA, FACS, Histidine release test (following embodiment 3 describes) is all very consistent.Therefore, use dot hybridization to be used for characterizing the synthetic fit relative capacity of great majority in conjunction with the experiment of the binding affinity of test test experience varient and h-IgE.Chemosynthesis is fit, and the use denaturing polyacrylamide gel electrophoresis carries out purifying, 5 ' end-labelled γ- 32P ATP, test its to the direct bonding force of total man h-IgE to determine K D(contain Mg in aforesaid dot hybridization test at the PBS that Dulbecco ' s contains 0.1mg/ml BSA ++And Ca ++) in use protein titre { 30nM, 10nM, 3nM, 1nM, 300pM, 100pM, 30pM, 0pM} at 8.Use KaleidaGraph (KaleidaGraph v.3.51, Synergy Software) substitution formula y=(max/ (1+K/protem))+ymt to come calculating K DValue.Below table 18 listed synthetic, purifying, and with h-IgE bonded ARC445 derivative sequence, and protein bound characterization result.
[00274] comprise residue to replace the first step that deoxidation comprises the residue process be synthetic with 2 '-O-methyl and detect ARC1265-ARC1306 (sequence number 220-261) in conjunction with active, wherein each all to combine activity suitable with increasing ARC656 with 2 '-O-methyl residue replacement deoxidation residue.Binding data from table 18 as can be seen, some positions 2 '-O-methyl residue of holding is easily replaced the deoxidation residue, other then are not.The ARC656 skeleton district that is suggested 2 '-O-methyl residue of holding is replaced the deoxidation residue.In addition, mutually one also be included in fit skeleton district blocking-up deoxidation residue and replaced by 2 '-O-methyl residue.
[00275] based on the phase 1 structure-activity relationship result of fit medical chemistry design, design, synthetic, the another series of purifying fit, and detection combines situation with h-IgE.To having added fitly also detecting after the stable thiophosphoric acid that contains connection (ARC1391 (sequence number 266) and ARC1417 (sequence number 292)).Among these best aspect the simple avidity be ARC1410 (sequence number 285).Although many structures of many tests have all kept high relatively and avidity h-IgE (this point is very clearly), almost do not have to keep and the suitable avidity of female composition ARC656 (sequence number 157).
[00276] in some embodiments, invention has comprised that containing following table 18 describes the fit of nucleotide sequence.In some embodiments, table 18 is described fit nucleotide sequence and is also comprised 3 ' cap (3 ' reverse dT cap (3T)), and/or 5 ' amino (NH2) is modified, so that Chemical bond or be connected to the non-immunogen compound of high molecular (promptly, PEG) on, the nucleotide sequence that table 18 is described then lacks this modification.In other embodiments, the nucleotide sequence that table 18 is described does not have 3 represented ' cap (that is 3 ' oppositely dT caps (3T)).Nucleosides abbreviation A, C, G, or the lowercase before the T " f ', m " and " d " represent 2 '-fluorine respectively, modify, and thiophosphoric acid replaces between " s " expression nucleosides by 2-O-methyl and deoxidation.
Table 18: the sequence of modified derivative ACR656 and binding affinity
234 ARC1279 dGdGdGdGdCTdAdCTTTdATdCmCdGTTd CdCTdCdCTdAdGTdGdGdGTdAdGdCdCd CdC-3T 0.8
235 ARC1280 dGdGdGdGdCTdAdCTTTdATdCdCmGTTd CdCTdCdCTdAdGTdGdGdGTdAdGdCdCd CdC-3T 0.6
236 ARC1281 dGdGdGdGdCTdAdCTTTdATdCdCdGmU TdCdCTdCdCTdAdGTdGdGdGTdAdGdCd CdCdC-3T 0.1
237 ARC1282 dGdGdGdGdCTdAdCTTTdATdCdCdGTm UdCdCTdCdCTdAdGTdGdGdGTdAdGdCd CdCdC-3T 0.2
238 ARC1283 dGdGdGdGdCTdAdCTTTdATdCdCdGTTm CdCTdCdCTdAdGTdGdGdGTdAdGdCdCd CdC-3T 0.6
239 ARC1284 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CmCTdCdCTdAdGTdGdGdGTdAdGdCdCd CdC-3T 0.1
240 ARC1285 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCmUdCdCTddGTdGdGdGTdAdGdCd CdCdC-3T 0.8
241 ARC1286 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTmCdCTdAdGTdGdGdGTdAdGdCdCd CdC-3T 7
242 ARC1287 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCmCTdAdGTdGdGdGTdAdGdCdCd CdC-3T 1.0
243 ARC1288 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCmUdAdGTdGdGdGTdAdGdCd CdCdC-3T 2
244 ARC1289 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTmAdGTdGdGdGTdAdGdCdCd CdC-3T No Binding
245 ARC1290 dGdGdGdGdCTdAdCTTTdATdCdCdZGTTd CdCTdCdCTdAmGTdGdGdGTdAdGdCdCd CdC-3T No Binding
246 ARC1291 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGmUdGdGdGTdAdGdCd CdCdC-3T No Binding
247 ARC1292 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTmGdGdGTdAdGdCdCd CdC-3T 22
248 ARC1293 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGmGdGTdAdGdCdCd CdC-3T No Binding
249 ARC1294 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGmGTdAdGdCdCd CdC-3T 8
250 ARC1295 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGmUdAdGdCd CdCdC-3T 3
251 ARC1296 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTmAdGdCdCd CdC-3T 1.2
252 ARC1297 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTdAmGdCdCd CdC-3T 0.8
253 ARC1298 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTdAdGmCdCd CdC-3T 0.4
254 ARC1299 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTdAdGdCmCd CdC-3T 0.5
255 ARC1300 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTdAdGdCdCm CdC-3T 0.7
256 ARC1301 dGdGdGdGdCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTdAdGdCdCd CmC-3T 0.5
257 ARC1302 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGmGTmAmGdC dCdCdC-3T 19
258 ARC1303 dGdGdGdGmCmUdAmCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGdGmUdAdGm CmCmCmC-3T 1.3
259 ARC1304 mGmGmGmGdCTdAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGdGTdAdGmC mCmCmC-3T 0.6
260 ARC1305 mGmGmGmGmCTdAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGdGTdAmGmC mCmCmC-3T No Binding
261 ARC1306 mGmGmGmCTdAdCTTTdATdCdCdGTTd CdCTdCdCTdAdGTdGdGdGTdAmGmCmC mC-3T 14
262 ARC1387 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGdGTdAmGmC mCmCmC-3T 2.4
263 ARC1388 mGmGmGmGmCmUmAmCTTTdATdCdC dGTTdCdCTdCdCTdAdGTdGdGdGTdAm GmCmCmCmC-3T 4.4
264 ARC1389 mGmGmGmGdCTmAdCTTmUdATdCdCd GmUmUdCmCTdCdCTdAdGTdGdGdGTd AmGmCmCmCmC-3T 5.4
265 ARC1390 mGmGmGmGmCmUmAmCTTmUdATdCd CdGmUmUdCmCTdCdCTdAdGTdGdGdG TdAmGmCmCmCmC-3T 17
266 ARC1391 mGmGmGmGdCTmAdC-s- TTTdATdCdCdGTTdCdCTdCdCTdAdGTd GdGdGTdAmGmCmCmCmC-3T 4.4
267 ARC1392 mGmGmGmGdCTmAdCT-s- TTdATdCdCdGTTdCdCTdCdCTdAdGTdG dGdGTdAmGmCmCmCmC-3T 3
268 ARC1393 mGmGmGmGdCTmAdCTT-s- TdATdCdCdGTTdCdCTdCdCTdAdGTdGd GdGTdAmGmCmCmCmC-3T No Binding
269 ARC1394 mGmGmGmGdCTmAdCTTT-s- dATdCdCdGTTdCdCTdCdCTdAdGTdGdG dGTdAmGmCmCmCmC-3T 8.1
270 ARC1395 mGmGmGmGdCTmAdCTTTdA-s- TdCdCdGTTdCdCTdCdCTdAdGTdGdGdG TdAmGmCmCmCmC-3T 5.7
271 ARC1396 mGmGmGmGdCTmAdCTTTdAT-s- dCdCdGTTdCdCTdCdCTdAdGTdGdGdGT dAmGmCmCmCmC-3T 2
272 ARC1397 mGmGmGmGdCTmAdCTTTdATdC-s- dCdGTTdCdCTdCdCTdAdGTdGdGdGTdA mGmCmCmCmC-3T 1.8
273 ARC1398 mGmGmGmGdCTmAdCTTTdATdCdC-s- dGTTdCdCTdCdCTdAdGTdGdGdGTdAm GmCmCmCmC-3T 2.7
274 ARC1399 mGmGmGmGdCTmAdCTTTdATdCdCdG- s- TTdCdCTdCdCTdAdGTdGdGdGTdAmGm CmCmCmC-3T 1.8
275 ARC1400 mGmGmGmGdCTmAdCTTTdATdCdCdGT -s- TdCdCTdCdCTdAdGTdGdGdGTdAmGmC mCmCmC-3T 2.4
276 ARC1401 mGmGmGmGdCTmAdCTTTdATdCdCdGT T-s- dCdCTdCdCTdAdGTdGdGdGTdAmGmCm CmCmC-3T 2
277 ARC1402 mGmGmGmGdCTmAdCTTdATdCdCdGT TdC-s- dCTdCdCTdAdGTdGdGdGTdAmGmCmC mCmC-3T 2.1
278 ARC1403 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdC-s- TdCdCTdAdGTdGdGdGTdAmGmCmCmC mC-3T Not Done
279 ARC1404 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCT-s- dCdCTdAdGTdGdGdGTdAmGmCmCmCm C-3T 1.8
280 ARC1405 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdC-s- dCTdAdGTdGdGdGTdAmGmCmCmCmC- 3T 2.5
281 ARC1406 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdC-s- TdAdGTdGdGdGTdAmGmCmCmCmC-3T 3.2
282 ARC1407 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCT-s- dAdGTdGdGdGTdAmGmCmCmCmC-3T 1.8
283 ARC1408 mGmGmGmGdCTmAdCTTdATdCdCdGT TdCdCTdCdCTdA-s- dGTdGdGdGTdAmGmCmCmCmC-3T 1
284 ARC1409 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdG-s- TdGdGdGTdAmGmCmCmCmC-3T Not Done
285 ARC1410 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGT-s- dGdGdGTdAmGmCmCmCmC-3T 0.7
286 ARC1411 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdG-s- dGdGTdAmGmCmCmCmC-3T 5.4
287 ARC1412 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdG-s- dGTdAmGmCmCmCmC-3T 2.5
288 ARC1413 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGdG-s- TdAmGmCmCmCmC-3T 3.3
289 ARC1414 mGmGmGmGdCTmAdCTTTdATdCdCdGT TdCdCTdCdCTdAdGTdGdGdGT-s- dAmGmCmCmCmC-3T 2.9
290 ARC1415 mGmGmGmGdCTmAdCT-s-TTdA-s-TdC- s-dCdGTT-s-dCdCT-s-dCdCT-s-dAdGT-s- dGdGdG-s-TdAmGmCmCmCmC-3T 1.2
291 ARC1416 mGmGmGmGmCmUmAmCT-s-TTdA-s- TdC-s-dCdGTT-s-dCdCT-s-dCdCT-s- dAdGT-s-dGdGdG-s-TdAmGmCmCmCmC- 3T No Binding
292 ARC1417 mGmGmGmGmCmUmAmCT-s-TmUdA-s- TdC-s-dCdGmUmUdCmCT-s-dCdCT-s- dAdGT-s-dGdGdG-s-TdAmGmCmCmCmC- 3T 27
Embodiment 2G: fit-5 '-PEG linker synthetic
[00277] (GE Healthcare on AKTA OligoPilot 100 synthesizers, Uppsala, Sweden), according to 2 of the purchase of recommending service routine use standard,-oxygen-methyl MA, deoxidation xanthoglobulin and DNA phosphoramidite (Glen Research, Sterlmg, VA) and oppositely deoxythymidine CPG supports synthetic oligonucleotide 5 ' NH2 mA mG mC mC mU dG mG dG-s-dG mA mC mC mCmA mU-s-dI-s-mG dI-s-dG dI-s-dG mC mU-idT 3 ' (ARC 1666, sequence number 216).Terminal amino functional groups and 5 '-(Glen Research, Sterlmg VA) connect amino-modification C6-TFA.Go after the protection, oligonucleotide carries out purifying through ion-exchange chromatography Super Q 5PW (30) resin (Tosoh Biosciences), and uses ethanol sedimentation.
[00278] after synthetic 5 ' amido modified fit component is connected to (as 40kDa, 60kDa PEG group) on the different PEG groups.Fit being dissolved in water/DMSO (1: 1) solution, concentration is between 1.5 to 3mM.Add sodium carbonate buffer, pH8.5, up to final concentration is 100mM, have only a few molecules and 1.7-3 doubly to react (promptly to the molecule of purpose PEG reagent, 40 kDa Sunbright GL2-400NP p-oil of mirbane carbonic ethers [NOF Corp, Japan], 40kDa or 60kDa mPEG2-NHS ester [Nektar, Huntsville AL]), purpose PEG agent dissolves is in isopyknic acetonitrile.40kDa that produces or 60kDa PEGization product are gone up purifying at ion-exchange chromatography Super Q 5PW (30) resm (Tosoh Biosciences), use reverse-phase chromatography Amberchrom CG300-S resm (Rohm and Haas) to go up desalination, and freezing doing.
[00279] the fit sequence of the PEGization of Chan Shenging is listed in the table below in 19.Lowercase " f ", " m " and " d " represents 2 '-fluorine respectively, and 2-O-methyl and deoxidation are modified, and phosphoric acid replaces between " s " expression nucleosides, " I " expression xanthoglobulin replacement guanosine, the amino that chemistry connects is convenient in " NH " expression, " 3T " expression 3 ' reverse dT.
Table 19: 5 ' PEG linker of the fit ARC1666 of anti-IgE
ARC1787(SEQ ID NO 293)
40K-NH-mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-dGmCmU-3T
ARC1788(SEQ ID NO 294)
60K-NH-mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-dGmCmU-3T
[00280] 5 ' PEGization product is to the almost not effect of fit function, and this is to measure by the detection based on cell that following embodiment 3 describes.
Embodiment 2H: fit-3 '-5 '-PEG linker synthetic
[00281] according to the 2 '-oxygen-methyl MA that recommends service routine employing standard to buy, phosphoric acid in deoxidation xanthoglobulin and the DNA (Glen Research, Sterlmg, VA) and 3 '-phthalimide-amino-modification C6 CPG is supported in (GE Healthcare Uppsala, Sweden) synthetic oligonucleotide 5 ' NH2 mA mG mC mC mU dG mG dG-s-dG mA mC mC mC mA mU-s-dI-s-mG dI-s-dG dI-s-dG mC mU-NH in the AKTA OligoPilot100 synthesizer 23 ' (ARC1784, sequence number 297).Terminal amino group acid functional group and 5 '-amino-(Glen Research, Sterlmg VA) is connected to modify basic C6-TFA.Go after the protection, oligonucleotide is through ion-exchange chromatography Super Q 5PW (30) resm (Tosoh Biosciences) and ethanol sedimentation and then purifying.
[00282] after synthetic with 3 '-5 '-diamino modifies fit component and is connected to (20kDa and 30kDa PEG group) on the different PEG groups.With 1.5 and 3mM fit be dissolved in the solution of water/DMSO (1: 1).Add sodium carbonate buffer, pH8.5, up to final concentration is 100mM, have only a small amount of with 2.7-3.5 times to the molecule (e.g. of purpose PEG reagent, 20kDa or 30kDa Sunbright GL2-400NP p-oil of mirbane carbonic ether [NOF Corp, Japan]) to react and spend the night, purpose PEG agent dissolves is in isopyknic acetonitrile.2 * the 20kDa that produces or the product of 2 * 30kDa PEGization are at Super Q 5PW (30) resm (Tosoh Biosciences) purifying on ion-exchange chromatography, use reverse-phase chromatography Amberchrom CG300-S resin (Rohm and Haas) to go up and remove freshen, and freezing doing.
[00283] the fit sequence of two PEGization of Chan Shenging is listed in the table below in 20.Lowercase " f ", " m " and " d " represents 2 '-fluorine respectively, and 2-O-methyl and deoxidation are modified, and thiophosphoric acid replaces between " s " expression nucleosides, and " I " expression xanthoglobulin replaces guanosine, and the amino that chemistry connects is convenient in " NH " expression.
Table 20: anti-IgE is fit 3 of ARC 1666 '-5 '-PEG linker
ARC 1785 (SEQ ID NO 295)
PEG20K-NH-mAmGmCmCmUdGmGdG-s-dGmAmCmCmGmAmU-s-dI-s-mGdI-s-dGdI-s-dGmCmU-NH-
PEG20K
ARC1790(SEQ ID NO 296)
PEG30K-NH-mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-dGmCmU-NH-
PEG30K
[00284] 3 '-5 ' PEGization has influence seldom to fit function or does not influence, this result that detects based on cell experiment that following embodiment 3 describes.
Embodiment 3: the functional cell test
Embodiment 3A: acceptor (Fc ε R1) is in conjunction with suppressing ELISA
[00285] adopt one group of rRfY IgE of ELISA experimental test fit (example I A describes) to suppress the ability of h-IgE and soluble monomeric Fc ε R1 α (indoor purifying) formation mixture.4 ℃ of cultivations are spent the night in the hole of Fc ε R1 among the IX PBS (100 μ L, 10 μ g/mL) in Nunc Maxisorb 96 orifice plates, so that it is adsorbed in hole surface.Remove supernatant, with 120 μ l IX PBS solution washing holes three times, and with 300mL IX PBS and 0.2%Tween-20 4 ℃ of following closed poress two hours.Use IX PBS washing hole three times after the sealing.And then the fit of different concns cultivated 30 minutes under the room temperature in 100 μ L PBS and 0.05%Tween-20 with 0.5nM h-IgE, then mixed solution joined in the test hole and also at room temperature cultivated one hour.With 120 μ L IX PBS washing holes five times.(goat-anti people IgE-HRP (074-1004) (KPL, Gaithersburg, MD)) detects bonded h-IgE to anti-h-IgE polyclonal antibody by adding the HRP mark.(Pierce, Rockford IL) also at room temperature cultivated 15 minutes to add 100 μ l Quantablue substrate in each hole.In every hole, add the stop bath that 100 μ l provide again.Plate uses the SpectraMax 96 orifice plate readers stimulation of 325nm and 420nm respectively/disperse down and read.The relative fluorescence unit in each hole (RFU) is used for calculating IC 50Following table 21 shows the IC that calculates 50, the different fit inhibition of expression rRfY screening to Fc ε RI α acceptor.
Table 21 acceptor (Fc ε R1) is fit in conjunction with inhibition-rRfY
Sequence number IC50(nM)
11 2.6
12 5.0
13 4.3
14 26.8
18 51.3
21 3.7
19 7.4
Embodiment 3B:FACS suppresses acceptor (Fc ε R1) combination
