CN101012460B - Pig production trait related gene CACNA2D1 order and uses thereof - Google Patents

Abstract

The invention discloses a relative gene CACNA2D1 sequence and application of relative pig deseription, which is characterized by the following: adopting three couples of primer in the SEQ ID No.2 andSEQ ID No.3, SEQ ID No.4 and SEQ ID No.5, SEQ ID No.6 and SEQ ID No.7 to do PCR augumentation for total pig DNA; detecting sequence; obtaining two DNA segments with length at 458bp and 349bp; affirming whether the 352nd base is G or A on the SEQ ID No.15' end and the base on the 1739th is A and G.

Description

Sequence of pig production character genes involved CACNA2D1 and uses thereof

Technical field

The present invention relates to Protocols in Molecular Biology and the breeding field of pig, be specifically related to sequence of a kind of pig production character genes involved CACNA2D1 and uses thereof.Be pig with clone, single nucleotide polymorphism analysis production traits genes involved CACNA2D1 partial sequence and utilize the genetic marker of this gene as pig production character.

Background technology

Molecular genetic marker is meant each proterties that is subjected to Gene Handling and can be used for selecting indirectly.Choose seeds according to genetic marker, be expected to discern breeding stock individuality, improve selection intensity, shorten the generation interval, obtain maximum genetic progress with excellent genes.Since the nineties, along with the progress of Protocols in Molecular Biology and in the pig breeding Application for Field, progressively having occurred is the molecular marker assisted selection and the infiltration equimolecular breeding technique of core with the molecule marker, and these technology combine with traditional breeding method, have quickened the pig breeding process greatly.Can molecule marker bring into play due effect in the practices of breeding, depends on 4 factors: (1) has and the closely linked molecule marker of target gene; (2) has the genetic map that the high molecule marker of polymorphism is drawn; (3) can realize the molecular marker analysis automatization, reduce cost, simplify experiment; (4) use the improvement that mark is predicted the method for breeding value.The gene or the mark that can be applied to molecular marker assisted selection must have bigger genetic contribution to objective trait, be major gene or mark, therefore seeking prerequisite and the basis that these major genes and closely linked with it molecule marker become molecular marker assisted selection, also is the research emphasis and the urgent problem of for some time pig biology field at present and in the future.

Pig CACNA2D1 gene is made up of 39 exons and 38 introns, mRNA coding head of district 3273bp, 1091 amino acid (Brown JP et al. encodes, 1998, Cloning and deletionmutagenesis of the alpha2 delta calcium channel subunit from porcinecerebral cortex.Expression of a soluble form of the protein that retains[3H] gabapentin binding activity.J Biol Chem.273 (39): 25458-65).According to people and mouse CACNA2D1 gene genome length, estimate that pig CACNA2D1 gene genome length is more than 40 ten thousand bp.

The α of CACNA2D1 genes encoding skeletal muscle calcium channel ₂With the δ auxiliary subunit, be one of (Malignant hyperthermia syndrome) candidate gene (Robinson etc. of human malignant's high temperature syndromes, 2000), Dui Ying pig stress syndromes (PSS) can not only cause the death of pig with it, and can cause meat of poor quality (as PSE, DFD meat etc.).The contriver (2005, Radiation hybrid mapping ofskeletal muscle calcium channel genes CACNB1 and CACNG1 to porcinechromosome 12 and CACNA2D1 to porcine chromosome 9.Animal Genetics.36,358-359) utilize radiation hybrid cell line with the CACNA2D1 assignment of genes gene mapping on No. 9 karyomit(e) of pig, its position and de Koning etc. (2001, Detection and characterization ofquantitative trait loci for meat quality traits in pigs.Journal of AnimalScience.79,2812-29) and Guo Xiaoling (2002, the trunk value of pig, the QTL of meat and profile proterties location. Kiel, Germany university agronomy and Foodstuffs Academy Ph D dissertation) QTL that influences the meat proterties of discovery is overlapping respectively on No. 9 karyomit(e)s.Can infer that the CACNA2D1 gene is the suitable candidate genes of these QTL, be necessary to study the influence of the variation of CACNA2D1 gene the meat proterties.

