CN100577800C

CN100577800C - Histone methylated transferase and its encoding gene and application

Info

Publication number: CN100577800C
Application number: CN200710063138A
Authority: CN
Inventors: 曹晓风; 丁勇; 刘春艳; 储成才
Original assignee: Institute of Genetics and Developmental Biology of CAS
Current assignee: Institute of Genetics and Developmental Biology of CAS
Priority date: 2007-01-29
Filing date: 2007-01-29
Publication date: 2010-01-06
Anticipated expiration: 2027-01-29
Also published as: CN101012456A

Abstract

The invention discloses a histone methylating transferase and coded gene and application, which contains protein (a) or protein (b), wherein the (a) is composed of residue sequence of amino acid in the sequence list 1; (b) protein is composed of (a) derivatized plant in the sequence list 1; the transferase controls the swivelling activity of Tos17, which makes Tos17 insert new location to produce mutant.

Description

A kind of histone methylated transferase and encoding gene thereof and application

Technical field

The present invention relates to a kind of histone methylated transferase and encoding gene thereof and application.

Background technology

Nineteen fifty-one Barbara Mclintock has at first found controlling elements in corn, afterwards called after transposable element or transposon (transposon).Transposon is one section dna sequence dna movably in the genome, can be by a series of processes such as cutting, reintegrate from a genomic position " jump " to another position.This element not only can be used for analyzing the biological heredity evolution and goes up some phenomenons that molecularity causes, also provide strong tool for genetically engineered and molecular biology research, can be under the situation of the biochemical property of not understanding gene product and expression pattern, the separating clone plant gene, be transposon tagging (transposon tagging), be called the transposon tracer method again.Its principle is to utilize the insertion of transposon to cause transgenation, based on the transposon sequence, from the gene library of mutant strain, filter out the clone who has this transposon, it must contain the partial sequence of the mutator gene adjacent with the transposon sequence, utilizes this part sequence to obtain complete gene again from the wild type gene library.

Transposon can be divided into two big classes: with the transposon and the retrotransposon (retrotransposon) of DNA-DNA mode swivel base.First kind transposon can be by dna replication dna or is directly excised the dual mode acquisition and can move fragment, inserts in the genomic dna again.The second class transposon, it is newfound in recent years transposable element by RNA mediation swivel base, structure and duplicate with retrovirus (retrovirus) similar, just there is not the necessary env gene of virus infection, it is by transcribing synthetic mRNA, the synthetic new element of reverse transcription is incorporated into and finishes swivel base in the genome again, and 1 copy number of revolution seat will increase by 1 part, thus it be at present known to the movable genetic constitution of a class of quantity maximum in the higher plant.3 types of retrotransposons have been found at present altogether: the Ty1-copia class, Ty3-gypsy class and LINE (long interspersed nuclear Clements) class transposon, preceding two classes are to have long terminal repetition transposon, and LINE class transposon is not long terminal repetition.Retrotransposon in the higher plant mainly belongs to the Ty1-copia class, and it is very extensive to distribute, and has almost covered all higher plant kinds.

Paddy rice is again important monocotyledonous model plant as important crops simultaneously, and its genome size is 430Mb, and wherein about about 40% is moderately repetitive sequence and transposon.Tos17 is the retrotransposon of copia class, is high methylation in normal plant, is in silence state simultaneously, and can become very active in cell tissue is cultivated, and swivel base can take place, the state of keeping silent again simultaneously in regeneration plant.People such as Hirchick in 1996 just utilize paddy rice retrotransposon Tos17 to set up paddy gene and knock out system (geneknock-out system).Although the instrument that Tos17 has inserted as a kind of gene is used for the generation in rice mutant storehouse, the mechanism of its swivel base is unclear always.

The eukaryotic gene group can be divided into euchromatin and heterochromatic zone by its function, and activation or suppressor gene transcribes respectively.The post transcriptional modificaiton of histone N end has and activates or function that suppressor gene is transcribed, these modifications comprise methylate, acetylize, ubiquitinization, phosphorylation, ADP-glycosylation and SUMOization.In recent years to histone methylated studies show that, the Methionin that H3 is the 4th, 36 and 79 methylates and understands transcribing of activated gene, the Methionin of histone H 3 the 9th, 27 and the 20th of H4 methylates and then suppresses relevant with genetic transcription, in addition, and can single, double, trimethylammoniumization on the istone lysine.Different loci Methionin methylates, methylating in various degree, and with histone on the modification in other site be together to form apparent regulation and control password, participate in the regulation and control of downstream gene.

Except that the methylated transferase Dot1 of H3K79 position, known istone lysine methylated transferase all contains a SET structural domain.From the Suv39h in the mouse is first found methyltransgerase, has special H3K9 activity.After this a plurality of methylated transferases are identified that in succession as G9a, ESET, GLP, these gene regulatings mammiferous growing.Suv39hs mainly acts on the heterochromatic zone in the mouse, and after Suv39hs knocked out, its cancer incidence obviously improved, and the dna methylation level of heterochromatic zone descends, and karyomit(e) becomes extremely unstable.

39 genes SET domain protein of can encoding is arranged in the Arabidopis thaliana, wherein portion gene plays an important role in growing, the MEA Gene Handling the growth of Arabidopis thaliana embryo, the morphological development that the ATX1 Gene Handling is blossomed, and SDG8 and EMF Gene Handling flowering time.Overexpression SUVH2 can cause the Arabidopis thaliana plant short and small; In tobacco, overexpression NtSET1 also can cause leaf and root growth slow; OsSET1 in the paddy rice is the albumen of another SET structural domain, can cause Arabidopis thaliana apical meristem hypoevolutism behind the overexpression OsSET1 gene.

