CN101012482A - Method for sifting differentia site and flank sequence of genom DNA - Google Patents
Method for sifting differentia site and flank sequence of genom DNA Download PDFInfo
- Publication number
- CN101012482A CN101012482A CN 200710063835 CN200710063835A CN101012482A CN 101012482 A CN101012482 A CN 101012482A CN 200710063835 CN200710063835 CN 200710063835 CN 200710063835 A CN200710063835 A CN 200710063835A CN 101012482 A CN101012482 A CN 101012482A
- Authority
- CN
- China
- Prior art keywords
- dna
- sequence
- gene group
- joint
- testing gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Pending
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The invention discloses a sieving method of differential position and laterial winged sequence from genome DNA, which comprises the following steps: 1) digesting reference genome DNA and detected genome DNA through restrictive nucleic interior contact enzyme to produce viscous end; 2) designing joint H according to viscous end; connecting joint H and DNA segment with viscous end; 3) adopting the connected product as mould; utilizing primer H1 to do PCR augumentation; 4) utilizing S1 nuclease to cut antithetic two-chained DNA with misfit base; adding limit nucleic interior contact enzyme; 5) adding dATP tail in the differential positional lateral winged segment in the genome DNA; 6) connecting joint T in the differential positional lateral winged segment in the genome DNA; 7) testing sequence; obtaining lateral winged sequence; affirming differential position in the detected genome DNA.
Description
Technical field
The present invention relates to the method for difference site among a kind of screening-gene group DNA and flanking sequence thereof.
Background technology
Natural variation is the core of evolutionary biology, plant and animal thremmatology and human genetics, and natural variation is all being sought to understand in these fields.The progress of genomics has produced tremendous influence to research natural variation, might study the molecular basis of knowing these complex characteristic variations.Research to the clone of natural variation gene mainly concentrates on three aspects such as phenotypic cloning, positional cloning and sudden change detection.
1, positional cloning
Positional cloning is called the map based cloning technology again, is along with various plant molecular marker collection of illustrative plates are set up and a kind of new gene clone technology that grows up in succession, is the method for carrying out gene clone according to the position of goal gene on karyomit(e).Utilizing molecular marking technique that goal gene is carried out on the pinpoint basis, use and the closely linked molecular marker screening DNA of goal gene library, thereby make up the physical map in goal gene zone, utilize the karyomit(e) walking to approach goal gene again or finally find the clone who comprises this goal gene, finally by genetic transformation and the final base sequence of determining goal gene of the checking that has complementary functions by the method that karyomit(e) lands.
The sport technique segment of map based cloning comprises screening and the closely linked molecule marker of goal gene, the location of goal gene, the structure of high quality gene library group, the screening of goal gene and evaluation.Since application drawing position clone technology in 1992 is successfully separated ABI3 and FAD3 gene in Arabidopis thaliana since, up to now, only there be more than 30 plant gene successfully to separate by this technology.Trace it to its cause, this technical system has a lot of restricted factors: the breeding cycle that genome size or tumor-necrosis factor glycoproteins affect chromosome walking, species affects the foundation of colony, the density of genetic map affects the searching of close linkage mark, so be necessary to seek other cloning process clone spontaneous mutation gene.
2, phenotypic cloning
The research of phenotypic cloning mainly concentrates on the research of disease related gene, and clone this genoid is the most breathtaking problem in the human molecular genetics always.Palmer in 1984 and Lamer proposed a kind of separate and identify be present in a kind of DNA colony and lack in the subtractive hybridization technology (Subtractivehybridization) of the dna sequence dna of another kind of colony, this afterwards technology is constantly developed forms differential cloning (differentialcloning).On this basis, weissman (1995) has proposed the notion of " phenotypic cloning ", only the phenotype that produces according to the sudden change of related gene just changes directly clone's strategy of this gene of separation, do not locate and do not find out its biochemical function or collection of illustrative plates in advance, even do not need number or its interactional mode of hypothetical gene yet, the feature that is about to phenotype and gene structure or genetic expression connects, thereby separates the relevant gene of particular phenotype.
Be divided into corresponding two classes from the strategy of getting in touch clone gene of DNA or mRNA expression and proterties: the first kind, consider genome sequence structural be the major reason of phenotype unusual (as Human diseases) unusually, directly start with from the structural big disappearance of genome sequence or little (single base) difference, clone goal gene according to same (IBD) principle of blood relation and mispairing cutting (mismatch cleavage) strategy, wherein main representative is genome mispairing triage techniques (GMS, genome mismatch scanning) and represent variance analysis technology (RDA, representational differential analysis), the RFLP method of residues (RFLP subtraction), gel in situ competition renaturation technology (IGCR, in-gel competitive re-association) etc. belongs to several effective replacement scheme of RDA.They are conceived to separate two genomic isotactic sequences and difference zone, and both reach the same goal by different routes, for prospect has been showed in the separation of complex character genes involved.Second class, normal biological process and pathological change, no matter be term single gene or controlled by multiple genes, final all difference of the quality and quantity by genetic expression realizes.When this species diversity may come from the specific expression regulation change of gene also may be structural unusual, and the gene expression difference that screens different phenotypes is that clonal complexity shape genes involved has been opened up another important channel, and this scheme mainly is that mRNA difference shows.In application process, aforesaid method also has certain limitation.Most scheme only is suitable for studying big segmental disappearance and insertion.
3, sudden change detection method
It is extensive and small variation that variation in genomic DNA can be divided into two classes.The large-scale variation comprises chromosome number variation, chromosome translocation and excalation, and these large-scale variations can be easily by high-resolution cytogenetics detection method---fluorescence in situ hybridization detection arrives.And at the DNA subtle change, development in recent years goes out many sudden change detection methods, has also declared many patents.