(Single nucleotide polymorphism SNP), mainly is meant on genomic level by the caused dna sequence polymorphism of the variation of single Nucleotide single nucleotide polymorphism.The polymorphism that SNP showed only relates to the variation of single base, this variation can be by the conversion (transition of single base, C → T, then G → A) or transversion (transversion on its complementary strand, C → A, G → T, C → G, A → T) cause also can be by due to the insertion or disappearance of base.But usually said SNP does not comprise back two kinds of situations.

The method of detection SNP has many, as dna sequencing, restriction fragment length polymorphism (RFLP), single strand conformation polymorphism (SSCP), allele specific oligonucleotide oligonucleotide hybridization (ASO) and high performance liquid chromatography etc.But, just can carry out other detection then no matter any method at first must be carried out the amplification of target sequence.

Orita etc. discover, the single stranded DNA fragment is complicated space folded conformation, this three-dimensional arrangement is mainly kept by interaction force in its inner base pairing equimolecular, when a base changes, can influence its space conformation more or less, conformation is changed, and the discrepant single strand dna of space conformation is varied in size by exclusion in polyacrylamide gel.Therefore, by native polyacrylamide gel electrophoresis (PAGE), can very observantly discrepant molecular separation on the conformation be opened, this method is that (Single-Strand Conformation Polymorphism SSCP) analyzes single strand conformation polymorphism.SSCP is used to check the transgenation of pcr amplification product, has set up the PCR-SSCP technology, further improved the simplicity and the susceptibility that detect mutation method.Its primary process is: 1. pcr amplification target DNA; 2. with special pcr amplification product sex change, then snapback makes it to become the single strand dna with certain space structure: 3. an amount of single stranded DNA is carried out native polyacrylamide gel electrophoresis; 4. dye by radioactive automatic developing, silver at last or ethidium bromide chromogenic assay result.If discovery single stranded DNA band mobility is compared with normal control change, just can judge that this chain conformation changes, and then infer in this dna fragmentation that base mutation is arranged.This method is easy, quick, sensitive, does not need special instrument, can find the base mutation of unknown position in the target dna fragment.But it also has weak point.For example, can only to determine the position and the type of sudden change at last, also need further order-checking as a kind of sudden change detection method; Deposition condition requires strict; In addition, because SSCP causes that according to point mutation the change of single strand dna three-dimensional conformation realizes electrophoretic separation, in the time of point mutation when some position so just may occurring inoperative or effect be very little to the change of single strand dna three-dimensional conformation, add other condition effect, polyacrylamide gel electrophoresis can't be differentiated cause omission.However this method is compared the higher detection rate that still has with additive method.Takao thinks that most available these methods of all single sequence changes that it is now know that detect.

The invention provides pig CACNA2D1 gene genome the 27th, 28,29 exons, the 27th, 28 intron full sequences and the 29th intron partial sequence, and heritable variation in the 27th and 29 introns and the relation between hog on hook and meat proterties.

Summary of the invention

The purpose of this invention is to provide sequence of a kind of pig production character genes involved CACNA2D1 and uses thereof.

The sequence of pig production character genes involved CACNA2D1 is shown in SEQ ID No.1.

Described SEQ ID No.1 sequence total length is 2413bp, wherein comprises pig CACNA2D1 gene genome the 27th, 28,29 exons, the partial sequence of the full sequence of the 27th, 28 introns and the 29th intron.There is G → A in SEQ ID No.1 sequence 352bp place, and the 1739bp place exists the mononucleotide of A → G to replace.Three pairs of primers of SEQ ID No.1 sequence amplification and sequencing are shown in SEQ ID No.2 to SEQ IDNo.7.Two pairs of primers of SEQ ID No.1 sequence 352bp and 1739bp place single nucleotide polymorphism are shown in SEQ ID No.8 to SEQ ID No.11.

