CN100516207C - Variants of beta-glucosidases - Google Patents

Abstract

The present invention relates to variants of a parent beta-glucosidase, comprising a substitution at one or more positions corresponding to positions 142, 183, 266, and 703 of amino acids 1 to 842 of SEQ ID NO: 2 or corresponding to positions 142, 183, 266, and 705 of amino acids 1 to 844 of SEQ ID NO: 70, wherein the variant has beta-glucosidase activity. The present invention also relates to nucleotide sequences encoding the variant beta-glucosidases and to nucleic acid constructs, vectors, and host cells comprising the nucleotide sequences.

Description

The variant of beta-glucosidase enzyme

Rights statement about the invention under the research and development of federal funding, finished

The basic contract DE-AC36-98GO10337 that the present invention provides according to Ministry of Energy (Department of Energy), subcontract No.ZCO-30017-02 makes under government supports.Government has certain right in the present invention.

Background of the present invention

Technical field

The present invention relates to the variant of beta-Polyglucosidase, its parental generation enzyme with respect to it has one or more improved character, and the nucleic acid of the described variant of encoding produces the method for the described variant of methods and applications of described variant.

Background technology

Mierocrystalline cellulose is that simple sugar glucose is passed through beta-1, the polymkeric substance that 4 keys are covalently bound.The enzyme of the dextran that many microorganisms hydrolysis beta-connect.These enzymes comprise endoglucanase (endoglucanase), cellobiose hydrolase (cellobiohydrolase) and beta-Polyglucosidase.Endoglucanase is opened it to be attacked by cellobiose hydrolase at random site digest cellulose polymkeric substance.Cellobiose hydrolase discharges the molecule of cellobiose subsequently successively from the end of cellulose polymer compound.Cellobiose is the water-soluble beta-1 of glucose, the dimer that 4-connects.The Beta-Polyglucosidase is hydrolyzed to glucose with cellobiose.

Cellulosicly formerly expect that alcoholic acid transforms easy operability with big content of starting materials, avoids burning or the advantage of the degree of cleaning of the desirability of landfill raw material and alcohol fuel.With timber, agricultural residue (agricultural residue), draft crop (herbaceous crop) and municipal solid waste (municipalsolid waste) raw material as alcohol production.These materials are mainly by Mierocrystalline cellulose, hemicellulose (hemicellulose) and xylogen (lignin).In case cellulose conversion is a glucose, the glucose of gained is ethanol by yeast fermentation easily.Because glucose is ethanol by various yeast fermentations easily, cellobiose is then not all right, and any remaining cellobiose is represented the loss of ethanol production when hydrolysis finishes.The more important thing is that cellobiose is effective inhibition of endoglucanase and cellobiose hydrolase.To produce for ethanol be extremely undesirable in the accumulation of cellobiose in the hydrolytic process.

The subject matter of cellobiose accumulation having become enzymatic hydrolysis is because produce a small amount of beta-Polyglucosidase of microorganisms of (cellulase-producing) of cellulase.A spot of beta-Polyglucosidase causes lacking the ability that cellobiose is hydrolyzed to glucose.Having adopted several method to be used in cellulose conversion is the amount of the process increase beta-Polyglucosidase of glucose.

A kind of method is that using microbe produces the beta-Polyglucosidase, the plain enzyme of described microorganisms small amount of fibers, and add the outer seedbed of beta-Polyglucosidase to endoglucanase and cellobiose hydrolase to strengthen hydrolysis.Yet for payable biomass (biomass) in the ethanol operation, required amount is that cost is too high.

Second method is that cellulose hydrolysis and glucose are carried out simultaneously by yeast fermentation.This process is known as synchronous glycosylation fermentation (SSF).In the SSF system, the fermentation of glucose with it from solution removal.Yet the SSF system is commercial also infeasible, because 28 ℃ of zymic service temperatures are too low for 50 ℃ of conditions that require.

The third method that overcomes the shortage of beta-Polyglucosidase is to cross expression beta-Polyglucosidase in the host, increases the output of beta-Polyglucosidase thus.

In the art, provide beta-Polyglucosidase variant can become a kind of advantage, described beta-Polyglucosidase variant is converted into monose, disaccharides and polysaccharide for cellulosic material and has improved character.Improved character comprises the temperature variant activity distribution (profile) of change, thermostability, pH activity, pH stability, substrate specificity, product specificity and chemical stability.

An object of the present invention is to provide the variant of beta-Polyglucosidase, it is compared with their parental generation enzyme has improved character.

Summary of the invention

The present invention relates to the variant of isolating parental generation beta-Polyglucosidase, be included in the replacement in one or more sites, described site is corresponding to the site in the amino acid/11-842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705, wherein said variant has the beta-glucosidase activity.