[00286] detect one group and represent rRfY, the fit inhibition h-IgE of dRmY and DNA composition is in conjunction with the ability of Fc ε R1, and Fc ε R1 is at mouse basophilia leukemia (RBL) cell surface expression.The SX38 cell be RBL clone (Harvard University, Cambridge, expression h-IgE acceptor α that MA) can be stable, β and γ chain are used for streaming hemocyte h-IgE in conjunction with test.Cell is spent 5%CO at the low Eagle of the limiting the quantity of substratum (MEM) that contains 16% fetal bovine serum (FBS) and 1mg/mL G418 (Mvitrogen) 37 2Condition under cultivate.The SX38 cell contain 1%BSA (Sigma, St.Louis, MO) and 0.03%NaAzide (FACs buffer) (VWR, WestChester, PA) among the 1 X DPBS, 1,000,000 cells are divided exactly by suitable number of perforations on the 96 orifice plate plates, and cultivate 30 minutes on ice.Fit and the h-IgE of every kind of concentration (hatched on ice 30 minutes for Athens Research and Technology, Athens by 2X mixed solution GA).Fit and mixture h-IgE join in the SX38 cell obtaining the IX final concentration, and cultivate 30 minutes on ice again.Detect down final concentration scope fit in 0-1 μ M at 3 μ g/mLh-IgE (15nM).Then with FACs washed cell 3X not remove not the h-IgE with receptors bind.In order to detect the h-IgE combination, (QED Biosciences, San Diego CA) join cell to anti-h-IgE-FITC antibody, and cultivate 30 minutes on ice.After the cultivation, cell washs 3 times to remove unconjugated antibody with the FACs damping fluid.Cell suspends in the FACs damping fluid and (BD Biosciences, San Jose CA) analyze with FACSCAN.H-IgE separately and the natural mixture of h-IgE included negative control and positive control respectively.Recently measure the fit activity of h-IgE by calculating h-IgE and cell bonded inhibition percentage.The average fluorescent strength value is used for calculating inhibition per-cent.Table 22 has shown the selecteed various rRfY that calculate by the FACS test, the IC of dRmY and dna clone 50
Table 22FACS test rRfY, dRmY, dna clone: acceptor (FceR1) is in conjunction with suppressing
Sequence number ARC# Composition IC 50(nM)
12 rRfY 7.1
11 rRfY 14
21 rRfY 14.4
18 rRfY 35
13 rRfY 10.3
19 rRfY 9.9
14 rRfY 17.3
91 rRfY 3.8
93 rRfY 12.5
98 ARC442 dRmY 58.9
99 ARC443 dRmY 30.2
100 ARC444 dRmY 52.4
102 ARC445 dRmY 22.6
102 ARC446 dRmY 33.8
149 DNA 55.9
149(with 3’idT) DNA 35.8
152 DNA 17.4
151 DNA 17.1
151(with 3’idT) DNA 10.6
155 DNA 14.4
156 DNA 9.7
*IdT: identical sequence 3 ' end is the le 3 '-endN.D. that contains reverse dT residue: do not determine
[00287] uses above-mentioned FACS test and following modification: several modified derivatives of ARC 445 (sequence number 101) (describing) and ARC 656 (sequence number 157) (describing among the embodiment 2D) are tested the combination that detects its h-IgE acceptor (FceR1) suppress in embodiment 2E.To every kind of fit concentration, (GA) mixture of 2X was cultivated on ice 30 minutes for Athens Research and Technology, Athens for fit and h-IgE; Mixture fit and h-IgE adds in the SX38 cell, and final concentration is IX, cultivates on ice 2 hours again; Under 0.5 μ g/mL h-IgE (2.5nM), detect the fit concentration at end between the 0-1 μ M.The IC that calculates 50Value is summarised in the table 23.
The modified derivative of table 23:ARC445; FACS tests ARC656: acceptor (FceR1) is in conjunction with suppressing
Sequence table ARC# FACsIC50 (nM)
101 ARC445 10.8
176 ARC1335 7.3
178 ARC1337 4.7
179 ARC1382 6.9
180 ARC1383 7.5
181 ARC1384 4.4
182 ARC1572 22.8
183 ARC1573 69.4
212 ARC1641 1.8
213 ARC1642 1.8
214 ARC1643 8.0
215 ARC1644 5.2
216 ARC1666 1.7
217 ARC1667 2.3
218 ARC1728 13.2
219 ARC1729 2.9
157 ARC656 21.2
[00288] in embodiment 2G and 2H, describe be connected with PEG fit under following condition, all be activated in the FACS test.The IC that calculates 50Value is summarised in the following table 24.From the data of table 24 as can be seen, dissimilar PEG linkers work to fit function almost.
Table 24:
Sequence number PEG ARC# FACSIC 50(nM)
295 2 * 20kDa (linear) ARC1785 2.0
296 2 * 30kDa (linear) ARC1790 0.89
293 The 40kDa ramose ARC1787 1.2
294 The 60kDa ramose ARC1788 1.2
Embodiment 3C: the cross reaction of fit and macaque IgE
[00289] employing ELISA detects the ability of testing fit inhibition macaque IgE and Fc ε R1 α-Fc association formation.4 ℃ of cultivations are spent the night to be adsorbed in the surface in the hole of Fc ε R1 α-Fc among the 1 X PBS (100mL, 5 μ g/mL) in Nunc Maxisorb 96 orifice plates.Remove supernatant, also use 300mL 1X PBS and two hours closed poress of 0.2%Tween-20 degree three times with 120 μ l, 1 X PBS washing hole.With 120 μ L, 1 X PBS washing hole.And then the fit of different concns cultivated 30 minutes containing under 100 μ L PBS (or serum of macaque (Sigma) is diluted to 10% equally) room temperature of 0.5ng h-IgE, then mixed solution joined in the test hole and at room temperature cultivated one hour.With 120 μ L, 1 X PBS washing hole five times.(goat-anti IgE-HRP (074-1004) (KPL, Gaithersburg, MD)) detects bonded h-IgE to anti--h-IgE polyclonal antibody by adding the HRP mark.(Pierce, Rockford IL) detect peroxidase activity to use the Quantablue substrate.Adding 100 μ l peroxidase substrate in every hole also at room temperature cultivated 15 minutes.In every hole, adding the stop bath that 100 μ l provide, stimulating/disperse down at 325nm and 420nm respectively and use SpectraMax 96 orifice plate readers to read.The relative fluorescence unit in every hole (RFU) is used for calculating IC50 ' s.
[00290] have nucleotide sequence be the DNA of sequence number 149 (contain 3 ' oppositely deoxythymidines) and sequence number 151 (3 '-3 ' reverse deoxythymidine) fit and with nucleotide sequence be that the rRfY of sequence number 90 and sequence number 93 is fit respectively under 250nM and 1 μ M concentration, do not suppress monkey and be attached on the Fc ε R1-Fc, and the dRm of nucleotide sequence ARC445 (sequence number 101) and ARC1666 (sequence number 216)
Figure A20058002136601311
Fit interact (ARC445, the monkey IC of then blocking probably 50=161nM; People IC 50=63nM; ARC1666, monkey IC 50=8nM; People IC 50=5nM), show that cross reaction takes place for this molecule and macaque IgE and people IgE.Other control experiment shows that ARC445 under this detecting pattern does not suppress the detection of monkey IgE.
[00291] Figure 13 has shown rRfY, and dRmY and DNA minimize fit possible secondary structure.The FACS test shows that DNA minimizes fit blocking-up IgE:Fc ε R1 bonded possibility maximum.Left sided sequence number 91 (rRfY), the residue of listing are 2 '-F; Middle: ARC445 (sequence number 101) (dRmY), the residue of underscore is 2 '-deoxidation, the residue of listing is 2 '-OMe; Right ARC475 (sequence number 151) (DNA), underscore residue 2 '-deoxidation.
Embodiment 3D: Histidine discharges and suppresses
[00292] (Dana Farber Cancer Mstitute, Boston MA) tests by using Histidine to discharge chemical examination SX38 cell based on the fit cytoactive of IgE.The SX38 cell is energy stably express people h-IgE acceptor α, the RBL clone of β and γ chain.Because containing the SX38 cell conditioned medium liquid of h-IgE and anti--h-IgE cross connection antibody contains than the fit more Histidine of cell of being blocked, use competitive Histidine ELISA (Immuno-Biological Laboratories, Mmneapolis, MN) quantitatively be released into h-IgE and h-IgE cross connection antibody+/-Histidine in the SX38 cell conditioned medium liquid of the fit processing of IgE.
[00293] each contains in MEM and the 16%FBS hole and all spreads into (200,000) SX38 cell on 24 orifice plates the day before yesterday in experiment.Second day, (AthensResearch and Technology, Athens GA) cultivated 30 minutes in MEM and 16%FBS for fit (it is 8 titration of solution that 1 μ M begins 2 times of dilutions) of suitable concentration and 3ug/mL h-IgE.Then mixed solution is joined in the SX38 cell at 37 ℃ 5%CO 2The middle cultivation 30 minutes.Every kind of concentration all detects 1/4th.Use MEM and 16%FBS washed cell three times, and then add at MEM and to cultivate again among the 16%FBS 5.5 hours.(QED Biosciences, San Diego CA) join on the cell culture medium of 1ug/mL concentration and cultivated 2 hours again h-IgE cross connection antibody.It is freezing at-20 ℃ to collect supernatant before Histidine ELISA uses.Histidine ELISA recommends usage according to using.Separately h-IgE and h-IgE with respect to natural mixture by respectively as the positive and negative control.The inhibition percentage that is released into supernatant by the mensuration Histidine is recently measured the fit activity of IgE, shows (wherein ARC445 is a sequence number 101, and ARC656 is a sequence number 157, and ARC714 is non-binding negative control) as Figure 14.
[00294] ARC445 (sequence number 101) (embodiment 2E description) and DNA are fit, several modified derivatives also are used to test the ability that it suppresses above-mentioned SX38 groups of cells propylhomoserin release among the ARC656 (sequence number 157) (embodiment 2D description), measure the IC of ARC445 derivative 50Be summarised in the table 25.
Table 25:ARC445 modified derivative; Histidine discharges and suppresses in the ARC656:SX38 cell
Sequence number ARC# Histamine release IC 50 (nM)
101 ARC445 31.28
176 ARC1335 33.69
181 ARC1384 59.0
216 ARC1666 19.4
157 ARC656 16.9
Embodiment 4:PK research
[00295] among the embodiment 4, all concentration datas based on quality only are meant the molecular mass of fit oligonucleotide part, and are irrelevant with the quality of PEG linker.
Embodiment 4A: the fit plasma stability of anti-IgE
One group of [00296] identifying in the fit medical chemistry process of detection is fit at people and mouse blood plasma amplifying nucleic acid enzyme stability.On following denaturing polyacrylamide gel electrophoresis, measure the blood plasma nuclease degradation.Briefly, use denaturing polyacrylamide gel electrophoresis to come the fit of purifying chemosynthesis, 5 ' end mark γ- 32P ATP, gel-purified then is to measure plasma stability.The 32-P mark of trace is fit in contain in unmarked fit 95% human plasma of 100nM (or 95% mouse blood plasma) the 200 microlitre ligations and cultivate.The reaction of time zero branches away separately, usefulness be identical PBS of composition rather than blood plasma.This has guaranteed amount or the radiant unanimity on the gel in the experiment.Unless otherwise specified, reaction solution cultivates 1,3,10,30 and 100 hours in 37 ℃ of thermal cyclers.On each time point, remove the reaction solution of 20 microlitres, upload dyestuff quick-frozen and be stored in-20 ℃ in liquid nitrogen with 200 microlitre methane amides.After last point has been got, take out the sample freeze and remove 20 microlitres from each time point.Adding SDS is 0.1% up to final concentration in a small amount of sample.Sample was cultivated 10-15 minute at 90 ℃ then, and directly was written on 15% denaturing polyacrylamide gel 12W leakage of electricity swimming 35 minutes.Use Storm 860 phosphoroimager systems (Amersham Biosciences, Piscataway, NJ) radiant on the next quantitative gel.Quantize 0 hour fit band of time point total length and also divide exactly, thereby determine that go up the fit per-cent of total length at every with the path number.The fit percentage ratio of total length on each time point standardizes then to the 0 hour fit per-cent of time point total length.Fit total length percentage ratio and each time are gone up the function relationship coincidence formula:
ml*e^(-m2*m0)
Wherein ml is the maximum % (ml=100) of fit total length; M2 is a degradation rate.
Fit transformation period (T 1/2) equate with (ln2)/m2.
[00297] Figure 15 a and 15b have shown sample data, and the result that check is is summarised in the table 26.Consistent, fit stable in human plasma than in mouse blood plasma with our expection, the number of modification that increases stabilization treatment in the sugared phosphate backbone is relevant with the increase plasma stability.
Table 26:ARC445 and ARC656 derivative plasma stability
Sequence table ARC# Transformation period in mouse blood plasma (hour) Transformation period in human plasma (hour)
101 ARC445 2.2 Not done
176 ARC1335 16 Not done
178 ARC1337 29 Not done
179 ARC1382 16 Not done
180 ARC1383 26 Not done
181 ARC1384 22 149
182 ARC1572 62 339
183 ARC1573 74 ＞500
216 ARC1666 11 49
219 ARC1729 42 180
157 ARC656 Not done 6
285 ARC1410 Not done 9
Embodiment 4B: anti-IgE is fit with respect to the PEGization product behind the mouse IV administration 10mg/kg: ARC1785, ARC1787, the pharmacokinetics of ARC1788 and ARC1790
[00298] Figure 16 has shown Muridae intravenously administrable ARC1785, ARC1787, ARC1788 and ARC1790 pharmacokinetic.Briefly, this research is formed (amounting to 33 animals) by three groups.On each sample collecting time point, put to death three animals, the aperture by heart collects 0.5mL whole blood collection blood plasma.Be mixed with the injection reagent that final concentration is 10mg/mL (an oligonucleotide concentration) with standard 0.9% salt with freeze dried powder is fit, and before administration sterilising filtration.Dosage regimen is single vein pill injection, and dosage is 10mg/kg.On specified time point, before the t=administration, 0.08,0.5,1,2,4,8,16,24, obtained whole blood samples in 32,48 and 72 hours and directly transfer in the test tube of K2EDTA absorption, oppositely mix and be placed on ice.
[00299] blood-EDTA test tube 3500rpm was collected blood plasma in centrifugal 5 minutes.Plasma sample is transferred to the 1.5mL test tube of new mark and is stored in-80 ° of C before analyzing.Use the identical fit concentration of methods analyst blood plasma, directly the blood plasma with aliquot joins the fluorescence nucleic acid detection reagent Oligreen that contains direct purchase TM(Molecular Probes, Eugene is in test holes OR).Simply cultivate under the room temperature (5 minutes), lucifuge uses the fluorescence flat bed reader to read check-out console.The fluorescent signal in each hole is directly proportional with fit concentration in the hole, comes calculation sample concentration (mean value is from dual curve) by add fluorescent value on the fluorescence concentration standard curve.Every group of three animal obtain mean plasma concentration and the time post dose plots Figure 17 at each time point.
[00300] plasma concentration and time data will use industrial standards pharmacokinetic model software WmNonLm TMV.4.0 (Pharsight Corp., Mountam View CA) carry out non-division analysis (NCA).Main pharmacokinetic parameter below can estimating: maximal plasma concentration, Cmax; Area under the concentration-time curve AUC; T1/2, t 1/2Rate is known, Cl in whole end; The steady state volume of distribution, Vss.Use WmNonLm TMV.4.0 (Pharsight Corp., Mountam View, CA).Analyze (NCA) non-division analytical data, obtained the estimated value of the main pharmacokinetic parameter that time Figure 20 lists.
Embodiment 4C: anti-after the mouse SC administration (10mg/kg)-IgE is fit with respect to PEG Change product: ARC1785, ARC1787, the medicine of ARC1788 and ARC1790 is for moving Mechanics and bioavailability
[00301] Figure 18 has shown by the ARC1785 in the intravenous injection administration research muroid pharmacokinetics, ARC1787, the design of the bioavailability of ARC1788 and ARC1790.Briefly, this research is formed (33 animals) by three groups.On each sample collecting time point, put to death three animals, the whole blood of gathering 0.5mL by the heart aperture is to collect blood plasma.Use standard 0.9% salt is mixed with the injection liquid that final concentration is 10mg/mL (an oligonucleotide concentration) with dry powder is fit, and sterilization (0.2 μ m) before injection.The administration route is a simple subcutaneous injection medicine, and dosage is 10mg/kg.On specified time point, before the t=administration, 0.08,0.5,1,2,4,8,16,24,32,48 and 72 hours, obtain whole blood sample and also directly transfer in the test tube of K2EDTA absorption, the reversing mixing is placed on ice.
