CN100535113C - Small-interfering RNA inhibiting gene expression of GATA-3 and its coding gene and use - Google Patents
Small-interfering RNA inhibiting gene expression of GATA-3 and its coding gene and use Download PDFInfo
- Publication number
- CN100535113C CN100535113C CNB2006101443587A CN200610144358A CN100535113C CN 100535113 C CN100535113 C CN 100535113C CN B2006101443587 A CNB2006101443587 A CN B2006101443587A CN 200610144358 A CN200610144358 A CN 200610144358A CN 100535113 C CN100535113 C CN 100535113C
- Authority
- CN
- China
- Prior art keywords
- sequence
- gata
- gene
- sirna
- cell
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention discloses a little interference RNA and coding gene and application in the allergic rhinitis drug to inhibit GATA-3 gene expression, which is characterized by the following: possessing at least one double-chain RNA sequence in the 1) and 2), wherein the 1) positive chain possesses nucleotide sequence in the sequence list 1 and the negative chain possesses nucleotide sequence in the sequence list 2; the 2) positive chain possesses nucleotide sequence in the sequence list 3 and the negative chain possesses nucleotide sequence in the sequence list 4. The invention can inhibit GATA-3 gene expression, which is key component in the drug.
Description
Technical field
The present invention relates to siRNA and encoding gene thereof and application, particularly relate to the siRNA and encoding gene and its application in preparation treating allergic rhinitis medicine that suppress GATA-3 genetic expression.
Background technology
Rhinallergosis have a strong impact on people's quality of life, and global sickness rate is ascendant trend year by year.Though medicines such as traditional antihistaminic, glucocorticosteroid and leukotriene antagonist have certain curative effect to this disease, need take for a long time.Along with the rhinallergosis Study on Pathogenesis deepens continuously, the researchist find rhinallergosis be since Th1/Th2 cell and cytokine regulate unbalance due to, wherein, GATA-3 is a crucial transcription factor that is positioned at Th2 immunological network central position, it causes inflammatory reaction (the Pai SY of nasal mucosa by the hyperpolarization that stimulates the Th2 cell, TruittML, Ho IC.GATA-3 deficiency abrogates the development and maintenance of Thelper type 2cell.Proc Narl Acad Sci USA.2004; 101 (7): 1993-8.).
RNA perturbation technique (RNA interference, be called for short RNAi) be the biotechnology of specificity degraded target gene under the mediation of little double-stranded RNA (dsRNA) molecule, can make the genetic expression silence, reach the effect of antagonism target gene function, thereby, have good biology (gene) treatment potentiality.Length is the siRNA (siRNA of 21-22nt, small interfering RNA) mediation specificity disturbance reponse, only mRNA (Elbashir, the S.M. of degraded and its length complementary specific gene, Harborth, J., Lendeckel, W.et al., Duplexes of21-nucleotide RNAs mediate RNA interference in cultured mammalian cells, Nature, 2001,411 (6836): 494).The RNAi technology receives much concern having great potential aspect the disease treatment because of it.The RNA perturbation technique provides easy relatively fast approach for systematically suppressing RNA molecule synthesis albumen, thereby provides important thinking for the control of disease.Therefore, suppressing Th2 idiosyncratic transcription factor GATA-3 expression of gene by exploring on the modification of mRNA or translation skill, can be the new thinking of direction developing of exploring rhinallergosis pharmacological agent.
Summary of the invention
The siRNA that the purpose of this invention is to provide the inhibition GATA-3 genetic expression of carrier target.
The siRNA of inhibition GATA-3 provided by the present invention genetic expression is one of following double-stranded RNA sequence:
1) positive-sense strand is the sequence 1 in the sequence table, and antisense strand is the double-stranded RNA sequence of the sequence 2 in the sequence table;
2) positive-sense strand is the sequence 3 in the sequence table, and antisense strand is the double-stranded RNA sequence of the sequence 4 in the sequence table.
To have 1) double-stranded RNA sequence called after siRNA-1,338-358 position sequence 5 '-AACAUCGAUGGUCAAGGCAAC-3 ' complementation of its antisense strand and GATA-3 gene mRNA.Sequence 1 is by 21 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 2 is by 21 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right.