The SET domain protein can also be regulated and control heterochromatin and genomic stability as the H3K9 ZNFN3A1 except can influencing the growing of normal plant.DIM-5 coding H3K9 ZNFN3A1 is being controlled dna methylation and is being formed in the bread mold.KYP/SUVH4 is the H3K9 ZNFN3A1 in the Arabidopis thaliana, the methylated formation of control CNG, and simultaneously, kyp/suvh4 also can raise the transcriptional level of some transposons, as TSI, AtCOPIA4 and AtSN1.

Summary of the invention

An object of the present invention is to provide a kind of histone methylated transferase and encoding gene thereof.

Histone methylated transferase provided by the present invention derives from paddy rice (Oryza sativa L.), and name is called SDG714, is following (a) or protein (b):

(a) protein of forming by the amino acid residue sequence of sequence in the sequence table 1;

(b) with the amino acid residue sequence of sequence in the sequence table 1 through the replacement of one or several amino-acid residue and/or disappearance and/or interpolation and to have a histone methylated transferase active by (a) deutero-protein.

Wherein, the sequence in the sequence table 1 is made up of 663 amino-acid residues.The 480th of N-terminal from sequence 1 is the SET structural domain to the 640th amino acids residue, from the 375th of the N-terminal of sequence 1 to 478 amino acids residues is halfcystine die body pre-SET, is halfcystine die body post_SET from the 641st of the N-terminal of sequence 1 to the 663rd amino acids residue.

The replacement of described one or several amino-acid residue and/or disappearance and/or interpolation are meant and replace outside the above-mentioned SET structural domain of sequence 1 and halfcystine die body and/or lack and/or add.

Above-mentioned histone methylated transferase encoding gene (SDG714) also belongs to protection scope of the present invention.

The encoding gene of described histone methylated transferase, its nucleotide sequence are the proteinic polynucleotide of sequence 1 in the code sequence tabulation.

The encoding sequence of described histone methylated transferase gene can be the nucleotide sequence from 5 ' terminal the 98th to 2086 deoxyribonucleotides composition of sequence 2 in the sequence table.

Described histone methylated transferase encoding gene specifically can be following 1) or 2) gene:

1) its nucleotide sequence is the sequence 2 in the sequence table;

2) under stringent condition with 1) the dna sequence dna hybridization that limits and the dna molecular of coding histone methylated transferase.

Described stringent condition can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS,, and wash film with this solution 65 ℃ of hybridization down.

Sequence 2 in the sequence table is made up of 2357 deoxyribonucleotides, is the cDNA gene order of SDG714, and sequence 2 is encoding sequence from 5 ' terminal the 98th to 2086 deoxyribonucleotides in the sequence table.

The recombinant expression vector, transgenic cell line and the transformed host bacterium that contain above-mentioned histone methylated transferase encoding gene all belong to protection scope of the present invention.

Another object of the present invention provides a kind of method that activates Tos17 swivel base in the paddy rice.

The method of Tos17 swivel base is the expression that suppresses the above-mentioned histone methylated transferase in the rice cell in the activation paddy rice provided by the present invention.

The nucleotide sequence of described paddy rice Tos17 can be the sequence 3 in the sequence table.

Can utilize the expression of the histone methylated transferase SDG714 in the method inhibition paddy rice of the prior art, as RNA interference method, gene disruption method (gene disruption).

The RNAi expression vector pCAMBIA2300-SDG714RNAi that described RNA interference method specifically can be SDG714 imports in the paddy rice.

Above-mentioned RNAi expression vector is by cell or tissue such as conventional biological method rice transformation such as agriculture bacillus mediated grade, and the rice tissue that transforms is cultivated into plant.

Experiment showed, the swivel base that activates Tos17 in the mutant that changes pCAMBIA2300-SDG714RNAi.Illustrate that this histone methylated transferase can control the transposition activity of Tos17.In actual applications, can activate the swivel base of Tos17, make Tos17 insert new site,, produce mutant by destroying the gene that inserts the site by reducing the expression amount of SDG714 in the paddy rice.The swivel base that utilizes method of the present invention to activate Tos17 is the important means of functional genome research.

The present invention will be further described below in conjunction with drawings and Examples.

Description of drawings

Fig. 1 is GST-SDG714 and core histones reaction result

Fig. 2 is the RT-PCR result of SDG714

Fig. 3 is the Southern blot result of Tos17

Embodiment

Experimental technique among the following embodiment if no special instructions, is ordinary method.

The acquisition of embodiment 1, histone methylated transferase SDG714

1, the discovery of histone methylated transferase SDG714

Data by http://www.chrombd.org database mining show 38 SET domain proteins are arranged, called after SDG701 to SDG741 in paddy rice.Evolutionary analysis shows: SDG714 is the most similar to the KYP/SUVH4 in the Arabidopis thaliana, and KYP/SUVH4 belongs to Su (var) 3-9 family.SDG714 663 amino acid (sequence 1 in the sequence table) of encoding, contain about 130 amino acid conservative SET structural domain (from the 480th-640 amino acids residue of N-terminal of sequence 1) and two conservative halfcystine die bodys, i.e. pre-SET (in sequence 1 the 375th to 478 amino acids residues) and post_SET (the 641st to 663 amino acids residue in sequence 1).YDG structural domain (from the 182nd of the N-terminal of sequence 1 to the 346th amino acids residue) is very conservative in the higher plant SUVH family, but in the histone methylated transferase of animal, do not occur, as from the DIM-5 in the bread mold, from the Clr4 in the yeast with from people's SUV39H1 albumen.

The cDNA gene of SDG714 is the sequence 2 in the sequence table.Sequence 2 in the sequence table is made up of 2357 deoxyribonucleotides, is encoding sequence from 5 ' terminal the 98th to 2086 deoxyribonucleotides.

