CN100522250C - N type non-viral vector and pharmaceutical composition containing same - Google Patents
N type non-viral vector and pharmaceutical composition containing same Download PDFInfo
- Publication number
- CN100522250C CN100522250C CNB031239404A CN03123940A CN100522250C CN 100522250 C CN100522250 C CN 100522250C CN B031239404 A CNB031239404 A CN B031239404A CN 03123940 A CN03123940 A CN 03123940A CN 100522250 C CN100522250 C CN 100522250C
- Authority
- CN
- China
- Prior art keywords
- sequence
- dna
- polypeptide
- gene
- seq
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The invention relates to a non-viral vector and fusion gene for encoding it, wherein the non-virus carrier can lead the protein expression type recombinant member with destroying action to cells targetedly into GnRH acceptor positive anoxybiotic tumor cells. The invention also relates to the pharmaceutical compositions containing the non-viral vectors and the expression type recombinant and their use.
Description
Technical field
The invention belongs to the gene therapy medicament field, specifically, the present invention relates to non-virus carrier and its fusion gene of encoding, described non-virus carrier is to pack and to carry the protein expression type recombinant targeting ground importing specific tumors cell that coding has lethal effect, so that this expression type recombinant goes out protein at this kind cell inner expression, thereby kill and wound this kind tumor cell and do not injure other cell.The invention still further relates to the pharmaceutical composition and the application thereof that comprise described non-virus carrier and described expression type recombinant.
Background technology
The human body heterologous protein of known total thousands of kinds of antitumor or antiviral activity, but when the clinical practice of paying, have two problems: the one, the serious toxic and side effects problem that no specificity causes the lethal effect of all cells (or targeting); The 2nd, as the human body heterologous protein, the serious immunogenicity problem that when importing the human body blood circulation, occurs.For addressing the above problem, fusion gene that tumor cell receptors ligand gene and pyocyanin gene II, III functional domain encoding gene make up and the guiding fusion rotein that is produced thereof the eighties once appearred utilizing in eighties of last century.But clinical research shows, though this guiding protein can strengthen the guidance quality and the specificity of toxin protein to a certain extent, not exclusively.Meanwhile, toxin protein in this case, its intensive immunogenicity problem still exists.When clinical practice, though there is good efficacy at the initial stage, after 4 weeks, because of antibody forms, neutralizing effect takes place and complete failure.Though modify or seal the antigenic determinant of toxin by multiple trial, aminoacid as PEG modification and point mutation transformation toxin is formed, but all because of modification causes the toxin inactivation, or can not eliminate the immunogenicity of toxin protein fully, finally still cause the inefficacy of toxin.Therefore, seek a kind of safe, import target cell effectively, be necessary thereby kill the tumor target cell and avoid toxin protein to Normocellular toxic and side effects and immunogenic method.
Gene target shifts and expresses the safety of guaranteeing gene therapy, is the problem that must at first consider in the gene therapy.Therapeutic gene transferred to tumor tissues specifically or in tumor cell specifically expressing, can effectively avoid injury to normal structure, also can increase transfection efficiency simultaneously, realize the magnetic target therapy of gene.Targeting (restricted) expression that realizes gene mainly contains two kinds of regulatory mechanisms: the one, so-called " transcribing the targeting regulatory mechanism ", select promptly that isogenic cis acting element of tumor associated antigen (as AFP, CEA) (as starting the factor, enhancer) and corresponding target are gene constructed to become expression cassette for use, insert gene transfer vector, metastatic gene is only expressed in the tumor that produces above-mentioned tumor correlated albumen like this, thereby tumor cell is produced specificity kill and wounding effect; The 2nd, so-called " the external source regulatory mechanism of transgene expression ", promptly utilize the cis acting element that can be subjected to certain factor abduction delivering gene, become expression cassette with corresponding target is gene constructed, insert gene transfer vector, like this, whether metastatic gene expresses the regulation and control that directly are subjected to corresponding inducement in vivo.
The surface of most adenocarcinoma cells is expressing promoting sex gland hormones release peptide (GnRH) receptor specifically, use can with the bonded part GnRH of its specificity as targeting proteins, to there be the pseudomonal toxin (PE) of lethal effect to import tumor cell, be expected killing tumor cell with GnRH-PE fusion rotein form.This design has solved the problem of toxin guiding killing tumor cell substantially, but because of also expressing the GnRH receptor in some normal cell surfaces, so that yet may occur the toxic and side effects problem to toxin lead-in portion normal cell, meanwhile, pseudomonal toxin is a kind of heterologous protein for human body, will produce immunogenicity.
At using these obstacles that exist in the toxitherapy tumor, there is a need in the art for when avoiding toxin protein immunogenicity and toxic and side effects fully, thus the new target therapeutic agent and the relevant carriers of reservation toxin protein activity specific killing tumor cell.
Summary of the invention
In first aspect, the invention provides a kind of non-virus carrier, its essence is a kind of targeting fusion rotein, described fusion rotein is by receptors ligand polypeptide, TNF87 polypeptide, nuclear localization sequence polypeptide and be rich in positive amino acid whose polypeptide and form.In this another embodiment on the one hand of the present invention, non-virus carrier of the present invention is by receptors ligand polypeptide, TNF87 polypeptide and be rich in positive amino acid whose polypeptide and form.According to the present invention, described to be rich in positive amino acid whose polypeptide be the conjugated protein SON of DNA or its fragment; Described TNF87 polypeptide is tumor necrosis factor (TNF) sudden change back sequence; Described nuclear localization sequence polypeptide is TAP; Described receptors ligand polypeptide be the receptors ligand polypeptide in the described non-virus carrier be can with the bonded GnRH of GnRH receptor-specific or its associated clip, analog or mutant.Owing to use GnRH as guide molecule, so the inventor is called N type non-virus carrier with non-virus carrier of the present invention.
Preferably, obtain fusion gene in vitro recombination, and in prokaryotic cell or eukaryotic cell, express this fusion gene and obtain non-virus carrier of the present invention (fusion rotein) by gene engineering method.Therefore, on the other hand, the invention provides the fusion gene of coding non-virus carrier of the present invention.
On the other hand, the invention provides the pharmaceutical composition of the complex that comprises non-virus carrier of the present invention and a kind of expression type DNA recombinant, to be used for the gene therapy of targeting malignant tumor, described expression type recombinant comprises expresses the proteinic gene that pair cell has kill capability.
According to the present invention, the protein that described pair cell has kill capability is pseudomonal toxin, diphtheria toxin, diphtherotoxin, Radix Phytolaccae, Ricin, or other all pair cells have the albumen from human body, animals and plants or microorganism of kill capability, or their active function zone, mutant or analog, and the protein with killer cell activity of synthetic or polypeptide and respective coding gene thereof.Preferably, the protein that wherein said pair cell has kill capability is pseudomonal toxin, or its second and the 3rd domain; More preferably, described pair cell has the 3rd domain or its mutant that the protein of kill capability is pseudomonal toxin.In a preferred embodiment of the invention, described mutant is a bacillus pyocyaneus III functional domain mutant (REDLK of C section is mutated into KDEL), is called PEIIImut.It can produce the stronger toxin protein of lethality, shown in its aminoacid sequence SEQ ID NO.:9.