First kind chromatography is as distinguishing allos hybrid DNA molecule and homologous dna molecule (United States Patent, 7,135,289) in high performance liquid chromatography.The second class microarray method, Liu etc. utilize microarray assay and positional mutation, have introduced restriction enzyme and nuclease (United States Patent, 7,141,371 that can detect the mutational site in their strategy; Japen 2004-016131; CN1556223).The 3rd class enzymatic cutting mispairing method, the nuclease that is utilized mainly is a S1 nuclease family, as S1, P1, mung-bean nuclease and CEL I etc., Wuhan Virology Institute,Chinan academy of Sciences combines S1 nuclease sudden change detection method with slide, applied for patent (CN1293255).The 4th class is an electrophoretic method, detects sudden change according to the electrophoretic mobility difference of mutator gene and its wild type gene, as SSCP, and DGGE.
S1 nuclease sudden change detection method is to utilize this endonuclease capable to discern principle (the Jason T.Howard of dna single chain zone and generation cutting specifically specifically, Jeffrey Ward, Jennifer N.Watson and KennethH.Roux.1999.Heteroduplex Cleavage Analysis Using Sl Nuclease.BioTechniques Vol.27, No.1:pp 18-19), its effect substrate is the heteroduplex DNA molecule that contains the mispairing strand, if PCR product, then needn't pass through purifying, only need digestion to get final product (JasonT.Howard in 20-30 minute, Jeffrey Ward, Jennifer N.Watson and Kenneth H.Roux.1999.Heteroduplex Cleavage Analysis Using S1 Nuclease.BioTechniques Vol.27, No.1:pp 18-19).But this method can't be used for separating mutator gene from the genome of complexity, and reason is as follows: 1, this method is used for the single gene mutation detection, and under the situation of indeterminate target gene sequences, primer can't design, and also just can't increase obtains goal gene; If the product size that 2 cuttings produce is similar to substrate, just can not detect with agarose gel electrophoresis; 3, the fragment of genome complexity can't accurately be hybridized the effective mispairing strand of formation.
Summary of the invention
The method that the purpose of this invention is to provide difference site among a kind of screening-gene group DNA and flanking sequence thereof.
The method of difference site and flanking sequence thereof among the screening-gene group DNA provided by the present invention may further comprise the steps:
1) with the restriction endonuclease digestion reference genomic dna and the testing gene group DNA that can produce sticky end, make described reference genomic dna and testing gene group DNA produce the dna fragmentation that has sticky end respectively;
2) according to described sticky end designed joint H, described joint H is connected with the described dna fragmentation that has sticky end, obtain described reference genomic dna endonuclease bamhi connection product and be connected product with described testing gene group DNA endonuclease bamhi; The end that described joint H is a wherein chain has the complementary nucleotide chain of described sticky end sequence;
3) connect product with described reference genomic dna endonuclease bamhi and be connected product as template with described testing gene group DNA endonuclease bamhi, utilization be selected from described joint H not with the partial sequence of that strand Nucleotide of described sticky end sequence as primer H1, carry out pcr amplification, obtain containing the heteroduplex DNA and the homoduplex DNA of base mismatch; The end of described heteroduplex DNA and homoduplex DNA is flat terminal;
4) utilize the described heteroduplex DNA that contains base mismatch of S1 nuclease cutting earlier, obtain difference site flanking sequence fragment among the described testing gene group DNA; And then in reaction system, add described restriction endonuclease, make two ends of described homoduplex DNA be sticky end;
5) difference site flanking sequence fragment among the described testing gene group DNA is added the dATP tail, obtain having difference site flanking sequence fragment among the testing gene group DNA of dATP tail;
6) to difference site flanking sequence fragment jointing T among the described testing gene group DNA with dATP tail; The end that described joint T is a chain is the complementary nucleotide chain of outstanding dTTP;
7) utilize primer according to described joint T and joint H design to H1 and T1, difference site flanking sequence fragment among the described testing gene group DNA that increases;
8) difference site flanking sequence fragment amplification product among the described testing gene group DNA is checked order, obtain difference site flanking sequence among the described testing gene group DNA;
9) according to difference site flanking sequence fragment among the described testing gene group DNA, determine the difference site among the described testing gene group DNA.
In the aforesaid method, in order to improve screening efficiency, described reference genomic dna and testing gene group DNA are preferably the genomic dna of length less than 100kb, as the genomic dna of Mitochondrial Genome Overview DNA, chloroplast genomic dna, less genomic virus, bacterium etc.
Described reference genomic dna and testing gene group DNA can derive from a kind of biology or biology not of the same race.
For the ease of reclaiming PCR product, a primer mark vitamin H in a pair of primer of described step 7).Also comprise in the described method, before difference site flanking sequence fragment amplification product checks order in to described testing gene group DNA, with the step of difference site flanking sequence fragment amplification product among the described testing gene group of the magnetic beads for purifying DNA of Streptavidin bag quilt.
In order to increase the amount of difference site flanking sequence fragment amplification product among the described testing gene group DNA, also comprise in the described method, before difference site flanking sequence fragment amplification product checks order in to described testing gene group DNA, in with the described testing gene group of the magnetic beads for purifying DNA of Streptavidin bag quilt after the flanking sequence fragment amplification product of difference site, design another to primer H2 and T2 according to described joint T and joint H, flanking sequence segmental step in difference site among the described testing gene group DNA that increases again.
Described 1) the available restriction endonuclease that one or both can produce sticky end digests described reference genomic dna and testing gene group DNA in.
In the aforesaid method, the existing restriction endonuclease that can produce sticky end all can be selected for use, restriction endonuclease EcoRI, the HindIII etc. that form by 6 nucleotide pairs as recognition sequence, recognition sequence still has the enzyme of star activity to avoid using as BamHI by 4 or 5 restriction endonuclease Sau3A, MaeIII etc. that nucleotide pair is formed as far as possible.