[00302] blood-EDTA test tube 3500rpm was collected blood plasma in centrifugal 5 minutes.Plasma sample is transferred to the 1.5mL test tube of new mark and is stored in-80 ° of C before analyzing.Making uses the same method analyzes fit concentration in the different plasma samples, directly blood plasma is joined the fluorescence nucleic acid detection reagent Oligreen that contains purchase TM(MolecularProbes, Eugene is in hole OR).Cultivate under the room temperature (5mm), lucifuge, check-out console uses the fluorescence flat bed reader to read.The fluorescent signal in each hole is directly proportional with fit concentration in the hole, comes calculation sample concentration (mean value is from dual curve) by using the fluorescent value of adding on the fluorescence concentration standard curve.Each time point obtains mean plasma concentration and the time post dose plots Figure 19 in every group of three animals.
[00303] plasma concentration and time data will use industrial standards pharmacokinetic model software WmNonLm TMV.4.0 (Pharsight Corp., Mountam View CA) carry out non-division analysis (NCA).Main pharmacokinetic parameter below can estimating: maximal plasma concentration, Cmax; Area under the concentration-time curve AUC; T1/2, t1/2; Rate is known, Cl in whole end; The steady state volume of distribution, Vss.The whole WmNonLm that uses TMV.4.0 (Pharsight Corp., Mountam View, CA).Analyze the estimation that (NCA) data have generated the main pharmacokinetic parameter that Figure 20 lists, all PEG connect the fit detected subcutaneous bioavailability that shown.
[00304] the present invention has been used the formal description of written description and embodiment, those of ordinary skills can recognize that the present invention can use in multiple embodiments, and top description and embodiment are not to be the restriction of claims for explanation.
Sequence table
＜110〉Archemix Corp.
＜120〉the specific nucleic acid part of immunoglobulin E and as the application of atopic disease therapeutics
<130>23239-581-061
<150>60/565,601
<151>2004-04-26
<150>60/574,120
<151>2004-05-24
<150>60/581,865
<151>2004-06-22
<150>60/660,204
<151>2005-03-07
<160>298
<170>Patentln version 3.3
<210>1
<211>93
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(25)..(54)
＜223〉n is a, t, c, or g
<400>1
catcgatgct agtcgtaacg atccnnnnnn nnnnnnnnnn nnnnnnnnnn nnnncgagaa 60
cgttctctcc tctccctata gtgagtcgta tta 93
<210>2
<211>92
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(24)..(53)
＜223〉n represents a, t, c, or g
<400>2
catgcatcgc gactgactag ccgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnngtagaac 60
gttctctcct ctccctatag tgagtcgtat ta 92
<210>3
<211>92
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(24)..(53)
＜223〉n represents a, t, c, or g
<400>3
catcgatcga tcgatcgaca gcgnnnnnnn nnnnnnnnnn nnnnnnnnnn nnngtagaac 60
gttctctcct ctccctatag tgagtcgtat ta 92
<210>4
<211>10
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic immunostimulation motif
<400>4
aacgttcgag 10
<210>5
<211>88
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(25)..(64)
＜223〉n represents a, t, c, or g
<400>5
gggaaaagcg aatcatacac aagannnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60
nnnngctccg ccagagacca accgagaa 88
<210>6
<211>41
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>6
taatacgact cactataggg aaaagcgaat catacacaag a 41
<210>7
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>7
ttctcggttg gtctctggcg gagc 24
<210>8
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(25)..(64)
＜223〉n is a c, u, or g
<400>8
gggaaaagcg aaucauacac aagannnnnn nnnnnnnnnn nnnnnnnnnn nnnnnnnnnn 60
nnnngcuccg ccagagacca accgagaa 88
<210>9
<211>24
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic FX
<400>9
gggaaaagcg aaucauacac aaga 24
<210>10
<211>24
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic FX
<400>10
gcuccgccag agaccaaccg agaa 24
<210>11
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-OH, all phonetic '-hydroxyl pyridine (C and U) is 2 '-fluorine
<400>11
gggaaaagcg aaucauacac aagacgucgc cagauugagu gucgugguuc ggguugaggc 60
ggaagcuccg ccagagacca accgagaa 88
<210>12
<211>87
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(87)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>12
ggaaaagcga aucauacaca agagucgcga uagauugcuu gugaaugguu uugguggaag 60
cgggcuccgc cagagaccaa ccgagaa 87
<210>13
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>13
gggaaaagcg aaucauacac aagagucgcu agauugcuag uguaugguuu aucuaaaggc 60
ggccgcuccg ccagagacca accgagaa 88
<210>14
<211>87
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(87)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>14
gggaaaagcg aaucauacac aagaggucuu acagauccug uguagugguu cgauacaugc 60
ggggcuccgc cagagaccaa ccgagaa 87
<210>15
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>15
gggaaaagcg aaucauacac aagacgugag cauaucauug aguguagugg uuccggagua 60
agucgcuccg ccagagacca accgagaa 88
<210>16
<211>87
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(87)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>16
gggaaaagcg aaucauacac aagagcaccu ugacugugau ucgcgggugu gagucgugcg 60
aaggcuccgc cagagaccaa ccgagaa 87
<210>17
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>17
gggaaaagcg aaucauacac aagagugcaa gaagugcauu gcugugucug guucuuggcg 60
augugcuccg ccagagacca accgagaa 88
<210>18
<211>88
<212>RNA
＜213〉synthetic
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>18
gggaaaagcg aaucauacac aagauccgag ggugggcaau aggcucacaa ggguuucgcg 60
ugaugcuccg ccagagacca accgagaa 88
<210>19
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>19
gggaaaagcg aaucauacac aagagugccg aggcauugcu ugguaugguu ccggucuugu 60
cggggcuccg ccagagacca accgagaa 88
<210>20
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>20
gggaaaagcg aaucauacac aagacgucgc cagauugagu guggugguuc ggguugaggc 60
ggaagcuccg ccagagacca accgagaa 88
<210>21
<211>90
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(90)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>21
gggaaaagcg aaucauacac aagacgucag uaagauugag uguaugguuc cugguggaca 60
auaauggcuc cgccagagac caaccgagaa 90
<210>22
<211>88
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(88)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>22
gggaaaagcg aaucauacac aagagagugg aggagguaug uaugguuugu gcgucuggug 60
cggugcuccg ccagagacca accgagaa 88
<210>23
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(23)..(52)
＜223〉n represents a, t, c, or g
<400>23
gggagaggag agaacgttct acnnnnnnnn nnnnnnnnnn nnnnnnnnnn nncgctgtcg 60
atcgatcgat cgatg 75
<210>24
<211>22
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>24
gggagaggag agaacgttct ac 22
<210>25
<211>22
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>25
catcgatcga tcgatcgaca gc 22
<210>26
<211>22
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic FX
<400>26
gggagaggag agaacguucu ac 22
<210>27
<211>23
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic FX
<400>27
cgcugucgau cgaucgaucg aug 23
<210>28
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>28
gggagaggag agaacguucu acgauuagca gggagggaga gugcgaagag gacgcugucg 60
aucgaucgau cgaug 75
<210>29
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>29
gggagaggag agaacguucu acacucuggg gacccguggg ggagugcagc aacgcugucg 60
aucgaucgau cgaug 75
<210>30
<211>74
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(74)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>3 0
gggagaggag agaacguucu acgaggugag ggucuacaau ggagggaugg ucgcugucga 60
ucgaucgauc gaug 74
<210>31
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is a, c, u, or g
<220>
＜221〉other features
<222>(48)..(48)
＜223〉n is a, c, u, or g
<400>31
gggagaggag agaacguucu acccgcagca uagccugngg acccaugngg ggcgcugucg 60
aucgaucgau cgaug 75
<210>32
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>32
gggagaggag agaacguucu acuggggggc guguucauua gcagcgucgu gucgcugucg 60
aucgaucgau cgaug 75
<210>33
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>33
gggagaggag agaacguucu acgcagcgca ucuggggacc caagagggga uucgcugucg 60
aucgaucgau cgaug 75
<210>34
<211>73
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜220〉modified base
<222>(1)..(73)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>34
gggagaggag agaacguucu acgggauggg uaguuggaug gaaaugggaa cgcugucgau 60
cgaucgaucg aug 73
<210>35
<211>74
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(74)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>35
gggagaggag agaacguucu acgaggugua gggauagagg gguguaggua acgcugucga 60
ucgaucgauc gaug 74
<210>36
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>36
gggagaggag agaacguucu acaggagugg agcuacagag aggguuaggg gucgcugucg 60
aucgaucgau cgaug 75
<210>37
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>37
gggagaggag agaacguucu acggauguug ggagugauag aaggaagggg agcgcugucg 60
aucgaucgau cgaug 75
<210>38
<211>76
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(76)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>38
gggagaggag agaacguucu acuuggggug gaaggaguaa gggaggugcu gaucgcuguc 60
gaucgaucga ucgaug 76
<210>39
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>3 9
gggagaggag agaacguucu acguauuagg ggggaagggg aggaauagau cacgcugucg 60
aucgaucgau cgaug 75
<210>40
<211>76
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(76)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>40
gggagaggag agaacguucu acagggagag aguguugagu gaagaggagg agucgcuguc 60
gaucgaucga ucgaug 76
<210>41
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>41
gggagaggag agaacguucu acauugugcu ccuggggccc aguggggagc cacgcugucg 60
aucgaucgau cgaug 75
<210>42
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>42
gggagaggag agaacguucu acgagcagcc cuggggcccg gagggggaug gucgcugucg 60
aucgaucgau cgaug 75
<210>43
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>43
gggagaggag agaacguucu acaggcaguu cuggggaccc augggggaag ugcgcugucg 60
aucgaucgau cgaug 75
<210>44
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>44
gggagaggag agaacguucu accaacggca uccugggccc cacaggggau gucgcugucg 60
aucgaucgau cgaug 75
<210>45
<211>74
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(74)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>45
gggagaggag agaacguucu acgaguggau agggaagaag gggaguaguc acgcugucga 60
ucgaucgauc gaug 74
<210>46
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>46
gggagaggag agaacguucu acccgcagca uagccugggg acccaugggg ggcgcugucg 60
aucgaucgau cgaug 75
<210>47
<211>76
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(76)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(61)-(61)
＜223〉n is a, c, u, or g
<400>47
gggagaggag agaacguucu acggucgcgu gugggggacg gauggguauu ggucgcuguc 60
naucgaucga ucgaug 76
<210>48
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>48
gggagaggag agaacguucu acgggguuac gucgcacgau acaugcauuc aucgcugucg 60
aucgaucgau cgaug 75
<210>49
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>49
gggagaggag agaacguucu acuagcgagg agggguuuuc uauuuuugcg aucgcugucg 60
aucgaucgau cgaug 75
<210>50
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(75)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>50
gggagaggag agaacguucu acaagcaguu cuggggaccc augggggaag ugcgcugucg 60
aucgaucgau cgaug 75
<210>51
<211>75
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<220>
＜221〉other features
<222>(23)..(52)
＜223〉n represents a, t, c, or g
<400>51
gggagaggag agaacgttct acnnnnnnnn nnnnnnnnnn nnnnnnnnnn nncgctgtcg 60
atcgatcgat cgatg 75
<210>52
<211>22
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>52
gggagaggag agaacgttct ac 22
<210>53
<211>22
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>53
catcgatcga tcgatcgaca gc 22
<210>54
<211>21
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic FX
<400>54
gggagaggag agaacguucu a 21
<210>55
<211>23
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic FX
<400>55
cgcugucgau cgaucgaucg aug 23
<210>56
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-OH, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>56
gggagaggag agaacguucu acgaucuggg cgagccaguc ugacugagga agcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>57
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>57
gggagaggag agaacguucu acgcggucgg guguguggag gaaguaguuc gucgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>58
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>58
gggagaggag agaacguucu acgacguuaa ugcagcggcu agggaugggc agcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>59
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>59
gggagaggag agaacguucu acaggcgugu ugguagggua cgacgaggca ugcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>60
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>60
gggagaggag agaacguucu acugagggau aauacgggug ggauugucuu cccgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>61
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>61
gggagaggag agaacguucu acgaaaaaga uaugagagaa aggauuaaga gacgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>62
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>62
gggagaggag agaacguucu acgaagaaga uaugagagaa aggauuaaga gacgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>63
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>63
gggagaggag agaacguucu acgaaaaaga uaugagagaa aggauuaaga gacgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>64
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>64
gggagaggag agaacguucu acgaaaaaga uaugagagaa aggauuaaga ggcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>65
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>65
gggagaggag agaacguucu acgaaaaaga caugagagaa aggauuaaga gacgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>66
<211>83
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(83)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n is a, c, u, or g
<220>
＜221〉other features
<222>(50)..(50)
＜223〉n is a, c, u, or g
<400>66
gggagaggag agaacguucu acnaaaaagu auaugagaga aaggauuaan agacgcuguc 60
gaucgaucga ucgaugaagg gcg 83
<210>67
<211>83
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(83)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>67
gggagaggag agaacguucu acgaaaaaga uaugagagaa aaggauugag agaugcuguc 60
gaucgaucga ucgaugaagg gcg 83
<210>68
<211>83
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(83)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>68
gggagaggag agcacguucu acgaaaaaga uauggagaga aaggauuaag agacgcuguc 60
gaucgaucga ucgaugaagg gcg 83
<210>69
<211>84
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(84)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>69
gggagaggag agaacguucu acgaaaaaga uaugagagaa aggauuaaaa gagacgcugu 60
cgaucgaucg aucgaugaag ggcg 84
<210>70
<211>85
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(85)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n is a, c, u, or g
<400>70
gggagaggag agaacguucu acgaanaaga uacauaguag aaaggauuaa uaagacgcug 60
ucgaucgauc gaucgaugaa gggcg 85
<210>71
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>71
gggagaggag agaacguucu acaggcgugu ugguagggua cgacgaggca ugcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>72
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>72
gggagaggag agaacguucu acgcaaaaau gugaugcgag guaauggaac gccgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>73
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222> (1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>73
gggagaggag agaacguucu acggaccuca gcgauagggg uugaaaccga cacgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>74