The present invention changes the mode of toxin protein targeting transfered cell into toxin protein encoding gene targeting transfered cell Therapeutic Method, when avoiding toxin protein immunogenicity and toxic and side effects fully, thereby keep toxin protein activity specific killing tumor cell.The present invention's design makes described non-virus carrier and the toxin gene expression type recombinant that can only express in the anoxia tumor cell constitute compound medicine, thus target killing tumor cell.Utilize non-virus carrier will encode that pair cell has a strong lethal effect and be subjected to PEIIImut (the mutant gene fragment of pyocyanin the 3rd section) that anoxia condition drives to import tumor cell with the form targeting of expression type recombinant, cause PEIIImut only in tumor cell, to express, thereby kill this cell.Simultaneously, at this tumor cell that utilizes is the characteristics of hypoxic cell, under the situation of anoxia condition as the controlled condition of gene controlled expression, even the expression type recombinant is imported into normal cell, because of this cell is an aerobic cell, then toxin gene PEIIImut can not express, and cell also is unlikely and is killed and wounded.Like this, both avoided the immunogenicity of toxin protein, also avoided any Normocellular lethal effect, i.e. toxic and side effects.This design has been guided out " individuation diagnosis and individualized treatment " necessity, so the indication of this pharmaceutical composition mainly is hepatocarcinoma, breast carcinoma, colorectal cancer, cancer of pancreas, ovarian cancer, carcinoma of prostate, pituitary tumor etc.This is a principal character of the present invention.
Description of drawings
Description of drawings
Fig. 1 is the overall design drawing of pharmaceutical composition of the present invention.
Fig. 2 is for making up the recombinant pLSD-GnRH-TNF87-TAP-SON (GTTS) and pLSD-GnRH-TNF87-SON (GTS) the enzyme action qualification result of the encoding gene that contains fusion rotein GTTS, and wherein sequence number 1～4 is represented respectively: the two GnRH-TNF87-TAP-SON that cut of 1:BamHI and NdeI; The two λ dna molecular amount labellings of cutting of 2:HindIII and EcoRI; 3:BstNI singly cuts the pBR322 molecular weight marker; The two GnRH-TNF87-SON that cut of 4:BamHI and NdeI.
Fig. 3 is the enzyme action qualification result of construction recombination plasmid pGL3-4HRE, and wherein sequence number 1～8 is represented respectively: 1:HindIII singly cuts λ dna molecular amount labelling; 2:SalI singly cuts pGEM-7Zf-1HRE; 3:1HRE PCR result; The two pGEM-7Zf-1HRE that cut of 4:HindIII and XbaI; The two pGEM-7Zf-2HRE that cut of 5:HindIII and XbaI; The two pGEM-7Zf-4HRE that cut of 6:HindIII and XbaI; 7:SalI singly cuts pGL3-4HRE; 8:BstNI singly cuts the pBR322 molecular weight marker.
Fig. 4 is the enzyme action qualification result of construction recombination plasmid spectrum pGL3-4HRE-PEIIImut and pGL3-PEIIImut, and wherein sequence number 1～8 is represented respectively: 1:HindIII singly cuts λ dna molecular amount labelling; The two pCDNA3.1his-PEIII that cut of 2:EcoRI and EcoRV; The two pBSKs-PEIIImut that cut of 3:HindIII and XbalI; 4:HindIII singly cuts pGL3; The two pGL3 that cut of 5:HindIII and XbaI; 6:SmaI singly cuts pGL3-PEIIImut; 7:SmaI singly cuts pGL3-4HRE-PEIIImut; 8:BstNI singly cuts the pBR322 molecular weight marker.
Fig. 5 is the enzyme action qualification result of recombiant plasmid pGL3-4HRE-miniCMV-PEIIImut, pGL3-4HRE-miniCMV-IntronII-PEIIImut, and wherein sequence number 1～4 is represented respectively: 1:SmaI singly cuts pGL3-4HRE-miniCMV-Intron II-PEIIImut; 2:Sma
I singly cuts pGL3-4HRE-miniCMV-PEIIImut; The two λ dna molecular amount labellings of cutting of 3:HindIII and EcoR I; 4:BstNI singly cuts the pBR322 molecular weight marker.
The structure collection of illustrative plates of Fig. 6 recombinant pGL3-4HRE.
The structure collection of illustrative plates of Fig. 7 recombinant pGL3-PEIIImut.
Fig. 8 recombinant pGL3-4HRE-miniCMV-PEIIImut makes up collection of illustrative plates.
Two kinds of albumen of Fig. 9 .GnRH-TNF87-TAP-SON, GnRH-TNF87-SON are induced the result, and wherein sequence number 1～10 is represented respectively: 1:GnRH-TNF87-SON does not induce; 2,3,45:GnRH-TNF87-SON induces; 6: protein labeling; 7:GnRH-TNF87-TAP-SON does not induce; 8,9,10:GnRH-TNF87-TAP-SON induces.
Figure 10 .DNA and GTTS different proportion electrophoresis result detect DNA and protein binding situation, and wherein sequence number 1～5 is represented respectively: 1: simple DNA; 2:DNA and albumen charge ratio are 8:1; 3:DNA and albumen charge ratio are 4:1; 4:DNA and albumen charge ratio are 2:1; 5:DNA and albumen charge ratio are 1:1.
Figure 11 .DNA albumen composition is placed a month rear electrophoresis result at 4 ℃, and wherein sequence number 1～2 is represented respectively: 1:DNA and Protein G TTS complex; 2: simple DNA.
Figure 12 .GTTS and the plasmid pIRES-EGFP complex transfection Hela cell that contains green fluorescent protein.After the plasmid that contains reporter gene is swallowed cell, enter and be expressed as green fluorescent protein in the nucleus, under fluorescence microscope, send green fluorescence.
Figure 13 .GTTS and pGL3-HRE4-miniCMV-PEIIImut complex detect collection of illustrative plates with flow cytometer handle the Hela cell under anoxia condition after.
Figure 14. the OD value of 2BS cell different dosing group mapping under the aerobic conditions, wherein sequence number 1～6 is represented respectively: 1: blank; 2: albumen; 3:DNAa; 4:DNAa+ albumen; 5:DNAb; 6.DNAb+ albumen; Wherein, DNAa is pGL3-4HRE-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.
Figure 15. the OD value of HEK293 cell different dosing group mapping under the aerobic conditions, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.
Figure 16. the OD value of HepG2 cell different dosing group mapping under the aerobic conditions, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.
Figure 17. the OD value of Hela cell different dosing group mapping under the aerobic conditions, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.
Figure 18. the OD value of MCF-7 cell different dosing group mapping under the aerobic conditions, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.
Figure 19. the OD value of 2BS cell different dosing group mapping under the anoxia condition, wherein sequence number 1～6 is represented respectively: 1: blank; 2: albumen; 3:DNAa; 4:DNAa+ albumen; 5:DNAb; 6.DNAb+ albumen; Wherein, DNAa is pGL3-4HRE-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.
Figure 20. the OD value of HepG2 cell different dosing group mapping under the anoxia condition, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.。
Figure 21. the OD value of Hela cell different dosing group mapping under the anoxia condition, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.。
Figure 22. the OD value of MCF-7 cell different dosing group mapping under the anoxia condition, wherein sequence number 1～10 is represented respectively: 1. blank; 2: albumen; 3:DNA (a, 8ug/ml); 4:DNA (a, 8ug/ml)+albumen; 5:DNA (a, 2ug/ml)+albumen; 6:DNA (a, 0.5ug/ml)+albumen; 7:DNA (b, 8ug/ml); 8:DNA (b, 8ug/ml)+albumen; 9:DNA (b, 2ug/ml)+albumen; 10:DNA (b, 0.5ug/ml)+albumen; Wherein, DNAa is pGL3-HRE4-miniCMV-PEIIImut; DNAb is pGL3-PEIIImut.。
Figure 23. experiment flow figure of the present invention.
The specific embodiment
Master-plan of the present invention and experiment flow are referring to Fig. 1 and shown in Figure 23.