When the described restriction endonuclease that can produce sticky end is HindIII; Described joint H is for being respectively two complementary nucleotide chains that single stranded DNA is formed of sequence 1 and sequence 2 in the sequence table by nucleotide sequence; The nucleotide sequence of described primer H1 be in the sequence table sequence 1 from 5 ' terminal the 3rd to 20 deoxyribonucleotides; Sequence 5 in the nucleotide sequence of described primer H2 such as the sequence table;
Described joint T is for being respectively two complementary nucleotide chains that single stranded DNA is formed of sequence 3 and sequence 4 in the sequence table by nucleotide sequence; The nucleotide sequence of described primer T1 be in the sequence table sequence 4 from 5 ' terminal the 6th to 26 deoxyribonucleotides; The nucleotide sequence of described primer T2 be in the sequence table sequence 4 from 5 ' terminal the 20th to 40 deoxyribonucleotides.
Used archaeal dna polymerase is the TaqDNA polysaccharase in the described pcr amplification.
Described reference genomic dna and testing gene group DNA can select according to the experiment needs, can be the genomic dna that wild-type DNA, testing gene group DNA can be mutant as the reference genomic dna.
Method of the present invention can filter out a plurality of differences site and the flanking sequence thereof in testing gene group DNA and the reference genomic dna.
Method of the present invention, do not need to know in advance any information of research object, as the biochemical function of the position on the karyomit(e), coded product and sequence thereof etc., ultimate principle is to utilize the terminal character that produces behind the S1 nuclease cutting single-chain DNA to separate with the difference of cut end character not.
Description of drawings
Fig. 1 is the schema of the method for difference site among the screening-gene group DNA of the present invention and flanking sequence thereof
Fig. 2 is H joint and T joint and primer sequence thereof
Fig. 3 is mutational site 5 ' flanking sequence and its wild-type cab gene and the mutant cab gene order comparison result synoptic diagram that is separated to
Fig. 4 is the result in screening Mitochondrial Genome Overview DNA difference site
Embodiment
Below with wild type gene group DNA as the reference genomic dna, the mutant gene group DNA that contains a difference site (mutational site) is as testing gene group DNA, is example with HindIII as restriction endonuclease, illustrates the flow process of the method for difference site among the screening-gene group DNA of the present invention and flanking sequence thereof.
As shown in Figure 1: 1) at first extract the genomic dna of wild-type and mutant, making wild type gene group DNA and mutated genes group DNA produce the dna fragmentation that has sticky end respectively with HindIII digestion again;
2) according to the sticky end of HindIII, designed joint H (contains the HindIII sticky end, its sequence as shown in Figure 2), joint H is connected with the above-mentioned dna fragmentation that has sticky end, obtains wild type gene group DNA endonuclease bamhi connection product and be connected product with mutated genes group DNA endonuclease bamhi; Joint H is the complementary nucleotide chain that the end of a wherein chain has HindIII sticky end sequence;
3) mutant with equivalent is connected the product mixing as template with wild type gene group DNA endonuclease bamhi, utilizes H1 primer (its sequence as shown in Figure 2) to carry out coamplification, forms the heteroduplex DNA molecule and the homoduplex dna molecular that contain base mismatch.
4) contain the heteroduplex DNA molecule of base mismatch with S1 nuclease cutting, obtain difference site flanking sequence fragment among the mutant gene group DNA; And then in reaction system, add described restriction endonuclease, make and listen two ends stating the homoduplex dna molecular to be sticky end;
5) difference site flanking sequence fragment among the mutant gene group DNA is added the dATP tail, obtain having difference site flanking sequence fragment among the mutant gene group DNA of dATP tail;
6) this had difference site flanking sequence fragment jointing T among the mutant gene group DNA of dATP tail; This joint T is the complementary nucleotide chain of the end of a chain for outstanding dTTP, and its sequence as shown in Figure 2;
7) design primer H1 and T1 respectively according to joint T and joint H, their sequence as shown in Figure 2, difference site flanking sequence fragment among the amplification mutant gene group DNA;
8) difference site flanking sequence fragment amplification product among the mutant gene group DNA is checked order, obtain difference site flanking sequence among the mutant gene group DNA;
9), determine the difference site among the described testing gene group DNA according to difference site flanking sequence fragment among the mutant gene group DNA.
Following examples of the present invention use molecular biological method to be known technology.The Current Protocols in Molecular Biology that publishes in the John Wiley and Sons company that Ausubel writes, write the Molecular Cloning:A Labortory Manual that Cold Spring Harbor Laboratory Press (2001) publishes with J.Sambrook etc., documents such as 3rd ED. all have detailed explanation.
Among Fig. 1, projection is represented the mutational site, and biotin labeling represented in asterisk, and square brackets are joint.
Difference site and flanking sequence thereof in embodiment 1, the screening single-gene
Verify technical scheme of the present invention with the experiment of screening difference site in the known single-gene and flanking sequence thereof below.
1, site-directed mutagenesis chlorophyll a/b conjugated protein (cab) gene
1) genomic dna of extraction maize leaf utilizes primer 1 (5 '-G
AAGCTTCACGGAAGATCCAGGT-3 ') and primer 2 (5 ' CG
AAGCTTGACGCCGCCACCTTGGGCT-3 ') amplification obtains the cab gene DNA of 1.01kb wild-type, and 5 of two primers ' are held and all introduced the HindIII restriction enzyme site;
2) the cab gene that obtains with the step 1) amplification is a template, primer 1 and primer 3 (5 ' GGGTCCTTAATTTGCATTCT CGTGGAAATCTTAAGACGAGCTGGT-3 ') increasing obtains the fragment of 800bp.The cab gene that obtains with the step 1) amplification is a template, utilizes primer 2 and primer 4 (5 ' ACCAGCTCGTCTTAAGATTTCCACGAGAATGCAAATTAAGGACCC-3 ') amplification to obtain the fragment of 220bp.Mole such as above-mentioned two fragments mixes the back as template, utilizes the amplification of primer 1 and primer 2 to obtain the cab gene DNA of mutant again, with respect to wild-type cab gene, has inserted 8 bases (ATGCAAAT) in 789 positions.