To have 2) double-stranded RNA sequence called after siRNA-2,717-737 the position sequence 5 '-AAGAUGAGAAAGAGUGCCUCA-3 ' of its antisense strand and GATA-3 gene mRNA determines complementary.Sequence 3 is by 21 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 4 is by 21 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right.
The encoding gene of the siRNA molecule of above-mentioned inhibition GATA-3 genetic expression can have following 1) and 2) at least one double chain nucleotide sequence:
1) sense strand (positive-sense strand) (not making the DNA chain of template) has the nucleotide sequence of sequence 5 in the sequence table or the nucleotide sequence of the dna sequence dna hybridization that can limit with sequence in the sequence table 5 under the rigorous condition of height; Antisense strand (making the DNA chain of template) has the nucleotide sequence of sequence 6 in the sequence table or the nucleotide sequence of the dna sequence dna hybridization that can limit with sequence in the sequence table 6 under the rigorous condition of height;
2) sense strand (positive-sense strand) (not making the DNA chain of template) has the nucleotide sequence of sequence 7 in the sequence table or the nucleotide sequence of the dna sequence dna hybridization that can limit with sequence in the sequence table 7 under the rigorous condition of height; Antisense strand (making the DNA chain of template) has the nucleotide sequence of sequence 8 in the sequence table or the nucleotide sequence of the dna sequence dna hybridization that can limit with sequence in the sequence table 8 under the rigorous condition of height.
The rigorous condition of described height can be 0.1 * SSPE (or 0.1 * SSC), in the solution of 0.1%SDS, under 65 ℃, hybridize and wash film.
To have 1) double chain oligonucleotide sequence encoding unnamed gene be siDNA1, the coding siRNA-1.Sequence 5 is by 63 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 6 is by 63 based compositions in the sequence table, and the direction of sequence is 3 ' end → 5 ' end from left to right.
To have 2) double chain oligonucleotide sequence encoding unnamed gene be siDNA2, the coding siRNA-2.Sequence 7 is by 64 based compositions in the sequence table, and the direction of sequence is 5 ' end → 3 ' end from left to right; Sequence 8 is by 64 based compositions in the sequence table, and the direction of sequence is 3 ' end → 5 ' end from left to right.
The expression vector, transgenic cell line and the host bacterium that contain the siRNA encoding gene of above-mentioned inhibition GATA-3 genetic expression all belong to protection scope of the present invention.
The invention provides the siRNA that can produce interference effect to the GATA-3 expression of gene.Transfection has the mouse hypertrophy cell oncocyte system (P815 cell) of siRNA encoding gene of the present invention and the expression of GATA-3 gene on mRNA and protein level in the mice spleen T lymphocyte all significantly to be suppressed.The present invention lays a good foundation for the functional study of GATA-3, for the further effect of research GATA-3 in the mechanism of causing a disease of rhinallergosis provides new platform, also provide new thinking and method simultaneously for prevention and treatment rhinallergosis and relative disease thereof.The present invention has the potential using value in prevention of the specificity of rhinallergosis and treatment, particularly will play a significant role in preparation with the siRNA that suppresses GATA-3 genetic expression or the expression vector that carries the siRNA encoding gene of described inhibition GATA-3 genetic expression is the medicine of activeconstituents.
Below in conjunction with specific embodiment the present invention is described in further details.
Description of drawings
Fig. 1 is for carrying the BamH I and the Hind III double digestion qualification result of the recombinant plasmid of siDNA1, siDNA2 and siDNA3 respectively
Fig. 2 is the observations of the positive transfectional cell of mouse hypertrophy cell oncocyte P815 under fluorescent microscope
Fig. 3 is the RT-PCR detected result that the GATA-3 target gene suppresses efficient in the positive transfectional cell of siRNA1, siRNA2 and siRNA3 at transcriptional level
Fig. 4 is the Western blot detected result that the GATA-3 target gene suppresses efficient in the positive transfectional cell of siRNA1, siRNA2 and siRNA3 at protein level
Before the positive transfection T of Fig. 5 cell polarization and the microscopic examination result after the polarization
Fig. 6 is the RT-PCR detected result that the GATA-3 target gene suppresses efficient in the positive transfection polarization of siRNA1 and the siRNA2 T cell at transcriptional level
Fig. 7 is the Western blot detected result that the GATA-3 target gene suppresses efficient in the positive transfection polarization of siRNA1 and the siRNA2 T cell at protein level
Fig. 8 is for interfering the RT-PCR detected result of GATA-3 expression of gene to the influence of T cell Th2 function of polarization
Embodiment
Method therefor is ordinary method if no special instructions among the following embodiment, and concrete steps can be referring to " Molecular Cloning:A Laboratory Manual " (Sambrook, J., Russell, David W., Molecular Cloning:A Laboratory Manual, 3
RdEdition, 2001, NY, Cold SpringHarbor).The primer and dna sequence dna are synthetic by Beijing AudioCodes.
