CN100560723C - Recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof - Google Patents
Recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof Download PDFInfo
- Publication number
- CN100560723C CN100560723C CNB2005100248722A CN200510024872A CN100560723C CN 100560723 C CN100560723 C CN 100560723C CN B2005100248722 A CNB2005100248722 A CN B2005100248722A CN 200510024872 A CN200510024872 A CN 200510024872A CN 100560723 C CN100560723 C CN 100560723C
- Authority
- CN
- China
- Prior art keywords
- pharmaceutical composition
- fusion protein
- sctla
- recombination human
- sctla4
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Abstract
The present invention relates to field of biological pharmacy, disclose a kind of recombination human sCTLA 4-Ig fusion protein gene that in mammalian cells such as CHO, has high expression amount.The invention also discloses a species specific immune suppressant drug composition, its effective constituent comprises the zone, extracellular of sCTLA4 and the constant zone of immunoglobulin (Ig).Pharmaceutical composition of the present invention can combine with the CTLA4 part on antigen presenting cell surface in vivo, thereby blocking-up B7-1 and/or B7-2 and the CD28 of T cell surface and/or combining of CTLA4 acceptor play the effect that suppresses organism immune response.
Description
Invention field
The invention belongs to field of biological pharmacy, relate to a kind of antigen-4 fusion protein gene of cytolytic T lymphocyte antigen 4, more particularly, the present invention relates to a kind of recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof.
Background of invention
Being cytolytic T lymphocyte antigen 4 (Cytotoxic T Lymphocyte associate Antigen-4, CTLA-4 claims CD152 again), is one of significant molecule that is expressed on the activating T cell surface.Studies show that this composition is a negative regulatory factor of keeping T cell stability in the body, have the value-added function that suppresses activation T-cell, constituted a pair of crucial immune-regulating factor with CD28.At present, it is used as the immunosuppression acceptor and has carried out extensive studies, might use as the preparation that suppresses immunological rejection clinically.
T-cell, antigen presenting cell surface participate in producing altogether, and the molecule of hormesis is referred to as costimulatory molecules.Generally acknowledge that at present most important stimulation channels altogether is that B7-CD28 stimulates path altogether.B7 is positioned at antigen presenting cell, combines with the CD28 molecule of T cell surface and can produce common stimulation.Behind t cell activation, its cell surface can occur another can with B7 cell bonded molecule CTLA4.The avidity of CTLA4 and B7 is very high, this molecule with can induce the accent of B7 cell to die after the B7 cell combines.Therefore think that at present it has down regulation to t cell activation, the balance of immunological status plays an important role in the human body for keeping.CTLA4 can also combine with CD80 and CD86, and their avidity is than the obvious height of CD28, and its function is opposite with CD28, and the T cell is had down regulation.
CTLA-4 is a kind of polarity transmembrane protein.The segmental coding region of Fc of outer soluble fractions of this proteic film and antibody molecule is merged the fusion gene sCTLA4-Ig of formation, insert appropriate carriers, can obtain a kind of natural non-existent fusion rotein after importing suitable cell, its existing cell surface receptor is expected original part bonded ability, the same solubility of antibody molecule is arranged again, transformation period and antibody molecule are approaching, keep the active time long.The protein molecular that utilizes human source gene to obtain can not cause immune response in vivo.Be produced out and be successfully used to clinical at present by multiple similar soluble fusion protein matter.The soluble receptors of CTLA4 can combine with the B7 molecule competitively, and its avidity to B7 is far longer than CD28, therefore can suppress the B7-CD28 passage significantly.