2, the formation of heteroduplex DNA molecule
Said mutation type and wild-type cab gene DNA produce sticky end with restriction enzyme HindIII digestion; Sticky end according to HindIII, designed joint H (contains the HindIII sticky end, its sequence as shown in Figure 2), joint H is connected with the above-mentioned dna fragmentation that has sticky end, obtains wild-type cab gene DNA endonuclease bamhi connection product and be connected product with mutant cab gene DNA endonuclease bamhi; Joint H is the complementary nucleotide chain that the end of a wherein chain has HindIII sticky end sequence; Equimolar wild-type cab gene DNA endonuclease bamhi is connected product be connected the product mixing with mutant cab gene DNA endonuclease bamhi as template, utilize H1 primer (sequence as shown in Figure 2) to carry out coamplification, form the heteroduplex DNA molecule that contains base mismatch.
Wherein, 1) contains 3.0 μ l, 10 * HindIII reaction buffer in each digestion with restriction enzyme system, 1.0 μ gDNA, 5U HindIII restriction enzyme, cumulative volume is 30 μ l, react more than 3 hours down at 37 ℃, make it complete digestion, again in 65 ℃ of following heated and inactivated restriction enzymes;
2) linked system comprises above-mentioned 30 μ l solution, 5.0 μ l 10mM ATP, and the joint H of 50pmol, cumulative volume are 50 μ l, 16 ℃ of following connections spend the night;
3) the pcr amplification system is 30 μ l, contains 3.0 μ l, 10 * PCR reaction buffer, 2.5mM Mg
2+, 10pmolH1 primer, 0.2mM dNTP, 5U Taq archaeal dna polymerase.Response procedures be 95 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 2 minutes, 30 circulations.
3, S1 nuclease cutting mispairing strand
Cumulative volume is 50 μ l, contain 5 μ l, 10 * Sl buffer, the S1 nuclease (available from Promega company) of above-mentioned PCR product of 30 μ l and 10U reacted 30 minutes down in 27 ℃, use 10 μ l 250mM EDTA stopped reactions again, add the saturated phenol of 50 μ l Tris and remove albumen.Use ammonium acetate and ethanol sedimentation DNA at last, and with 43 μ l sterilized water dissolution precipitations.
4, the mark of cleavage site
Comprise that restrictive diges-tion produces 5 and ' protruding terminus, adds being connected of dATP end reaction and T-joint.
1) in above-mentioned reaction system, adds HindIII, make two ends of homoduplex DNA be sticky end;
2) difference site flanking sequence fragment in the mutant cab gene DNA is added the dATP tail, obtain having difference site flanking sequence fragment in the mutant cab gene DNA of dATP tail;
3) this had difference site flanking sequence fragment jointing T in the mutant cab gene DNA of dATP tail; Joint T is the complementary nucleotide chain of the end of a chain for outstanding dTTP, and its sequence as shown in Figure 2.
Wherein, a) HindUI digests system: cumulative volume is 50 μ l, comprises above-mentioned 43 μ l DNA, 5 μ l, 10 * HindIII reaction buffer, 1.0 μ l arginine, 1.0 μ l HindIII restriction enzymes reacted 3 hours down at 37 ℃, heated down in 65 ℃ to make enzyme deactivation in 10 minutes.With ammonium acetate and ethanol sedimentation DNA, and with 43 μ l sterilized water wash-outs.
B) add dATP end reaction system: cumulative volume is 50 μ l, comprises above-mentioned 43 μ l DNA, 5.0 μ l, 10 * PCRbuffer, and 1.0 μ l 10Mm dATP, 5U Taq DNA polymerase, of short duration centrifugal behind the above-mentioned system mixing, be positioned over 72 ℃ of reaction 30min down.Reclaim above-mentioned DNA with PCR product purification test kit again, remove the DNA and the dATP of small segment, with the aseptic dd H of 40 μ l
2The O wash-out.
C) connection of joint T, reaction system is: cumulative volume is 50 μ l, comprises above-mentioned 40 μ l dna solutions, 50pmol joint T, 2.5 μ l T4 DNA ligase, 16 ℃ of following reactions are spent the night.
5, the amplification of target gene fragment and evaluation
Comprise magnetic bead absorption target DNA, the pulsating evaluation of goal gene of two-wheeled amplification, Streptavidin bag quilt
1) design a pair of primer H1 and T1 according to joint T and joint H, their sequence as shown in Figure 2, difference site flanking sequence fragment (purpose product) in the pcr amplification mutant cab gene DNA.Wherein, reaction system is 30 μ l, comprises the above-mentioned dna solution of 5.0 μ l, 10pmol primer H2 and primer T1,0.2mM dNTP, 5uTaqDNA polymerase.Biotin labeling primer T1.Response procedures be 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 2 minutes, 30 circulations.
2) magnetic bead with Streptavidin bag quilt adsorbs target DNA.
3) second take turns amplification purpose product: except that primer is that H2 and T2, template are the first round amplified production, amplification system and amplification program are the same.
4) evaluation of target gene fragment: the 5 ' flanking sequence (sequence 6) that cut glue recovery target DNA, be connected to the T carrier, order-checking obtains the mutational site, the result shows that the corresponding sequence of the flanking sequence in this mutational site and wild-type cab gene is in full accord.
Fig. 3 shows is the partial sequence of mutational site 5 ' flanking sequence of being separated to and the comparison result synoptic diagram of wild-type cab gene and mutant cab gene corresponding sequence.Among Fig. 3, MT-DNA represents mutant cab gene corresponding sequence, and WT-DNA represents wild-type cab gene corresponding sequence, and Isolated-DNA represents the mutational site part flanking sequence that the inventive method obtains, and 789bp represents to insert 5 ' terminal positions of sudden change.
Embodiment 2, from Arabidopis thaliana Mitochondrial Genome Overview screening difference site sequence
Further illustrate technical scheme of the present invention with the experiment of difference site and flanking sequence thereof among the screening Arabidopis thaliana Mitochondrial Genome Overview DNA below.