One, suppresses the design of the siRNA of GATA-3 genetic expression
At first on GenBank, find the open reading frame total length (ORF of mouse GATA-3 gene, GenBank number: NM_008091), carrier pSilencer2.1U6neo at the Ambion company that selects for use, RNAi principle of design (Elbashir SM according to Elbashir, Harborth J, Lendecke 1W, et al.Duplexes of21-nucleotide RNAs mediate RNA interference In culturedMammalian cells.Nature.2001; 411:494-498.), simultaneously by the online design of http://www.ambion.com/techlib/misc/siRNA_finder.htmL, 3 target position of final selection, 3 segment length that lay respectively at GATA-3 gene mRNA sequence transcription initiation site aug downstream are the sequence of 21bp, the siRNA difference called after siRNA-1 (sequence 1 and sequence 2 in the sequence table) that 3 couple who obtains is suppressed the GATA-3 protein gene expression, siRNA-2 (sequence 3 and sequence 4 in the sequence table) and siRNA-3 (sequence 9 and sequence 10 in the sequence table), siRNA-1 acts on 338-358 position sequence 5 '-aacaucgauggucaaggcaac-3 ' of GATA-3mRNA, siRNA-2 acts on 717-737 position sequence 5 '-aagaugagaaagagugccuca-3 ' of GATA-3mRNA, and siRNA-3 acts on 1232-1252 position sequence 5 '-agucaggggucuguuaauauu-3 ' of GATA-3mRNA.
Two, the structure that suppresses the RNAi interference carrier of GATA-3 genetic expression
1, according to target sequence that siRNA-1, siRNA-2 and siRNA-3 acted on and the service requirements of carrier pSilencer2.1U6neo (Ambion company), design can produce the siDNA sequence of siRNA-1, siRNA-2 and siRNA-3, difference called after siDNA1, siDNA2 and siDNA3, concrete sequence following (the underscore base sequence is the target sequence at GATA-3mRNA):
The siDNA1 positive-sense strand:
5 '-gatccgcatcgatggtcaaggcaacttcaagaga
GttgccttgaccatcgatgttTtttggaaa-3 ' (sequence 5)
The siDNA1 antisense strand:
3 '-gcgtagctaccagttccgttgaagttctct
CaacggaactggtagctacaaAaaaccttttcga-5 ' (sequence 6)
The siDNA2 positive-sense strand:
5 '-gatccgatgagaaagagtgcctcattcaagaga
TgaggcactctttctcatcttTtttggaaa-3 ' (sequence 7)
The siDNA2 antisense strand:
3 '-gctactctttctcacggagtaagttctct
ActccgtgagaaagagtagaaAaaaccttttcga-5 ' (sequence 8)
The siDNA3 positive-sense strand:
5 '-gatccgtattaacagacccctgactttcaagaga
AgtcaggggtctgttaatattTtttggaaa-3 ' (sequence 11)
The siDNA3 antisense strand:
3 '-gcataattgtctggggactgaaagttctct
TcagtccccagacaattataaAaaaccttttcga-5 ' (sequence 12).