CD80 (B7-1) that sCTLA4-Ig and APC go up to express and the avidity of CD86 (B7-2) are higher than the CD28 that expresses on the T cell and the avidity of B7-1 and B7-2.The effect of sCTLA4-Ig is the T cell co-stimulatory effect that suppresses the CD28 mediation.The CD40/CD40L approach is that another group is attacked stimulation molecule, can stimulate T and B cell to transform simultaneously.As seal the CD40/CD40L approach, can prolong the allograft survival of mouse and primates.If associating sCTLA4-Ig and anti-CD 40 L monoclonal antibody seal these two kinds and are total to the hormesis approach with the significant prolongation graft survival.In view of the vital role of T cell in transplant rejection, present clinical use and most immunosuppressor of developing all act on the T cell.
Summary of the invention
Technical problem to be solved by this invention is to provide a kind of recombination human sCTLA 4-Ig fusion protein gene, and it has the described gene order of SEQ ID NO:1.
Technical problem to be solved by this invention also is to provide a kind of recombination human sCTLA 4-Ig fusion protein pharmaceutical composition, comprises sCTLA4-Ig fusion rotein, trehalose and phosphate buffered saline buffer in the described pharmaceutical composition.
More particularly, described recombination human sCTLA 4-Ig fusion protein pharmaceutical composition contains sCTLA4-Ig fusion rotein 10-30mg/ml, contains trehalose 20-50mg/ml, is dissolved in the phosphate buffered saline buffer of 100mM.Such as, wherein can contain CTLA4-Ig fusion rotein 20mg/ml, contain trehalose 40mg/ml, be dissolved in the phosphate buffered saline buffer of 100mM.
More particularly, when the pharmaceutical composition of the described recombination human sCTLA 4-Ig fusion protein of preparation, the pharmaceutical composition of liquid state can be made freeze-dried preparation, resuspended with distilled water when using.
More particularly, described recombination human sCTLA 4-Ig fusion protein pharmaceutical composition can be taked intramuscular administration, intravenous administration, subcutaneous administration or intradermal administration.
In the present invention, " pharmaceutical composition of the present invention " refers to contain the composition of sCTLA4-Ig fusion rotein and pharmaceutically acceptable carrier, can play the effect that suppresses organism immune response.
In the present invention, " (s) CTLA4-Ig fusion rotein " refers to merge formed fusion rotein by people CTLA-4 soluble part (sCTLA-4) and people Ig antibody Fc fragment.
Trehalose (α-D glucopyranosyl-(glycopyranoside)) is naturally occurring non-reduced type disaccharides.The form of trehalose comprises the trehalose dihydrate compound (TD) of crystal type, and non-crystalline type trehalose (AT) also can be the trehalose of anhydrous form, promptly anhydrous armorphous trehalose (AAT) and anhydrous crystal trehalose (ACT).Can use the trehalose of any physical form among the present invention, comprise trehalose anhydrous, partially hydrated, complete hydration.
When using pharmaceutical composition of the present invention, be that safe and effective amount pharmaceutical composition is used for Mammals, wherein this safe and effective amount is usually at least about 10 μ g sCTLA4-Ig fusion rotein/Kg body weight, and in most of the cases be no more than about 8mg sCTLA4-Ig fusion rotein/Kg body weight, preferably this dosage is the about 1mg/Kg body weight of about 10 μ g/ kg body weight.Certainly, specifically dosage also should be considered factors such as route of administration, patient health situation, age.
Description of drawings
Fig. 1 has shown the expression vector pMG18-3K that the present invention is used, has indicated element and restriction enzyme site wherein.HCMV pro, human cytomegalovirus M ajor Immediate early promoter; C
k, people κ chain constant region gene; CH, people γ 1 chain constant region gene; PA, the poly-adenosine signal; DHFR, dihydrofolate reductase gene; PUC origin, the plasmid replication initiation site; Amp is an ampicillin resistance gene.
Preferred implementation
Embodiment 1
The design of recombinant human sCTLA-4 fusion rotein and preparation
1. the design of recombinant human sCTLA-4 gene
In the applicant's existing patent CN01132075.3, the recombinant human sCTLA-4 antigen-4 fusion protein gene structure of the applicant's design is disclosed, in this patent, be starting point to improve proteic expression amount and avidity, the applicant has done further improvement to the gene of sCTLA-4.