Pig CACNA2D1 gene the 27th intron PCR-SSCP pleomorphism site (SEQ ID No.1 sequence 352bp) genotype not simultaneously, there are significant difference in intramuscular fat content, muscle crude protein and intramuscular moisture content.The intramuscular fat content of AA genotype pig is significantly higher than AB and BB genotype (p＜0.05), and muscle crude protein of AA genotype pig and intramuscular moisture content then significantly are lower than AB and BB genotype (p＜0.05).

Pig CACNA2D1 gene the 28th intron PCR-SSCP pleomorphism site (SEQ ID No.1 sequence 1739bp place) genotype not simultaneously, the leg stern is heavy, leg stern fat is heavy, there are significant difference in muscle crude protein and intramuscular fat content.The leg stern representation work of DD genotype pig is greater than CC and CD genotype (p＜0.05), the leg stern fat representation work of DD genotype pig is greater than CD genotype (p＜0.05), the intramuscular crude protein content of DD genotype pig significantly is lower than CC and CD genotype (P＜0.05), and the intramuscular fat content of CC genotype pig then significantly is lower than DD and CD genotype (P＜0.05).

The beneficial effect that the present invention has: above-mentioned long 2413bp sequence 352bp of methods analyst pig CACNA2D1 gene and 1739bp place single nucleotide polymorphism that the present invention uses PCR-SSCP directly to check order in conjunction with the PCR product, have easy and simple to handle, highly sensitive, can detect the advantage of sample on a large scale; PCR product directly order-checking has not only been simplified operation steps greatly, but also can determine the position and the character of suddenling change.Utilize the different genotype that the single nucleotide polymorphism at SEQ ID No.1 sequence 352bp and 1739bp place causes and the relation of pig production character, to carrying out the molecular genetic marker assisted Selection of pig production character, improve the accuracy of pig production character seed selection, improve genetic progress, significant.

Description of drawings

Fig. 1 (a) is the 27th an intron polymorphic site PCR-SSCP somatotype electrophoretogram as a result;

Fig. 1 (b) is the 28th an intron polymorphic site PCR-SSCP somatotype electrophoretogram as a result;

Fig. 2 (a) is the 27th intron polymorphic site place sequence (primer I V) order-checking peak figure;

Fig. 2 (b) is the 28th intron polymorphic site place sequence (primer V) order-checking peak figure.

Embodiment

Be clone pig CACNA2D1 gene genome the 27th, 28,79 exons, 27th, 28 intron full sequences and the 29th intron partial sequence, seek the mutational site of pig CACNA2D1 gene and the detection method of gene pleiomorphism, for the molecular breeding of pig provides assisted selection method.

Detection provided by the invention pig CACNA2D1 gene mononucleotide polymorphism and with the method for the relation of pig production character, be the pig genomic dna to be carried out pcr amplification by primer I～III, obtain the dna sequence dna (2413bp) of the SEQID No.1 in the sequence table, then according to this sequences Design primer I V and V, in order to carrying out pcr amplification, amplified production length is respectively 458 and 349bp.After the amplified production sex change in 12% non-denaturing polyacrylamide (29: 1) gel electrophoresis, stripping glue silver dyes the back and judges genotype, homozygote order-checking back is determined that 5 ' end the 352nd bit base from sequence table SEQ ID No.1 is G or A, and the 1739th bit base is A or G.

The long 458bp of the pcr amplification product of primer I V is G if hold the 352nd bit base from 5 ' of sequence table SEQ ID No.1, and its homozygote genotype is AA; 5 ' end the 352nd bit base from sequence table SEQ ID No.1 is A, and its homozygote genotype is BB; The genotype of its heterozygote is AB.