2, with siDNA1, after the positive-sense strand of siDNA2 and siDNA3 and antisense strand are annealed in twos, under the effect of T4DNA ligase enzyme, be connected with the linearized vector pSilencer2.1U6neo of Hind III double digestion respectively with through restriction enzyme BamHI again, connect product with three kinds and distinguish transformed into escherichia coli DH5 α competent cell again, the screening positive monoclonal, the upgrading grain, carrying out double digestion with restriction enzyme BamHI and Hind III identifies, qualification result is (swimming lane M:DNA Marker DL15000 as shown in Figure 1, swimming lane 1: the recombinant plasmid before enzyme is cut, swimming lane 2: the recombinant plasmid behind the double digestion), size before three kinds of recombinant plasmid enzymes are cut is about 4500bp, behind double digestion, demonstrate different bands, show that cyclic plasmid forms linearizing plasmid after enzyme is cut, conform to expected results, again its method with order-checking is done further evaluation, sequencing result shows insertion sequence (siDNA1, siDNA2 and siDNA3) correct, proof obtained insertion sequence and position thereof all correct respectively with siRNA1, siRNA2 and siRNA3 are the RNAi carrier of the GATA-3 gene of target sequence, to with 5 '-aacaucgauggucaaggcaac-3 ' the RNAi carrier called after pU6-s im1 of the GATA-3 gene of target sequence, to be the RNAi carrier called after pU6-sim2 of the GATA-3 gene of target sequence with 5 '-aagaugagaaagagugc cuca-3 ', will be the RNAi carrier called after pU6-sim3 of the GATA-3 gene of target sequence with 5 '-agucaggggucuguuaauauu-3 '.
Three, utilizing the mouse hypertrophy cell oncocyte is that P815 detects siRNA1, siRNA2 and the siRNA3 interference effect to the GATA-3 gene
1, transfection mouse hypertrophy cell oncocyte is P815
RNAi carrier pU6-sim1, pU6-sim2 that step 2 is made up at siRNA1, siRNA2 and siRNA3 respectively and pU6-sim3 with liposome mediated-method respectively transfection mouse hypertrophy cell oncocyte be the P815 cell, positive transfectional cell is expressed the GFP green fluorescent protein, thereby under fluorescent microscope (blue light illumination), can be observed green fluorescence, (A is the observations of transfectional cell under the simple microscope, and B is the observations of transfectional cell under the fluorescent microscope as shown in Figure 2; Magnification: 200 *), to the positive transfectional cell that screens with following methods analyst siRNA1, siRNA2 and siRNA3 interference effect to the GATA-3 gene.
2, the GATA-3 target gene detects at the RT-PCR that transcriptional level suppresses efficient in the positive transfectional cell of siRNA1, siRNA2 and siRNA3
Total RNA of the positive transfectional cell of extraction step 1 transfection after 48 hours, simultaneously there is derive from plant one section not exist total RNA of the P815 cell of plasmid fragment (pSilencer2.1U6 neo is obtained linearization plasmid after with restriction enzyme BamH I and Hind III double digestion) of homology and the P815 cell that transfection has the pSilencer2.1U6neo empty carrier as negative control with the GATA-3 gene order with transfection, at primer P1 (upstream primer): detecting respectively with the method for RT-PCR under the guiding of 5 '-cggcttcatcctcttctctg-3 ' and P2 (downstream primer): 5 '-cagggatgacatgtgtctgg-3 ', transfection has pU6-sim1, the GATA-3 target gene is at the expression of transcriptional level in the positive transfectional cell of pU6-sim2 and pU6-sim3, with the GAPDH gene is that confidential reference items (detect and are: 5 '-acccagaagactgtggatgg-3 ' and 5 '-cttgctcagtgtccttgctg-3 ') with primer sequence, the PCR reaction conditions is as shown in table 1, and wherein cycle number is made as 23 and 25 respectively.
Table 1RT-PCR reaction conditions
| The PCR reaction process | Temperature | Time |
| Pre-sex change | 94℃ | 5mins |
| Sex change | 94℃ | 45secs |
| Annealing | 56℃ | 45secs |
| Extend | 72℃ | 50secs |
| Cycle number | 23、25 | |
| Extend at last | 72℃ | 8mins |
Cycle number is respectively 23 and 25 RT-PCR detected result (swimming lane M:DNA Marker DL2000 as shown in Figure 3, the positive transfectional cell of swimming lane 1:siRNA1, the positive transfectional cell of swimming lane 2:siRNA2, the positive transfectional cell of swimming lane 3:siRNA3, swimming lane 4: transfection has the one section P815 cell that does not have the plasmid of homology with the GATA-3 gene order that derives from plant, swimming lane 5: transfection has the P815 cell of pSilencer2.1U6 neo empty carrier, the continuous amplification of different cycle numbers as can be seen from Fig. 3, siRNA1 and siRNA2 can effectively suppress the expression of GATA-3mRNA, wherein with the inhibition best results of siRNA1, and siRNA3 does not have the inhibition effect.