Based on above-mentioned existing patent, the present invention is with reference to the rule of some genetic expressions, according to the preferences of existing experience and codon,, designed one section new reorganization sCTLA-4 gene (SEQ ID NO:1) that has the clonal expression operating sequence through hundreds of times design and improvement:
CAT
gctagcATG
GCTATGCACG?TCGCGCAGCC?AGCCGTAGTT?CTCGCGAGGA?GCCGTGGAAT?GGCAAGTATA 60
GTCTGAGACT?AAGCTTCCCC?TGGAAAGGCA?ACGGACGTGC?GAGTCACTGT?CCTACGCCAT?120
GCAGAGAGGC?ACGTCACAGA?GGTGTGAGCC?GCTACGTAGA?ACACCGGAAA?GGACTTCACG?180
TTGCTCGAAG?AGTCGATATG?GACCGGAACA?TCGAGAGGTA?AGCAAGTCAA?GCTGACAATT?240
CATGGTCTCA?GCGCGATGGA?GACCGGTCTG?TAGATGTGGA?ACGTCGACCT?GATGTAGCCT?300
CCACGTTAGT?AGCTCGGAAT?CGGAAAGGGT?AGGCACATAT?ACGTCATAGA?ACCTGATCCC?360
TGGCCTGAAT?CAGAGTTGCT?GCTGTGCATA?CTAGCTGCTG?TAAGATCCGG?CTTCTAATTA?420
TAAAGGTTGC?TACTGACTGC?AGTATCATTC?AGGAATATGC?TTAACAATAG?TAGGCCACTA?480
ACTACTGGCG?TGTAAGTCAA?TATGCCTCCC?ACTGACCCTG?ATTGAGATAA?CCATTTGCAT?540
CCTTAATTAA?TCGGAATGAA?TTGT 564
2.sCTLA-4/Fc the acquisition of fusion gene
Human IgG1 Fc fragments sequence is known (referring to for example Genebank accession number acc82527).With aforesaid sCTLA4 and the plasmid pMG18-3K (Fig. 1 that has total length IgG1 gene, also can be with reference to DEVELOPMENT OF TOOLS FOR ENVIRONMENTAL MONITORING BASEDON INCP-9 PLASMIDS SEQUENCES.A.Greated, R.Krasowiak, M.Titok, C.M.Thomas School of Biological Sciences, University of Birmingham, Edgbaston, Birmingham B 15 2TT, UK and Faculty of Biology, Dept of Microbiology, BelarusState University Scorina Av.4, Minsk 220080 Belarus) be template, design corresponding primer, carry out PCR (concrete grammar can referring to the applicant's patent CN01132075.3).Carrying out gel after the acquisition molecular size is about the single band of 1233bp on the agarose gel electrophoresis reclaims.The DNA that obtains is cloned on pUC 18 carriers back transformed into escherichia coli and is carried out blue hickie screening according to ordinary method, cuts by enzyme and identifies and order-checking, confirms the right-on clone of sequence, is sCTLA4/Fc.
Selectable, can also between sCTLA4 and IgG1, add joint sequence, be (Ala
3Ser
2)
5(SEQID NO:2), its gene order is:
5 '-ACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTCGTCAACCACAACCTC GTCAACCACAACCTCGTCA-3 ' (SEQ ID NO:3) is sCTLA4/ joint/Fc (concrete grammar can referring to the applicant's patent CN01132075.3).
Embodiment 2
The sCTLA-4 Expression of Fusion Protein
1. the structure of integrative gene expression vector
PUC18[sCTLA-4/Fc with aforementioned structure] and pUC18[sCTLA-4/ joint/Fc] correct clone is inoculated in the 20ml liquid LB substratum that contains penbritin, 37 ℃ of overnight incubation, with the Midi plasmid DNA extracting and purifying test kit extracting plasmid DNA of Promega company, each get about 30 micrograms of plasmid DNA.