2, the clone of the cDNA gene of SDG714

Extract total RNA of the fine plant inflorescence of paddy rice Japan, obtain the first chain cDNA after reverse transcription, cDNA is a template with this first chain, utilizes forward primer CX187 (5 '-TAG AgatcTATGGAGGTGATGGATTCGGTGGCCGT-3 ') and reverse primer CX188 (5 '-GTC TctagaCTAATAAAGTCGCTTCCGGCAGTAC-3 ') carries out pcr amplification.Amplified production carries out agarose electrophoresis to be separated, and reclaims and is cloned on pGEM-T (Promega) carrier, carries out sequencing analysis, and sequencing result shows that this pcr amplification product has the nucleotide sequence of sequence 2 in the sequence table, is the cDNA sequence of SDG714.This PCR product cloning to Topo-PCR4.0 carrier (Invitrogen), is obtained recombinant vectors pCR 4.0-TOPO-SDG714.

3. the expression of histone methylated transferase SDG714 and detection

(1) expression of the fusion rotein GST-SDG714 of GST and SDG714

Utilize BglII and EcoRI enzyme to cut pCR 4.0-TOPO-SDG714 and obtain the SDG714 fragment, the SDG714 fragment is inserted through between the BamHI and EcoRI site of the pGEX-4T-1 carrier (Amersham) that BamHI and EcoRI enzyme are cut, obtained containing the recombinant expression vector pGEX-SDG714 of the fusion gene of SDG714 with nucleotide sequence of sequence 2 in the sequence table and GST encoding gene.PGEX-SDG714 can express the fusion rotein GST-SDG714 of GST and SDG714.

In pGEX-SDG714 transformed into escherichia coli BL21 (RIL) (Novagen company product), the picking mono-clonal, be cultured to OD=0.6 in the 2 * YT substratum that adds 100 μ g/ml penbritins after, the IPTG that adds 0.1mM cultivated 12 hours in 18 ℃.Expressed proteins obtains GST-SDG714 with gsh-sepharose 4B affinity chromatography column purification.

(2) histone methylated transferase SDG714 is active detects

In order to detect the activity whether SDG714 has histone methylase, after SDG714 and the fusion of GST albumen, behind expression and purification, react with core histones.

GST-SDG714 through gsh-sepharose 4B affinity chromatography column purification reacts with core histones as follows: add calf thymus core histones H2A, H2B, H3 and H4 (Roche company) respectively in concentration is the GST-SDG714 of 0.3ug/ul, the final concentration of H2A, H2B, H3 and H4 is respectively 0.08ug/ul, adding final concentration successively is 20mM Tris-HCl (pH 8.0), 4mM EDTA, 1mM PMSF, 0.5mM DTT and through H ₃The SAM of mark (S-adenylyl-L-methionine(Met)).After 1 hour, reaction product is carried out the SDS-PAGE electrophoresis 37 ℃ of reactions, carry out Coomassie brilliant blue dyeing or radioactive automatic developing after electrophoresis finishes.The GST replacement GST-SDG714 that with the final concentration is 1ug/ul simultaneously carries out identical experiment in contrast.

The result shows that GST-SDG714 can make core histones H2A as shown in Figure 1, H2B, and H3, the H3 among the H4 methylates.Among Fig. 1, add the reaction product result of calf thymus core histones H2A, H2B, H3 and H4 among 1, the 3 expression GST-SDG714 respectively, add the reaction product result of calf thymus core histones H2A, H2B, H3 and H4 among 2, the 4 expression GST respectively; Image to left is the Coomassie brilliant blue coloration result, and Image to right is the radioactive automatic developing result.

The swivel base of Tos17 in embodiment 2, the activation paddy rice

1. the structure of the RNAi expression vector of SDG714

For function in the body of understanding SDG714, utilize the RNAi technology that SDG714 is knocked out, with the non-conservative part of a part of the N of SDG714 end and YDG as the RNAi zone.

The construction process of the RNAi expression vector of SDG714 is as follows: extract the total RNA of paddy rice, with oligo d (T) is primer, reverse transcription becomes cDNA, with primer CX52 (5 '-ATTctcgagGCAACTTGTATTGTCATGTCGGG-3 ') and CX53 (5 '-AGCagatctGGGAGCTTCAGCACGAGTAA-3 ') pcr amplification sequence 2 from the 712nd to 1085 deoxyribonucleotides of 5 ' end.With the PCR product after BglII and XbalI enzyme are cut, insert in the pUCRNAi carrier that XhoI/BglII and two groups of enzymes of BamHI/SalI are cut with positive and negative both direction, obtain recombinant vectors pUC-SDG714RNAi, will insert PstI restriction enzyme site among the pCAMBIA2300ACT with the stem ring plate section that the PstI enzyme is cut the both forward and reverse directions that pUC-SDG714RNAi obtains again.To cut evaluation through the PstI enzyme and contain the segmental recombinant vectors called after of this stem ring pCAMBIA2300-SDG714RNAi.

Wherein, pUCRNAi transforms to obtain on pUC18 carrier basis, makes up as follows: after BamHI and EcoRI enzyme are cut, it is mended flat by the T4 polysaccharase pUC18 carrier; DNA is a template with the potato gene group, utilizes forward primer: CCT GCA GGC TCG AGA CTA GTA GAT CTG GTA CGG ACC GTA CTACTC TA and reverse primer: CCT GCA GGG TCG ACT CTA GAG GAT CCC CTA TAT AAT TTA AGTGGA AAA carries out the intron in the pcr amplification potato GA20 oxydase.The product of amplification is inserted the pUC18 carrier in the mode of flush end, obtain the pUCRNAi carrier.

PCAMBIA2300ACT is made up on the basis by pCAMBIA2300 (CAMBIA company) carrier, concrete grammar is as follows: the genomic dna with paddy rice is a template, use primer CGAATTCGAGCTCGGTACCCTCGAGGTCATTCATATGCTTGAGA, carry out PCR with TCTAGAGGATCCCCGGGTACCTCTTCTACCTACAAAAAAGCTCCGCAC, amplification Actin1.The PCR product is inserted after EcoRI and XbalI enzyme are cut between the EcoRI and XbalI site of pCAMBIA2300 carrier, and the promotor as driving obtains recombinant vectors pCAMBIA2300ACT, and it is fine to be used for rice transformation Japan.