3, the GATA-3 target gene detects at the Western blot that protein level suppresses efficient in the positive transfectional cell of siRNA1, siRNA2 and siRNA3
With Western blot method again to siRNA1, the GATA-3 target gene is done further detection in protein level inhibition efficient in the positive transfectional cell of siRNA2 and siRNA3, the one section negative contrast of P815 cell that does not have the plasmid (identical with step 2) of homology with the GATA-3 gene order that derives from plant is arranged with transfection, used one anti-is GATA-3 polyclonal antibody (available from santa cruz company), two anti-are HRP sheep anti-mouse igg (Pierce company), simultaneously with β-Actin albumen be confidential reference items (detect with one anti-be the monoclonal antibody (available from Santa Cruz company) of anti-β-Actin, two to resist be the HRP sheep anti-mouse igg).Detect (swimming lane 1 as shown in Figure 4, the positive transfectional cell of 2:siRNA1, swimming lane 3, the positive transfectional cell of 4:siRNA2, swimming lane 5, the positive transfectional cell of 6:siRNA3, swimming lane 7,8: transfection has the one section P815 cell that does not have the plasmid of homology with the GATA-3 gene order that derives from plant), as can be seen from Figure 4, siRNA1 and siRNA2 can effectively suppress the expression of target protein GATA-3, wherein with the inhibition best results of siRNA1, and siRNA3 does not have the inhibition effect, and is consistent with the detected result of step 2, proves that siRNA1 and siRNA2 are for suppressing the siRNA of GATA-3 genetic expression.
Four, utilize mice spleen T lymphocyte detection siRNA1 and siRNA2 interference effect to the GATA-3 gene
1, transfection mice spleen T lymphocyte and polarization thereof are cultivated
RNAi carrier pU6-sim1 and pU6-sim2 are distinguished transfection mice spleen T lymphocyte (being called for short the T cell) with liposome mediated-method, the positive transfection T cell of screening after 6 hours, shown in the figure A among Fig. 5 (magnification: 40 *), in substratum, add 20mg/mL concanavalin A (ConA), 1000U/mL interleukin II (IL-2), 200U/mL interleukin-4 (IL-4) and 1 μ M/mL chicken ovalbumin (OVA) stimulate positive transfection T cell proliferation and the Th2 polarization take place, the T cell that polarizes back 24 hours (magnification: 200 *) shown in the figure B among Fig. 5, after cytokine stimulates, propagation and polarized T cell taking place present the state that beading sample is assembled growth, can grow 5 days in vitro culture.
2, the GATA-3 target gene detects at the RT-PCR that transcriptional level suppresses efficient in the positive transfection polarization of siRNA1 and the siRNA2 T cell
Total RNA of the back 48 hours positive transfection T cell of polarization in the extraction step 1, simultaneously having derive from plant one section with the back 48 hours transfection that polarizes, not have total RNA of the back 48 hours T cell of the T cell of plasmid (identical with step 3) of homology and polarization with the GATA-3 gene order be contrast, with with step 3 in identical method under the guiding of primer P1 and P2, detect transfection respectively and have that the GATA-3 target gene is confidential reference items at the expression of transcriptional level with the GAPDH gene in the positive transfection polarization of pU6-sim1, the pU6-sim2 T cell with the method for RT-PCR.Detected result is (swimming lane M:DNA Marker DL2000 as shown in Figure 6, swimming lane 1: the T cell that polarizes back 48 hours, swimming lane 2: transfection has the one section T cell that does not have the plasmid of homology with the GATA-3 gene order that derives from plant, the positive transfection polarization of swimming lane 3:siRNA2 T cell, the positive transfection polarization of swimming lane 4:siRNA1 T cell), consistent with the RT-PCR detected result of P815 clone in the step 3, siRNA1 and siRNA2 all can effectively suppress the expression of GATA-3mRNA, and wherein the inhibition effect of siRNA1 is better.