The present invention also relates to have the isolated polypeptide of beta-glucosidase activity, the amino acid/11 to 844 of the amino acid/11 to 842 of wherein said amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 is different in one or more sites, and described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.

The present invention also relates to encode variant beta-Polyglucosidase or have the isolating nucleotide sequence of the polypeptide of beta-glucosidase activity, and relate to nucleic acid construct, carrier and the host cell that comprises described nucleotide sequence.

The present invention also relates in host cell, produce the variant of parental generation beta-Polyglucosidase or have the method for the polypeptide of beta-glucosidase activity.

The present invention also relates to obtain the method for the variant of parental generation beta-Polyglucosidase, comprising:

(a) corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 or import corresponding to one or more sites of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 and to replace, wherein said variant has the beta-glucosidase activity; With

(b) reclaim described variant.

The present invention also relates to detergent composition, the polypeptide that it comprises beta-Polyglucosidase variant and has the beta-glucosidase activity.

The present invention also relates to plant, its coding beta-Polyglucosidase variant or have the polypeptide of beta-glucosidase activity.

The invention further relates at Mierocrystalline cellulose in the conversion of glucose, use beta-Polyglucosidase variant and polypeptide with beta-glucosidase activity.

Description of drawings

Fig. 1 shows the restriction map of pSATe101.

Fig. 2 shows the restriction map of pSATe111.

Fig. 3 shows the restriction map of pMJ04.

Fig. 4 shows the restriction map of pCaHj527.

Fig. 5 shows the restriction map of pMT2188.

Fig. 6 shows the restriction map of pCaHj568.

Fig. 7 shows the restriction map of pMJ05.

Fig. 8 shows the restriction map of pSMail30.

Fig. 9 shows the cDNA sequence (SEQ ID NO:1) of aspergillus oryzae (Aspergillus oryzae) beta-Polyglucosidase gene and the aminoacid sequence of deriving (SEQ ID NO:2) thereof.

Figure 10 shows Humicola insolens endoglucanase (endoglucanase) the V signal sequence of inferring (ATG initiator codon to Ala-21, SEQ ID NO:29) of 63bp.

Figure 11 shows the restriction map of pSMail35.

Figure 12 shows the restriction map of pALFd1.

Figure 13 shows the restriction map of pAILol.

Figure 14 shows the restriction map of pBANe10.

Figure 15 shows the restriction map of pAILo2.

Figure 16 shows the restriction map of pALFd3BG41.

Figure 17 shows the restriction map of pALFd3BG48.

Figure 18 shows the thermal stability determination of aspergillus oryzae beta-Polyglucosidase variant BG41 and BG48.

Figure 19 show sudden change G142S and H266Q independent with thermal stability result combination.

Figure 20 shows the restriction map of pEJG97.

Figure 21 shows Aspergillus fumigatus (Aspergillus fumigatus) genomic dna sequence of beta-Polyglucosidase and the aminoacid sequence of deriving (being respectively SEQ ID NOS:69 and 70).The signal peptide of prediction underlines, and the intron of prediction prints in italics.

Figure 22 shows the restriction map of pCR4Blunt-TOPOAfcDNA5 '.

Figure 23 shows the restriction map of pCR4Blunt-TOPOAfcDNA3 '.

Figure 24 shows the restriction map of pCR4Blunt-TOPOAfcDNA.

Figure 25 shows the restriction map of pALFd7.

Figure 26 shows the restriction map of pALFd6.

Figure 27 shows the restriction map of pEJG97AfumFAM3AG142S.

Figure 28 shows the restriction map of pALFd7G142S.

Figure 29 shows the restriction map of pEJG97AfumFAM3AH266Q.

Detailed Description Of The Invention

The variant of the parental generation beta-glucosidase that the present invention relates to separate, be included in the replacement in one or more sites, described site is corresponding to the site 142,183 in the amino acid/11-842 of SEQ ID NO:2,266 and 703 or corresponding to the site 142,183 in the amino acid/11-844 of SEQ ID NO:70,266 and 705, wherein said variant has the beta-glucosidase activity.

Definition

Term " beta-glucosidase " is defined herein as beta-D-glucoside glucose hydrolase (beta-D-glucoside glucohydrolase) (E.C.3.2.1.21), the hydrolysis of the terminal non-reducing beta-D-glucose residue of its catalysis and the release of beta-D-glucose. In order to realize purpose of the present invention, according to by Venturi et al, the basic step that 2002, J.BasicMicrobiol.42:55-66 describes is removed and is used different temperature and pH 5 here, measures the beta-glucosidase activity. A unit definition of beta-glucosidase activity is that at 25 ℃, pH 5 per minutes produce the beta-D-glucose of 1.0 μ mole.