According to a first aspect of the invention, the invention provides a kind of non-virus carrier, its essence is a kind of targeting fusion rotein, and described fusion rotein is by receptors ligand polypeptide, TNF87 polypeptide, nuclear localization sequence polypeptide and be rich in positive amino acid whose polypeptide and form.In this another embodiment on the one hand of the present invention, non-virus carrier of the present invention is by receptors ligand polypeptide, TNF87 polypeptide and be rich in positive amino acid whose polypeptide and form.According to the present invention, described to be rich in positive amino acid whose polypeptide be the conjugated protein SON of DNA or its fragment; Described TNF87 polypeptide is tumor necrosis factor (TNF) sudden change back sequence; Described nuclear localization sequence polypeptide is TAP; Described receptors ligand polypeptide be the receptors ligand polypeptide in the described non-virus carrier be can with the bonded GnRH of GnRH receptor-specific or its associated clip, analog or mutant.Owing to use GnRH as guide molecule, so the inventor is called N type non-virus carrier with non-virus carrier of the present invention.Non-virus carrier of the present invention is to the human body non-immunogenicity.
Preferably, the encoding gene of above-mentioned receptor polypeptides GnRH is the mutant nucleotide sequence that comprises the escherichia coli preference codon, and the sequence shown in SEQ ID NO.1 perhaps also can be its wild type DNA sequence.
Preferably, the TNF87 in the described non-virus carrier is a fragment of tumor necrosis factor (TNF) sudden change back sequence, and it has impelled Expression of Fusion Protein.The encoding gene of described polypeptide can be the mutant nucleotide sequence that comprises the escherichia coli preference codon, and the sequence shown in SEQ ID NO.2 perhaps also can adopt its wild type DNA sequence.
Preferably, contain or do not contain nuclear localization sequence TAP in the described non-virus carrier, the expression type recombinant is entered in the nuclear express.The gene of described coding TAP can be the mutant nucleotide sequence that comprises the escherichia coli preference codon, and the sequence shown in SEQ ID NO.3 perhaps also can adopt its wild type DNA sequence.
Preferably, the fragment that to be rich in positive amino acid whose polypeptide be the 788-859 amino acids of the conjugated protein SON of DNA in the described non-virus carrier, its aminoacid sequence is: KVKDTHEKSKKNKNRDKGEKEKKRDSSLRSRSKRSKSSEHKSRKRTSESRSRARKR SSKSKSHRSQTRSR.This segmental DNA sequences encoding can be for comprising the mutant nucleotide sequence of escherichia coli preference codon, and the sequence shown in SEQ ID NO.4 perhaps also can adopt its wild type DNA sequence.
Preferably, obtain fusion gene in vitro recombination, and in protokaryon and eukaryotic cell, express this fusion gene and obtain non-virus carrier of the present invention (fusion rotein) by gene engineering method.
Particularly preferably, described non-virus carrier is GTTS, promptly holds to the C end from N and is made up of the 788-859 amino acids of GnRH polypeptide, TNF87 polypeptide, TAP polypeptide and the conjugated protein SON of DNA successively, and its aminoacid sequence is shown in SEQ ID NO.5.
Particularly preferably, described non-virus carrier is GTS, promptly holds to the C end from N and is made up of the 788-859 amino acids of GnRH polypeptide, TNF87 polypeptide and the conjugated protein SON of DNA successively, and its aminoacid sequence is shown in SEQ ID NO.7.
Choosing ground obtains fusion gene by gene engineering method in vitro recombination, and expresses this fusion gene and obtain non-virus carrier of the present invention (fusion rotein) in prokaryotic cell or eukaryotic cell.For example in one embodiment of the invention, the DNA sequence of described fusion gene (coding GTS) or its wild type DNA sequence shown in (coding GTTS) or its wild type DNA sequence and the SEQID NO.8 shown in SEQ ID NO.6 respectively.Their encoding fusion protein GTTS and GTS.GTTS comprises 42 aminoacid of 87 aminoacid, nuclear localization sequence TAP of 10 aminoacid, the sudden change back TNF of GnRH and 72 aminoacid of people SON successively from N to C end, contain 51 lysines and arginine altogether, 32 positive charges of synteny when pH=7.GTS comprises 87 aminoacid of 10 aminoacid, sudden change back TNF of GnRH and 72 aminoacid of people SON, contains 41 lysines and arginine altogether, 28 positive charges of synteny when pH=7.The aminoacid sequence of GTTS and GTS is respectively shown in SEQ ID NO.5 and SEQ IDNO.7.
In one embodiment of the invention, described fusion gene respectively with temperature-induced expression type carrier pLSD (J.Bacteriology, 171 (6) 1989,3427-3432) reorganization, called after pLSD-GnRH-TNFmut-TAP-SON and pLSD-GnRH-TNFmut-SON respectively.With above-mentioned plasmid transformed into escherichia coli DH5 α respectively, the engineering bacteria that acquisition can expressed fusion protein.
On the other hand, the invention provides the pharmaceutical composition of the complex that comprises non-virus carrier of the present invention and a kind of expression type DNA recombinant, to be used for the gene therapy of targeting malignant tumor, described expression type recombinant comprises expresses the proteinic gene that pair cell has kill capability.
The protein that described pair cell has kill capability is pseudomonal toxin, diphtheria toxin, diphtherotoxin, Radix Phytolaccae, Ricin, or all other pair cells have the albumen from human body, animals and plants or microorganism of kill capability, or their active function zone, mutant or analog, and the protein with cell killing activity or the polypeptide of synthetic, and respective coding gene.Preferably, the protein that wherein said pair cell has kill capability is pseudomonal toxin, or its second and the 3rd domain.
Pseudomonal toxin (PE) is by the excretory a kind of toxin of bacillus pyocyaneus, and it is a kind of virulent toxin, only can make it dead in 24 hours to intravenous injection 0.3 microgram of mice.The importing of the toxin of several molecule can make this cell death concerning a cell.Because this particular performances of PE makes in its gene therapy that is applied to acquired immune deficiency syndrome (AIDS) as a kind of up-and-coming toxin and goes.PE has three domains, domain Ia (AA1-252) is the cell binding structural domain, domain II I (AA405-613) is ADP glycosylation zone, and domain II and domain II I are collectively referred to as PE40 again, and domain Ib (AA365-404) does not have tangible biological function.Be to strengthen virulence, the inventor is the codon of KDEL with the codon mutation of 5 amino acid residue RDELK of pseudomonal toxin III domain C end, and introduces termination codon TGATAA and obtain recombinant DNA PEIII
Mut, the virulence of the toxin protein of its coding obviously is better than original PEIII.In order to increase toxin gene PEIII
MutThe safety of expressing in human body reduces its toxic and side effects, and the present invention has designed the HRE of four copies and the upstream that miniCMV is connected on toxin gene in addition, in the hope of the regulating and controlling effect by hypoxia condition, the expression of toxin gene is limited in the anoxybiotic tumor cell.
Therefore, preferably, the protein that described pair cell has kill capability is the 3rd domain or its mutant of pseudomonal toxin, wherein said mutant PEIII
MutAminoacid sequence SEQ ID NO.9 shown in, its nucleotide sequence is shown in SEQ ID NO:12.
Preferably, PEIII
MutCan introduce various expression vectors being used for construction expression type recombinant according to technology well known in the art, thereby express toxin protein.In one embodiment of the invention, the expression type recombinant pGL3-PEIII of described expression type recombinant for making up based on pGL3
MutOr pGL3-4HRE-PEIII
Mut
In another embodiment of the invention, described expression type recombinant is the recombinant expressed type recombinant of the eucaryon pGL3-HRE4-miniCMV-PEIII that is subjected under four copy HRE and the dual control of miniCMV promoter
MutWith pGL3-HRE4-miniCMV-Intron II-PEIII
MutThe DNA sequence of described HRE gene is shown in SEQ ID NO.10.The DNA sequence of described miniCMV gene is shown in SEQ ID NO.11.
