CN100554435C - Systemic displacement polymerase lymerase chain reaction - Google Patents
Systemic displacement polymerase lymerase chain reaction Download PDFInfo
- Publication number
- CN100554435C CN100554435C CNB2007101078287A CN200710107828A CN100554435C CN 100554435 C CN100554435 C CN 100554435C CN B2007101078287 A CNB2007101078287 A CN B2007101078287A CN 200710107828 A CN200710107828 A CN 200710107828A CN 100554435 C CN100554435 C CN 100554435C
- Authority
- CN
- China
- Prior art keywords
- template
- indication
- measured
- chain reaction
- dna
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a kind of " systemic displacement polymerase lymerase chain reaction ", it is characterized in that by template to be measured-indication template hybridization ligase enzyme reaction, pcr amplification to be measured is replaced as the amplification of the indication PCR system that comprises that a cover is above, comprise the steps that (1) will add top templet gene reservation queue formation to be measured indication template with the indication template two ends that template to be measured has nothing to do and add head and the tail DNA; (2) indication template utilization adds the complementary hybridization of different zones reservation queue in head and the tail and the template to be measured, and (3) connect indication template head and the tail breach by T4 or the reaction of Taq ligase enzyme and form ring-type and indicate template; (4) by inverse PCR amplification ring-type indication template.But template to be measured is also RNA sample of DNA both, and because of hybridization coupling dependency reparation amplification makes the detection of its suitable transgenation inherited disease, also is applicable to the quantitative assay of template to be measured with the fluorescent molecular bacon coupling.
Description
Technical field
The present invention relates to further developing of polymerase chain reaction,PCR pcr gene amplification technique, a kind of new PCR that Molecular Detection is used by way of, especially gene test PCR system is replaced as tens of covers independently DNA indication PCR system use by turns.
Background technology
In the evening of nineteen eighty-three, K.B.Mullis has created fantasy (the The unusual originof the polymerase chain reaction of PCR accidentally, Sci, Am.262:56,1990 and US patent#4683202), and through the many improvement of PE-Cetus company and practicality.Along with the application (Saiki R.K., et.al, Science 239:487-491,1988) of the heat-stable DNA polymerase of originating from thermophilic water bacteria, round pcr is ripe gradually, efficient, automatization.Be widely used in various fields such as gene clone, order-checking, Molecular Detection, established the solid foundation of modern molecular biology.And derived gradually numerous PCR utilisation technologies and evolutionary operation (Molecular Cloning, 3
RdEdit).
Along with the mankind wait finishing of range gene group order-checking, and enter the functional protein group epoch, molecule PCR detects to be used more and more widely, has been penetrated into biological each field.Especially since 1989 begin to apply to Clinical Laboratory, the hot technology that PCR is easy, quick with it, the sensitive advantage becomes the clinical experiment diagnostics has been applied to fields such as communicable diseases such as hepatitis, pulmonary infection and venereal disease and inherited disease, tumour, prenatal and postnatal care.Yet the gene index formula of PCR amplification mode is too in sensitivity, and 20 powers of template 2 just approximately increase 1,000,000 times.The need to be resolved hurrily false positive problem of amplification gene product recontaminate of clinical application.General at present by independent PCR Lab, the Bechtop of uv irradiating uses disposable glove and disposable filtering Tip head to control; Further also can prevent recontaminate (Hartley J.L.et.al by adding uridylic glycosidic link in uridylic N-glycosylase cutting replaces dT with dU the PCR product PCR product of degrading, 1993 PCR Methods App1.3:s10-s14), but can only cut the degraded most of PCR product; These measures are difficult in full force and effect for highly sensitive PCR.
Summary of the invention
Detect easily pollution, the deficiency that false positive is high in order to overcome PCR.(System Substitute Polymerase Chain Reaction ssPCR), evades the recontaminate of pcr amplification product by displacement PCR work system to the invention provides a kind of systemic displacement polymerase lymerase chain reaction.