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>74
gggagaggag agaacguucu acauggucgg augcugggga guaggcaagg uucgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>75
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>75
gggagaggag agaacguucu acguaucggc gagcgaagca uccgggagcg uucgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>76
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>76
gggagaggag agaacguucu acguauuggc gcgcgaagca uccgggagcg uucgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>77
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>77
gggagaggag agaacguucu acuuauaccu gacggccgga ggcgcauagg ugcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>78
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>78
gggagaggag agaacguucu acauggucgg augcugggga guaggcaagg uucgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>79
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>79
gggagaggag agaacguucu acacgagagu acugaggcgc uugguacaga gucgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>80
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>80
gggagaggag agaacguucu acagaaggua gaaaaaggau agcugugaga agcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>81
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>81
gggagaggag agaacguucu acugagggau aauacgggug ggauugucuu cccgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>82
<211>84
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(84)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>82
gggagaggag agaacguucu acauugagcg uugaaguugg ggaagcuccg aggccgcugu 60
cgaucgaucg aucgaugaag ggcg 84
<210>83
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>83
gggagaggag agaacguucu acgcggagau auacagcgag guaauggaac gccgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>84
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>84
gggagaggag agaacguucu acgaagacag cccaauagcg gcacggaacu ugcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>85
<211>84
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(84)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>85
gggagaggag agaacguucu accgguugag ggcucgcgug gaagggccaa cacgcgcugu 60
cgaucgaucg aucgaugaag ggcg 84
<210>86
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>86
gggagaggag agaacguucu acauaucaau agacucuuga cguuuggguu ugcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>87
<211>79
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(79)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>87
gggagaggag agaacguucu acagugaagg aaaaguaagu gaaggugugc gcugucgauc 60
gaucgaucga ugaagggcg 79
<210>88
<211>82
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(82)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>88
gggagaggag agaacguucu acggaugaaa ugagugucug cgauagguua agcgcugucg 60
aucgaucgau cgaugaaggg cg 82
<210>89
<211>83
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(83)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>89
gggagaggag agaacguucu acggaaggaa augugugucu gcgauagguu aagcgcuguc 60
gaucgaucga ucgaugaagg gcg 83
<210>90
<211>49
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(49)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>90
gggaaaagcg aaucauacac aagacgucgc cagauugagu gucgugguu 49
<210>91
<211>43
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(43)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>91
ggaaucauac acaagacguc gccagauuga gugucguggu ucc 43
<210>92
<211>41
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(41)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>92
ggaaucauac acaagacguc gccagauuga gugucguggu u 41
<210>93
<211>37
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>93
ggagauccga gggugggcaa uaggcucaca aggguuu 37
<210>94
<211>35
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(35)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>94
ggauccgagg gugggcaaua ggcucacaag ggucc 35
<210>95
<211>43
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(43)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>95
ggaaucauac acaagacguc aguaagauug aguguauggu ucc 43
<210>96
<211>41
<212>RNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(41)
＜223〉all purine (A and G) be 2 '-hydroxyl, all pyrimidines (C and U) are 2 '-fluorine
<400>96
ggaaucauac acaagacguc aguaagauug aguguauggu u 41
<210>97
<211>21
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(21)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>97
uucuggggac ccauggggga a 21
<210>98
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>98
guucugggga cccauggggg aac 23
<210>99
<211>25
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(25)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>99
aguucugggg acccaugggg gaacu 25
<210>100
<211>21
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(21)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>100
gccuggggac ccaugggggg c 21
<210>101
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>101
agccugggga cccauggggg gcu 23
<210>102
<211>25
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(25)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>102
uagccugggg acccaugggg ggcua 25
<210>103
<211>21
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(21)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>103
gccuggggaa ccaugggggg c 21
<210>104
<211>68
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<400>104
gggagaggag agaacgttct acagcctggg gacccatggg gggctggtcg atcgatcgat 60
catcgatg 68
<210>105
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>105
catcgatgat cgatcgatcg acc 23
<210>106
<211>22
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(22)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>106
agccugggga cccauggggg cu 22
<210>107
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>107
cgccugggga cccagggggg gcu 23
<210>108
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>108
agccuggugg cccauggggu gcu 23
<210>109
<211>25
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(25)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>109
agccugggga cccauggggg guggu 25
<210>110
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>110
agucugggga cagauggaug gcu 23
<210>111
<211>22
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(22)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>111
agcuguggag ucgugugggg cu 22
<210>112
<211>25
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(25)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>112
aagccugggg acccaugggg gggcu 25
<210>113
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>113
ggggcacgtt tatccgtccc tcctagtggc gtgcccc 37
<210>114
<211>74
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic template
<400>114
gatcccttgt tcagtccggg gcacgtttat ccgtccctcc tagtggcgtg ccccttaagc 60
cacaggactc caaa 74
<210>115
<211>18
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic primer
<400>115
gatcccttgt tcagtccg 18
<210>116
<211>17
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic primer
<220>
＜221〉modified base
<222>(17)-(17)
＜223〉the 17th VITAMIN B4 be 2 '-hydroxyl
<400>116
ggagtcctgt ggcttaa 17
<210>117
<211>20
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic primer
<220>
＜221〉other features
<222>(1)..(3)
＜223〉1 to 3 n is 5-vitamin H-thymus pyrimidine
<400>117
nnnggagtcc tgtggcttaa 20
<210>118
<211>17
<212>DNA
＜213〉synthetic primer
<400>118
ggagtcctgt ggcttaa 17
<210>119
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>119
ggggcacatt tatccgtccc tcctagtggt gtgcccc 37
<210>120
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>120
ggggtacctt tatccgtccc tcctagtggg gtgcccc 37
<210>121
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>121
ggggtacctt tatccgtccc tcctagtggg gtacccc 37
<210>122
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>122
ggggcaaatt tatccgtccc tcctagtggt ttgcccc 37
<210>123
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>123
ggggcatatt tatccgtccc tcctagtggt atgcccc 37
<210>124
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>124
ggggcacatt tatccgttcc tcctagtggt gtgcccc 37
<210>125
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>125
ggggtacatt tatccgtccc tcctagtggc atgcccc 37
<210>126
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>126
ggggcatgtt tatccgtccc tcctagtggc atgcccc 37
<210>127
<211>36
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>127
ggggcaactt tatccgttcc tcctagtggg ttgccc 36
<210>128
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>128
ggggcacatt catccgtccc tcctagtggt gtgctcc 37
<210>129
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>129
ggggtacctt gatccgtccc tcctagtggg gtgcccc 37
<210>130
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>130
ggggcatgtt tatccgttcc tcctagtggc atgcccc 37
<210>131
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>131
ggggcagctt tatccgttcc tcctagtggg ctgcctc 37
<210>132
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>132
ggggtacctt tatccgtttc tcctagtggg gtgcccc 37
<210>133
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>133
ggggtatgtt gatccgtccc tcctagtggc atgcccc 37
<210>134
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>134
ggggcatgtt catccgttcc tcctagtggc gtgcccc 37
<210>135
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>135
gggacacatt tatccgttac tcttagtggt gtgcccc 37
<210>136
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>136
ggggcacatt tatccgttac tcttagtggt gtgcccc 37
<210>137
<211>34
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>137
ggggcacgtt tacagtccct ccttatcgcc tccc 34
<210>138
<211>34
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>138
ggggcacgtt tacagtccct ccttatcgcc tccc 34
<210>139
<211>36
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>139
gggcaacttt atccgttcct cttagtgggt tgcccc 36
<210>140
<211>36
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>140
gggctacttt atccgtccct cctagtgggt agcccc 36
<210>141
<211>35
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>141
ggcaccttta tccgtccctc ctagtggggt gcccc 35
<210>142
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>142
ggggcacctt tatccgtccc tcctagtggg gtgcccc 37
<210>143
<211>36
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>143
gggcacattc atccgttcct cctagtggtg tgcccc 36
<210>144
<211>34
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>144
ggcaccttta tccgttcctt ctagtggggt gccc 34
<210>145
<211>36
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>(28)..(28)
＜223〉the 28th n is a, t, c, or g
<400>145
cggcaccttt atccgttact cttagtgngg tgcccc 36
<210>146
<211>35
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>146
ggcaccttga tccgttcctc ctagtggggt gcccc 35
<210>147
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>147
gcgggcaaat tcatccgtcc ctcctagtgg tttgccc 37
<210>148
<211>34
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>148
gggcacttta tccgttcctt ctagtgggtg tccc 34
<210>149
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>149
ggcggcagct ttatccgtac ctcccagtgg gctgctcc 38
<210>150
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>150
ggggcagctt tatccgtacc tcccagtggg ctgcccc 37
<210>151
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>151
ggggctactt tatccgtccc tcctagtggg tagcccc 37
<210>152
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>152
ggggctactt tatccgtacc tcccagtggg tagcccc 37
<210>153
<211>37
<212>DN
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>153
ggggctactt gatccgtccc tcctagtggg tagcccc 37
<210>154
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>154
ggggctactt catccgtccc tcctagtggg tagcccc 37
<210>155
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>155
ggggctactt tatccgttcc tcttagtggg tagcccc 37
<210>156
<211>37
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<400>156
ggggctactt tatccgttcc tcctagtggg tagcccc 37
<210>157
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>(38)..(38)
＜223〉the 38th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>157
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>158
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 1st VITAMIN B4 be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (31-31 connection) of a reverse deoxidation
<400>158
agccugggga cccauggggg gcun 24
<210>159
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>159
agccugggga cccauggggg gcun 24
<210>160
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 6th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>160
agccugggga cccauggggg gcun 24
<210>161
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 7th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>161
agccugggga cccauggggg gcun 24
<210>162
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 8th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>162
agccugggga cccauggggg gcun 24
<210>163
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 9th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>163
agccugggga cccauggggg gcun 24
<210>164
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 10th VITAMIN B4 be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>164
agccugggga cccauggggg gcun 24
<210>165
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 14th VITAMIN B4 be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>165
agccugggga cccauggggg gcun 24
<210>166
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 16th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>166
agccugggga cccauggggg gcun 24
<210>167
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 17th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>167
agccugggga cccauggggg gcun 24
<210>168
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 18th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>168
agccugggga cccauggggg gcun 24
<210>169
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 19th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>169
agccugggga cccauggggg gcun 24
<210>170
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 20th guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>170
agccugggga cccauggggg gcun 24
<210>171
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 21st guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>171
agccugggga cccauggggg gcun 24
<210>172
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 1st VITAMIN B4 be 2 '-oxygen-methyl and the 2nd, 20 and 21 's guanine is 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>172
agccugggga cccauggggg gcun 24
<210>173
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd guanine be 2 '-oxygen-methyl, the 10th and 14 VITAMIN B4 is 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>173
agccugggga cccauggggg gcun 24
<210>174
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>174
agccugggga cccauggggg gcun 24
<210>175
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 10th and 14 VITAMIN B4 is 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>175
agccugggga cccauggggg gcun 24
<210>176
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10 and 14 VITAMIN B4 is 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉the 24th n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>176
agccugggga cccauggggg gcun 24
<210>177
<211>28
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(27)
＜223〉all purine (A and G) are deoxidations, except the 3rd, 8 and 20 guanine be 2 '-oxygen-methyl, the 11st and 15 VITAMIN B4 is 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(2)..(2)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)-(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(28)-(28)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>177
angccugggg acccaungng gggngcun 28
<210>178
<211>30
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(29)
＜223〉all purine (A and G) are deoxidations, except the 3rd, 8 and 21 guanine be 2 '-oxygen-methyl, the 12nd and 16 VITAMIN B4 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(2)(2)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(11)-(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)-(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(30)..(30)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>178