3, the GATA-3 target gene detects at the Westernblot that protein level suppresses efficient in the positive transfection polarization of the siRNA1 T cell
With with step 3 in identical Western blot method the more positive transfection T of the siRNA1 cell that polarizes back 48 hours (is had the one section T cell that does not have the plasmid (identical with step 3) of homology with the GATA-3 gene order that derives from plant with the back 48 hours transfection that polarizes, T cell that polarizes back 48 hours and unpolarized T cell are contrast) middle GATA-3 target gene suppresses efficient at protein level and does further detection, is confidential reference items with β-Actin albumen simultaneously.Detect (swimming lane 1: the T cell that polarizes back 48 hours as shown in Figure 7, swimming lane 2: the back 48 hours transfection that polarizes has the one section T cell that does not have the plasmid of homology with the GATA-3 gene order that derives from plant, the positive transfection polarization of swimming lane 3:siRNA1 T cell, swimming lane 4: the T cell does not polarize), consistent with the detected result of step 2, siRNA1 can effectively suppress the expression of target protein GATA-3.
4, RT-PCR detects and interferes the influence of GATA-3 expression of gene to T cell Th2 function of polarization
The variation of IL-5 gene expression dose in pU6-sim1 and pU6-sim2 and the generation Th2 polarized T cell is arranged with the transfection respectively of RT-PCR method detection step 1 acquisition, method is: total RNA of the back 48 hours positive transfection T cell that polarizes in the extraction step 1, simultaneously the one section T cell that does not have the plasmid (identical with step 3) of homology with the GATA-3 gene order that derives from plant is arranged with the back 48 hours transfection that polarizes, the total RNA that reaches the back 48 hours T cell of polarization before the polarization is contrast, on the detection IL-5 gene, the downstream primer sequence is: 5 '-ATGACTGTGCCTCTGTGCCTGGAGC-3 ' and 5 '-CTGTTTTTCCTGGAGTAAACTGGGG-3 ' is confidential reference items with the GAPDH gene.Detected result is (swimming lane M:DNA Marker DL2000 as shown in Figure 8, the positive transfection polarization of swimming lane 1:siRNA1 T cell, the positive transfection polarization of swimming lane 2:siRNA2 T cell, swimming lane 3: transfection has the one section T cell that does not have the plasmid of homology with the GATA-3 gene order that derives from plant, swimming lane 4: the T cell does not polarize, swimming lane 5: the T cell that polarizes back 48 hours), as seen from Figure 8, Th2 polarized T cell does not take place express IL-5 gene (swimming lane 4) hardly, T cell IL-5 genetic expression (swimming lane 5) after the polarization, there is a section of deriving from plant not exist the T cell (swimming lane 3) of the plasmid of homology to compare with transfection with the GATA-3 gene order, transfection siRNA1, the T cell of siRNA2 (swimming lane 1 and swimming lane 2) IL-5 expression of gene level significantly reduces, and has proved that siRNA1 and siRNA2 are by downward modulation GATA-3 expression of gene and then influenced the Th2 function of polarization of T cell.
Sequence table
<160>12
<210>1
<211>21
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>1
aacaucgaug gucaaggcaa c 21
<210>2
<211>21
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>2
guugccuuga ccaucgaugu u 21
<210>3
<211>21
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>3
aagaugagaa agagugccuc a 21
<210>4
<211>21
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>4
ugaggcacuc uuucucaucu u 21
<210>5
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>5
gatccgcatc gatggtcaag gcaacttcaa gagagttgcc ttgaccatcg atgttttttg 60
gaaa 64
<210>6
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>6
gcgtagctac cagttccgtt gaagttctct caacggaact ggtagctaca aaaaaccttt 60
tcga 64
<210>7
<211>63
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>7
gatccgatga gaaagagtgc ctcattcaagagatgaggca ctctttctca tcttttttgg 60
aaa 63
<210>8
<211>63
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>8
gctactcttt ctcacggagt aagttctcta ctccgtgaga aagagtagaa aaaacctttt 60
cga 63
<210>9
<211>21
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>9
aauauuaaca gaccccugac u 21
<210>10
<211>21
<212>RNA
＜213〉artificial sequence
<220>
<223>
<400>10
agucaggggu cuguuaauau u 21
<210>11
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>11
gatccgtatt aacagacccc tgactttcaa gagaagtcag gggtctgtta atattttttg 60
gaaa 64
<210>12
<211>64
<212>DNA
＜213〉artificial sequence
<220>
<223>
<400>12
gcataattgt ctggggactg aaagttctct tcagtcccca gacaattata aaaaaccttt 60
tcga 64
Claims (8)
1, suppressing the siRNA of GATA-3 genetic expression, is following 1) and 2) at least one double-stranded RNA sequence:
1) positive-sense strand is the nucleotide sequence by 1 expression of sequence in the sequence table, and antisense strand is the nucleotide sequence by 2 expressions of sequence in the sequence table;
2) positive-sense strand is the nucleotide sequence by sequence in the sequence table 3, and antisense strand is the nucleotide sequence by sequence in the sequence table 4.