2. plant transgene and detection

Change RNAi expression vector pCAMBIA2300-SDG714RNAi and pCAMBIA2300ACT over to paddy rice Japan fine mature seed callus by the mediation of agrobacterium tumefaciens (Agrobacterium tumefaciens) strains A GL1 respectively, when the bud that differentiates at callus grows to 3-5cm, downcut bud, move into the root media (MS+25mg/L grass ammonium phosphine) of additional 25mg/L weedicide grass ammonium phosphine, 26 ± 1 ℃ of illumination cultivation are taken root; Seedling grows to about 8-10cm height, and culturing bottle was uncapped hardening 1-2 days, and flush away root plant gel is planted in the field, Routine Management, and ripe the receipts planted.

Whether whether transform the plant that obtains exists the checking transgenosis successful by PCR checking neomycin phosphotransferase II (NPTII) gene.Genomic dna with plant is a template, utilizes primer: the segmental first-generation transfer-gen plant of neomycin phosphotransferase II that CX637 (5 ' GATTGAACAAGATGGATTGCACGCAGGTT3 ') and CX638 (5 ' CAGAAGAACTCGTCAAGAAGGCGATAGAA3 ') pcr amplification obtain 666bp is that T0 is for transfer-gen plant.The result obtains 13 strain T0 for changeing the pCAMBIA2300-SDG714RNAi plant, and 13 strain T0 are for changeing the pCAMBIA2300ACT plant.T1 is produced for selfed seed by T0 for transgenic seedling.

3, the generation of SDG714 mutant

Get T0 for changeing pCAMBIA2300-SDG714RNAi plant (3 strain systems), T0 for changeing pCAMBIA2300ACT plant (10 strain) and wild-type Japan fine (10 strain), utilize TRIZON to extract plant RNA (method is seen the explanation of invitrogen company), with oligo d (T) is primer, reverse transcription becomes cDNA, obtains article one cDNA chain.With this article one cDNA chain template, following primer PCR amplification of nucleotide acid sequence is the SDG714 from the 98th to 2086 of 5 ' ends of sequence 2, detects the expression amount of histone methylated transferase SDG714.Simultaneously with the Actin gene as the internal reference gene.Wherein, amplification Actin primer: CX151 (5 '-CCTCGTCTCGACCTTGCTGGG-3 ') and CX152 (5 '-GAGAACAAGCAGGAGGAGGGCC-3 '); Amplification SDG714 primer: CX47 (5 '-GTCGTCGACATCTAATAAAGTCGCTTCCGGCAGTAC-3 ') and CX48 (5 '-GAGGAATTCTACAAGGTTGTAGATGACTGGGTGCAG-3 ').

The result shows that the T0 of 3 strain systems is for changeing pCAMBIA2300-SDG714RNAi plant (claiming the SDG714IRs mutant again), the SDG714 nucleotide fragments that all do not increase, and 10 strain T0 are for changeing the fine plant of pCAMBIA2300ACT plant and the 10 strain wild-types Japan SDG714 nucleotide fragments that all can increase.Among Fig. 2,1 is that the pCAMBIA2300ACT plant is changeed in a strain, 2,3,43 strains that are respectively commentaries on classics pCAMBIA2300-SDG714RNAi are SDG714IR-14, SDG714IR-22 and SDG714IR-26, and 32 circulations and 28 circulations represent that respectively the cycle number of PCR is 32 and 28.Show the mutant material success of being done.

4, Tos17 transcribing in the SDG714IR mutant raised and swivel base

With after the cutting with the XbalI enzyme of T0 generation with the T1 SDG714IRs mutant seedling in generation, the genomic dna that changes the pCAMBIA2300ACT plant, in 0.8% agarose electrophoresis, the commentaries on classics film.Utilization is a template with the fine genomic dna of Japan, carrying out the Tos17 fragment amplification product that pcr amplification obtains 666bp with primer CX430 (5 '-GCTACCCGTTCTTGGACTAT-3 ') and CX431 (5 '-CTGAAATCGGAGCACTGACA-3 ') is probe, with α-p32 mark, hybridize.Utilizing with the fine genomic dna of Japan simultaneously is template, carrying out the 1180bp Tublin amplified production that pcr amplification obtains with primer CX1201 (5 '-GAGAGAGATCCTGCACATCCA-3 ') and CX1202 (5 '-ACTCCTCCCTGATCTTTGATATC-3 ') is probe, carry out identical experiment, contrast as confidential reference items.

The Southern detected result shows that Tos17 T0 and seedling in T1 generation in changeing the pCAMBIA2300ACT contrast have the identical shellfish number of examining, and all have 2 copies as shown in Figure 3.Significantly increase and in the SDG714IRs mutant, examine the shellfish number, have 2 to examine shellfish, and examine shellfish for equal 3-5 at T1 at T0.And Tos17 has 2 to examine the shellfish number in wild-type Japan is fine.Show that Tos17 can enliven to the swivel base state in the SDG714IRs mutant.Because the Tos17 on No. 10 and No. 7 karyomit(e), after the XbalI enzyme was cut, resulting length differed less than 100bp, and agarose electrophoresis can not be separated them, so have only a band in Southern.

Among Fig. 3, Control changes the T of pCAMBIA2300ACT for changeing the pCAMBIA2300ACT plant ₀Generation one strain, T ₁Generation 2 strains; The T of SDG714IR-14 and SDG714IR-22 ₀For homogeneous strain, T ₁The Dai Junsi strain.

Sequence table

<160>3

<210>1

<211>663

<212>PRT

＜213〉paddy rice (Oryza sativa L.)