angccugggg nacccaungn ggnggngcun 30
<210>179
<211>27
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(28)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 18 be guanine, the 1st, 11 and 15 VITAMIN B4
2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(27)-(27)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>179
agccugggng acccaugggn ggngcun 27
<210>180
<211>28
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(27)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 19 guanine be 2 '-oxygen-methyl, the 1st, 11 and 15 VITAMIN B4 is 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)-(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(21)-(21)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>180
agccugggng acccaunggg nggngcun 28
<210>181
<211>29
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(28)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 20 guanine be 2 '-oxygen-methyl, the 1st, 11 and 15 VITAMIN B4 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(29)..(29)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>181
agccugggng acccaungng gnggngcun 29
<210>182
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 8 and 21 guanine be 2 '-oxygen-methyl, the 1st, 13 and 17 VITAMIN B4 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)-(6)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)-(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)-(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>182
agccunggng ngacccaung gngngngngc un 32
<210>183
<211>35
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(34)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 9 and 23 guanine be 2 '-oxygen-methyl, the 1st, 14 and 18 VITAMIN B4 2 '-oxygen-methyl; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)..(6)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(8)..(8)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(10)..(10)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(12)..(12)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)-(20)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(30)..(30)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(32)-(32)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(35)..(35)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>183
agccungngn gngacccaun gngngngngn gncun 35
<210>184
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(2)..(2)
＜223〉n is the 7-deazaguanine of deoxidation
<400>184
anccugggga cccauggggg gcu 23
<210>185
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)..(6)
＜223〉n is the 7-deazaguanine of deoxidation
<400>185
agccunggga cccauggggg gcu 23
<210>186
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(7)..(7)
＜223〉n is the 7-deazaguanine of deoxidation
<400>186
agccugngga cccauggggg gcu 23
<210>187
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(8)..(8)
＜223〉n is the 7-deazaguanine of deoxidation
<400>187
agccuggnga cccauggggg gcu 23
<210>188
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
<223>
All purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n is the 7-deazaguanine of deoxidation
<400>188
agccugggna cccauggggg gcu 23
<210>189
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(16)..(16)
＜223〉n is the 7-deazaguanine of deoxidation
<400>189
agccugggga cccaungggg gcu 23
<210>190
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n is the 7-deazaguanine of deoxidation
<400>190
agccugggga cccaugnggg gcu 23
<210>191
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n is the 7-deazaguanine of deoxidation
<400>191
agccugggga cccauggngg gcu 23
<210>192
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(2 3)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n is the 7-deazaguanine of deoxidation
<400>192
agccugggga cccaugggng gcu 23
<210>193
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) be 2 ' oxygen-methyl-
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n is the 7-deazaguanine of deoxidation
<400>193
agccugggga cccauggggn gcu 23
<210>194
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n is the 7-deazaguanine of deoxidation
<400>194
agccugggga cccauggggg ncu 23
<210>195
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, all pyrimidines (C and U) are 2 '-oxygen-methyl
<400>195
aggcugggga cccauggggg ccu 23
<210>196
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 3rd guanine be 2 '-oxygen-methyl; All pyrimidines 2 '-oxygen-methyl
<400>196
aggcugggga cccauggggg ccu 23
<210>197
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<400>197
agucugggga cccauggggg acu 23
<210>198
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 21st VITAMIN B4 2 '-oxygen-methyl; All pyrimidines 2 '-oxygen-methyl
<400>198
agucugggga cccauggggg acu 23
<210>199
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations; All pyrimidines (C and U) are 2 '-oxygen-methyl
<400>199
agacugggga cccauggggg ucu 23
<210>200
<211>23
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 3rd VITAMIN B4 2 '-oxygen-methyl; All pyrimidines 2 '-oxygen-methyl
<400>200
agacugggga cccauggggg ucu 23
<210>201
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 7th and 17 guanine 2 '-oxygen-methyl, the 1st, 10 and 14 VITAMIN B4 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(2)..(2)
＜223〉the 2nd n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>201
anccugggga cccauggggg gcun 24
<210>202
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)..(6)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>202
agccunggga cccauggggg gcun 24
<210>203
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(7)..(7)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>203
agccugngga cccauggggg gcun 24
<210>204
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd and 7 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(8)..(8)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>204
agccuggnga cccauggggg gcun 24
<210>205
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except guanine be 2,7 and 17 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>205
agccugggna cccauggggg gcun 24
<210>206
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(16)..(16)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>206
agccugggga cccaungggg gcun 24
<210>207
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd and 7 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>207
agccugggga cccaugnggg gcun 24
<210>208
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine of a reverse deoxidation
<400>208
agccugggga cccauggngg gcun 24
<210>209
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>209
agccugggga cccaugggng gcun 24
<210>210
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(20)-(20)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)-(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>210
agccugggga cccauggggn gcun 24
<210>211
<211>24
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(23)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 17 guanine be 2 '-oxygen-methyl, the 1st, 10,14 VITAMIN B4 is 2 '-oxygen-methyl
＜221〉modified base
<222>(1)..(23)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>211
agccugggga cccauggggg ncun 24
<210>212
<211>29
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(28)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 20 guanine be 2 '-oxygen-methyl, the 1st, 11,15 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)-(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(25)-(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(29)-(29)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>212
agccugggng acccaungng gngnngcun 29
<210>213
<211>29
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 20 guanine be 2 '-oxygen-methyl, the 1st, 11,15 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(19)-(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(29)..(29)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>213
agccugggng acccaunnng gngnngcun 29
<210>214
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 8 and 21 guanine be 2 '-oxygen-methyl, the 1st, 13,17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all pyrimidines (C and U) are 2 T-O-methyl
<220>
＜221〉other features
<222>(6)..(6)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(11)-(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>214
agccunggng ngacccaung gngngnnngc un 32
<210>215
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 8 and 21 guanine be 2 '-oxygen-methyl, the 1st, 13,17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)-(6)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>215
agccunggng ngacccaunn gngngnnngc un 32
<210>216
<211>29
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 20 guanine be 2 '-oxygen-methyl, the 1st, 11,15 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(29)..(29)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>216
agccugggng acccaunnng nngnngcun 29
<210>217
<211>29
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all purine (A and G) are deoxidations, except guanine be 2,7 and 20 2 '-oxygen-methyl, VITAMIN B4 is 1,11,15 are2 '-oxygen-methyl
<220>
＜221〉modified base
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(29)..(29)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>217
agccugggng acccaungng nngnngcun 29
<210>218
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 8 and 21 guanine be 2 '-oxygen-methyl, the 1st, 13,17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)..(6)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)-(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>218
agccunggng ngacccaung gnnngnnngc un 32
<210>219
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(31)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 8 and 21 guanine be 2 '-oxygen-methyl, the 1st, 13,17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)-(31)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(6)..(6)
＜223〉n connects between a thiosulphate nucleosides
＜220〉other features
<221>
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..( 24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>219
agccunggng ngacccaunn gnnngnnngc un 32
<210>220
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 1st guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)-(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>220
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>221
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 2nd guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>221
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>222
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 3rd guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>222
ggggctactt tatccgttcc tcctagtgggtagccccn 38
<210>223
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) and all pyrimidines (C and T) are deoxidations, except the 4th guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>223
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>224
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 5th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>224
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>225
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 6th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>225
ggggcuactt tatccgttcc tcctagtggg tagccccn 38
<210>226
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 7th VITAMIN B4 be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>226
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>227
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉(A (A and G) and all pyrimidines (C and T) are deoxidations to all purine, except the 8th cytosine(Cyt) is 2 ' oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>227
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>228
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 9th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>228
ggggctacut tatccgttcc tcctagtggg tagccccn 38
<210>229
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 10th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>38
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>229
ggggctactu tatccgttcc tcctagtggg tagccccn 38
<210>230
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 11st uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>230
ggggctactt uatccgttcc tcctagtggg tagccccn 38
<210>231
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 12nd VITAMIN B4 be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>231
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>232
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 13rd uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>232
ggggctactt tauccgttcc tcctagtggg tagccccn 38
<210>233
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 14th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)-(38)
＜223〉n is the thymus pyrimidine (3 ,-3 ' connection) of a reverse deoxidation
<400>233
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>234
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 15th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)-(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>234
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>235
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 16th guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>235
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>236
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 17th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>236
ggggctactt tatccgutcc tcctagtggg tagccccn 38
<210>237
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 18th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>237
ggggctactt tatccgtucc tcctagtggg tagccccn 38
<210>238
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 19th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>238
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>239
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 20th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>239
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>240
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 21st uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>240
ggggctactt tatccgttcc ucctagtggg tagccccn 38
<210>241
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 22nd cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>241
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>242
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 23rd cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>242
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>243
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 24th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>243
ggggctactt tatccgttcctccuagtggg tagccccn 38
<210>244
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 25th VITAMIN B4 be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>244
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>245
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 26th guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>245
ggggctactt tatccgttcc tcctagtgggtagccccn 38
<210>246
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 27th uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>246
ggggctactt tatccgttcc tcctaguggg tagccccn 38
<210>247
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 28th guanine be 2 '-oxygen-methyl
<220>
＜221〉other characteristics
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>247
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>248
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 29th guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>248
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>249