Particularly preferably, pharmaceutical composition of the present invention comprises and is selected from GTTS/pGL3-4HRE-miniCMV-PEIII
Mut, GTTS/pGL3-4HRE-miniCMV-Intron II-PEIII
Mut, GTS/pGL3-4HRE-miniCMV-PEIII
MutWith GTS/pGL3-4HRE-miniCMV-Intron II-PEIII
Mut, GTTS/pGL3-PEIII
Mut, GTTS/pGL3-4HRE-PEIII
Mut, GTS/pGL3-PEIII
MutAnd GTS/pGL3-4HRE-PEIII
MutComplex.
The designed targeting proteins non-virus carrier of the present invention can mediate toxin gene effectively and enter the tumor cell that is rich in specific receptor GnRHR, and expression toxin protein, thereby killing tumor cell, but will have more serious toxic and side effects, and only under anaerobic condition, hypoxia response element HRE and miniCMV have good selectivity as " second switch ", toxin gene is only started down at the environment (tumor cell) of hypoxia, bring into play the malignant cell that there is the GnRH receptor on accurate specific target tropism's killer cell surface.The normal cell of the no GnRH receptor in killer cell surface neither, also there is not the non-anoxia normal cell of GnRH receptor on the killer cell surface." biswitch " design so promptly utilizes the guiding design of the relation of receptors ligand, and utilizes anoxia condition as the design of gene controlled expression, has then realized class tumor target gene therapy design accurately.Targeting and the safety that toxin uses guaranteed in above-mentioned design.
In this application that is used for the medicine of targeting gene therapy of the present invention, comprise PEIII
MutExpression type recombinant and fusion rotein in can be that people SON combines closely in conjunction with the component of DNA, guiding component GnRH in the fusion rotein is by importing tumor cell with the GnRH receptors bind of tumor cell surface with complex, nuclear localization sequence TAP helps the toxin recombinant imported in the nucleus of tumor cell and is expressed as toxin protein, thereby tumor cell is killed.
Specifically, because pharmaceutical composition of the present invention is toxin gene to be imported in the tumor cell of GnRH receptor positive express, therefore, just do not need the transmembrane transport domain of toxin.Just because of this reason, toxin gene PEIII of the present invention
MutIn only contain the coded sequence with the active III domain of ADP glycosylase of pseudomonal toxin.The albumen that this coded sequence gives expression in target cell can be used as the toxin that kills target cell.In addition, 4 amino acid residue KDEL that the inventor holds with diphtheria toxin, diphtherotoxin C have substituted 5 amino acid residue REDLK of PE toxin C end, have strengthened the cell killing ability of toxin thus greatly.In addition, because toxin protein is to express in cell, this has just thoroughly been avoided the immunogenicity problem of toxin protein.Even after the target cell disintegrate, perhaps, toxin protein wherein (amount is few) may be caught by immunity of organism identification, thereby generation antibody, but the toxin protein of these antibody in both can't scavenger cell can not react with the plasmid DNA as the toxin protein expression vector yet.In fact, the cell that is killed of this class will be removed by the immunologic mechanism of body rapidly.
Utilize a part in the conjugated protein SON molecule of DNA of normal presence in the human body as functional areas in the fusion rotein of the present invention in conjunction with DNA.The fragment that is adopted contains 72 aminoacid, wherein contains a large amount of basic amino acids, particularly lysine and arginine, and this polypeptide fragment is positively charged under certain pH conditions, can combine with electronegative DNA by electrostatic interaction.Its natural form itself just has important effect aspect eukaryotic gene group DNA folding, dense poly-.Design can guarantee that dna molecular has fully guaranteed reduced immunogenicity on the dense poly-basis like this, and can be by the target cell endocytosis.
Further describe the present invention by the following examples.
1.1 the clone of single copy HRE (hypoxia response elements) sequence
HRE also claims the trans-acting DNA sequence, and its core sequence is 5 '-RCGTG-3 '.It has one or more HIF-1 binding sites, and HIF-1 is by coming the expression of controlling gene in conjunction with HRE.Be positioned at VEGF5 ' end transcriptional start site the 939th-985bp totally 47 bp according to bibliographical information HRE, the VEGF gene order of originating at this human peripheral that provides according to GenBank designs primer, for convenience of identifying, further clone multicopy HRE and this section sequence being inserted among the carrier pGEM-7Zf, introduce KpnI site and SalI site at 5 ' end of sequence respectively, 3 ' end in sequence is introduced the XhoI site, and the primer with design is that template is carried out pcr amplification simultaneously.Obtaining length is the purpose fragment of 70bp.Through KpnI and XhoI are two cut after, connect between the KpnI and XhoI site of cloning vehicle pGEM-7Zf.Utilize carrier to have, lay respectively at the HindIII and the XbaI that insert the fragment two ends and carry out the enzyme action evaluation.Obtain the fragment of size respectively through HindIII and XbaI double digestion, singly cut through SalI and obtain the big or small fragment (see figure 3) of 3044bp that is for 88bp and 2956bp.With this positive recombiant plasmid called after pGEM-7Zf-1HRE that has the purpose fragment to insert.The sequence that sequencing result demonstration institute's calling sequence and GenBank provide is coincide.
1.24 the clone of copy HRE sequence
In order to clone the HRE of two copy HRE and 4 copies, a pair of isocaudarner SalI and XhoI when design primer amplification list copy HRE, have been introduced respectively at the sequence two ends from the HRE of single copy.There is single S caI restriction enzyme site among the carrier pGEM-7Zf.XhoI and ScaI double digestion plasmid pGEM-7Zf-1HRE obtain two fragments that size is respectively 1878bp, 1166bp, wherein contain the sequence of HRE47 bp in the fragment of 1878bp, reclaim this fragment.With SalI and ScaI double digestion plasmid pGEM-7Zf-1HRE, obtain two fragments that size is respectively 1221bp, 1823bp again, wherein also contain the sequence of HRE47 bp in the fragment of 1221bp, reclaim the fragment of this 1221bp.Connect two fragments that reclaim,, disappear, still form single S caI restriction enzyme site after two ScaI half sites connect so connect the back restriction enzyme site because SalI and XhoI are the coordination enzymes.HRE then increases to two copies by single copy.Identify through HindIII and XbaI double digestion, obtain the positive recombiant plasmid that size is inserted for the purpose fragment of 141bp, naming this recombiant plasmid that contains two copy HRE sequences is pGEM-7Zf-2HRE.
Obtain to contain the recombiant plasmid of 4 copy HRE sequences with identical method.Identify through HindIII and XbaI double digestion, obtain size and be the purpose fragment of 247bp.Naming this recombiant plasmid that contains 4 copy HRE sequences is pGEM-7Zf-4HRE.Sequencing result shows entirely true.
1.3 the structure of recombiant plasmid pGL3-4HRE
With KpnI and XhoI 4 copy HRE sequence small fragments under the enzymolysis from plasmid pGEM-7Zf-4HRE, this small fragment is inserted between the site of the KpnI of expression vector pGL3 and XhoI.Through SalI singly cut (not having the SalI site in the expression vector) obtain the size be the fragment of 3203bp, with this recombiant plasmid called after pGL3-4HRE.