<400>1

Met?Glu?Val?Met?Asp?Ser?Val?Ala?Val?Met?Glu?Val?Ser?Pro?Val?Pro

1 5 10 15

Lys?Pro?Pro?Leu?Glu?Ala?Ala?Leu?Ala?Leu?Arg?Arg?Ser?Val?Arg?Cys

20 25 30

Leu?Asn?Arg?Thr?Arg?Arg?Pro?Thr?Tyr?Val?Glu?Gln?Glu?Glu?Pro?Lys

35 40 45

Glu?Ser?Ala?Gly?Arg?Arg?Arg?Gly?Gly?Lys?Arg?Lys?Arg?Glu?Glu?Glu

50 55 60

Lys?Lys?Glu?Pro?Val?Ala?Gln?His?Ala?Met?Lys?Pro?Val?Arg?Met?Gly

65 70 75 80

Asp?Ala?Ala?Ser?Glu?Arg?Lys?Pro?Ser?Ser?Glu?Gly?Lys?Pro?Met?Pro

85 90 95

Ala?Ile?Ala?Ala?Glu?Pro?Val?Ser?Cys?Ala?Gly?Phe?Ala?Arg?Pro?Ala

100 105 110

Ala?Glu?Asp?Asp?Val?Leu?Gly?Asn?Gly?Lys?Ser?Ala?Lys?Leu?Arg?Val

115 120 125

Lys?Glu?Thr?Leu?Arg?Ala?Phe?Thr?Ser?His?Tyr?Leu?His?Leu?Val?Gln

130 135 140

Glu?Glu?Gln?Lys?Arg?Ala?Gln?Ala?Val?Leu?Gln?Glu?Gly?Gln?Lys?Arg

145 150 155 160

Pro?Ser?Lys?Arg?Pro?Asp?Leu?Lys?Ala?Ile?Thr?Lys?Met?Gln?Glu?Ser

165 170 175

Asn?Ala?Val?Leu?Tyr?Pro?Glu?Lys?Ile?Ile?Gly?Glu?Leu?Pro?Gly?Val

180 185 190

Asp?Val?Gly?Asp?Gln?Phe?Tyr?Ser?Arg?Ala?Glu?Met?Val?Val?Leu?Gly

195 200 205

Ile?His?Ser?His?Trp?Leu?Asn?Gly?Ile?Asp?Tyr?Met?Gly?Met?Lys?Tyr

210 215 220

Gln?Gly?Lys?Glu?Glu?Tyr?Ala?Asn?Leu?Thr?Phe?Pro?Leu?Ala?Thr?Cys

225 230 235 240

Ile?Val?Met?Ser?Gly?Ile?Tyr?Glu?Asp?Asp?Leu?Asp?Lys?Ala?Asp?Glu

245 250 255

Ile?Ile?Tyr?Thr?Gly?Gln?Gly?Gly?Asn?Asp?Leu?Leu?Gly?Asn?His?Arg

260 265 270

Gln?Ile?Gly?Ser?Gln?Gln?Leu?Gln?Arg?Gly?Asn?Leu?Ala?Leu?Lys?Asn

275 280 285

Ser?Lys?Asp?Asn?Gly?Asn?Pro?Ile?Arg?Val?Ile?Arg?Gly?His?Ile?Ser

290 295 300

Lys?Asn?Ser?Tyr?Thr?Gly?Lys?Val?Tyr?Thr?Tyr?Asp?Gly?Leu?Tyr?Lys

305 310 315 320

Val?Val?Asp?Asp?Trp?Val?Gln?Asn?Gly?Val?Gln?Gly?His?Val?Val?Phe

325 330 335

Lys?Tyr?Lys?Leu?Lys?Arg?Leu?Glu?Gly?Gln?Pro?Ser?Leu?Thr?Thr?Ser

340 345 350

Glu?Val?Arg?Phe?Thr?Arg?Ala?Glu?Ala?Pro?Thr?Thr?Ile?Ser?Glu?Leu

355 360 365

Pro?Gly?Leu?Val?Cys?Asp?Asp?Ile?Ser?Gly?Gly?Gln?Glu?Asn?Leu?Pro

370 375 380

Ile?Pro?Ala?Thr?Asn?Leu?Val?Asp?Asp?Pro?Pro?Val?Pro?Pro?Thr?Gly

385 390 395 400

Phe?Val?Tyr?Ser?Lys?Ser?Leu?Lys?Ile?Pro?Lys?Gly?Ile?Lys?Ile?Pro

405 410 415

Ser?Tyr?Cys?Asn?Gly?Cys?Asp?Cys?Glu?Gly?Asp?Cys?Ala?Asn?Asn?Lys

420 425 430

Asn?Cys?Ser?Cys?Ala?Gln?Arg?Asn?Gly?Ser?Asp?Leu?Pro?Tyr?Val?Ser

435 440 445

His?Lys?Asn?Ile?Gly?Arg?Leu?Val?Glu?Pro?Lys?Ala?Ile?Val?Phe?Glu

450 455 460

Cys?Gly?Ala?Asn?Cys?Ser?Cys?Asn?Asn?Asn?Cys?Val?Asn?Arg?Thr?Ser

465 470 475 480

Gln?Lys?Gly?Leu?Gln?Tyr?Arg?Leu?Glu?Val?Phe?Lys?Thr?Ala?Ser?Lys

485 490 495

Gly?Trp?Gly?Val?Arg?Thr?Trp?Asp?Thr?Ile?Leu?Pro?Gly?Ala?Pro?Ile

500 505 510

Cys?Glu?Tyr?Thr?Gly?Val?Leu?Arg?Arg?Thr?Glu?Glu?Val?Asp?Gly?Leu

515 520 525

Leu?Gln?Asn?Asn?Tyr?Ile?Phe?Asp?Ile?Asp?Cys?Leu?Gln?Thr?Met?Lys

530 535 540

Gly?Leu?Asp?Gly?Arg?Glu?Lys?Arg?Ala?Gly?Ser?Asp?Met?His?Leu?Pro

545 550 555 560

Ser?Leu?His?Ala?Glu?Asn?Asp?Ser?Asp?Pro?Pro?Ala?Pro?Glu?Tyr?Cys

565 570 575

Ile?Asp?Ala?Gly?Ser?Ile?Gly?Asn?Phe?Ala?Arg?Phe?Ile?Asn?His?Ser

580 585 590

Cys?Glu?Pro?Asn?Leu?Phe?Val?Gln?Cys?Val?Leu?Ser?Ser?His?Asn?Asp

595 600 605

Val?Lys?Leu?Ala?Lys?Val?Thr?Leu?Phe?Ala?Ala?Asp?Thr?Ile?Leu?Pro

610 615 620

Leu?Gln?Glu?Leu?Ser?Tyr?Asp?Tyr?Gly?Tyr?Val?Leu?Asp?Ser?Val?Val