The long 349bp of the pcr amplification product of primer V is G if hold the 1739th bit base from 5 ' of sequence table SEQ ID No.1, and its homozygote genotype is CC; 5 ' end the 1739th bit base from sequence table SEQ ID No.1 is A, and its homozygote genotype is DD; The genotype of its heterozygote is CD.

With primer I V the total DNA of pig being carried out PCR-SSCP analyzes, the result shows that the intramuscular fat content of AA genotype pig is significantly higher than AB and BB genotype (p＜0.05), and muscle crude protein of AA genotype pig and intramuscular moisture content then significantly are lower than AB and BB genotype (p＜0.05).

With primer V the total DNA of pig being carried out PCR-SSCP analyzes, the result shows that the leg stern representation work of DD genotype pig is greater than CC and CD genotype (p＜0.05), the leg stern fat representation work of DD genotype pig is greater than CD genotype (p＜0.05), the intramuscular crude protein content of DD genotype pig significantly is lower than CC and CD genotype (p＜0.05), and the intramuscular fat content of CC genotype pig then significantly is lower than DD and CD genotype (p＜0.05).

The invention provides the PCR-SSCP genotyping method of identifying above-mentioned 2413bp sequence 352bP place (in the 27th intron) and 1739bP place (in the 28th intron) single nucleotide variations.Its step comprises: according to the above-mentioned SEQ ID No.1 sequences Design primer that is obtained, primer sequence is respectively shown in sequence table SEQ D No.8～11, carry out pcr amplification in the pig genomic dna, pcr amplified fragment detects with polyacrylamide gel electrophoresis somatotype and order-checking.

The present invention further provides and utilized definite different genotype individuality of PCR-SSCP method and the correlationship between the production traits.

Embodiment 1: the acquisition of genome sequence

From the pig blood sample of Jinhua, extract the pig genome DNA with phenol-imitative method, with pig CACNA2D1 gene mRNA sequence and the comparison of people CACNA2D1 gene genome sequence, after determining its whole exon sequences, according to pig CACNA2D1 gene the 27th, 28,29,30 exon sequences design primer, primer sequence is as follows:

Primer I: forward primer F ₁: 5 ' TTG CCA CTG TAT AAG GAC C 3 '

Reverse primer R ₁: 5 ' AAT CAA TTC ACA GAC ACT CCA 3 '

Primer I I: forward primer F ₂: 5 ' ACC ATG ATG CCT GAT TCA TAA G 3 '

Reverse primer R ₂: 5 ' AAA CCC AGA AAC ATA TGA GGA C 3 '

Primer I II: forward primer F ₃: 5 ' GTA GGG AGC AGT GAA AAC ATA GT 3 '

Reverse primer R ₃: 5 ' GAG TGA AAG CAC GGT TTG TTG TA 3 '

Pig genomic dna with extraction is a template, carry out pcr amplification with these three pairs of primers, the PCR reaction system is 25 μ l, wherein template DNA is 1 μ l, dNTPs concentration is 200 μ mol/L, and forward and reverse primer concentration is 0.4 μ mol/L, the Taq archaeal dna polymerase (Sangon of 3U, Shianghai), add deionized water to cumulative volume 25 μ l.The PCR reaction conditions is: 94 ℃ of pre-sex change 4min, 94 ℃ of sex change 50s, (primer I: 57 ℃ then, primer I I:57.5 ℃, primer I II:56 ℃) annealing 50s, 72 ℃ are extended 40s, after 35 circulations in 72 ℃ extend the PCR product purified (UNIQ-10 pillar DNA glue reclaims test kit and gives birth to worker biotech company available from Shanghai) of the different primers of 10min. after, with R ₁, R ₂, R ₃, F ₁, F ₂And F ₃For sequencing primer carries out sequencing, sequencing is given birth to worker biotech company by Shanghai and is finished.The row length after integrating that checks order is 2413bp, and the mRNA sequence of the sequence of this integration and pig CACNA2D1 gene is carried out sequence alignment find: the homology of pig the 27th, 28,29 exon sequences that this sequence comprises and pig CACNA2D1 gene mRNA sequence corresponding section is 100%.