Term " variant " is defined herein as the beta-glucosidase, and it comprises one or more changes, such as one or more specific sites in described polypeptide, and the one or more specific amino acid of replacement, insertion, disappearance and/or brachymemma.

Term " wild type " beta-glucosidase represents by naturally occurring microorganism, the beta-glucosidase of expressing such as the yeast found in nature or filamentous fungi.

Here term " parental generation " the beta-glucosidase of using refers to it is modified, and for example replaces, insertion, disappearance and/or brachymemma, to produce the beta-glucosidase of enzyme variants of the present invention. This term also refers to polypeptide that variant is compared and compared with it. Described parental generation can be naturally occurring (wild type) polypeptide, or it in addition can be it by the variant of any suitable method preparation. For example, parental generation albumen can be the variant of naturally occurring polypeptide, and it is modified in described amino acid sequence or changes. Parental generation also can be allele variant, and it is to occupy in two or more replacement forms of gene of identical chromosomal foci any. The allele variant of polypeptide is the polypeptide by the allele variant coding of the gene of correspondence.

Term " reset (shuffling) " refers to the restructuring of the nucleotide sequence between the nucleotide sequence of two sections or multistage homology, the nucleotide sequence of its generation restructuring (namely, through resetting the nucleotide sequence of circulation), described nucleotide sequence is compared the nucleotides with many changes with the nuclei originis nucleotide sequence.

Term " randomized (randomized) library ", " variant library " or " library " are defined herein as the library of variant polypeptide. Diversity in the variant library can produce in the sudden change of DNA three sub-levels by the gene of the described variant of coding, so just makes independent codon variation, for example passes through the primer of the randomized sequence of applying portion in the PCR reaction. Several method has been described, can be by making several nucleotide site variations and they being recombinated by these methods, create the library of diversified combination, for example, to such an extent as to can not be covered by single ((spiked) of admixture or (doped) that mix) Oligonucleolide primers away from getting too when these sites. These methods comprise the vitro recombination of using independent diversified gene segment, and as the 3rd page of WO 97/07205, the 8th to 29 row is described. These methods also comprise uses the library that the DNA rearrangement method creates full-length gene, and the some of them gene segment is combined, and wherein each sections can, for example, by admixture sudden change (spiked mutagenesis) (Stemmer, 1994, Nature370:389-391; US 5,811, and 238; US 5,605,793 and US 5,830,721) carry out variation. Can adopt the gene of encoding proteins " skeleton " (wild type parental generation polypeptide) as the template polynucleotides, and its oligonucleotides with one or more strands or two strands is combined, described at WO 98/41623 and WO 98/41622. Described single stranded oligonucleotide can carry out the randomization of part in synthetic process. Described double chain oligonucleotide can be and mixes multifarious PCR product in the specific region. In two kinds of situations, can reduce diversity with the corresponding sections of sequence of coding skelemin, import the average that changes with restriction.

Term " restructuring " is defined herein as a kind of method, and its amplifying nucleic acid is regional interrelated homology, produces DNA exchange in the chain between those sequences. In order to realize purpose of the present invention, according to by Paques and Haber, the step that 1999, Microbiology and Molecular Biology Reviews 63:349-404 sums up has been determined homologous recombination (homologous recombination). " homologous recombination " is defined herein as restructuring, wherein do not change in the homology zone inner nucleotide sequence with respect to the input nucleus nucleotide sequence. For perfect homologous recombination, the nucleic acid of sufficient amount should be contained in described zone, such as 100 to 1,500 base-pairs, preferred 400 to 1,500 base-pairs, and 800 to 1,500 base-pairs most preferably, its with corresponding nucleotide sequence height homology to increase the possibility of homologous recombination. Described restructuring also can produce by non--homologous recombination (non-homologous recombination). " non--homologous recombination " is defined herein as restructuring, and wherein the DNA that mixes the chain exchange of any pattern repairs and produces the nucleotide sequence that is different from any recombination sequence.

Term " improved character " is defined herein as the characteristic relevant with variant, and it is compared with parental generation beta-glucosidase is improved. The temperature variant activity distribution that these improved character include, but not limited to change, heat endurance, pH are active, pH is stable, substrate specificity, product specificity and chemical stability.