625 630 635 640

Gly?Pro?Asp?Gly?Asn?Ile?Val?Lys?Leu?Pro?Cys?Phe?Cys?Gly?Ala?Pro

645 650 655

Tyr?Cys?Arg?Lys?Arg?Leu?Tyr

660

<210>2

<211>2357

<212>DNA

＜213〉paddy rice (Oryza sativa L.)

<400>2

tccacacctt?ctcctcctcc?tcccacactg?ctgcgcggcc?gccgccgccg?ccgccgcctt 60

ccgcatcgtc?gccgtcgatt?ttgcggagct?ccagtggatg?gaggtgatgg?attcggtggc 120

cgtgatggag?gtctcgccgg?tgccgaagcc?gccactggag?gcggcgcttg?cgctgcgccg 180

cagcgttcgg?tgcttgaaca?ggacgcgccg?tcccacttac?gtggagcagg?aggagcccaa 240

ggagagtgct?ggccggcggc?gcggcggcaa?gaggaagcgg?gaagaggaga?agaaggagcc 300

ggtggcgcag?cacgccatga?agccggtcag?gatgggcgat?gcagcctcgg?agaggaagcc 360

ctcctcggag?gggaagccga?tgcccgcaat?tgcggcggag?ccggtttctt?gtgccgggtt 420

cgcacgacct?gctgccgagg?atgatgtcct?tggcaacggg?aagagtgcga?aactgcgggt 480

gaaggaaacc?ttgagggcat?tcaccagcca?ttaccttcac?cttgtccagg?aggagcagaa 540

aagagcacaa?gcggtgttac?aggaaggcca?gaagcgtcca?tcaaagcggc?ctgacttgaa 600

agccattaca?aagatgcaag?aaagcaatgc?cgtgctttat?ccagagaaga?taatagggga 660

actacctggt?gttgatgttg?gggatcaatt?ttattctcgt?gccgagatgg?ttgttttggg 720

cattcatagt?cattggctga?atggcattga?ttatatggga?atgaaatatc?agggaaagga 780

ggagtatgca?aacctaactt?tcccactggc?aacttgtatt?gtcatgtcgg?gaatatatga 840

agatgatctt?gataaggcag?atgaaattat?ttatactggt?caaggaggaa?atgatttact 900

cggtaatcat?cgccaaattg?gctctcaaca?actgcaacgt?ggaaatttgg?cattgaagaa 960

cagtaaggat?aatggcaatc?ccataagagt?tatccgagga?catatatcaa?agaatagcta 1020

cactgggaag?gtctacacct?atgatgggct?gtacaaggtt?gtagatgact?gggtgcagaa 1080

tggagtacaa?gggcacgttg?ttttcaaata?taaattaaag?cggcttgagg?gacagccatc 1140

actgacaact?tctgaggtcc?gatttactcg?tgctgaagct?cccaccacga?tttcggaatt 1200

acctgggttg?gtttgtgatg?acatatctgg?tgggcaggag?aatcttccta?ttcctgctac 1260

taatttggtt?gatgacccac?ctgttcctcc?aactggtttt?gtgtactcca?aatctctaaa 1320

aattccaaag?ggcatcaaga?ttccatctta?ttgtaatggc?tgtgactgtg?aaggagattg 1380

cgcaaacaac?aaaaactgct?catgcgcgca?gcgcaatggt?tctgatttac?cttatgtatc 1440

acacaagaac?attggcaggt?tggtggagcc?caaagctatt?gtatttgaat?gtggtgctaa 1500

ttgcagctgc?aacaacaact?gtgtaaatag?aacatctcag?aaaggtctgc?agtatcgctt 1560

ggaggtattt?aagacagctt?caaaaggctg?gggtgtcagg?acttgggata?ctatcctccc 1620

tggggctccc?atctgtgagt?acactggtgt?gctgaggagg?actgaagaag?tagatggttt 1680

gctgcagaac?aattacatat?ttgatattga?ttgtcttcaa?actatgaagg?gtctggatgg 1740

aagagagaaa?agggctggct?ctgacatgca?tctgccgtct?cttcatgcgg?agaatgattc 1800

agatccacct?gcaccagagt?attgcattga?tgctggctct?attggcaact?ttgcaaggtt 1860

tataaaccac?agctgcgagc?ctaacctttt?tgtccagtgt?gtcttgagct?cccataatga 1920

tgttaagctg?gcaaaggtga?cgctctttgc?tgctgacact?atacttcctc?ttcaggagct 1980

ttcatatgat?tatggctatg?tcttggacag?tgttgttggg?cctgatggaa?atattgtcaa 2040

gctgccttgc?ttctgtggtg?caccgtactg?ccggaagcga?ctttattaga?tctgcacctg 2100

tttgcatcta?tttggaatat?gaaccactct?aaactataat?atatagtagt?atatgtattc 2160

agtgccaggc?gtgtaaatgg?catgctggaa?acactatgat?attttgcaga?agatgagcat 2220

tctgattttt?ttgtagaggt?catgttggag?atgctatgat?atttagcaaa?agaatagcat 2280

tctatttttg?tgtagagaac?atgctatgat?atcttataaa?caattaacct?atatatctaa 2340

gtgctgattt?aaccctc 2357

<210>3

<211>4202

<212>DNA

＜213〉paddy rice (Oryza sativa L.)