Use Nhe I and Xho I (Phamarcia) (10U/ μ l) digestion pUC18[sCTLA-4/Fc respectively], pUC18[sCTLA-4/ joint/Fc] and expression plasmid pMSG (Phamarcia).37 ℃ of reactions of endonuclease reaction are spent the night.Enzyme is cut product and carry out isolation identification on 0.8% agarose electrophoresis, is about the fragment of 1500bp with the gel recovery test kit recovery size of Promega company.
Use T4 dna ligase (10U/ μ l) sCTLA-4/Fc or sCTLA-4/ joint/Fc to be connected to the Nhe I and the Xho I site of pMSG carrier respectively.
According to ordinary method (seeing Sambrook etc., 1989) connection gained reorganization pMSG transformed into escherichia coli DH5a bacterial strain, and on the IPTG/X-Gal plate culture medium, carry out blue hickie screening.Respectively get 12 of hickies and be inoculated in and extract plasmid after 37 ℃ of cultivations of LB liquid nutrient medium and carry out enzyme as previously mentioned and cut evaluation, every kind of fusion gene obtains 4 segmental clones of insertion with correct size at least, as candidate clone.
Carry out dna sequencing with two in the above-mentioned candidate clone.According to sequencing result, confirm to insert the in full accord of fragments sequence and design respectively.The correct clone of gained is remembered work: pMSG[sCTLA4/Fc respectively], pMSG[sCTLA4/ joint/Fc].
2.CHO transformation and expression
Get the coli strain that has above-mentioned 2 kinds of reorganization pMSG, be inoculated in the 2xYT liquid nutrient medium that 500ml has added penbritin respectively, 37 ℃, the 260rpm concussion was cultivated 16 hours.With " Ultrapure Plasmid Purification Kit " extracting plasmid DNA of Qiagen company, extractive process is carried out according to the specification sheets that producer provides.
Use the liposome transfection Chinese hamster ovary celI, the transfection reagent box is available from Invitrogene company.Get the pMSG[sCTLA4/ joint/Fc of above-mentioned purifying during transfection respectively], pMSG[sCTLA4/Fc] plasmid 100 micrograms carry out transfection as the DNA sample to Chinese hamster ovary celI, the transfection schedule of operation is carried out according to the specification sheets of producer.
Chinese hamster ovary celI after the transfection is through continuous 3 months methotrexate (MTX) screening, and to 10 μ M, per two weeks increase a concentration to its concentration from 0.05 μ M, and the consumption of each MTX is about previous 2 times, concrete visual cell's growing state and deciding.Cell cultures is carried out according to routine, and substratum is: 15% foetal calf serum (Gibco)+RPM1640/DEME.In 37 ℃, 5%CO
2Cultivate in the incubator.Carry out mono-clonalization according to routine extreme dilution method then.Use the ELISA method and detect its Expression of Fusion Protein amount respectively, obtain pMSG[sCTLA4/ joint/Fc altogether] clone 152, pMSG[sCTLA4/Fc] clone 128.
The conventional cultivation in the DEME substratum, the expression intensity of above-mentioned part clone sCTLA-4 is studied concrete data such as following table with ELISA:
Table 1
Above data declaration, reorganization sCTLA-4 gene of the present invention has significantly improved the Expression of Fusion Protein level, has improved about order of magnitude (10 times) than original level.
Embodiment 3
The sCTLA-4 fusion rotein suppresses the lymphopoiesis Research on ability
With above-mentioned pMSG[sCTLA4/ joint/Fc] and pMSG[sCTLA4/Fc] expression cell line cultivate the back and carry out affinity chromatography with A albumen-Sepharose, acquisition purity reaches the fusion rotein more than 90%.