1, the extraction of Mitochondrial Genome Overview DNA
Cultivate a strain in (30 ℃) 8-10 days inferior environmental Arabidopis thaliana etiolated seedlings of taxi driver brother's rival as the reference plant with the darkroom, an other strain amounts to the combination of 100 reference plant and plant to be measured as plant to be measured.Only be combined as example below, set forth experimental technique with one of them reference plant and plant to be measured that screens a difference site.
The extracting method of plastosome of reference plant and plant to be measured and Mitochondrial Genome Overview DNA is as follows:
Get Arabidopis thaliana etiolated seedling 80-100g, the homogenate buffer that adds 3 times of volumes (3ml/g) precooling (contains 0.4mol/L N.F,USP MANNITOL, 40mmol/L MOPS (3-(N-morpholino)-propanesulfonic acid), 1mmol/L EDTA, 0.05% (0.05g/100ml) halfcystine, 0.1% (0.1g/100ml) BSA and 0.1% (0.1g/100ml) mercaptoethanol, 5 mmol/LKCl, pH7.6), in tissue mashing machine, smash 4-6 time at a high speed, at every turn 5-6 second; Homogenate after 6 layers of filtered through gauze, filtrate centrifugal (4 ℃, 2000g, 10min); Supernatant liquor is in 4 ℃, the centrifugal 15min of 10000g; Precipitation with suspension (contain 0.4mol/L N.F,USP MANNITOL, 10mmol/L MOPS, 0.1% (0.1g/100ml) mercaptoethanol, 5mmol/L KCl, pH7.5) suspension, under 4 ℃, 1400g 5min is centrifugal, supernatant liquor 12000g 15min is centrifugal; After the plastosome pellet resuspended of preliminary purification, add MgCl
2To final concentration be 6mmol/L, add DNase to final concentration be 15 μ g/ml, act on after 1 hour adding Na
2EDTA to final concentration be 15mmol/L.(20-60%) is centrifugal through sucrose density gradient, and the purifying plastosome that obtains (40-50% interface) is suspended in 4 times of volume shelf damping fluids (0.6mol/L sucrose, 10mmol/L Tris-Cl, 20mmol/L EDTA), the centrifugal 10min of 12000g; The purifying plastosome add an amount of lysis buffer (contain 1.2% (1.2g/100ml) SDS, 1mmol/L EDTA, 50mmol/L Tris-HCl, 50mmol/L NaCl, pH7.5) and 1/100 volume 10mg/ml RNase, 50 ℃ of insulation 30min; Add 1/150 volume Proteinase K solution (25mg/ml) again, 37 ℃ of insulation 30min; Use phenol, phenol/chloroform/primary isoamyl alcohol (24: 24: 1), chloroform/primary isoamyl alcohol (24: 1) extracting successively; Supernatant liquor adds 1/10 volume 3mol/LNa
2Ac and 2-2.5 times volume ethanol, centrifugal (12000g, 4 ℃), DNA precipitates after dry air, adds an amount of pH8.0 TE solution dissolving, obtains Mitochondrial Genome Overview DNA.It is stand-by to put-20 ℃ of preservations.
2, above-mentioned reference line plastochondria genomic dna and Mitochondrial Genome Overview DNA to be measured produce sticky end with restriction enzyme HindIII digestion respectively; Sticky end according to HindIII, designed joint H (contains the HindIII sticky end, its sequence as shown in Figure 2), joint H is connected with the above-mentioned dna fragmentation that has sticky end, obtains reference line plastochondria genomic dna endonuclease bamhi connection product and be connected product with Mitochondrial Genome Overview DNA endonuclease bamhi to be measured; Joint H is the complementary nucleotide chain that the end of a wherein chain has HindIII sticky end sequence.Equimolar reference line plastochondria genomic dna endonuclease bamhi is connected product be connected the product mixing with Mitochondrial Genome Overview DNA endonuclease bamhi to be measured, utilize H1 primer (sequence as shown in Figure 2) to carry out coamplification as template.
Wherein, 1) contains 3.0 μ l, 10 * HindIII reaction buffer in each digestion with restriction enzyme system, 1.0 μ g DNA, 5U HindIII restriction enzyme, cumulative volume is 30 μ l, react more than 3 hours down at 37 ℃, make it complete digestion, again in 65 ℃ of following heated and inactivated restriction enzymes;
2) linked system comprises above-mentioned 30 μ l solution, 5.0 μ l 10mM ATP, and the joint H of 50pmol, cumulative volume are 50 μ l, 16 ℃ of following connections spend the night.
3) the pcr amplification system is 30 μ l, contains 3.0 μ l, 10 * PCR reaction buffer, 2.5mM Mg
2+, 10pmolH1 primer, 0.2mM dNTP, 5U Taq archaeal dna polymerase.Response procedures be 95 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 2 minutes, 30 circulations.
3, S1 nuclease cutting mispairing strand
Cumulative volume is 50 μ l, contain 5 μ l, 10 * S1 buffer, the S1 nuclease (available from Promega company) of above-mentioned PCR product of 30 μ l and 10U reacted 30 minutes down in 27 ℃, use 10 μ l 250mM EDTA stopped reactions again, add the saturated phenol of 50 μ l Tris and remove albumen.Use ammonium acetate and ethanol sedimentation DNA at last, and with 43 μ l sterilized water dissolution precipitations.
4, the mark of cleavage site
Comprise that restrictive diges-tion produces 5 and ' protruding terminus, adds being connected of dATP end reaction and T-joint.
1) in above-mentioned reaction system, adds HindIII, make two ends of homoduplex DNA be sticky end;
2) treat that difference site flanking sequence fragment adds the dATP tail in the survey line plastochondria genomic dna, obtain having difference site flanking sequence fragment among the Mitochondrial Genome Overview DNA to be measured of dATP tail;
3) this had difference site flanking sequence fragment jointing T among the Mitochondrial Genome Overview DNA to be measured of dATP tail; Joint T is the complementary nucleotide chain of the end of a chain for outstanding dTTP, and its sequence as shown in Figure 2.