2, siRNA according to claim 1 is characterized in that: described siRNA is the nucleotide sequence of a positive-sense strand by 1 expression of sequence in the sequence table, and antisense strand is by the double-stranded RNA sequence of the nucleotide sequence of sequence in the sequence table 2.
3, siRNA according to claim 1 is characterized in that: described siRNA is the nucleotide sequence of a positive-sense strand by sequence in the sequence table 3, and antisense strand is by the double-stranded RNA sequence of the nucleotide sequence of sequence in the sequence table 4.
4, the gene of the siRNA of each described inhibition GATA-3 genetic expression of coding claim 1-3.
5, gene according to claim 4 is characterized in that: the encoding gene of the siRNA of described inhibition GATA-3 genetic expression is following 1) and 2) at least one double chain nucleotide sequence:
1) sense strand is the nucleotide sequence by 5 expressions of sequence in the sequence table; Antisense strand is the nucleotide sequence by 6 expressions of sequence in the sequence table;
2) sense strand is the nucleotide sequence by 7 expressions of sequence in the sequence table; Antisense strand is the nucleotide sequence by 8 expressions of sequence in the sequence table.
6, gene according to claim 5, it is characterized in that: the encoding gene of the siRNA of described inhibition GATA-3 genetic expression is a double chain nucleotide sequence, its sense strand is the nucleotide sequence of sequence 5 in the sequence table, and antisense strand is the nucleotide sequence of sequence 6 in the sequence table.
7, gene according to claim 5, it is characterized in that: the encoding gene of the siRNA of described inhibition GATA-3 genetic expression is a double chain nucleotide sequence, its sense strand is the nucleotide sequence of the nucleotide sequence of sequence 7 in the sequence table, and antisense strand is the nucleotide sequence of the nucleotide sequence of sequence 8 in the sequence table.
8, the expression vector, transgenic cell line or the host bacterium that contain the siRNA encoding gene of the arbitrary described inhibition GATA-3 of claim 4-7 genetic expression.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101443587A CN100535113C (en) | 2006-12-04 | 2006-12-04 | Small-interfering RNA inhibiting gene expression of GATA-3 and its coding gene and use |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006101443587A CN100535113C (en) | 2006-12-04 | 2006-12-04 | Small-interfering RNA inhibiting gene expression of GATA-3 and its coding gene and use |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1962864A CN1962864A (en) | 2007-05-16 |
| CN100535113C true CN100535113C (en) | 2009-09-02 |
Family
ID=38082091
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006101443587A Expired - Fee Related CN100535113C (en) | 2006-12-04 | 2006-12-04 | Small-interfering RNA inhibiting gene expression of GATA-3 and its coding gene and use |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100535113C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP2408915A2 (en) * | 2009-03-19 | 2012-01-25 | Merck Sharp&Dohme Corp. | RNA INTERFERENCE MEDIATED INHIBITION OF GATA BINDING PROTEIN 3 (GATA3) GENE EXPRESSION USING SHORT INTERFERING NUCLEIC ACID (siNA) |
| CN107338252A (en) * | 2017-08-08 | 2017-11-10 | 信雅生物科技（苏州）有限公司 | Human keratin KRT80 genes and application |
-
2006
- 2006-12-04 CN CNB2006101443587A patent/CN100535113C/en not_active Expired - Fee Related
Non-Patent Citations (5)
| Title |
|---|