The 4HRE gene order
CGTCGACCCACAGTGCATACGTGGGCTCCAACAGGTCCTCTTCC
CTCCCATGCACTCGACCCACAGTGCATACGTGGGCTCCAACAG
GTCCTCTTCCCTCCCATGCACTCGACCCACAGTGCATACGTGGG
ATACGTGGGCTCCAACAGGTCCTCTTCCCTCCCATGCAC
The structure of embodiment 2 recombiant plasmid pGL3-4HRE-PEIIImut and pGL3-PEIIImut
With the pcDNA3.1his-PEIII plasmid that EcoRI and EcoRV double digestion are preserved by this chamber, obtain size and be the PEIIImut of 649bp by these two restriction enzyme sites the PEIIImut sequence to be inserted among the excessive carrier pBSKs again.Obtain the big or small aim sequence of 649bp that is through EcoRI and EcoRV double digestion.This has been inserted the plasmid recombinant called after pBSKs-PEIIImut of target gene fragment.PEIIImut sequence two ends have HindIII and these two restriction enzyme sites of XbaI among the recombiant plasmid pBSKs-PEIIImut, obtain size once more by HindIII and XbaI double digestion and be the PEIIImut genetic fragment of 687bp, be inserted into respectively between the HindIII and XbaI site among plasmid recombinant pGL3-4HRE-SV40 and the carrier pGL3.The former singly cuts through SmaI and obtains the big or small single band of 4195bp that is.(carrier pGL3 with the SmaI site when inserting HRE, cut, have single S maI site in the PEIIImut genetic fragment so have only.) latter singly cuts through SmaI and obtain two fragments that size is respectively 888bp and 3120bp.(all have single S maI site in carrier pGL3 and the PEIIImut genetic fragment, can obtain two fragments) so SmaI singly cuts.With this two kinds of recombiant plasmid difference called after pGL3-4HRE-PEIIImut and pGL3-PEIIImut.Sequencing result is entirely true.
The structure of embodiment 3 recombiant plasmid pGL3-4HRE-miniCMV-PEIIImut and pGL3-4HRE-miniCMV-Intron II-PEIIImut
Because the startup activity of SV40 is very strong, can't select only in the tumor cell of hypoxia, to start, further be transformed into the miniCMV promoter, toxin gene is only expressed in the tumor cell of hypoxia.
Add BglII site: AGATCT in the upstream, add SmaI (CCCGGG), be convenient to identify that the downstream adds HindIII (AAGCTT) thereafter.According to the existing research of inventor, rabbit Intron II can strengthen the activity of promoter.Improve the specific while at miniCMV, add rabbit IntronII, prevent that the activity of promoter is low excessively thereafter.
72 aa in the SON fragment are changed over the codon that escherichia coli are had a liking for fully, and original 157 aminoacid of TNF are shortened into 87 aminoacid, and 84,86 and 87 amino acids are transformed, and make it not have the TNF activity, make up GnRH-TNF87-TAP-SON; Consider that simultaneously TAP may influence expression, made up GnRH-TNF87-SON, insert the pLSD carrier respectively and express.(expression is seen Fig. 9)
The abduction delivering of embodiment 5 fusion gene GTTS, inclusion body extract and detect
5.1 the extraction of temperature-induced and inclusion body
5.1.1 large volume is cultivated:
Engineering bacteria is inoculated in 50ml LB culture medium, adds the ampicillin that final concentration is 100mg/ml simultaneously, 32 ℃ of jolting overnight incubation.Be re-seeded into two bottles by 2% inoculum concentration and contain 500ml LB/Amp respectively
+In the 2L triangular flask of culture fluid.Be cultured to OD600 32 ℃ of following joltings and be about at 0.6 o'clock.Place 42 ℃ of continuation joltings to cultivate then and induce 5h.4000g is centrifugal, the collection thalline, places-20 ℃ of multigelations.
5.1.2 washed cell:
6000g * 15 minute centrifugal collection antibacterial, the wet thallus of weighing.
Wash thalline with 3%TritonX-100, stirred evenly on the agitator 30 minutes, 6000g,
15 minutes centrifugal collection consumptions are 10ml-50ml buffer/1g wet thallus (comprising following various lavation buffer solution).
5.1.3 lysozyme broken cell:
With cell suspension, buffer is prepared: 50mmol/L Tris.Cl (pH8.5-9.0), 2mmol/LEDTA, 100mmol/LNaCl, 0.5%TritonX-100, lysozyme 1mg/ml with buffer).At room temperature stir with agitator, make the effect thickness of suspension because of lysozyme.
5.1.4 ultrasonic broken cell:
Each super making a call to 10 seconds, interval 15 seconds, 20-50 secondary action (deciding on cell concentration) is to thalline no longer till the thickness.Centrifugal then collection, 6000g * 15 minute.Aforesaid operations should carry out in frozen water, and for preventing carbonization, ultrasonic power is unsuitable excessive, carries out in glass beaker better, and ultrasound probe gos deep into liquid level greater than 3 centimetres, and is good apart from cup 2 centimetres of positions, the end.
5.1.55%TritonX-100 washing:
With the buffer precipitation that thoroughly suspends, stir and ultrasonic Treatment 30 times, referring to above-mentioned steps 2.3.Buffer is: 50mmol/L Tris.Cl (pH8.0), 2mmol/L EDTA, 5%TritonX-100.Centrifugal collecting precipitation, 6000g, 15 minutes.
5.2 Identification of Fusion Protein
5.2.1SDS-PAGE protein electrophoresis
Adopt Tris-glycine-SDS-PAGE.Use discontinuous buffer system, resolving gel concentration is 15% or 12%, and concentrated glue is 5% or 3%.Sample adds 3 * sample-loading buffer, 99 ℃ of degeneration 6～10 minutes.Centrifugal, get sample on the supernatant.In Tris-glycine electrophoretic buffer, earlier enter separation gel, again with 15mA electrophoresis to the bromophenol blue separation gel of just swimming out with 8mA electrophoresis to sample.
5.2.2 protein staining
5.2.2.1 coomassie brilliant blue staining
Soak gel with at least 5 times of coomassie brilliant blue staining liquid to gel volume behind the electrophoresis, dyeing was reclaimed dye liquor more than 4 hours under the room temperature, and gel is soaked in a few hours in the destaining solution, changes destaining solution several times therebetween, and is high-visible until protein band.After the decolouring, gel is stored in 20% glycerine water solution.
5.2.2.2 silver dyes
Use at least 5 times of protein on the gel stationary liquid immobilized gel of gel volume behind the electrophoresis, shake more than 2 hours under the room temperature gently, 50% ethanol is washed twice, shook gently 20 minutes at every turn, discard ethanol, adding freshly prepared 0.02% hypo solution soaked 1 minute, the deionized water of 10 times of volumes of reuse is given a baby a bath on the third day after its birth inferior, after discarding last slurry, gel is soaked in the silver-colored dye liquor of at least 5 times of volumes, shook gently under the room temperature 30 minutes, discard silver-colored dye liquor, the gel two sides adds freshly prepared colour developing liquid after washing slightly with deionized water, treats to react with the stop buffer color development stopping immediately when protein band reaches desirable strength.
5.2.3 the mensuration of protein content
Test kit determination of protein concentration (BCA protein Assay Kit)
Production standard curve sample at first.BSA stock solution is diluted preparation 2mg/ml, 1.5mg/ml, 1.0mg/ml, 0.75mg/ml, 0.5mg/ml, 0.25mg/ml, 0.125mg/ml, the sample of 0.025mg/ml and 0mg/ml concentration respectively.Again protein dry powder to be detected is dissolved in the 1ml sterilized water.Get A liquid 5ml and B liquid 100 μ l mixings in the test kit.The A, the B mixed liquor that in 9 standard sample and 25 μ l testing protein solution, respectively add 200 μ l.Place 37 ℃ to react 30 minutes all samples behind the light mixing.Use the OD value of microplate reader working sample under the wavelength of 490nm and 630nm then.The concentration of according to standard sample and OD value production standard curve are abscissa with proteinic concentration, and the OD value is the vertical coordinate mapping.Find testing sample OD value corresponding proteins concentration from standard curve again, measurement range is 0.01-2.0mg/ml.
1. inclusion body is in every gram 20ml ratio, with solubilization of inclusion bodies liquid (50mM Tris-HCl, 2mM EDTA, 100mM NaCL, 10mM DTT, 7M guanidine hydrochloride, PH9.0) dissolving inclusion body, the filter membrane in 0.45 μ m aperture excessively.