Embodiment 2: the acquisition of gene fragment and the foundation of polymorphic detection method

Selecting Jinhua pig, Pietrain and Xiangshan wild boar is test materials, and according to above-mentioned pig CACNA2D1 gene order design primer, primer sequence is as follows:

Primer I V: forward primer F ₄: 5 ' GCCCACTTAATGGACTGTTCT 3 '

Reverse primer R ₄: 5 ' CAAGGGAGTGAAAGCACGGT 3 '

Primer V: forward primer F ₅: 5 ' CAGCACTGCCAGGTGATA 3 '

Reverse primer R ₅: 5 ' TAATTCTCATCCCAAAGTCAA 3 '

Carry out pcr amplification with these two pairs of primers in Jinhua pig, Pietrain and three pig kinds of Xiangshan wild boar DNA, PCR reaction totally is 10 μ l, 10 * Buffer, 1.0 μ l wherein, 25mM MgCl ₂0.7 μ l, 10mMdNTP 0.2 μ l, each 0.8 μ l of upstream and downstream primer (10pM), 5U/ μ l Taq archaeal dna polymerase 0.2 μ l, template DNA 0.6 μ l (25ng) adds ddH ₂O to 10.0 μ l.The pcr amplification condition is: 94 ℃ of 4min; 94 ℃ of 1min.58 ℃ of 40sec.72℃ 50sec。After 35 circulations again 72 ℃ extend 8min, expanding fragment length is respectively primer I V458bp, primer V 349bp, 2% agarose electrophoresis detects and shows that the amplified band specificity is good, can be directly used in SSCP and detect.

PCR-SSCP detects

Get the 5ul pcr amplification product, add 7 μ l sex change sample-loading buffer (95% deionized formamide, 0.2mmol/L EDTA, 0.05% dimethylbenzene green grass or young crops, 0.05% tetrabromophenol sulfonphthalein) mixing, in 98 ℃ of sex change 8min, ice bath 5min gets sample on the 10 μ l immediately, 12% non-denaturing polyacrylamide (29: 1), electrophoresis 10h below the constant voltage 400V, water circulating pump temperature control to 25 ℃, stripping glue silver dyes.

Silver dyes back electrophoresis band spectrum on the gel scanning into scanner and preserves in the computer.By analysis, primer I V has three kinds of genotype, and (Fig. 1 a), among Fig. 1 a, swimming lane 1,2,5 is the genotypic amplified production of AA, and swimming lane 3,7 is the genotypic amplified production of BB to be defined as AA, BB and AB respectively; Swimming lane 4,6 is the genotypic amplified production of AB; Primer V also has three kinds of genotype, is defined as CC, DD and CD (Fig. 1 b) respectively, and swimming lane 6,7 is the genotypic amplified production of CC among Fig. 1 b, and swimming lane 2 is the genotypic amplified production of DD, and swimming lane 1,3,4,5 is the genotypic amplified production of CD; The individual amplification order-checking of homozygote back is found that the sudden change of G → A and the sudden change (Fig. 2 a, Fig. 2 b) that A → G takes place at sequence SQ ID NO.1 1739bp place primer V take place at sequence SQ ID NO.1 352bp place primer I V.

Embodiment 3: the polymorphic distribution of molecule marker in different swinerys

In Large White, Du Luoke, landrace, Pietrain, Jinhua pig and wild boar, detected the single nucleotide polymorphism of pig CACNA2D1 gene the 27th and 28 intron partial sequences, detected result as shown in Table 1 and Table 2, the independence chi square test shows, the different genotype in these two sites is difference extremely significantly (p＜0.001) in the several pig kinds that detected.