Wherein, a) HindIII digests system: cumulative volume is 50 μ l, comprises above-mentioned 43 μ l DNA, 5 μ l, 10 * HindIII reaction buffer, 1.0 μ l arginine, 1.0 μ l HindIII restriction enzymes reacted 3 hours down at 37 ℃, heated down in 65 ℃ to make enzyme deactivation in 10 minutes.With ammonium acetate and ethanol sedimentation DNA, and with 43 μ l sterilized water wash-outs.
B) add dATP and add the A reaction system: cumulative volume is 50 μ l, comprises above-mentioned 43 μ l DNA, 5.0 μ l, 10 * PCR buffer, 1.0 μ l 10Mm dATP, 5U Taq DNA polymerase is behind the above-mentioned system mixing, of short duration centrifugal, be positioned over 72 ℃ of reaction 30min down.Reclaim above-mentioned DNA with PCR product purification test kit again, remove the DNA and the dATP of small segment, with the aseptic dd H of 40 μ l
2The O wash-out.
C) connection of joint T, reaction system is: cumulative volume is 50 μ l, comprises above-mentioned 40 μ l dna solutions, 50pmol joint T, 2.5 μ l T4 DNA ligase, 16 ℃ of following reactions are spent the night.
5, the amplification of target gene fragment and evaluation
Comprise magnetic bead absorption target DNA, the pulsating evaluation of goal gene of two-wheeled amplification, Streptavidin bag quilt
1) design a pair of primer H1 and T1 according to joint T and joint H, their sequence as shown in Figure 2, difference site flanking sequence fragment (purpose product) among the pcr amplification Mitochondrial Genome Overview DNA to be measured.Wherein, reaction system is 30 μ l, comprises the above-mentioned dna solution of 5.0 μ l, 10pmol primer H2 and primer T1,0.2mM dNTP, 5uTaqDNA polymerase.Biotin labeling primer T1.Response procedures be 95 ℃ 30 seconds, 55 ℃ 30 seconds, 72 ℃ 2 minutes, 30 circulations.
2) magnetic bead with Streptavidin bag quilt adsorbs target DNA.
3) second take turns amplification purpose product: removing primer is H2 and T2, and template is outside the first round amplified production, and amplification system and amplification program are the same.
4) evaluation of target gene fragment: the flanking sequence that cut glue recovery target DNA, be connected to the T carrier, order-checking obtains the difference site.
5) the flanking sequence design primer that obtains with order-checking, the reference line plastochondria genomic dna endonuclease bamhi that obtains with step 2 connects product to be connected product with Mitochondrial Genome Overview DNA endonuclease bamhi to be measured is template respectively, pcr amplification comprises the Mitochondrial Genome Overview dna fragmentation to be measured and the reference line plastochondria genomic DNA fragment in difference site, and it is connected respectively to the sequence that T carrier, order-checking obtain comprising the Mitochondrial Genome Overview dna fragmentation to be measured and the reference line plastochondria genomic DNA fragment in difference site.
The result has to have screened a difference site in the combination in 100 reference plant and plant to be measured combination.This difference site is present in the Terminal oxidase gene, and this difference site sequence as shown in Figure 4.The difference that 3 bases are arranged in reference plant and the plant to be measured is the 145th to 147 of Fig. 4.Among Fig. 4, the Terminal oxidase gene corresponding sequence of 4 expressions plant to be measured, the Terminal oxidase gene corresponding sequence of 3 expression reference plant, Consensus represents consistent sequence.
Wherein, sequence 7 in the 5 ' flanking sequence in this difference site that obtains in the step 4) such as the sequence table, sequence 8 in the 3 ' flanking sequence in this difference site such as the sequence table.In the step 5) with this two flanking sequences design primer P (5 '-GATCCAGTCACCTGAAGATTCTC-3 ') and primer R (5 '-CTTCAGCAACTTCTTCACTAGCGTT-3 '), the reference line plastochondria genomic dna endonuclease bamhi that obtains with step 2 connects product to be connected product with Mitochondrial Genome Overview DNA endonuclease bamhi to be measured is template respectively, pcr amplification comprises the Mitochondrial Genome Overview dna fragmentation to be measured and the reference line plastochondria genomic DNA fragment in difference site, it is connected respectively to the T carrier, order-checking obtains comprising the sequence of the Mitochondrial Genome Overview dna fragmentation to be measured and the reference line plastochondria genomic DNA fragment in difference site, sequence such as Fig. 4 that amplification obtains.