Systemic displacement polymerase lymerase chain reaction, it is characterized in that hybridization by the part complementary sequence, convert the amplification of PCR to be measured to comprise that a cover is above indication PCR system amplification, the amplification of described every cover indication PCR system be the indication template that has nothing to do with template to be measured in the formed hybridization complementary sequence of different zones reservation queue, the gene order of described indication template be the gene order irrelevant with template to be measured (otherwise the 6-8base base is above consecutive identical for relevant. have nothing to do).
Described template to be measured is double-stranded DNA, single stranded RNA or DNA-RNA heteroduplex, and described single stranded RNA comprises mRNA, and described template reservation queue length to be measured is 20-200bp.
Described template reservation queue length to be measured is preferably 30-50bp.
Described indication template is a double-stranded DNA, and sequence length is 80-1000bp.
Described indication template sequence length is preferably 80-150bp.
This reaction also comprises fluorescent molecular bacon, and described fluorescent molecular bacon sequence and template reservation queue to be measured are hybridized or hybridized with the indication template sequence.
The present invention is according to existing P CR system, having designed a kind of new polymerase chain reaction,PCR approach is systemic displacement polymerase lymerase chain reaction (ssPCR) (see figure 1), include tens of covers in this system and indicate the PCR system, replace PCR system works to be measured with indication PCR system.The principle of systemic displacement polymerase lymerase chain reaction and operate as follows:
Gene with sample to be measured is a template to be measured; Choose one section irrelevant gene order (about 80-150bp) as indication template 1, the irrelevant sequence of another section is indication template 2 ... indicate template 3 by that analogy, indication template 4 ... or the like.Template to be measured is except that staying a bit of sequence (30-50bp) to be replaced as the indication template sequence as most sequences the hybridization reservation queue.The hybridization sequences of the 30-50bp that just indicates template complete sequence and template to be measured reservation of pcr amplification.Every cover indicates the PCR system to choose template different zones to be measured as reservation queue, and the reservation queue that promptly every cover indication PCR chooses is mutually different.So the gene order of every cover indication PCR system be have nothing in common with each other fully, separate.
The conservative sequence that does not have a three-dimensional arrangement that template to be measured is chosen a series of long 30-50bp according to the length difference is as keeping hybridization sequences, reservation queue 1 corresponding indication template 1, and reservation queue 2 corresponding indication templates 2 ... by that analogy, or the like.Each reservation queue is divided into the left-half L and the right half part R of disconnection again.Right half part R sequence (with the sense strand sequence) 3, end is added in indication template 5 ' the end 20bp synthetic indication in sequence front template amplification 5 ' end primer, and left side sequence (with the antisense strand sequence) 3 ' end is added in indication template 3 ' the end 20bp synthetic indication in sequence back template amplification 3 ' end primer.With this to primer with generate the indication template that two ends comprise part template reservation queue to be measured with the indication template of the flat terminal irrelevant sequence of pfu enzymatic amplification and add head and the tail DNA, and with PCR product purification column purification.
Template to be measured-indication template hybridization ligase enzyme reaction:
The sample hybridization to be measured of indication template PCR and purifying, then add the end sequence hybridization of head and the tail DNA two if any positive template by its reservation queue and indication template, make indication template both sides 5 ' terminal and 3 ' terminal because of in conjunction with template hybridization sequences to be measured tandem array mutually, and repair breach and generate ring-type through Taq or T4 ligase enzyme and indicate template.And the flat terminal joint efficiency of the head and the tail of the two strands indication template PCR chain of hybridization is low too many than the breach remediation efficiency of strand in the two strands, and almost is suppressed entirely because of the double-stranded Oligo oligomer that adds the irrelevant sequence of excessive flush end 8-16bp.The indication template that the result has only the positive sample template to have hybridization sequences to help could form cyclic DNA, and then only there is linear indication template DNA in negative sample.