The distribution results of table 1 pig CACNA2D1 gene the 27th intron PCR-SSCP polymorphism in different swinerys

Kind	Quantity	The AA genotype	The AB genotype	The BB genotype	The A gene frequency	The B gene frequency
							Large White	19	0	3	16	0.079	0.921
Landrace	10	1	9	0	0.550	0.450
							Duroc	48	1	28	19	0.313	0.687
Pietrain pigs	24	0	14	10	0.292	0.708
							The Jinhua pig	57	9	35	13	0.465	0.535
Wild boar	12	4	2	6	0.417	0.583

The distribution results of table 2 pig CACNA2D1 gene the 28th intron PCR-SSCP polymorphism in different swinerys

Kind	Quantity	The CC genotype	The CD genotype	The DD genotype	The C gene frequency	The D gene frequency
							Large White	21	3	4	14	0.238	0.762
Landrace	10	0	1	9	0.050	0.950
							Duroc	48	0	3	45	0.031	0.969
Pietrain pigs	26	4	4	18	0.231	0.769
							The Jinhua pig	70	11	42	17	0.457	0.543
Wild boar	21	0	9	12	0.214	0.786

Embodiment 4: the association analysis of the molecule marker and the production traits

In order to determine whether the CACNA2D1 gene pleiomorphism is relevant with the pig phenotypic difference, 160 Jinhua * Pietrain F that selects Zhejiang University experiment pasture to set up ₂For resource colony is test materials, and the PCR-SSCP method that adopts embodiment 2 to be set up is carried out polymorphism and detected, according to the phenotype that electrophoretogram shows, and the statistics genotype frequency.With the GLM program of SPSS (13.0) to detection Jinhua * Pietrain resource family F ₂In generation,, individual genotype and pig production character value carried out the least square analysis, and model is Y=population mean+genotype effect+sex effect+concomitant variable+residual error.Genotype and sex effect are fixed effect, and carcass trait heavily is a concomitant variable with carcass, and the meat proterties is not considered concomitant variable.

Statistic analysis result between the different genotype and the production traits is summarized in table 3 and table 4.

As can be seen from Table 3, pig CACNA2D1 gene the 27th intron PCR-SSCP pleomorphism site genotype not simultaneously, there are significant difference in intramuscular fat content, muscle crude protein and intramuscular moisture content.The intramuscular fat content of AA genotype pig is significantly higher than AB and BB genotype (p＜0.05), and muscle crude protein of AA genotype pig and intramuscular moisture content then significantly are lower than AB and BB genotype (p＜0.05).

The statistical analysis table of table 3 pig CACNA2D1 gene the 27th intron PCR-SSCP pleomorphism site genotype and the production traits

Annotate: subscript contains different letter representation significant differences, P＜0.05

As can be seen from Table 4, pig CACNA2D1 gene the 28th intron PCR-SSCP pleomorphism site genotype not simultaneously, the leg stern is heavy, leg stern fat is heavy, there are significant difference in muscle crude protein and intramuscular fat content.The leg stern representation work of DD genotype pig is greater than CC and CD genotype (p＜0.05), the leg stern fat representation work of DD genotype pig is greater than CD genotype (p＜0.05), the intramuscular crude protein content of DD genotype pig significantly is lower than CC and CD genotype (P＜0.05), and the intramuscular fat content of CC genotype pig then significantly is lower than DD and CD genotype (p＜0.05).

The statistical analysis table of table 4 pig CACNA2D1 gene the 28th intron PCR-SSCP pleomorphism site genotype and the production traits

Annotate: subscript contains different letter representation significant differences, P＜0.05.