<160>8
<210>1
<211>23
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>1
ccggccaagc?ttgtagactc?acc 23
<210>2
<211>24
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>2
agctggtgag?tctacaagct?tggc 24
<210>3
<211>35
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>3
accatcgtgc?acagctccat?agactgcgta?ccgac 35
<210>4
<211>40
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>4
catcgtcggt?acgcagtcta?tggagctgtg?cacgatggtt 40
<210>5
<211>18
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
cttgtagact?caccagct 18
<210>6
<211>779
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
cttgtagact?caccagctca?cggaagatcc?aggtctcgag?actaggagac?ggatgggagg 60
cgcaacgcgc?gatggggagg?ggggcggcgc?tgacctttct?ggcgaggtcg?aggtagcggt 120
agagcagctg?cagcgcggac?acgatgagga?agacgaagat?agccgccagg?gacatggtcg 180
ccggcggcgg?cggagcgagg?ctgagccggt?ctctccggcc?tccgatcggc?gttaagttgg 240
ggatcgtaac?gtgacgtgtc?tcctctccac?agatcgacac?aaccggccta?ctcgggtgca 300
cgacgccgcg?acaagggtga?gatgtccgtg?cacgcagccc?gtttggagtc?ctcgttgccc 360
acgaaccgac?cccttacaga?acaaggccta?gcccaaaact?attctgagtt?gagcttttga 420
gcctagccca?cctaagccga?gcgtcatgaa?ctgatgaacc?cactaccact?agtcaaggca 480
aaccacaacc?acaaatggat?caattgatct?agaacaatcc?gaaggagggg?aggccacgtc 540
acactcacac?caaccgaaat?atctgccagt?atcagatcaa?ccggccaata?ggacgccagc 600
gagcccaaca?cctagcgacg?ccgcaaaatt?caccgcgagg?ggcaccgggc?acggcaaaaa 660
caaaagcccg?gcgcggtgag?aatatctggc?gactggcgga?gacctggtgg?ccagcgcgcg 720
gccacatcag?ccaccccatc?cgcccacctc?acctccggcg?agccaatacc?agctcgtca 779
<210>7
<211>218
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
cttgtagact?caccagctta?aacctaacaa?tttctctcag?agtgttatca?tcaaaagatt 60
cttggtctcc?gatccagtca?cctgaagatt?ctccgagctt?cttttgacca?cacactttca 120
atggcggatg?ctgtgaacgc?tcaaactcca?tcgctctccg?agcaatatca?tttggagaaa 180
gaagtgaagc?aagacacttg?gtagcacgtg?tcgaggta 218
<210>8
<211>286
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
cttgtagact?caccagctga?tctcatcagg?ggtttcttca?gcaacttctt?cactagcgtt 60
ttcgtcatta?ttttcttcag?cagcagcagg?agtctcttca?gcattgtctt?ccgctgcagc 120
aggagcctca?gaagccactt?ccgttgattc?aggagcagat?tcagacttct?cttcaactac 180
agaaaccgct?tcctcaacag?gagattcttc?cttagcttgc?tccgtcttaa?cctcttcagc 240
ttgtgtagta?acttctggtg?ccaccttggt?agcacgtgtc?gaggta 286
Claims (10)
1, the method for difference site and flanking sequence thereof among a kind of screening-gene group DNA may further comprise the steps:
1) with the restriction endonuclease digestion reference genomic dna and the testing gene group DNA that can produce sticky end, make described reference genomic dna and testing gene group DNA produce the dna fragmentation that has sticky end respectively;
2) according to described sticky end designed joint H, described joint H is connected with the described dna fragmentation that has sticky end, obtain described reference genomic dna endonuclease bamhi connection product and be connected product with described testing gene group DNA endonuclease bamhi; The end that described joint H is a wherein chain has the complementary nucleotide chain of described sticky end sequence;
3) connect product with described reference genomic dna endonuclease bamhi and be connected product as template with described testing gene group DNA endonuclease bamhi, utilization be selected from described joint H not with the partial sequence of that strand Nucleotide of described sticky end sequence as primer H1, carry out pcr amplification, obtain containing the heteroduplex DNA and the homoduplex DNA of base mismatch;
4) utilize the described heteroduplex DNA that contains base mismatch of S1 nuclease cutting earlier, obtain difference site flanking sequence fragment among the described testing gene group DNA; And then in reaction system, add described restriction endonuclease, make two ends of described homoduplex DNA be sticky end;
5) difference site flanking sequence fragment among the described testing gene group DNA is added the dATP tail, obtain having difference site flanking sequence fragment among the testing gene group DNA of dATP tail;
6) to difference site flanking sequence fragment jointing T among the described testing gene group DNA with dATP tail; The end that described joint T is a chain is the complementary nucleotide chain of outstanding dTTP;
7) design a pair of primer H1 and T1 according to described joint T and joint H, difference site flanking sequence fragment among the described testing gene group DNA that increases;
8) difference site flanking sequence fragment amplification product among the described testing gene group DNA is checked order, obtain difference site flanking sequence among the described testing gene group DNA;
9) according to difference site flanking sequence fragment among the described testing gene group DNA, determine the difference site among the described testing gene group DNA.
2, method according to claim 1 is characterized in that: described reference genomic dna and testing gene group DNA are the genomic dna of length less than 100kb.
3, method according to claim 1 is characterized in that: described reference genomic dna and testing gene group DNA derive from a kind of biology or biology not of the same race.
4, method according to claim 1 is characterized in that: a primer mark vitamin H in a pair of primer of described step 7).
5, method according to claim 4, it is characterized in that: also comprise in the described method, before the dna fragmentation amplified production to described difference site flanking sequence checks order, with the step of the described difference of the magnetic beads for purifying site flanking sequence dna fragmentation amplified production of Streptavidin bag quilt.
6, method according to claim 5, it is characterized in that: also comprise in the described method, before difference site flanking sequence fragment amplification product checks order in to described testing gene group DNA, in with the described testing gene group of the magnetic beads for purifying DNA of Streptavidin bag quilt after the flanking sequence fragment of difference site, design another to primer H2 and T2 according to described joint T and joint H, flanking sequence segmental step in difference site among the described testing gene group DNA that increases again.
7, according to arbitrary described method in the claim 1 to 6, it is characterized in that: the described recognition sequence that can produce the restriction endonuclease of sticky end is made up of 6 nucleotide pairs.
8, according to arbitrary described method in the claim 1 to 6, it is characterized in that: the recognition sequence of the described restriction endonuclease that can produce sticky end is made up of 4 or 5 nucleotide pairs.
9, method according to claim 7 is characterized in that: the described restriction endonuclease that can produce sticky end is HindIII; Described joint H is for being respectively two complementary nucleotide chains that single stranded DNA is formed of sequence 1 and sequence 2 in the sequence table by nucleotide sequence; The nucleotide sequence of described primer H1 be in the sequence table sequence 1 from 5 ' terminal the 3rd to 20 deoxyribonucleotides; Sequence 5 in the nucleotide sequence of described primer H2 such as the sequence table;
Described joint T is for being respectively two complementary nucleotide chains that single stranded DNA is formed of sequence 3 and sequence 4 in the sequence table by nucleotide sequence; The nucleotide sequence of described primer T1 be in the sequence table sequence 4 from 5 ' terminal the 6th to 26 deoxyribonucleotides; The nucleotide sequence of described primer T2 be in the sequence table sequence 4 from 5 ' terminal the 20th to 40 deoxyribonucleotides.