<400>3

taaatatata?tacaagctaa?tgtactgtat?agttggccca?tgtccagccc?atcggatgtc 60

cagcccattg?gatcttgtat?cttgtatata?cttctctatt?gctaatacta?ttgttaggtt 120

gcaagttagt?taagatggta?tcagagcaat?ggtctgaacc?ctagctgcca?attccccatc 180

gccggccggc?gcggcggcgt?gccgccggcg?tttcactgct?aagcaacctc?ctccaattca 240

tatttatcca?ctgctccact?gtccttttca?ccgtcgcctc?gtgggctatc?ggaccccagc 300

gcgatttgtc?gttgaccgcc?gtcgccgtcg?ccgccgccgc?gactttgccc?ttacccgcgt 360

gggcctgcag?ttgcgcagcc?gcgcggggac?gtcgtccaac?tctccgtccg?ccgctgtctg 420

cgcgcttgac?catctacatc?gttgctggct?tgctgcacag?gtcgaggccc?tgttcctccc 480

attgcctgct?gcggtgctgc?cgcttctgct?ttctgcttcc?agaaaatcag?aggaggaggc 540

tctctgctat?cagataaaag?atcagtaagc?ctgcactttc?ttggtggtac?tgcatacctg 600

ctctactagt?tcaactggga?cacggatttt?gcttatcaac?ttggattggt?tcaggactca 660

agtagctgag?ttgctagtga?tctttggttt?atacaattgt?tttgatatat?catggtgtca 720

gatggaattc?ttggtcccta?tccatgtgct?ggtattgcct?catgttcatc?tatatcaact 780

gttaccccaa?ttgcctccca?accatggatt?ttggactcag?gagcctcctt?tcatatgtca 840

tttgatgatt?catggctcac?atcatgccgt?ctggttaaaa?atggtgccac?cgttcataca 900

gctaatggaa?cattgtgtaa?ggttactcat?caggggtcta?tctcttctcc?tcagtttaca 960

gtacctaatg?tgtcacttgt?tccaaaacta?tccatgaacc?tcatttctgt?aggtcaactc 1020

acagatacaa?attgtttcgt?tggatttgat?gatacttcat?gctttgtgca?agatcgccac 1080

acaggagctg?tcattggcac?cggacatcgt?cagaaaagat?cctgtgggct?ttatatcctt 1140

gatagcttga?gtttgccttc?atcctccact?aacacacctt?ctgtctattc?tcctatgtgc 1200

tctacagctt?gtaaatcctt?cccacagtgg?caccatcgtt?tgggtcactt?gtgtggctct 1260

cgcctagcaa?ctcttatcaa?tcaaggcgtt?cttggttccg?tccctgttga?cactaccttt 1320

gtttgcaaag?gttgtaaact?tggtaagcaa?gtacagcttc?catatccttc?cagtacctcc 1380

aggtcgagtc?gaccttttga?tttggttcac?tctgatgttt?ggggaaagtc?cccctttcct 1440

tcaaaaggag?gccacaacta?ctatgttatt?tttgttgatg?attattctag?atatacatgg 1500

atctatttca?tgaagcatcg?gtctcagcta?atttctatat?atcagtcttt?tgcccagatg 1560

attcatactc?agttctctag?tgcaattcgt?attttccgct?cagactccgg?aggagagtat 1620

atgtcaaatg?cttttcgtga?atttttggta?tctcagggca?ctcttcctca?actttcttgt 1680

cctggtgctc?atgctcaaaa?tggtgttgct?gagcgtaaac?atcgccacat?cattgagact 1740

gctagaactc?ttctcattgc?atcatttgtt?ccagctcatt?tctgggcaga?ggctatttct 1800

acagctgtat?atctcatcaa?catgcaacca?tcttcttctt?tgcaaggcag?gtcccctgga 1860

gaagtgttgt?ttggctctcc?tccccgctat?gatcaccttc?gagtttttgg?ttgtacttgc 1920

tatgttttac?tagccccacg?tgagcgcacc?aagttgacag?cccaatcagt?tgagtgtgtt 1980

tttcttggat?atagtcttga?gcataaaggc?tatcgctgtt?atgatccttc?tgcacgtcga 2040

attcgtatct?cccgagatgt?tacttttgat?gagaacaaac?ccttcttcta?ttcttctact 2100

aatcagcctt?cttctccaga?aaattccatc?tccttccttt?accttccacc?tattccttca 2160

ccagagtctt?taccttcatc?accaataacc?ccatcaccat?cgcctatacc?tccttctgta 2220

ccttcaccaa?catatgtacc?acctccacca?ccttcccctt?caccctcacc?tgtatcgcct 2280

ccaccatcac?acatcccagc?ttcctcatca?cctccacatg?ttccttccac?tataacatta 2340

gacacttttc?ctttccacta?cagtcgtaga?cccaaaattc?ctaacgaatc?acaaccctcc 2400

caacctaccc?ttgaggatcc?aacatgttcc?gttgatgatt?catctcctgc?tccgaggtac 2460

aacttgcgtg?ctcgtgatgc?tcttcgtgca?cctaatagag?atgattttgt?tgttggggtt 2520

gtgtttgagc?catctactta?tcaggaggca?attgttttac?ctcattggaa?attggctatg 2580

tcagaggagc?ttgctgcact?agagcgtacc?aacacgtggg?atgttgtccc?gttgccatct 2640

catgctgttc?caatcacctg?taagtgggtt?tataaagtta?agaccaaatc?agatggtcaa 2700

gttgagagat?acaaggctcg?ccttgttgcg?cgaggtttcc?agcaagctca?tggtcgagac 2760

tatgatgaga?catttgctcc?tgttgctcat?atgactacgg?tgcgtacttt?aattgccgtg 2820

gcagctaccc?gttcttggac?tatctcacaa?atggatgtca?agaatgcttt?tcttcatggt 2880

gatcttcatg?aggaggtata?tatgcatcca?ccaccaggtg?tggaagctcc?accaggacat 2940

gtatttcgcc?ttcggcgtgc?actttatggt?ctcaagcagg?cccctcgtgc?ttggtttgca 3000

cgcttcagct?cagtggtact?tgcagctggg?ttttctccta?gcgatcatga?cccagcacta 3060

ttcattcata?cttcctcccg?tggtcgtact?ttgttgttac?tctatgtgga?tgacatgttg 3120

attacagggg?atgatttgga?gtacattgct?ttcgtgaaag?ggaaactcag?cgaacagttt 3180