1. conventional separation of human peripheral blood lymphocyte (PBMC), adjusting cell density is 2 * 10
6Cells/ml, PBMC and equal-volume nutrient solution mix the back with 2 * 10
5Cells/0.2ml/ hole inoculation " U " type 96 well culture plates add not 9 purified fusion proteins with amount, equal-volume corresponding empty carrier transfection supernatant or substratum are set compare, every group 3 multiple hole, 37 ℃, 5%CO
2Cultivate 5d, 16h adds before stopping cultivating
3H-TdR (final concentration 5 μ Ci/ml), collecting cell are dried on 0.45 μ m millipore filtration, and liquid scintillation counter is surveyed the DPM value
2. the result represents with x ± s, and Microsoft Excel statistics program carries out mean difference significance analysis.
3. at MLR reaction (Linsley P S, Brady W, Urnes M, et al.CTLA-4 is a second receptorfor the B cell activation antigen B7[J] .J Exp Med, 1991,174 (3): 561-569.) in the system, sCTLA4/ joint/Fc, the sCTLA4/Fc or the empty carrier transfection CHO cell supernatant that add 1 microgram, 5 micrograms and 10 microgram Protein A purifying purifying respectively, the result shows, even add the fusion rotein of 1 microgram A protein purification, also can significantly suppress human peripheral MLR, inhibiting rate is 60%～70%; And add the empty carrier transfection CHO cell supernatant of same volume, and then there is not this effect, through one-way analysis of variance, the result has statistical significance.Equally, we also once directly carried out the MLR experiment with the supernatant of unpurified transfectional cell, fail to observe significant inhibitory effect, this may cancel out each other relevant with the hormesis of heterologous protein in the purifying cells transfection supernatant not and the restraining effect of micro-fusion rotein.
Embodiment 4
Preparation of drug combination of the present invention
At first prepare the phosphate buffered saline buffer of 100mM, and regulate the pH value of damping fluid, make it about PH7.0.Add an amount of trehalose in phosphate buffered saline buffer, make it reach 50mg/ml, then add the sCTLA-4 fusion rotein, make it reach 50mg/ml, the medicament of acquisition can directly be applied to Mammals (comprising the people), as by intravenous mode.
In addition, also pharmaceutical composition of the present invention can be made freeze-dried preparation, so that transportation and storage.When needs are used, can pharmaceutical composition of the present invention be carried out with physiology available solvent resuspended, resuspended such as using distilled water to carry out.
Sequence table
＜110〉Shanghai CP Guojian Pharmaceutical Co.,Ltd
＜120〉recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof
<160>3
<210>1
<211>564
<212>DNA
＜213〉polynucleotide
<400>1
GCTATGCACG?TCGCGCAGCC?AGCCGTAGTT?CTCGCGAGGA?GCCGTGGAAT?GGCAAGTATA 60
GTCTGAGACT?AAGCTTCCCC?TGGAAAGGCA?ACGGACGTGC?GAGTCACTGT?CCTACGCCAT?120
GCAGAGAGGC?ACGTCACAGA?GGTGTGAGCC?GCTACGTAGA?ACACCGGAAA?GGACTTCACG?180
TTGCTCGAAG?AGTCGATATG?GACCGGAACA?TCGAGAGGTA?AGCAAGTCAA?GCTGACAATT?240
CATGGTCTCA?GCGCGATGGA?GACCGGTCTG?TAGATGTGGA?ACGTCGACCT?GATGTAGCCT?300
CCACGTTAGT?AGCTCGGAAT?CGGAAAGGGT?AGGCACATAT?ACGTCATAGA?ACCTGATCCC?360
TGGCCTGAAT?CAGAGTTGCT?GCTGTGCATA?CTAGCTGCTG?TAAGATCCGG?CTTCTAATTA?420
TAAAGGTTGC?TACTGACTGC?AGTATCATTC?AGGAATATGC?TTAACAATAG?TAGGCCACTA?480
ACTACTGGCG?TGTAAGTCAA?TATGCCTCCC?ACTGACCCTG?ATTGAGATAA?CCATTTGCAT?540
CCTTAATTAA?TCGGAATGAA?TTGT 564
<210>2
<211>25
<212>PRT
＜213〉joint peptide
<400>2
Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser?Ser?Ala
5 10 15
Ala?Ala?Ser?Ser?Ala?Ala?Ala?Ser?Ser
20 25
<210>3
<211>75
<212>DNA
＜213〉joint gene
<400>3
ACCACAACCT?CGTCAACCAC?AACCTCGTCA?ACCACAACCT?CGTCAACCAC?AACCTCGTCA 60
ACCACAACCT?CGTCA 75
Claims (5)
1. the gene of a recombination human sCTLA 4-Ig fusion protein is characterized in that, its gene order is shown in SEQ ID NO:1.