2. reversed-phase column: level pad is 10% acetonitrile; Elution buffer is 90% acetonitrile.Earlier with initial buffer flushing pillar, the elution buffer of reuse 20% is washed 1 column volume behind the last sample, and the elution buffer of 20-60% is washed 5 column volumes, and keeps 2 column volumes 60%.Use A
260And A
280Monitoring is collected each eluting peak and is carried out the evaluation of SDS-PAGE electrophoresis.Then, merge contain destination protein respectively manage freezing draining.
3. ion column: level pad is the 0.1M sodium acetate, and pH is about 5.1; Elution buffer is 2M sodium chloride+0.1M sodium acetate.With sample after the level pad dissolving lyophilizing, with the gradient elution of 20-80%, when electric conductivity value reached 100mS/cm, destination protein was eluted, and collected each eluting peak and carried out the evaluation of SDS-PAGE electrophoresis.
4. drainage column: level pad is 2M sodium chloride+0.1M sodium acetate; Elution buffer is the 0.1M sodium acetate, and pH is about 5.1.Merge the destination protein peak, the 0-100% gradient elution, when electric conductance dropped to 100mS/cm, destination protein was eluted, and collected each eluting peak and carried out the evaluation of SDS-PAGE electrophoresis.
1. press the described method cracking thalline of people's (molecular cloning laboratory manual the 2nd edition) such as Sambrook.
2. the collection supernatant adds 1MCaCl
2, making its final concentration is 0.2M, 12, and the centrifugal 10min of 000g/min.
3. chromatography is caught, with Hitrap DEAE anion-exchange column on the clarifying lysate, and the strong bind nucleic acid of this medium energy; Level pad is 25mM Tris-Cl, 1mM EDTA, pH8.0; Elution buffer is 25mM Tris-Cl, 1mM EDTA, 1M NaCl, pH8.0.Earlier with initial buffer flushing pillar, carry out eluting with elution buffer 0-100% then, about 5 column volumes behind the last sample.When electric conductivity value reached 35mS/cm, DNA and RNA were eluted, and collected and respectively managed the sepharose electrophoresis detection.
4. refining, second high-resolution anion-exchange column resourceQ on the nucleic acid component of collecting is further purified, remove remaining RNA, chromosomal DNA, albumen and endotoxin.Level pad is 25mM Tris-Cl, 1mM EDTA, pH8.0; Elution buffer is 25mM Tris-Cl, 1mM EDTA, 1M NaCl, pH8.0.The gradient of eluting is 20-100%, and the purpose peak elutes when electric conductivity value reaches 70mS/cm, collects and respectively manages the sepharose electrophoresis detection.
The used fusion rotein GTTS of present embodiment is both as targeting proteins, and is conjugated protein as DNA again.Because SON is rich in the lysine of positively charged, will combine with the dna molecular of electronegative property, thereby make whole complex molecule integral body electrically level off to neutrality, on sepharose electrophoresis, show the phenomenon that electrophoretic mobility lags behind.
DNA and protein solution mixed by different proportion (4:1 8:1), observes electrophoretic mobility and changes (see figure 10) on 0.8% sepharose electrophoresis gel for 1:1,2:1.Visible DNA-mixed liquid of protein has obviously and delays on the 0.8% sepharose electrophoresis gel, and wherein the mixed delay result of 1:1 is best.In addition, DNA and albumen composition were placed one month at 4 ℃, and 0.8% sepharose electrophoresis detects, and DNA still almost completely is trapped in the well and (sees Figure 11), can stablize preservation at 4 ℃ after the formation complex be described.
GTTS and the plasmid pIRES-EGFP complex transfection Hela cell (seeing Figure 12) that contains green fluorescent protein.
10.1DNA-mtt assay detects behind the albumen composition transfectional cell
1. incubated cell on 96 well culture plates, every hole about 1 * 10
4Cell, 18-24 hour.
2. discard culture fluid, add the DNA-albumen composition 200 μ l of variable concentrations, each sample is done 3 multiple holes, hatches under aerobic or anoxia condition 36 hours.
3. every hole adds 10 μ l10mg/ml MTT, hatches 2-4 hour.
4. add stop buffer (20%SDS, 50% dimethyl formamide) 100 μ l, hatch for 37 ℃.
5. microplate reader wavelength 490nm detects the OD value.
Under aerobic conditions, albumen is compared with matched group OD value in 8ug/ml dosage group the GnRH positive cells with pGL3-PEIII, and all there is significant difference P＜0.05; The GnRH negative control cell is not had lethal effect, P〉0.05.Kill rate (1-survival rate) to the male HEK293 of GnRH (HEKC), HepG2 (hepatoma carcinoma cell), Hela (cervical cancer) and MCF-7 (breast carcinoma) is respectively 72.9%, 57.9%, 54.1% and 51.7%.Proved that thus GnRH has good guidance quality.But this result illustrates that simultaneously this intensive lethal effect that occurs also can occur in the normal cell that there are all non-tumors of GnRH receptor on its surface under aerobic conditions.Therefore, this design has certain toxic and side effects to clinical application research.And this result then can be used as a foundation of following design.Non-virus carrier GTTS and pGL3-4HRE-miniCMV-PEIII complex are under aerobic conditions, even the GnRH positive cell is compared P in 8ug/ml dosage group with matched group OD value〉0.05, there is not significant difference.
Under anoxia condition, non-virus carrier albumen is compared with the OD value of matched group in 8ug/ml dosage group the GnRH positive cells with pGL3-PEIII, and all there is significant difference P＜0.05.Kill rate (1-survival rate) to GnRH positive cell HepG2, Hela and MCF-7 is respectively 61.3%, 60.1% and 53.9%.This result further specifies, and utilizes the design of SV40 promoter to have certain toxic and side effects when obtaining the High Fragmentation rate.Have only the design of the functional gene of realization controlled expression, just can realize target killing design accurately.Non-virus carrier albumen is compared with matched group OD value in 8ug/ml dosage group the GnRH positive cell with pGL3-HRE4-miniCMV-PEIII, and P＜0.05 has significant difference.Kill rate (1-survival rate) to HepG2, Hela and MCF-7 is respectively 57.1%, 56.9% and 41.7%.
Table 1.MTT method detects GTTS and toxin expression type recombinant complex under the aerobic situation to the influence (optical density value reflects the cell survival situation) of various cells and calculate kill rate (n=3, x ± SD)
| 2BS human embryonic lung fibroblast (GnRH receptor negative) | HEK293 cell (GnRH receptor positive) | HepG2 cell (GnRH receptor positive) | Hela cell (GnRH receptor positive) | MCF-7 cell (GnRH receptor positive) | |
| Blank | 0.464±0.075 | 0.836±0.126 | 1.003±0.153 | 0.937±0.133 | 0.753±0.100 |
| Independent albumen | 0.363±0.083 | 0.742±0.169 | 0.917±0.189 | 0.678±0.082 | 0.709±0.172 |
| DNA(a，8ug/ml) | 0.506±0.105 | 0.744±0.181 | 0.903±0.097 | 0.722±0.127 | 0.696±0.151 |
| DNA (a, 8ug/ml)+albumen | 0.450±0.050 | 0.761±0.074 | 0.855±0.143 | 0.730±0.077 | 0.698±0.115 |
| DNA (a, 2ug/ml)+albumen | 0.667±0.200 | 0.856±0.070 | 0.692±0.205 | 0.670±0.168 | |
| DNA (a, 0.5ug/m 1)+albumen | 0.729±0.229 | 0.898±0.173 | 0.846±0.093 | 0.549±0.081 | |
| DNA(b，8ug/ml) | 0.461±0.097 | 0.689±0.092 | 0.861±0.151 | 0.775±0.161 | 0.744±0.127 |
| DNA (b, 8ug/ml)+albumen | 0.447±0.112 | 0.227± 0.119 *(0.729) | 0.422± 0.162 *(0.579) | 0.430± 0.147 *(0.541) | 0.363± 0.062 *(0.517) |
| DNA (b, 2ug/ml)+albumen | 0.372± 0.034 *(0.556) | 0.599± 0.071 *(0.403) | 0.551± 0.056 *(0.412) | 0.557±0.210 | |
| DNA (b, 0.5ug/m 1)+albumen | 0.861±0.098 | 0.843±0.062 | 0.819±0.161 | 0.771±0.182 |
*For carrying out statistical analysis with the blank group, all there is significant difference P＜0.05; Numerical value in () is the result who further calculates kill rate.