SEQUENCE LISTING (sequence table)

＜110〉Zhejiang University

＜120〉sequence of pig production character genes involved CACNAA2D1 and uses thereof

<130>

<140>1

<141>2006-12-08

<160>11

<170>PatentIn version 3.1

<210>1

<211>2413

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>exon 27

<222>(7)..(69)

<223>

<220>

<221>exon 28

<222>(747)..(852)

<223>

<220>

<221>exon 29

<222>(1777)..(1864)

<223>

<400>1

tttcagcaag ggagtgaaag cacggtttgt tgtaactgat ggagggatta ccagagttta 60

tcccaaagag taagttcaga taacatctgt aaaagttact acattataag gactactcca 120

aggatatata tatatatata ttactgtata aggatataca gagaaactgg tcgttaatag 180

tagattaaat ggaggttgtt taaagtacta aattattaaa atactccatt tcttaaaaaa 240

aatgctacta tatgattcct caatgttgtt tttgcttgtc acatatacta ccaaatttaa 300

gaggttttaa aagagatttt tctctttcta gacataaact aacttggtta agtgaacata 360

gtggttatta tagcaatata tctgttgaga gcatttacat agaacatcat tgttttcact 420

gattttatct gtgtttatct taagaacagt ccattaagtg ggctgtgtac gcttgttaat 480

attaattgac ttattaactg atttatccat aattacctgg ctggtaaatg gcagagtaaa 540

actgggagtc agctttctct gctccgtaat ttaactctat gctgatctat tgcttagtaa 600

tgtgttattt acaccatcaa tttccactaa cttccttaga cgcacctgag atgcaaacaa 660

atctgtaaag ttcagtgagg tccacaaagg gaaaagtaag ttatcaagga gattaaagaa 720

taaatgatga gccatttcct ccttagggct ggagaaaatt ggcaagaaaa cccagaaaca 780

tatgaggaca gcttctataa aagaagtcta gataacgata actatgtttt cactgctccc 840

tactttaaca gtaagtattg ctttggaatt cagccatcgc agttcctttt tctatgtaag 900

ttattgctac tacctgcttt tcccctaaac aatatcatat gcacaacatt ggagaaaaag 960

aatatccatt tagttgagga ggcaaaatgc ataaatagga aatcagccat ccagtaatgt 1020

agagactgca tattacaggc ctgcacaata catcgaaaca catgtagata atccctcatt 1080

ttcacatttc atttcgtctt ttttagggcc acgcccgtgg catatggagg ttcgcaggat 1140

aggggttgaa ctggagctgt agccaccggc ctacaccaca gcaacagcaa tgagggatcc 1200

aagccgtgtc tgcaacatgc accacagctc acagcaatgc tggatcctta acccacagag 1260

caaggccagg gatcaaatct gcatcctcat ggctattcat cagattcttt tccactgtgc 1320

catgacggga actcaacaaa gtgcaaatat attgaagaat ttttaatgag ttaaaaaaat 1380

ataattaaat caattttcac aaaagaggaa ggtgcagttt ggagaatttc agttttttcc 1440

agggacatgt atcttttaaa atgtaaaagc agttttgtga atctgagatc tttgcacttt 1500

acttgagcag cctcccaata ttttagcaaa cattataaag cagaggtttg gtgtgcagcc 1560

ttcatatgtg agagtagata catttaagct gtttaattct catcccaaag tcaattaatg 1620

aaaatcaatt cacagacact ccaattacct tttatgccag aatatttaag cagaaaacta 1680

tcccccatac ctattaaaag aaatttcata ttatttgatt aatctacata ggtctgttat 1740

tttttgtttt ttgttttttg tttttttttt attttagaaa gtggacctgg tgcttatgaa 1800

tcaggcatca tggtaagcaa agctgtagaa atatacatcc aaggaaaact tcttaaacct 1860

gcaggtgagc atgtatttgt tcacatacat acaatcaaaa ttaaatgtga cccattcctc 1920

gtgttatcac ctggcagtgc tgatcaggaa agccatcagg aagcttcaac caaaataaaa 1980

tcaaagacat gcaaatttaa aaaataaaac acaattagtt acatataaat tggggataaa 2040

ataaaattga tactgtatag agttgaggaa ttttcaaaga agactatatg tttctatact 2100

gttgacacaa atttatggag tcagtttagt attgtatgtc acaattctaa gtgctagact 2160

gatcccacaa tcccactcta gaagtctatc ccatatagta ttttaaatat acaaaagtag 2220

atatggccaa gaatgtgaaa tgttggtaat aatttaaaca agaaaaggta agtttgcatc 2280

tttgggggaa aagataaatt atggtgtatc tatactatgt atctgttaaa aagaatttgg 2340

atagggatct attttttaaa aaccttacga tatataaaag agttttttga taaaccacgc 2400