2. a recombination human sCTLA 4-Ig fusion protein pharmaceutical composition is characterized in that, comprises sCTLA4-Ig fusion rotein, trehalose and the phosphate buffered saline buffer of gene order coding according to claim 1 in the described pharmaceutical composition.
3. recombination human sCTLA 4-Ig fusion protein pharmaceutical composition according to claim 2 is characterized in that, wherein contains sCTLA4-Ig fusion rotein 10-30mg/ml, contains trehalose 20-50mg/ml, is dissolved in the phosphate buffered saline buffer of 100mM.
4. recombination human sCTLA 4-Ig fusion protein pharmaceutical composition according to claim 3 is characterized in that, the pharmaceutical composition of liquid state is made freeze-dried preparation, and is resuspended with distilled water when using.
5. according to any recombination human sCTLA 4-Ig fusion protein pharmaceutical composition among the claim 3-4, it is characterized in that, take any mode in intramuscular administration, intravenous administration, subcutaneous administration or the intradermal administration.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100248722A CN100560723C (en) | 2005-04-05 | 2005-04-05 | Recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100248722A CN100560723C (en) | 2005-04-05 | 2005-04-05 | Recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof |
Related Child Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CN2009101301787A Division CN101519451B (en) | 2005-04-05 | 2005-04-05 | Recombinant human cytotoxic T lymphocyte associate antigen-4 fusion protein gene (sCTLA4-Ig) and pharmaceutical composition thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1693465A CN1693465A (en) | 2005-11-09 |
| CN100560723C true CN100560723C (en) | 2009-11-18 |
Family
ID=35352592
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100248722A Active CN100560723C (en) | 2005-04-05 | 2005-04-05 | Recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100560723C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101519451B (en) * | 2005-04-05 | 2011-05-25 | 上海中信国健药业股份有限公司 | Recombinant human cytotoxic T lymphocyte associate antigen-4 fusion protein gene (sCTLA4-Ig) and pharmaceutical composition thereof |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101343640B (en) * | 2008-01-24 | 2012-04-11 | 中国人民解放军军事医学科学院野战输血研究所 | Common expression CTLA4Ig and CTLA4 recombinant adenovirus carrier, recombinant adenovirus and uses thereof |
| CN102382193B (en) * | 2011-11-01 | 2013-08-14 | 孙嘉琳 | Fusion protein capable of inducing and activating cancer-targeted T cells, preparation method and use thereof |
| CN110066344A (en) * | 2019-06-04 | 2019-07-30 | 海南医学院第一附属医院 | A kind of Fc fusion protein F GFR1-MIP3a-CTLA4 and its application |
-
2005
- 2005-04-05 CN CNB2005100248722A patent/CN100560723C/en active Active
Non-Patent Citations (2)
| Title |
|---|
| CTLA-4/Ig融合蛋白在COS-7中的表达、纯化及鉴定. 易绍萱等.第三军医大学学报，第22卷第6期. 2000 |
| CTLA-4/Ig融合蛋白在COS-7中的表达、纯化及鉴定. 易绍萱等.第三军医大学学报，第22卷第6期. 2000 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101519451B (en) * | 2005-04-05 | 2011-05-25 | 上海中信国健药业股份有限公司 | Recombinant human cytotoxic T lymphocyte associate antigen-4 fusion protein gene (sCTLA4-Ig) and pharmaceutical composition thereof |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1693465A (en) | 2005-11-09 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US20190169621A1 (en) | Targeted/immunomodulatory fusion proteins in combination with additional therapeutic agents and methods for making same | |