Ring-type indication template inverse PCR:
As work indication PCR primer, the existence of template to be measured and what the oppositely amplification circular template that stretches out indicate indirectly with the sequence of indication template middle.But not circular template DNA is then separated and can not increase in oppositely.The PCR product is analyzed or quantitative fluorescence analysis with the Agarose gel detection.
Systemic displacement polymerase lymerase chain reaction of the present invention can be applicable in point mutation and the big fragment variation detection.
Testing gene sub-fraction sequence adds head and the tail DNA both-side ends sequence hybridization and through the T4 ligase enzyme it is joined end to end with the indication template, oppositely template is indicated in amplification again, hybridization must the complementary coupling of sequence could connect and increase, by the sequence at indication template DNA head and the tail two ends is set, be suitable for the variation that detects gene, comprise the detection of point mutation and big fragment variation.
Operating process:
(1) purifying of sample to be measured:
(1) purifying of dna sample:
The extracting of equivalent phenol-chloroform, commercial DNA purification column purifying (detailed step is undertaken by the Qiagen specification sheets)
1): add the 100-200ul sample adds equivalent in 1.5ml EP pipe phenol/chloroform/primary isoamyl alcohol (25: 24: 1) extracting, vortex oscillation, centrifugal 5 minutes the most at a high speed of desk centrifuge.
2): supernatant 100-200ul is transferred in the new EP pipe, adds equal amounts of chloroform, and vibration is centrifugal.
3): on reset and add 4 times Qiagen binding buffer liquid and move to purification column, lavation buffer solution is washed post twice, adds 50uldH
2The O wash-out is collected the sample of purifying.
(2) purifying of RNA sample:
The guanidinium isothiocyanate single stage method is extracted total RNA (Chomczynski, P.et, al.1987 Anal.Biochem.Vol 162,156).
Sample adds Trizole (the 1ml 4M guanidinium isothiocyanate of 1ml in the EP pipe, 1ml phenol, 0.1ml sex change liquid cracking 2M sodium-acetate PH4.0), strong vortex oscillation or aspirate repeatedly with syringe needle, add 200ul chloroform vibration again, centrifugal 5 minutes, get and reset and add equivalent 0.5ml Virahol and put-20 ℃ of centrifugations again in 2 hours, 70% washing with alcohol once adds the dH that 50ul DEPC handles
2The O dissolving.
Oligo (dT) paramagnetic beads purified mRNA: generally there is no need purified mRNA, the template purer as needs undertaken by the Promega specification sheets.
(2) the indication template adds the preparation of head and the tail DNA PCR:
A) synthetic indication PCR primer:
5, the end primer: template at first to be measured keeps hybridization sequences right half part sense strand 15-25base, adds the 20base sense strand sequence that indication template 5 ' end begins most again.
3, the end primer: template at first to be measured keeps hybridization sequences left-half antisense strand 15-25base, adds the 20base antisense strand sequence that indication template 3 ' end begins most again.
B) pcr amplification indication template is also with commercial PCR product purification column purification.
Irrelevant sequence indication DNA 1ul
5 ' end indication primer Primer (5uM) 1ul
3 ' end indication primer Primer (5uM) 1ul
10×pfu?buffer 5ul
10mM?dNTP 1ul
pfu 1ul
dH
2O 40ul
50ul
95 ℃ of sex change 5 minutes, 25 circulations, 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 30 seconds.25 the circulation back 72 ℃ 10 minutes.
Qiagen PCR product purification test kit purifying.
(3) the double-stranded Oligo oligomer that suppresses of synthetic flush end:
Blast search searches one section and has nothing to do ((consecutive identical for relevant more than the 4base base with template to be measured and indication DNA, otherwise irrelevant) short sequence, synthetic one section 8-16base strand Oligo, one section of resynthesis is the 8-16base strand Oligo of the complementary antisense strand of sequence with it, double-stranded Oligo (100uM) mixes, 90 ℃ were heated 5 minutes, and were cooled to room temperature storage.
(4) synthetic inverse PCR primer:
Get the long sequence of the about 40bp in indication DNA middle, the long sense strand sequence of right half part 20base is held the inverse PCR primer as 5 ', and the antisense strand of left-half 20base length is as 3 ' end inverse PCR primer.