| antisense-induced blockade of gata-3 expression could inhibitth2 excursion of tumor cells in vitro and in vivo. dongzhu yao, 等人.cellular & molecular immunology,Vol.2 No.3. 2005 * |
| antisense-induced blockade of gata-3 expression could inhibitth2 excursion of tumor cells in vitro and in vivo. dongzhu yao, 等人.cellular & * |
| molecular immunology,Vol.2 No.3. 2005 * |
| 反义GATA-3治疗哮喘气道炎症的实验研究. 邓群益等.实用医学杂志，第21卷第21期. 2005 * |
| 转录因子GATA-3在变应性鼻炎患者白细胞介素4和白细胞介素5表达中的作用. 李华斌等.中华耳鼻咽喉科杂志，第39卷第8期. 2004 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1962864A (en) | 2007-05-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Swiezewski et al. | Small RNA-mediated chromatin silencing directed to the 3′ region of the Arabidopsis gene encoding the developmental regulator, FLC | |
| Falaleeva et al. | C/D‐box snoRNAs form methylating and non‐methylating ribonucleoprotein complexes: Old dogs show new tricks | |
| Cullen | Enhancing and confirming the specificity of RNAi experiments | |
| Chu et al. | The inducible microRNA-21 negatively modulates the inflammatory response in teleost fish via targeting IRAK4 | |
| Montgomery et al. | AGO1-miR173 complex initiates phased siRNA formation in plants | |
| O'Connell et al. | Inositol phosphatase SHIP1 is a primary target of miR-155 | |
| DK1781787T3 (en) | TREATMENT OF EYE DISORDERS FEATURED BY AN INCREASED INTRAOCULAR PRESSURE WITH SIRNAS | |
| Song et al. | Let-7b inhibits the malignant behavior of glioma cells and glioma stem-like cells via downregulation of E2F2 | |
| Cui et al. | LncRNA SNHG20 contributes to cell proliferation and invasion by upregulating ZFX expression sponging miR‐495‐3p in gastric cancer | |
| US20090004668A1 (en) | Pre-miRNA loop-modulated target regulation | |
| US8841437B2 (en) | Precursor miRNA loop-modulated target regulation | |
| Marker et al. | Distinct RNA-dependent RNA polymerases are required for RNAi triggered by double-stranded RNA versus truncated transgenes in Paramecium tetraurelia | |
| EP2316491A1 (en) | Cell proliferation inhibitor | |
| US20190300882A1 (en) | Methods of treating neuroblastoma and reagents therefor | |
| Wang et al. | MicroRNA-936 induces cell cycle arrest and inhibits glioma cell proliferation by targeting CKS1 | |
| WO2007147067A2 (en) | Methods and compositions for regulating cell cycle progression | |
| Gao et al. | MicroRNA-2187 modulates the NF-κB and IRF3 pathway in teleost fish by targeting TRAF6 | |
| Pang et al. | Pancreatic cancer-derived exosomal microRNA-19a induces β-cell dysfunction by targeting ADCY1 and EPAC2 | |
| Li et al. | Comprehensive circRNA/miRNA/mRNA analysis reveals circRNAs protect against toxicity induced by BPA in GC-2 cells | |
| Zhang et al. | CircRNA_Maml2 promotes the proliferation and migration of intestinal epithelial cells after severe burns by regulating the miR-93-3p/FZD7/Wnt/β-catenin pathway | |
| CN100535113C (en) | Small-interfering RNA inhibiting gene expression of GATA-3 and its coding gene and use | |
| Wang et al. | Inhibition of miR‐24 suppresses malignancy of human non‐small cell lung cancer cells by targeting WWOX in vitro and in vivo | |
| Gong et al. | Shrimp miR-1000 functions in antiviral immunity by simultaneously triggering the degradation of two viral mRNAs | |
| Ma et al. | The role of circTMOD3 in regulating LPS-induced acute inflammation and injury in human lung fibroblast WI-38 cells | |
| Lin et al. | Gga-miR-200b-3p promotes macrophage activation and differentiation via targeting monocyte to macrophage differentiation-associated in HD11 cells |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090902 Termination date: 20101204 |