10, method according to claim 1 is characterized in that: used archaeal dna polymerase is the TaqDNA polysaccharase in the described pcr amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710063835 CN101012482A (en) | 2007-02-12 | 2007-02-12 | Method for sifting differentia site and flank sequence of genom DNA |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN 200710063835 CN101012482A (en) | 2007-02-12 | 2007-02-12 | Method for sifting differentia site and flank sequence of genom DNA |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CN101012482A true CN101012482A (en) | 2007-08-08 |
Family
ID=38700210
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN 200710063835 Pending CN101012482A (en) | 2007-02-12 | 2007-02-12 | Method for sifting differentia site and flank sequence of genom DNA |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN101012482A (en) |
Cited By (6)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN102634506A (en) * | 2012-04-06 | 2012-08-15 | 湖南杂交水稻研究中心 | Method for applying adhesive tail end joints to flanking sequence separation |
| WO2013053207A1 (en) * | 2011-10-14 | 2013-04-18 | 深圳华大基因科技有限公司 | Method for determining nucleotide sequence of disease-related nucleic acid molecule in sample to be tested |
| CN108034695A (en) * | 2017-12-21 | 2018-05-15 | 江苏省农业科学院 | A kind of method and its application for efficiently obtaining T-DNA insertion flanking sequences |
| CN108103154A (en) * | 2017-12-29 | 2018-06-01 | 武汉艾德士生物科技有限公司 | Judge the method for copy number of target genes in genome |
| CN108103169A (en) * | 2017-12-11 | 2018-06-01 | 西北大学 | A kind of PCR method of the connector mediation based on hot asymmetric reaction |
| CN109355334A (en) * | 2018-12-06 | 2019-02-19 | 江苏省农业科学院 | A method of preparing poly IC |
-
2007
- 2007-02-12 CN CN 200710063835 patent/CN101012482A/en active Pending
Cited By (8)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2013053207A1 (en) * | 2011-10-14 | 2013-04-18 | 深圳华大基因科技有限公司 | Method for determining nucleotide sequence of disease-related nucleic acid molecule in sample to be tested |
| CN102634506A (en) * | 2012-04-06 | 2012-08-15 | 湖南杂交水稻研究中心 | Method for applying adhesive tail end joints to flanking sequence separation |
| CN102634506B (en) * | 2012-04-06 | 2014-02-26 | 湖南杂交水稻研究中心 | Method for applying adhesive tail end joints to flanking sequence separation |
| CN108103169A (en) * | 2017-12-11 | 2018-06-01 | 西北大学 | A kind of PCR method of the connector mediation based on hot asymmetric reaction |
| CN108034695A (en) * | 2017-12-21 | 2018-05-15 | 江苏省农业科学院 | A kind of method and its application for efficiently obtaining T-DNA insertion flanking sequences |
| CN108034695B (en) * | 2017-12-21 | 2021-06-25 | 江苏省农业科学院 | Method for efficiently obtaining T-DNA inserted flanking sequence and application thereof |
| CN108103154A (en) * | 2017-12-29 | 2018-06-01 | 武汉艾德士生物科技有限公司 | Judge the method for copy number of target genes in genome |
| CN109355334A (en) * | 2018-12-06 | 2019-02-19 | 江苏省农业科学院 | A method of preparing poly IC |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US10941436B2 (en) | Methods for characterizing DNA sequence composition in a genome | |
| CN104797716B (en) | Cotton event pdab4468.19.10.3 detection method | |
| US20110015084A1 (en) | Methods for Identifying Genetic Linkage | |
| CN105696088B (en) | A kind of double digestion simplifies genome two generations sequencing library construction method and matched reagent box | |
| CN101310024B (en) | Method for high throughput screening of transposon tagging populations and massive parallel sequence identification of insertion sites | |
| CN107190003A (en) | A kind of method of efficient quick separating T DNA insertion point flanking sequences and application thereof | |
| CN108138230A (en) | For capturing the lock nucleic acid of fusion | |
| CN101012482A (en) | Method for sifting differentia site and flank sequence of genom DNA | |
| US6461814B1 (en) | Method of identifying gene transcription patterns | |
| CN108165554A (en) | Control corn leaf width gene ZmNL4 and its application | |
| CN105525012B (en) | A kind of method for identifying molecules of peanut hybridization kind | |
| CN106967716A (en) | Double gRNA, double gRNA libraries, double gRNA vector libraries and its preparation method and application | |
| CN104313172A (en) | Method for simultaneous genotyping of large number of samples | |
| WO2007125958A1 (en) | Marker for selecting aphanomyces cochlioides-resistant variety and selection method therefor | |
| CN113637786A (en) | DNA fragment related to linoleic acid content in oil tea seed oil, SNP molecular marker and application thereof | |
| CN115948600B (en) | Grape powdery mildew resistance dCAPS molecular marker and application thereof | |
| CN107460246A (en) | A kind of method of fast positioning peach target gene | |
| CN109161605B (en) | Development and application of SNP molecular marker of rice blast resistance gene Pi1 | |
| CN112410461B (en) | Anti-mosaic virus transgenic soybean event SMV-2 exogenous insert fragment flanking sequence and application thereof | |
| CN111304353B (en) | Method for breeding rice east field type three-line maintainer line by using outcross gene linkage markers | |
| CN108660240B (en) | SNP (Single nucleotide polymorphism) marker related to long shape of neck of millet as well as detection primer and application thereof | |
| CN117568388A (en) | CRISPR vector of BnanINJA gene of brassica napus, construction method, detection/identification method and application thereof | |
| CN112143830A (en) | Molecular marker of rice sword leaf width regulation gene NAL1 and application thereof | |
| CN116411108A (en) | Primer set, kit and method for detecting vector GATV2 transformation event | |
| CN117070662A (en) | SNP (single nucleotide polymorphism) marker of melon fruits, detection method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C12 | Rejection of a patent application after its publication | ||
| RJ01 | Rejection of invention patent application after publication |