(5) sample to be measured adds head and the tail DNA hybridization with the indication template:
The sample to be tested 2ul of purifying
The indication template of purifying adds head and the tail DNA 10ul
T4 ligase enzyme damping fluid 5ul
Suppress Oligo (100uM) 1ul
dH
2O 32ul
50ul
95 ℃ of sex change 5 minutes again 55 ℃ 10 minutes.
(6) ligase enzyme reaction:
Get above-mentioned (five) hybridization reaction solution 50ul and add T4 ligase enzyme 1ul, 16 ℃ of incubations 10 minutes-2 hours.
(7) inverse PCR:
Hybridization ligase enzyme reaction solution 2ul
(or purifying sample to be tested 1ul+ indication template adds head and the tail DNA 9ul)
5 ' end reverse primer Primer 1ul
3 ' end reverse primer Primer 1ul
10mM?dNTP 1ul
10×Taq?buffer 5ul
Taq 1ul
dH
2O 39ul/30ul
50ul
94 ℃ of sex change 5 minutes, 20-30 circulation, 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 30 seconds.25 the circulation back 72 ℃ 10 minutes.
If this step (seven) adds the 1ul thermostable ligase again and suppresses Oligo, can save step (five), the reaction of (six) hybridization ligase enzyme.
(8) PCR product analysis:
1.5% gelose gel agarose electrophoretic analysis or add the 1ul fluorescent molecular bacon in inverse PCR liquid, the fluorescent PCR amplification detects in real time.
Systemic displacement polymerase lymerase chain reaction of the present invention (ssPCR) advantage:
(1) can avoid the recontaminate of pcr amplification product, the limited PCR several times of sample to be measured converts the mutually different indication of tens of covers PCR system to and uses by turns.Polluted transducer set work once cover.
(2) simplify the RNA Molecular Detection, but RNA does not need reverse transcription to become just direct replacement one-tenth indication DNA cloning work of cDNA, is particularly suitable for the Molecular Detection of a large amount of RNA viruses.
(3) especially be fit to the transgenation inherited disease and detect, because the sample reservation queue will mate fully and could repair with the breach both sides that the indication template adds head and the tail DNA hybridization.If the indication template adds head and the tail DNA 5 ' end and 3 ' and holds and be set to the gene that mutant nucleotide sequence just can only increase and suddenly change.The ligase chain reaction LCR technology that detects transgenation is sensitiveer, easy.
(4) than Southern and Northern Blot molecular hybridization sensitivity, easy: convert molecular mark probe hybridization detection to indication PCR, it is sensitiveer to increase, and has saved operations such as electrophoresis, transfer, easier.
Description of drawings
Fig. 1 systemic displacement polymerase lymerase chain reaction synoptic diagram of the present invention:
(1) template to be measured: the long straight line in synoptic diagram left side is represented template, and thick line is sense strand or RNA, and fine rule is an antisense strand.
(2) indication template: on behalf of a cover indication template, the dicyclo that right figure go up to disconnect add DNA from beginning to end, comprise that loop wire represents one section sequence that has nothing to do with testing gene and two ends with template complementary reservation queue to be measured (short lines part).
(3) positive reaction is represented in the left side: template to be measured adds the hybridization of head and the tail dna sequence dna with the indication template and repairs breach after T4 is connected, and forms ring-type indication DNA, and is reversed pcr amplification.
(4) negative reaction is represented on the right side: breach indication DNA is suppressed by the double-stranded Oligo competition of excessive flush end, can not be by the cyclisation of T4 ligase enzyme, and not amplification.
The amplification of Fig. 2 the present invention in hepatitis B HBs Ag gene test
Wherein, 1 negative contrast, 2 is positive, and all the other are sample.
Embodiment
The present invention is described in further detail below in conjunction with embodiment.