DNAa is pGL3-4HRE-miniCMV-PEIIImut
DNAb is pGL3-PEIIImut
Albumen is GTTS
Table 2.MTT method detects GTTS and toxin recombinant complex under the anaerobic condition to the influence (optical density value reflects the cell survival situation) of various cells and calculate kill rate (n=3, x ± SD)
| 2BS human embryonic lung fibroblast (GnRH receptor negative) | HepG2 cell (GnRH receptor positive) | Hela cell (GnRH receptor positive) | MCF-7 cell (GnRH receptor positive) | |
| Blank | 0.508±0.047 | 0.853±0.118 | 0.887±0.113 | 0.689±0.107 |
| Independent albumen | 0.477±0.150 | 0.727±0.072 | 0.667±0.112 | 0.675±0.177 |
| DNA(a，8ug/ml) | 0.430±0.068 | 0.695±0.158 | 0.799±0.075 | 0.698±0.130 |
| DNA (a, 8ug/ml)+albumen | 0.487±0.145 | 0.366± 0.092 *(0.571) | 0.382± 0.121 *(0.569) | 0.402± 0.064 *(0.417) |
| DNA (a, 2ug/ml)+albumen | 0.553± 0.083 *(0.351) | 0.579±0.156 | 0.464±0.118 | |
| DNA (a, 0.5ug/ml)+albumen | 0.770±0.084 | 0.744±0.164 | 0.621±0.093 | |
| DNA(b，8ug/ml) | 0.446±0.043 | 0.828±0.138 | 0.790±0.087 | 0.745±0.200 |
| DNA (b, 8ug/ml)+albumen | 0.522±0.089 | 0.330± 0.071 *(0.613) | 0.354± 0.062 *(0.601) | 0.318± 0.058 *(0.539) |
| DNA (b, 2ug/ml)+albumen | 0.493± 0.016 *(0.422) | 0.582± 0.115 *(0.344) | 0.504±0.163 | |
| DNA (b, 0.5ug/m 1)+albumen | 0.823±0.067 | 0.891±0.091 | 0.794±0.100 |
*For carrying out statistical analysis with the blank group, all there is significant difference P＜0.05; Numerical value in () is the result who further calculates kill rate.
DNAa is pGL3-4HRE-miniCMV-PEIIImut
DNAb is pGL3-PEIIImut
Albumen is GTTS
Sequence table
＜110〉Institute of Basic Medical Sciences, Chinese Academy of Medical Sciences
＜120〉N type non-virus carrier and the pharmaceutical composition that comprises it
<130>I20031304CB
<160>12
<170>PatentIn version3.1
<210>1
<211>30
<212>DNA
＜213〉artificial sequence
<400>1
<210>2
<211>261
<212>DNA
＜213〉artificial sequence
<400>2
<210>3
<211>126
<212>DNA
＜213〉artificial sequence
<400>3
<210>4
<211>216
<212>DNA
＜213〉artificial sequence
<400>4
<210>5
<211>218
<212>PRT
＜213〉artificial sequence
<400>5
<210>6
<211>660
<212>DNA
＜213〉artificial sequence
<400>6
<210>7
<211>174
<212>PRT
＜213〉artificial sequence
<400>7
<210>8
<211>528
<212>DNA
＜213〉artificial sequence
<400>8
<210>9
<211>213
<212>PRT
＜213〉artificial sequence
<400>9
<210>10
<211>47
<212>DNA
＜213〉artificial sequence
<400>10
<210>11
<211>60
<212>DNA
＜213〉artificial sequence
<400>11
<210>12
<211>639
<212>DNA
＜213〉artificial sequence
<400>12
Claims (20)
1, a kind of non-virus carrier, it comprises a kind of receptors ligand polypeptide, TNF87 polypeptide, nuclear localization sequence polypeptide and a kind of targeting fusion rotein that is rich in positive amino acid whose polypeptide successively for holding from N to C end, wherein
Described receptors ligand polypeptide is promoting sexual gland hormone release peptide GnRH or its fragment of being made up of sequence MetGln His Trp Ser Tyr Gly LeuArg Pro;
Described TNF87 polypeptide is a fragment of sequence behind the tnf mutein, and it is the sequence by SEQ ID NO:2 coding,
Described nuclear localization sequence polypeptide is TAP, and wherein the encoding gene of TAP is SEQ IDNO:3 or its wild-type sequence,
Described be rich in positive amino acid whose polypeptide be the conjugated protein SON of DNA or its by the fragment that the 788-859 amino acids sequence of the conjugated protein SON of DNA is formed, wherein the 788-859 amino acids of SON is: KVKDTHEKSKKNKNRDKGEKEKKRDSSLRSRSKRSKSSEHKSRKRTSESRSRARKR SSKSKSHRSQTRSR.
2, non-virus carrier as claimed in claim 1, wherein hold the 788-859 amino acids that is followed successively by promoting sexual gland hormone release peptide GnRH, TNF87 polypeptide, nuclear localization sequence peptide T AP and the conjugated protein SON of DNA to the C end from N, the aminoacid sequence of described non-virus carrier is shown in SEQ ID NO.5.
3, a kind of non-virus carrier, it comprises a kind of receptors ligand polypeptide, TNF87 polypeptide and a kind of targeting fusion rotein that is rich in positive amino acid whose polypeptide successively for holding from N to C end, wherein
Described receptors ligand polypeptide is promoting sexual gland hormone release peptide GnRH or it is by sequence Met
The fragment that Gln His Trp Ser Tyr Gly Leu Arg Pro forms;
Described TNF87 polypeptide is a fragment of sequence behind the tnf mutein, and it is the sequence by SEQ ID NO:2 coding,
Described nuclear localization sequence polypeptide is TAP, and wherein the encoding gene of TAP is SEQ IDNO:3 or its wild-type sequence,
Described be rich in positive amino acid whose polypeptide be the conjugated protein SON of DNA or its by the fragment that the 788-859 amino acids sequence of the conjugated protein SON of DNA is formed, wherein the 788-859 amino acids of SON is: KVKDTHEKSKKNKNRDKGEKEKKRDSSLRSRSKRSKSSEHKSRKRTSESRSRARKR SSKSKSHRSQTRSR.
4, non-virus carrier as claimed in claim 3, it holds the 788-859 amino acids that is followed successively by promoting sexual gland hormone release peptide GnRH, TNF87 polypeptide and the conjugated protein SON of DNA to the C end from N, and the aminoacid sequence of described non-virus carrier is shown in SEQ ID NO.7.
5, a kind of fusion gene, its each non-virus carrier of coding claim 1-4.
6, fusion gene as claimed in claim 5, its nucleotide sequence of non-virus carrier of its coding claim 2 is the nucleotide sequence shown in the SEQ ID NO.6.
7, fusion gene as claimed in claim 5, its nucleotide sequence of non-virus carrier of its coding claim 4 is the nucleotide sequence shown in the SEQ ID NO.8.
8, the recombinant that comprises each described fusion gene of claim 5-7.