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 30th guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>249
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>250
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (1, (A and G) and all pyrimidines (C and T) are deoxidations, except the 31st uridylic be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>250
ggggctactt tatccgttcc tcctagtggg uagccccn 38
<210>251
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 32nd VITAMIN B4 be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>251
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>252
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 33rd guanine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>252
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>253
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 34th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>253
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>254
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A (A and G) and all pyrimidines (C and T) are deoxidations, except the 35th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>254
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>255
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(3
7)
＜223〉all purine (A and G) and all pyrimidines (C and T) are deoxidations, except the 36th cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)-(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>255
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>256
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) and all pyrimidines (C and T) are deoxidations, except the 37 cytosine(Cyt) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>256
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>257
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4,30 and 33 guanine is 2 '-oxygen-methyl, the 7th and 32 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>257
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>258
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations, except the 5th,
8,34,35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl and the 6th and 31 's uridylic is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>258
ggggcuactt tatccgttcc tcctagtggg uagccccn 38
<210>259
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3 and 4 guanine is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations, except the 34th, 35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>259
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>260
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 33 guanine is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations, except the 5th, 34,35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>260
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>261
<211>36
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(35)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3 and 32 guanine is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(35)
＜223〉all pyrimidines (C and T) are deoxidations, except the 4th, 33,34 and 35 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(36)..(36)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>261
gggctacttt atccgttcct cctagtgggt agcccn 36
<210>262
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 33 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations, except the 34th, 35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>262
ggggctactt tatccgttcc tcctagtggg tagccccn 38
<210>263
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 33 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations, except the 5th, 8,34,35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl and the 6th 's uridylic is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>263
ggggcuactt tatccgttcc tcctagtggg tagccccn 38
<210>264
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 33 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidines (C and T) are deoxidations, except the 20th, 34,35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl and the 11st, 17 and 18 's uridylic is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>264
ggggctactt uatccguucc tcctagtggg tagccccn 38
<210>265
<211>38
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 33 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(37)
＜223〉all pyrimidine (C and, T) be deoxidation, except the 5th, 8,20,34,35,36 and 37 cytosine(Cyt) is 2 '-oxygen-methyl and the 6th, 11,17 and 18 uridylic is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>265
ggggcuactt uatccguucc tcctagtggg tagccccn 38
<210>266
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>266
ggggctacnt ttatccgttc ctcctagtgg gtagccccn 39
<210>267
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(10)..(10)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>267
ggggctactn ttatccgttc ctcctagtgg gtagccccn 39
<210>268
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>268
ggggctactt ntatccgttc ctcctagtgg gtagccccn 39
<210>269
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(12)..(12)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>269
ggggctactt tnatccgttc ctcctagtgg gtagccccn 39
<210>270
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(13)..(13)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>270
ggggctactt tantccgttc ctcctagtgg gtagccccn 39
<210>271
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 31 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(14)-(14)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>271
ggggctactt tatnccgttc ctcctagtgg gtagccccn 39
<210>272
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(15)..(15)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>272
ggggctactt tatcncgttc ctcctagtgg gtagccccn 39
<210>273
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)-(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(16)-(16)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>273
ggggctactt tatccngttc ctcctagtgg gtagccccn 39
<210>274
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>274
ggggctactt tatccgnttc ctcctagtgg gtagccccn 39
<210>275
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>275
ggggctactt tatccgtntc ctcctagtgg gtagccccn 39
<210>276
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>276
ggggctactt tatccgttnc ctcctagtgg gtagccccn 39
<210>277
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>277
ggggctactt tatccgttcn ctcctagtgg gtagccccn 39
<210>278
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except guanine is 1,2,3,4 and 34 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 72 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)-(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>278
ggggctactt tatccgttcc ntcctagtgg gtagccccn 39
<210>279
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine of a reverse deoxidation
<400>279
ggggctactt tatccgttcc tncctagtgg gtagccccn 39
<210>280
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>280
ggggctactt tatccgttcc tcnctagtgg gtagccccn 39
<210>281
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 5th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>281
ggggctactt tatccgttcc tccntagtgg gtagccccn 39
<210>282
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)-(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>282
ggggctactt tatccgttcc tcctnagtgg gtagccccn 39
<210>283
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(26)-(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (31-31 connection) of a reverse deoxidation
<400>283
ggggctactt tatccgttcc tcctangtgg gtagccccn 39
<210>284
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)-(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>284
ggggctactt tatccgttcc tcctagntgg gtagccccn 39
<210>285
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and) is deoxidation, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(28)..(28)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>285
ggggctactt tatccgttcc tcctagtngg gtagccccn 39
<210>286
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(29)..(29)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>286
ggggctactt tatccgttcc tcctagtgng gtagccccn 39
<210>287
<211>3 9
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(30)..(30)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>287
ggggctactt tatccgttcc tcctagtggn gtagccccn 39
<210>288
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(31)..(31)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>288
ggggctactt tatccgttcc tcctagtggg ntagccccn 39
<210>289
<211>39
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 34 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(38)
＜223〉all pyrimidines (C and T) are deoxidations, except the 35th, 36,37 and 38 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(39)..(39)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>289
ggggctactt tatccgttcc tcctagtggg tnagccccn 39
<210>290
<211>46
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(45)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 41 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)-(45)
＜223〉all pyrimidines (C and T) are deoxidations, except the 42nd, 43,44 and 45 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(10)-(10)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(14)..(14)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(30)..(30)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(34)..(34)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(46)..(46)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>290
ggggctactn ttantcncgt tncctncctn agtngggnta gccccn 46
<210>291
<211>46
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(45)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 41 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(45)
＜223〉all pyrimidines (C and T) are deoxidations, except the 5th, 8,42,43,44 and 45 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(10)..(10)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(14)..(14)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(30)..(30)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(34)..(34)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(38)..(38)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(46)..(46)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>291
ggggcuactn ttantcncgt tncctncctn agtngggnta gccccn 46
<210>292
<211>45
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(44)
＜223〉all purine (A and G) are deoxidations, except the 1st, 2,3,4 and 40 guanine is 2 '-oxygen-methyl and the 7th 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(44)
＜223〉all pyrimidines (C and T) are deoxidations, except the 5th, 8,23,41,42,43 and 44 cytosine(Cyt) is 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(10)..(10)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(14)..(14)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(29)..(29)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(33)..(33)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(37)..(37)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(45)-(45)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>292
ggggcuactn tuantcncgu ucctncctna gtngggntag ccccn 45
<210>293
<211>31
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>
＜223〉n is a PEG who branches into the 40kDa size
<220>
＜221〉other features
<222>(2)..(2)
＜223〉n represents an amino
<220>
＜221〉modified base
<222>(3)..(30)
＜223〉all purine are deoxidations, except the 4th, 9 and 22 guanine be 2 '-oxygen-methyl, the 3rd, 13 and 17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(3)-(30)
＜223〉all pyrimidine 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(11)-(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)-(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(21)-(21)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)-(26)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(31)..(31)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>293
nnagccuggg ngacccaunn ngnngnngcu n 31
<210>294
<211>31
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>(1)..(1)
＜223〉n is a PEG who branches into the 40kDa size
<220>
＜221〉other features
<222>(2)..(2)
＜223〉n represents an amino
<220>
＜221〉modified base
<222>(3)..(30)
＜223〉all purine are deoxidations, except the 4th, 9 and 22 guanine be 2 '-oxygen-methyl, the 3rd, 13 and 17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(3)..(30)
＜223〉all pyrimidine 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)-(20)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)-(23)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(31)..(31)
＜223〉n is the thymus pyrimidine (3 '-3 ' connection) of a reverse deoxidation
<400>294
nnagccuggg ngacccaunn ngnngnngcu n 31
<210>295
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>(1)-(1)
＜223〉n is the PEG of 20kDa
<220>
＜221〉other features
<222>(2)..(2)
＜223〉n is an amino
<220>
＜221〉modified base
<222>(3)..(30)
＜223〉all purine are deoxidations, except the 4th, 9 and 22 guanine be 2 '-oxygen-methyl, the 3rd, 13 and 17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(3)..(30)
＜223〉all pyrimidine 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(31)..(31)
＜223〉n is an amino
<220>
＜221〉other features
<222>(32)..(32)
＜223〉n is the PEG of a 20kDa
<400>295
nnagccuggg ngacccaunn ngnngnngcu nn 32
<210>296
<211>32
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>(1)(1)
＜223〉n is the PEG of a 30kDa
<220>
＜221〉other features
<222>(2)..(2)
＜223〉n is an amino
<220>
＜221〉modified base
<222>(3)..(30)
＜223〉all purine are deoxidations, except the 4th, 9 and 22 guanine be 2 '-oxygen-methyl, the 3rd, 13 and 17 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(3)(30)
＜223〉all pyrimidine 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(11)..(11)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(27)..(27)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(31)..(31)
＜223〉n is an amino
<220>
＜221〉other features
<222>(32)..(32)
＜223〉the n 30kDa and the PEG that are
<400>296
nnagccuggg ngacccaunn ngnngnngcu nn 32
<210>297
<211>30
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉other features
<222>(1)..(1)
＜223〉n is an amino
<220>
＜221〉modified base
<222>(2)..(29)
＜223〉all purine are deoxidations, except the 3rd, 8 and 21 guanine be 2 '-oxygen-methyl, the 2nd, 12 and 16 VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(2)..(29)
＜223〉all pyrimidine be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(10)..(10)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(18)-(18)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(20)..(20)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(23)..(23)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(25)..(25)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(26)..(26)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(30)..(30)
＜223〉n is an amino
<400>297
nagccugggn gacccaunnn gnngnngcun 30
<210>298
<211>28
<212>DNA
＜213〉synthetic
<220>
＜223〉synthetic fit
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all purine (A and G) are deoxidations, except the 2nd, 7 and 20 guanine be 2 '-oxygen-methyl and the 1st, 11 and 15 's VITAMIN B4 is 2 '-oxygen-methyl
<220>
＜221〉modified base
<222>(1)..(28)
＜223〉all pyrimidine (C and U) be 2 '-oxygen-methyl
<220>
＜221〉other features
<222>(9)..(9)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(17)..(17)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(18)..(18)
＜223〉n is the xanthoglobulin of a deoxidation
<220>
＜221〉other features
<222>(19)..(19)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(21)..(21)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features
<222>(22)..(22)
＜223〉n connects between a thiosulphate nucleosides
<220>
＜221〉other features
<222>(24)..(24)
＜223〉n is the xanthoglobulin of deoxidation
<220>
＜221〉other features