Embodiment. hepatitis B HBsAg gene test:
(1) purifying of clinical 11 routine specimen dnas (being undertaken) by the Qiagen specification sheets:
1): add the 100-200ul sample adds equivalent in 1.5ml EP pipe phenol/chloroform/primary isoamyl alcohol (25: 24: 1) extracting, vortex oscillation, centrifugal 5 minutes the most at a high speed of desk centrifuge.
2): supernatant 100-200ul is transferred in the new EP pipe, adds equal amounts of chloroform, and vibration is centrifugal.
3): on reset and add 4 times Qiagen binding buffer liquid and move to purification column, lavation buffer solution is washed post twice, adds 50ul dH
2The O wash-out is collected the sample of purifying.
(2) the indication template adds the preparation of head and the tail DNA PCR:
1) chooses hepatitis B virus HBs Ag aa124-138 gene order
5’-gc?acg?att?cct?gct?caa?gga?acc?tct?atg?ttt?ccc?tct?tg-3’
3’-cg?tgc?taa?ggt?cga?gtt?cct?tg-5’
As reservation queue.
2) choose the initial 100bp sequence of schistosomicide L-glutamic acid S transferring enzyme gst gene:
5’-cctatac?taggttattg?gaaaattaag?ggccttgtgc?aacccactcg?acttcttttg?gaatatcttg?aagaaaaata?tgaagagcatttgtatgagc?gcg-3’
As the indication template sequence.
3) synthetic indication template 5 ' end primer: template reservation queue right half part sense strand 18base to be measured adds the 18base sense strand sequence that indication template 5 ' end begins most.
5’-c?tct?atg?ttt?ccc?tct?tg?cctatac?taggttattg?g-3’
4) synthetic indication template 3 ' end primer: template reservation queue left-half antisense strand 22 base to be measured add the 19 base antisense strand sequences that indication template 3 ' end begins most.
5’-ft?acc?ttg?agc?tgg?aat?cgt?gc?cgc?gctcatacaa?atgctc-3’
5) pcr amplification indication tailing template is also with commercial PCR product purification column purification.
PGEX-2T plasmid (0.5ug/ul) 1ul
5 ' end indication primer Primer (5uM) 1ul
3 ' end indication primer Primer (5uM) 1ul
10×pfu?buffer 5ul
10mM?dNTP 1ul
pfu 1ul
dH
2O 40ul
50ul
95 ℃ of sex change 5 minutes, 25 circulations, 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 30 seconds.25 the circulation back 72 ℃ 10 minutes.
PCR product 50ul adds 4 times 200ul Qiagen binding buffer liquid and moves to purification column, and lavation buffer solution is washed post twice, adds 50ul dH
2The O wash-out is collected the indication PCR DNA of purifying.
(3) the double-stranded Oligo oligomer that suppresses of synthetic flush end:
Get one section artificial short sequence 5 '-GCGGTACCGG-3 ' that all has nothing to do with template to be measured and indication DNA, synthetic one section strand Oligo, one section of resynthesis is 5 '-CCGGTACCGC-3 ' strand Oligo of the complementary antisense strand of sequence with it, double-stranded Oligo (100uM) mixes, 90 ℃ were heated 5 minutes, and were cooled to room temperature storage.
(4) synthetic inverse PCR primer:
Get the sequence 5 '-gtgc aacccactcg acttcttttg gaatatcttg-3 ' of the initial 100bp indication of GST DNA middle
3’-cacg?ttgggtgagc?tgaag-5’
The long sense strand sequence of right half part 19base is held the inverse PCR primer as 5 ': 5 '-cttcttttg gaatatcttg-3 ';
The long antisense strand of left-half 19base is held the inverse PCR primer as 3 ': 5 '-gaagt cgagtgggtt gcac-3 '.
(5) sample to be measured adds head and the tail DNA hybridization with the indication template:
The hepatitis B sample 2ul to be measured of purifying
The indication template of purifying adds head and the tail DNA 10ul
T4 ligase enzyme damping fluid 5ul
Suppress Oligo (100uM) 1ul
dH
2O 32ul
50ul
95 ℃ of sex change 5 minutes again 55 ℃ 10 minutes.