atgatgtctg?atttgggacc?actcagctac?tttctaggga?ttgaagtcac?ctctactgtt 3240

gatggttact?atctttctca?acaccgttat?attgaggatc?ttcttgctca?gtcaggcctc 3300

actgatagta?gaacaactac?tactcctatg?gagttgcatg?tccgacttcg?ttccacagat 3360

ggaactcctc?ttgatgaccc?ctcacggtat?cgacatcttg?tgggtagcct?tgtctatctt 3420

actgtcacta?ggccggatat?tgcttatgct?gttcatatct?tgagtcagtt?tgtcagtgct 3480

ccgatttcag?ttcactatgg?tcacttgctt?cgtgtcttac?gatatttgag?gggcactaca 3540

actcaatgct?tgttctatgc?agcatctagc?ccgcttcagc?ttcgcgcttt?ctcggactct 3600

acttgggcaa?gtgatcctat?tgatcgtcgc?tctgtcactg?gctattgtat?ttttcttggc 3660

acttctctcc?tcacttggaa?gtccaagaaa?caaacagcgg?tatctcgatc?tagtactgag 3720

gctgaacttc?gggctcttgc?cacaaccact?tcagagattg?tgtggttgcg?ttggctacta 3780

gctgattttg?gtgtctcttg?tgatgtcccg?acacctcttt?tatgtgacaa?caccggagct 3840

atacaaatcg?ccaatgatcc?aatcaagcat?gaattgacga?agcatattgg?cgttgatgca 3900

tctttcacac?gttctcattg?tcagcagtca?acaattgctc?tccactatgt?gccctccgag 3960

ctacaagtcg?ctgatttctt?caccaaggcc?caaactcgag?agcatcatcg?gttacatctt 4020

ctcaaactca?atgtggtaga?tccaccttga?gtttgaaggg?gggtgttaaa?tatatataca 4080

agctaatgta?ctgtatagtt?ggcccatgtc?cagcccatcg?gatgtccagc?ccattggatc 4140

ttgtatcttg?tatatacttc?tctattgcta?atactattgt?taggttgcaa?gttagttaag 4200

ac 4202

Claims

1, a kind of method that activates Tos17 swivel base in the paddy rice is the expression that suppresses the histone methylated transferase in the rice cell with the RNA interference method; The aminoacid sequence of described histone methylated transferase is shown in sequence in the sequence table 1;

Described RNA interference method is that the RNAi expression vector pCAMBIA2300-SDG714RNAi of described histone methylated transferase is imported in the paddy rice;

The preparation method of the RNAi expression vector pCAMBIA2300-SDG714RNAi of described histone methylated transferase is as follows:

Extract the total RNA of paddy rice, with oligo d (T) is primer, reverse transcription becomes cDNA, use primer CX52:5 '-ATTctcgagGCAACTTGTATTGTCATGTCGGG-3 ' and CX53:5 '-AGCagatctGGGAGCTTCAGCACGAGTAA-3 ' pcr amplification sequence 2 from 5 ' terminal the 712nd to 1085 deoxyribonucleotides; With the PCR product after BgII and XbalI enzyme are cut, insert in the pUCRNAi carrier that XhoI/BglII and two groups of enzymes of BamHI/SalI are cut with positive and negative both direction, obtain recombinant vectors pUC-SDG714RNAi, will insert PstI restriction enzyme site among the pCAMBIA2300ACT with the stem ring plate section that the PstI enzyme is cut the both forward and reverse directions that pUC-SDG714RNAi obtains again; To cut evaluation through the PstI enzyme and contain the segmental recombinant vectors called after of this stem ring pCAMBIA2300-SDG714RNAi;

Described pUCRNAi transforms to obtain on pUC18 carrier basis, makes up as follows: after BamHI and EcoRI enzyme are cut, it is mended flat by the T4 polysaccharase pUC18 carrier; With potato gene group DNA is template, utilize forward primer: CCT GCA GGC TCG AGA CTA GTA GAT CTG GTA CGG ACC GTA CTA CTC TA and reverse primer: CCT GCA GGG TCG ACT CTA GAG GAT CCC CTA TAT AAT TTA AGT GGA AAA carries out the intron in the pcr amplification potato GA20 oxydase, the product of amplification is inserted the pUC18 carrier in the mode of flush end, obtain the pUCRNAi carrier;

Described pCAMBIA2300ACT is by making up on the pCAMBIA2300 carrier basis, concrete grammar is as follows: the genomic dna with paddy rice is a template, use primer CGAATTCGAGCTCGGTACCCTCGAGGTCATTCATATGCTTGAGA, carry out PCR with TCTAGAGGATCCCCGGGTACCTCTTCTACCTACAAAAAAGCTCCGCAC, amplification Actinl; The PCR product is inserted between the EcoRI and XbalI site of pCAMBIA2300 carrier after EcoRI and XbalI enzyme are cut, obtain recombinant vectors pCAMBIA2300ACT.

2, method according to claim 1 is characterized in that: described paddy rice is fine for Japan.