Claims (40)

1. what be connected with the PEG group is fit, comprises following sequence: mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU.
2. according to claim 1 fit, wherein the PEG group is from by 60kDa, and 40kDa screens in the group that 30kDa and 20kDa formed.
3. according to claim 2 fit, wherein the PEG group is ramose PEG.
4. according to claim 3 fit, contain following structure:
Figure A2005800213660002C1
Wherein,
Represent a joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
MC wherein, mG, mU and mA difference=2 '-OMe C, 2 '-OMeG, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replaces, and the reverse deoxythymidine of 3T=3 '.
5. according to claim 4 fit, joint wherein is the alkyl joint.
6. according to claim 5 fit, alkyl joint wherein comprises 2 to 18 successive CH 2Group.
7. according to claim 6 fit, alkyl joint wherein comprises 2 to 12 successive CH 2Group.
8. according to claim 7 fit, alkyl joint wherein comprises 3 to 6 successive CH 2Group.
9. fit described in according to Claim 8, contain structure as described below:
Figure A2005800213660003C1
Fit=mALmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-dGmCmU-3T (sequence number 216)
MC wherein, mG, mU and mA difference=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replace and the reverse deoxythymidine of 3T=3 '.
10. according to claim 3 fit, contain the structure that proposes below:
Wherein,
Figure A2005800213660003C3
Represent a joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
MC wherein, mG, mU and mA respectively=2 '-OMe C, 2 '-OMe G, 2 '-OMe U and 2 '-OMe A, dG=deoxidation crow purine, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replace and the reverse thymus pyrimidine of 3T=3 '.
11. described fit according to claim 1O, joint wherein is the alkyl joint.
12. according to claim 11 fit, wherein the alkyl joint comprises 2-18 successive CH 2Group.
13. according to claim 12 fit, wherein the alkyl joint comprises 2-12 successive CH 2Group.
14. according to claim 13 fit, wherein the alkyl joint comprises 3-6 successive CH 2Group.
15. according to claim 14 fit, contain the structure that proposes below:
Figure A2005800213660004C1
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU-3T (sequence number 216)
MC wherein, mG, mU and mA difference=2 '-OMe C, 2 '-OMeG, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replaces, and the reverse thymus pyrimidine of 3T=3 '.
16. according to claim 2 fit, contain the structure that proposes below
Figure A2005800213660004C2
Wherein,
Figure A2005800213660004C3
Represent a joint
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
MC wherein, mG, mU and mA respectively=2 '-OMe C, 2 '-OMeG, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replaces, and the reverse thymus pyrimidine of 3T=3 '.
17. according to claim 16 fit, joint wherein is the alkyl joint.
18. according to claim 17 fit, alkyl joint wherein comprises 2-18 successive CH 2Group.
19. according to claim 18 fit, alkyl joint wherein comprises 2-12 successive CH 2Group.
20. according to claim 19 fit, alkyl joint wherein comprises 3-6 successive CH 2Group.
21. according to claim 17 fit, contain the structure that proposes below:
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
MC wherein, mG, mU and mA difference=2 '-OMe C, 2 '-OMeG, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replaces, and the reverse thymus pyrimidine of 3T=3 '.
22. the fit structure that proposes below that has according to claim 2
Figure A2005800213660006C1
Wherein,
Figure A2005800213660006C2
Represent a joint
Wherein, fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
MC wherein, mG, mU and mA respectively=2 '-OMe C, 2 '-OMeG, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replace and the reverse thymus pyrimidine of 3T=3 '.
23. according to claim 22 fit, joint wherein is the alkyl joint.
24. according to claim 23 fit, alkyl joint wherein comprises 2-18 successive CH 2Group.
25. according to claim 24 fit, alkyl joint wherein comprises 2-12 successive CH 2Group.
26. according to claim 25 fit, alkyl joint wherein comprises 3-6 successive CH 2Group.
27. according to claim 26 fit, contain the structure that proposes below:
Fit=mAmGmCmCmUdGmGdG-s-dGmAmCmCmCmAmU-s-dI-s-mGdI-s-dGdI-s-d GmCmU (sequence number 298)
MC wherein, mG, mU and mA difference=2 '-OMe C, 2 '-OMeG, 2 '-OMe U and 2 '-OMe A, dG=deoxidation G, dI=deoxidation xanthoglobulin, s=thiophosphoric acid skeleton replace and the reverse thymus pyrimidine of 3T=3 '.
28. energy specific combination IgE's is fit, described fit a kind of nucleotide sequence that comprises, and this sequence and any one are selected from by sequence number 11-15, and 18,19,21,29,33,41-44,46,50, the sequence of the group that 56-96 and 98-102 form has at least 80% homology.
29. according to claim 28 fit, fit nucleotide sequence wherein and any one are selected from by sequence number 11-15, and 18,19,21,29,33,41-44,46,50,56-96, the sequence of the group that 98-102 formed has at least 90% homology.
30. can specific combination IgE fit, the described fit nucleotide sequence that comprises, this nucleotide sequence be selected from sequence number 11-15,18,19,21,29,33,41-44,46,50 and 56-89 in the unique sequences zone of arbitrary sequence at least 80% homology is arranged.
31. according to claim 30 fit, fit nucleotide sequence wherein at least be selected from sequence number 11-15,18,19,21,29,33,41-44,46,50 and the unique sequences zone of arbitrary sequence of 56-89 at least 90% homology is arranged.
32. can be fit with the IgE bonded, comprise 30 adjacent nucleosides, described 30 adjacent nucleosides be selected from sequence number 11-15,18,19,21,29,33,41-44,46,50 with 56-96 in arbitrary sequence in 30 adjacent nucleotide sequences identical.
33. according to claim 32 fit, wherein fit includes 20 successive nucleosides, described successive nucleotide sequences be selected from sequence number 11-15,18,19,21,29,33,41-44,46,50,56-96,20 adjacent nucleotide sequences among the 98-102 in the unique sequences zone of arbitrary fit acid sequence are identical.
34. according to claim 33 fit, wherein fit includes 8 successive nucleosides, described successive nucleotide sequences be selected from sequence number 11-15,18,19,21,29,33,41-44,46,50,56-96, among the 98-102 in arbitrary sequence 8 adjacent nucleotide sequences in unique zone identical, fit specific combination IgE wherein.
35. from by sequence number 11-15,18,19,21,29,33,41-44,46,50,56-96,98-102,119-124,126-136,139-157,158-176,178-190,194-201,206-243,247,249-259,261-267, that selects in 269-290 and 292 groups of being formed is fit.
36. fit according to claim 35, wherein fit is single-chain nucleic acid.
37. according to claim 36 fit, it is connected with a kind of high molecular non-immunogenic compound or lipophilic compound.
38. described fit according to claim 37, high molecular wherein, the non-immunogenic compound is a kind of poly-alkyl ethylene glycol.
39. described fit according to claim 38, poly-alkyl ethylene glycol wherein is polyoxyethylene glycol.
40. according to claim 35 fit, this is fit to comprise and be selected from chemically modified: the chemistry on sugared site replaces; Chemistry on the phosphoric acid salt site replaces; Chemistry on the nucleic acid base site replaces; Reverse nucleosides 3 ' end-blocking; Reverse nucleosides 5 ' end-blocking.
CN 200580021366 2004-04-26 2005-04-26 Nucleic acid ligands to immunoglobuline e and their use as atopic disease therapeutics Pending CN101014609A (en)