(6) ligase enzyme reaction:
Get above-mentioned (5) hybridization reaction solution 50ul and add T4 ligase enzyme 1ul, 45 ℃/16 ℃ incubation 1-2 hour.
(7) inverse PCR:
Hybridization ligase enzyme reaction solution 2ul
5 ' end reverse primer Primer 1ul
3 ' end reverse primer Primer 1ul
10mM?dNTP 1ul
10×Taqbuffer 5ul
Taq 1ul
dH
2O 39ul
50ul
94 ℃ of sex change 5 minutes, 20-30 circulation, 94 ℃ 30 seconds, 52 ℃ 30 seconds, 72 ℃ 30 seconds.25 the circulation back 72 ℃ 10 minutes.
(8) PCR product analysis:
The PCR product the results are shown in accompanying drawing 2 through 1.8% gelose gel agarose electrophoretic analysis, and experimental result is 3,6,9,11,12, No. 13 positive amplifications of sample.
Experiment contrast: get above-mentioned 11 routine clinical blood samples, detect 6 routine anti-HBs Ag antibody positives through Xiamen Kehua's ELISA antibody assay kit, 5 examples are negative, the results are shown in Table 1.No. 1 negative contrast, No. 2 positive contrasts.All the other are experimental specimen.
1 2 3 4 5 6 7 8 9 10 11 12
A?0.005?1.853?1.241?0.012?0.025?2.213?0.053?0.004?0.876?0.022?0.785?0.941
B?1.235?0.002?0.000?0.000?0.000?0.000?0.000?0.000?0.000?0.000?0.000?0.000
From above-mentioned experimental result, accompanying drawing 2 is consistent with subordinate list one ELISA detected result.
Claims (7)
1. systemic displacement polymerase lymerase chain reaction, it is characterized in that by template to be measured-indication template hybridization ligase enzyme reaction, pcr amplification to be measured is replaced as the amplification of the indication PCR system that comprises that a cover is above, comprise the steps that (1) will add top templet gene reservation queue formation to be measured indication template with the indication template two ends that template to be measured has nothing to do and add head and the tail DNA; (2) indication template utilization adds the complementary hybridization of different zones reservation queue in head and the tail and the template to be measured, and (3) connect indication template head and the tail breach by T4 or the reaction of Taq ligase enzyme and form ring-type and indicate template; (4) by inverse PCR amplification ring-type indication template.
2. systemic displacement polymerase lymerase chain reaction according to claim 1, described template to be measured is double-stranded DNA, single stranded RNA or DNA-RNA heteroduplex, and described single stranded RNA comprises mRNA, and described template reservation queue length to be measured is 20-200bp.
3. systemic displacement polymerase lymerase chain reaction according to claim 2, described template reservation queue length to be measured is 30-50bp.
4. systemic displacement polymerase lymerase chain reaction according to claim 1, described indication template is a double-stranded DNA, sequence length is 80-1000bp.
5. systemic displacement polymerase lymerase chain reaction according to claim 4, described indication template sequence length is 80-150bp.
6. systemic displacement polymerase lymerase chain reaction according to claim 1 is characterized in that this reaction also comprises fluorescent molecular bacon, and described fluorescent molecular bacon sequence and template reservation queue to be measured are hybridized or hybridized with the indication template sequence.
7. the application of the arbitrary described systemic displacement polymerase lymerase chain reaction of claim 1-6 in point mutation and big fragment variation detection.