9, recombinant as claimed in claim 8, it makes up for being connected by the fusion gene of pLSD and claim 6 is recombinated.
10, recombinant as claimed in claim 8, it makes up for being connected by the fusion gene of pLSD and claim 7 is recombinated.
11, by the host cell of recombinant conversion, transfection or the transduction of claim 8.
12, each the method for non-virus carrier of production claim 1-4 is included in the host cell of cultivating claim 11 under the condition of suitable expression, and separation and purification are by the described non-virus carrier of described host cell expression.
13, a kind of pharmaceutical composition that is used for the targeting therapy of tumor, described pharmaceutical composition comprise claim 1-4 each non-virus carrier and a kind of complex of expression type recombinant, described expression type recombinant comprises a kind of proteinic gene that pair cell has kill capability of expressing.
14, pharmaceutical composition as claimed in claim 13, the protein that wherein said pair cell has kill capability is pseudomonal toxin, diphtheria toxin, diphtherotoxin, Radix Phytolaccae, Ricin, or other all pair cells have the albumen from human body, animals and plants or microorganism of kill capability, or their active function zone, mutant or analog; And the protein or the polypeptide that have kill capability according to the pair cell of synthetic.
15, the protein that pharmaceutical composition as claimed in claim 14, wherein said pair cell have kill capability is pseudomonal toxin, or its second or the 3rd functional domain.
16, pharmaceutical composition as claimed in claim 15, the protein that wherein said pair cell has kill capability is the 3rd functional domain or its mutant of pseudomonal toxin, the aminoacid sequence of described mutant is shown in SEQ ID NO.:9, and nucleotide sequence is shown in SEQ IDNO:12.
17, pharmaceutical composition as claimed in claim 13, the expression type recombinant of wherein said expression type recombinant for making up based on pGL3, it passes through pGL3 and PEIII
MutOr pGL3, four copy HRE and PEIII
MutReorganization connects and makes up, wherein the DNA sequence of HRE gene shown in SEQ ID NO.10, PEIII
MutThe DNA sequence of gene is shown in SEQ IDNO.12.
18. pharmaceutical composition as claimed in claim 17, it also comprises GTTS or GTS, and the aminoacid sequence of wherein said GTTS is shown in SEQ ID NO:5, and the aminoacid sequence of GTS is shown in SEQ ID NO:7.
19, claim 13-18 each pharmaceutical composition the preparation to the application in the accurate targeted drug of malignant tumor.
20, application as claimed in claim 19, wherein said malignant tumor are to the hepatocarcinoma of GnRH receptor positive, breast carcinoma, colorectal cancer, cancer of pancreas, ovarian cancer, carcinoma of prostate, pituitary tumor.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031239404A CN100522250C (en) | 2003-06-11 | 2003-06-11 | N type non-viral vector and pharmaceutical composition containing same |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB031239404A CN100522250C (en) | 2003-06-11 | 2003-06-11 | N type non-viral vector and pharmaceutical composition containing same |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1566347A CN1566347A (en) | 2005-01-19 |
| CN100522250C true CN100522250C (en) | 2009-08-05 |
Family
ID=34468967
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB031239404A Expired - Fee Related CN100522250C (en) | 2003-06-11 | 2003-06-11 | N type non-viral vector and pharmaceutical composition containing same |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100522250C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101117637B (en) * | 2006-07-31 | 2011-01-26 | 中国人民解放军军事医学科学院毒物药物研究所 | Strict hypoxia targeting carrier and uses thereof |
| CN101134110B (en) * | 2006-09-01 | 2012-11-07 | 中国医学科学院基础医学研究所 | Q type non-viral vector and pharmaceutical composition containing the same |
| CN101429523B (en) * | 2007-11-07 | 2011-04-06 | 中国医学科学院基础医学研究所 | Type T non--viral vector and composite medicament containing the same |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1181422A (en) * | 1996-10-31 | 1998-05-13 | 上海市肿瘤研究所 | Gene transfer carrier structured by polypeptide in conjunction with growth factor receptor |
-
2003
- 2003-06-11 CN CNB031239404A patent/CN100522250C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1181422A (en) * | 1996-10-31 | 1998-05-13 | 上海市肿瘤研究所 | Gene transfer carrier structured by polypeptide in conjunction with growth factor receptor |
Non-Patent Citations (3)
| Title |
|---|
| 基因治疗中关于非病毒载体的最新设计策略. 梁红雁等.生物工程进展，第17卷第5期. 1997 * |
| 表皮生长因子介导的基因转移载体蛋白的制备. 方华圣等.中国医学科学院学报，第24卷第4期. 2002 * |
| 非病毒载体H1s-EGFc 的构建及其功能的初步研究. 郭蕾等.中华医学杂志，第83卷第10期. 2003 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1566347A (en) | 2005-01-19 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| ES2605380T3 (en) | OX40-trimeric immunoglobulin fusion protein and methods of use | |
| Jean et al. | Chitosan–plasmid nanoparticle formulations for IM and SC delivery of recombinant FGF-2 and PDGF-BB or generation of antibodies | |
| KR101464842B1 (en) | FUSION POLYPEPTIDE AGAINST EB VIRUS-INDUCED TUMOR AND COLICIN Ia MUTANT | |
| US20120195895A1 (en) | Fusion Protein of an Anti-CD20 Antibody Fab Fragment and Lidamycin, a Method for Preparing the Same, and the Use Thereof | |
| US8968727B2 (en) | Telomerase activity inhibiting peptide and manufacturing method and application thereof | |
| Shen Ni et al. | Selective apoptosis induction in MCF-7 cell line by truncated minimal functional region of Apoptin | |
| DK2474558T3 (en) | New antibiotic containing simulacrumantistof, preparation method and use thereof | |
| Wo et al. | Engineering probiotic-derived outer membrane vesicles as functional vaccine carriers to enhance immunity against SARS-CoV-2 | |
| CN113121704B (en) | Nanoparticle-based coronavirus vaccines | |
| US20160122420A1 (en) | Antibody display | |
| Ma et al. | DT390-triTMTP1, a novel fusion protein of diphtheria toxin with tandem repeat TMTP1 peptide, preferentially targets metastatic tumors | |
| CN100522250C (en) | N type non-viral vector and pharmaceutical composition containing same | |
| CN110144003A (en) | The polypeptide and its application that a kind of pair of Epstein-Barr virus LMP2A albumen n end cytoplasmic domain is specifically bound | |
| CN105820219B (en) | There is polypeptide and its application of binding affinity to HPV18 E7 albumen | |
| KR20230005265A (en) | Vaccines against SARS-COV-2 and their manufacture | |
| CN107827970A (en) | A kind of suppression FOXM1 anti-tumor protein peptide | |
| WO2023109835A1 (en) | Vegf-crm197 recombinant fusion protein vaccine, and preparation method therefor and use thereof | |
| CN103360497A (en) | Novel antitumor fusion protein vaccine, and preparation method and application thereof | |
| CN101134110B (en) | Q type non-viral vector and pharmaceutical composition containing the same | |
| KR101466875B1 (en) | The therapy for autoimmune disease using minicircle vector designed to express TNFR2 | |
| CN100553682C (en) | G type non-virus carrier and the pharmaceutical composition that comprises it | |
| CN113817071B (en) | EGFR-targeted TRAIL fusion protein and preparation method and application thereof | |
| CN105622762B (en) | Chemotactic factor-mediated O-type foot-and-mouth disease targeting compound epitope protein for cattle and vaccine | |
| CN104611296A (en) | Hybridoma for secreting anti-recombinant schistosoma japonica enolase specific monoclonal antibody as well as preparation method and application of hybridoma | |
| CN112190704B (en) | M cell targeting recombinant lactobacillus vaccine, preparation method and application |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090805 Termination date: 20120611 |