Applications Claiming Priority (5)

Application Number Priority Date Filing Date Title
US56560104P 2004-04-26 2004-04-26
US60/565,601 2004-04-26
US60/574,120 2004-05-24
US60/581,865 2004-06-22
US60/660,204 2005-03-07

Publications (1)

Publication Number Publication Date
CN101014609A true CN101014609A (en) 2007-08-08

Family

ID=38701501

Family Applications (1)

Application Number Title Priority Date Filing Date
CN 200580021366 Pending CN101014609A (en) 2004-04-26 2005-04-26 Nucleic acid ligands to immunoglobuline e and their use as atopic disease therapeutics

Country Status (1)

Country Link
CN (1) CN101014609A (en)

Cited By (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105891486A (en) * 2015-11-15 2016-08-24 陈博 Kit for specific detection of oral cancer
CN107099536A (en) * 2017-06-23 2017-08-29 河北大学 A kind of IgE specific nucleic acids aptamer, its application and aptamer medicament
CN109371031A (en) * 2018-11-23 2019-02-22 北京化工大学 A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer

Cited By (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105891486A (en) * 2015-11-15 2016-08-24 陈博 Kit for specific detection of oral cancer
CN107099536A (en) * 2017-06-23 2017-08-29 河北大学 A kind of IgE specific nucleic acids aptamer, its application and aptamer medicament
CN107099536B (en) * 2017-06-23 2019-11-15 河北大学 A kind of IgE specific nucleic acid aptamer, its application and aptamer medicament
CN109371031A (en) * 2018-11-23 2019-02-22 北京化工大学 A kind of screening technique specifically binding bovine serum albumin(BSA) aptamer

Similar Documents

Publication Publication Date Title
JP5015923B2 (en) Materials and methods for generating complete 2 &#39;modified nucleic acid transcripts
JP5242918B2 (en) Aptamer therapy useful for the treatment of complement related disorders
AU777043B2 (en) Nucleic acid ligands to CD40ligand
RU2406507C2 (en) Aptameric therapeutic agents applicable for treating complement-related disorders
EP2596807B1 (en) Complement binding aptamers and anti-C5 agents useful in the treatment of ocular disorders
US5869641A (en) High affinity nucleic acid ligands of CD4
AU767501B2 (en) Tenascin-C nucleic acid ligands
JP2009521208A (en) Aptamers against the human IL-12 cytokine family and their use as therapeutics for autoimmune related diseases
JP2007527246A (en) Aptamers against the human IL-12 cytokine family and their use as therapeutics for autoimmune diseases
KR20070101227A (en) Aptamers to von willebrand factor and their use as thrombotic disease therapeutics
US20080214489A1 (en) Aptamer-mediated intracellular delivery of oligonucleotides
EP1807107B1 (en) Stabilized aptamers to platelet derived growth factor and their use as oncology therapeutics
US7579450B2 (en) Nucleic acid ligands specific to immunoglobulin E and their use as atopic disease therapeutics
CN101014609A (en) Nucleic acid ligands to immunoglobuline e and their use as atopic disease therapeutics
US20090053138A1 (en) Stabilized Aptamers to Platelet Derived Growth Factor and their Use as Oncology Therapeutics
JP2007534339A (en) Nucleic acid ligands specific for immunoglobulin E and their use as atopic disease treatment
CN101300361A (en) Aptamers to von willebrand factor and their use as thrombotic disease therapeutics
US20090018093A1 (en) Nucleic Acid Ligands Specific to Immunoglobuline E and Their Use as Atopic Disease Therapeutics
JP5349323B2 (en) Materials and methods for generating transcripts containing modified nucleotides
CN101356284A (en) Aptamer medicinal chemistry
KR20070031877A (en) Aptamers to the human il-12 cytokine family and their use as autoimmune disease therapeutics

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C02 Deemed withdrawal of patent application after publication (patent law 2001)
WD01 Invention patent application deemed withdrawn after publication

Open date: 20070808