Priority Applications (5)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007101078287A CN100554435C (en) | 2007-05-17 | 2007-05-17 | Systemic displacement polymerase lymerase chain reaction |
| PCT/CN2007/071173 WO2008141514A1 (en) | 2007-05-17 | 2007-12-05 | System substitute pcr |
| EP08734280A EP2167682A4 (en) | 2007-05-17 | 2008-05-09 | System substitute pcr |
| US12/600,063 US20100209918A1 (en) | 2007-05-17 | 2008-05-09 | System substitute pcr |
| PCT/CN2008/070928 WO2008141561A1 (en) | 2007-05-17 | 2008-05-09 | System substitute pcr |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2007101078287A CN100554435C (en) | 2007-05-17 | 2007-05-17 | Systemic displacement polymerase lymerase chain reaction |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101063159A CN101063159A (en) | 2007-10-31 |
| CN100554435C true CN100554435C (en) | 2009-10-28 |
Family
ID=38964441
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2007101078287A Expired - Fee Related CN100554435C (en) | 2007-05-17 | 2007-05-17 | Systemic displacement polymerase lymerase chain reaction |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100554435C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101250581B (en) * | 2007-11-02 | 2011-05-04 | 北京万达因生物医学技术有限责任公司 | Displacement amplification method for detecting hepatitis B viruse P gene YMDD variation |
| WO2008141514A1 (en) * | 2007-05-17 | 2008-11-27 | Wondergen Bio-Medicine Technology Co., Ltd. | System substitute pcr |
| CN101831491A (en) * | 2009-03-11 | 2010-09-15 | 北京泰格瑞分子检验有限公司 | System displacement multiple gene magnification technology |
-
2007
- 2007-05-17 CN CNB2007101078287A patent/CN100554435C/en not_active Expired - Fee Related
Non-Patent Citations (2)
| Title |
|---|
| The ligase chain reaction in a PCR world. F Barany.Genome Research,Vol.1 . 1991 |
| The ligase chain reaction in a PCR world. F Barany.Genome Research,Vol.1 . 1991 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101063159A (en) | 2007-10-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US8232058B2 (en) | Multiplex detection of respiratory pathogens | |
| JP3744548B2 (en) | Nucleic acid primers and probes for detecting HIV-1 and HIV-2 | |
| JP5740112B2 (en) | Nucleic acid primer set for LAMP amplification for coronavirus | |
| AU2023200928B2 (en) | Compositions and methods for detecting HEV nucleic acid | |
| CN111979307B (en) | Targeted sequencing method for detecting gene fusion | |
| CN1329673A (en) | Multi-local genomic analysis by method of improved cycle sequencing | |
| EP1713925B1 (en) | Primers and probes for the detection of hiv | |
| CN101638684A (en) | Strand substitute polymerase chain reaction | |
| CN100554435C (en) | Systemic displacement polymerase lymerase chain reaction | |
| EP1620556A1 (en) | Nucleic acid detection | |
| WO2009087685A2 (en) | Method for detection of hepatitis nucleic acid and uses thereof | |
| CN106319079B (en) | Method for detecting 22q11.2 copy number loss | |
| CN102399871B (en) | Heat-resisting isothermal nucleic acid detection reagent as well as kit and detection method thereof | |
| JP5722521B2 (en) | Reagent and method for detecting gonococci | |
| JP2013520987A (en) | Nucleic acid detection method through promotion of formation of branched DNA complex | |
| CN101250581B (en) | Displacement amplification method for detecting hepatitis B viruse P gene YMDD variation | |
| CN112662822B (en) | Primer group, reagent and method for detecting feline parvovirus based on polymerase helix reaction | |
| EP1697541A2 (en) | Reagents and methods for detecting neisseria gonorrhoeae | |
| WO2003057927A2 (en) | Detection of human papillomavirus e6 mrna | |
| CN1274847A (en) | Method of making marker signal amplifying probe | |
| JP2008154566A (en) | Nucleic acid primer set for lamp amplification for detecting hepatitis e virus | |
| CN100390299C (en) | Hepatitis B virus gene parting method | |
| CN105400877B (en) | Genome SNP locus detection method based on immune enzyme-linked reaction | |
| US20050089853A1 (en) | Method | |
| KR101566402B1 (en) | Diagnostic Multiplex Kit for White Spot Syndrome Virus Using Microarray Chip |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20091028 Termination date: 20180517 |