| US20180208639A1 (en) | CTLA-4 Variants | |
| US11845797B2 (en) | Anti-TCR antibody molecules and uses thereof | |
| JP2021090441A (en) | Immunomodulatory protein with tunable affinity | |
| US7094874B2 (en) | Soluble CTLA4 mutant molecules | |
| ES2302811T3 (en) | PROCEDURE TO PROTECT TRANSPLANTS OF ALOGENIC ISLOTES USING MUTING MOLECULES SOBLULES CTLA4. | |
| ES2225549T3 (en) | CTLA4 MODULES MUTAN SOLUBLES AND USES OF THE SAME. | |
| ES2899733T3 (en) | Anti-CD277 antibodies and uses thereof | |
| CN110325205A (en) | T cell modulability multimeric polypeptide and its application method | |
| US20020039577A1 (en) | Methods for regulating a lymphocyte-mediated immune response by blocking costimulatory signals and blocking LFA-1 mediated adhesion in lymphocytes | |
| WO2017048878A1 (en) | Tunable variant immunoglobulin superfamily domains and engineered cell therapy | |
| CN101198347A (en) | Methods for treating immune disorders associated with graft transplantation with soluble CTLA4 mutant molecules | |
| MXPA02012603A (en) | Methods for treating rheumatic diseases using a soluble ctla4 molecule. | |
| NO325828B1 (en) | Use of an antibody formed against an antigen. | |
| CN112004832A (en) | Chimeric antigen receptor binding to CD83 | |
| US20230227552A1 (en) | Anti-tcr antibody molecules and uses thereof | |
| US20230235067A1 (en) | SSTR-2 Binding Chimeric Antigen Receptors | |
| CN100560723C (en) | Recombination human sCTLA 4-Ig fusion protein gene and pharmaceutical composition thereof | |
| EP1702622A1 (en) | Soluble BTNL2 protein useful to inhibit inflammatory disorders | |
| US20220259285A1 (en) | CD80 and CD86 Binding Protein Compositions and Uses Thereof | |
| CN101519451B (en) | Recombinant human cytotoxic T lymphocyte associate antigen-4 fusion protein gene (sCTLA4-Ig) and pharmaceutical composition thereof | |
| US20230390391A1 (en) | Bi-specific chimeric antigen receptor t cells targeting cd83 and interleukin 6 receptor | |
| Cho et al. | Construction, and in vitro and in vivo analyses of tetravalent immunoadhesins | |
| CN113874389A (en) | Interleukin-2 receptor (IL2R) and interleukin-2 (IL2) variants for specific activation of immune effector cells | |
| US20230340068A1 (en) | Chimeric antigen receptor (car) with cd28 transmembrane domain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Patentee after: Shanghai CP Guojian Pharmaceutical Co., Ltd. Address before: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Patentee before: Zhongxin Guojian Pharmaceutical Co., Ltd., Shanghai |
|
| C56 | Change in the name or address of the patentee | ||
| CP01 | Change in the name or title of a patent holder |
Address after: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Patentee after: Three country Kin Pharmaceutical (Shanghai) Limited by Share Ltd Address before: Shanghai city 201203 libing road Pudong New Area Zhangjiang hi tech Park No. 399 Patentee before: Shanghai CP Guojian Pharmaceutical Co., Ltd. |