tgtacagtag aaa 2413

<210>2

<211>19

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer bind

<222>(1)..(19)

<223>

<400>2

ttgccactgt ataaggacc 19

<210>3

<211>21

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(21)

<223>

<400>3

aatcaattca cagacactcc a 21

<210>4

<211>22

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(22)

<223>

<400>4

accatgatgc ctgattcata ag 22

<210>5

<211>22

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(22)

<223>

<400>5

aaacccagaa acatatgagg ac 22

<210>6

<211>23

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(23)

<223>

<400>6

gtagggagca gtgaaaacat agt 23

<210>7

<211>23

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(23)

<223>

<400>7

gagtgaaagc acggtttgtt gta 23

<210>8

<211>21

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(21)

<223>

<400>8

gcccacttaa tggactgttc t 21

<210>9

<211>20

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(20)

<223>

<400>9

caagggagt g aaagcacgg t 20

<210>10

<211>18

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(18)

<223>

<400>10

cagcactgcc aggtgata 18

<210>11

<211>21

<212>DNA

＜213〉pig (Sus scrofa)

<220>

<221>primer_bind

<222>(1)..(21)

<223>

<400>11

taattctcat cccaaagtca a 21

Claims (6)

1. the dna sequence dna of a pig production character genes involved CACNA2D1 is characterized in that this sequence is shown in SEQ ID No.1.

2. the dna sequence dna of a kind of pig production character genes involved CACNA2D1 according to claim 1, it is characterized in that: the sequence total length of described SEQ ID No.1 is 2413bp, wherein comprise pig CACNA2D1 gene genome the 27th, 28,29 exons, the partial dna sequence of the full sequence of the 27th, 28 introns and the 29th intron.

3. the dna sequence dna of a kind of pig production character genes involved CACNA2D1 according to claim 1 is characterized in that: there is G → A in described SEQ ID No.1 sequence 352bp place, and the 1739bp place exists the mononucleotide of A → G to replace.

4. the dna sequence dna of a kind of pig production character genes involved CACNA2D1 according to claim 1, it is characterized in that: three pairs of primers of described SEQ ID No.1 sequence amplification and sequencing are shown in SEQ IDNo.2 to SEQ ID No.7, wherein SEQ ID No.2 is used with SEQ ID No.3, forms a pair of forward primer and reverse primer; SEQ ID No.4 is used with SEQ ID No.5, forms a pair of forward primer and reverse primer; SEQ ID No.6 is used with SEQ ID No.7, forms a pair of forward primer and reverse primer.

5. the dna sequence dna of a kind of pig production character genes involved CACNA2D1 according to claim 1, it is characterized in that: be used to detect two pairs of primers of described SEQ ID No.1 sequence 352bp and 1739bp place single nucleotide polymorphism shown in SEQ ID No.8 to SEQ ID No.11, wherein SEQ ID No.8 is used with SEQID No.9, forms a pair of forward primer and reverse primer; SEQ ID No.10 is used with SEQ IDNo.11, forms a pair of forward primer and reverse primer.

6. the purposes of the dna sequence dna of a pig production character genes involved CACNA2D1 as claimed in claim 1, it is characterized in that: it is used for the genetic marker of pig production character.

Images