Term " improved heat is active " is defined herein as, and variant enzyme shows the change of the temperature variant activity distribution of beta-Polyglucosidase variant in concrete temperature with respect to the temperature variant activity distribution of parental generation beta-Polyglucosidase.Described hot activity value provides in the middle of the catalysis of hydrolysis reaction in temperature range carries out, the measuring method of the efficient of enzyme.The beta-Polyglucosidase has special temperature range, and in described scope, described albumen is stable and keeps its enzymic activity, but along with temperature rising albumen becomes unstable thereby torpescence more.In addition, can be quickened by elevated temperature by the initial rate of the catalytic reaction of beta-Polyglucosidase, it is measured by hot activity of determining variant.The active higher variant of heat causes hydrolysis rate to increase, and the required enzyme concn of time decreased that hydrolysis needs and/or hydrolysis reduces.Replacedly, have the thermoactive variant of reduction, can be at the temperature catalytic hydrolysis reaction of the optimum temperuture that is lower than the parental generation enzyme, the optimum temperuture of described parental generation enzyme is by the temperature variant activity distribution definition of parental generation.

Term " improved thermostability " is defined herein as, and variant enzyme was presented at after high temperature incubation for some time with respect to the parental generation enzyme, the reservation of enzymic activity.Such variant can maybe cannot show the hot activity distribution with respect to the variation of parental generation, and for example, it can have improved ability to carry out refolding after the high temperature incubation with respect to parental generation.

In preferred embodiments, 1.5-times at least of the hot specific activity parental generation enzyme height of described variant beta-Polyglucosidase, preferably 2-is doubly at least, more preferably 5-is doubly at least, most preferably at least 7-doubly and even most preferably 20-is doubly at least, carried out 15 hours with pH 5 at 60 ℃ as substrate when using methyl Umbrella ketone-beta-D-glucopyranoside (methylumbelliferyl-beta-D-glucopyranoside), come the comparison residual activity.

Term " improved product specificity " is defined herein as, and variant enzyme shows the products distribution (profile) that changes with respect to parental generation, and the products distribution of wherein said change has been improved the performance of variant with respect to parental generation in given application.Term " products distribution " is defined herein as the chemical composition of the reaction product that is produced by enzymatic hydrolysis.

Term " improved chemical stability " is defined herein as, and variant enzyme is presented under the condition that one or more chemical exist incubation after for some time, the reservation of enzymic activity, and described chemical is naturally occurring or synthetic, it reduces the enzymic activity of parental generation enzyme.Improved chemical stability also can cause the ability of variant stronger catalyzed reaction under the condition that above-mentioned chemical exists.

The routine of variant name

In the present invention, used the special numbering in amino-acid residue site in the beta-Polyglucosidase variant.For example, by comparing the aminoacid sequence of known beta-Polyglucosidase, can give the numbering of any amino-acid residue designated amino acid site in any beta-Polyglucosidase.

The numbering system of the aminoacid sequence of beta-Polyglucosidase is risen in application, described beta-Polyglucosidase is open in SEQ ID NO:2 or SEQ ID NO:70, with many other aminoacid sequence comparisons of beta-Polyglucosidase, can be presented at the site of amino-acid residue in the zone of structural homology of beta-Polyglucosidase.

The multiple ratio that can carry out protein sequence is right, for example, use " ClustalW " (Thompson, J.D., Higgins, D.G. and Gibson, T.J., 1994, CLUSTAL W:Improving the sensitivity ofprogressive multiple senquence alignment through senquence weighting, position-specific gap penalties and weight matrix choice, Nucleic Acids Research22:4673-4680).The multiple ratio that can carry out dna sequence dna is right, as template, replaces described amino acid with the codon from dna sequence dna of correspondence with the albumen comparison.

Usually the matched sequence comparison algorithm that adopts enough detects the similarity between the protein sequence, and the difference of described protein sequence is no more than point (Doolittle, 1992, the ProteinSci.1:191-200 of about 20-30% sequence identity; Brenner et al, 1998, Proc.Natl.Acad.Sci.USA.95,6073-6078).Yet, real homologous albumen with same folding and similar biological function usually differs certain point, this point traditional can not detect their relation (Lindahl and Elofsson, 2000, J.Mol Biol.295:613-615) based on the comparison of sequence.In the search based on sequence, the application searches program can obtain higher susceptibility, and the possible representative that described search utility is used protein family (distribution) comes search database.For example, the PSI-BLAST program produces distribution by (iterative) database search process of iteration, and can detect not closely related homologue (Atschul et al, 1997, Nucleic Acids Res 25:3389-3402).If the family of target protein or superfamily have one or more representatives in the protein structure database, so just can obtain higher susceptibility.Program is as GenTHREADER (Jones1999, J Mol.Biol.287:797-815; McGuffin and Jones, 2003, Bioinformatics 19:874-881) information of using from multiple source (PSI-BLAST, secondary structure prediction, texture ratio are to distributing and the solvation electromotive force) is input to neural network, and the structure of predicted query sequence is folding.Similarly, Goughet al., 2000, J, Mol, Biol, the method for 313:903-919 can be used for comparing with the model of the described superfamily that exists in the SCOP database sequence of unknown structure.These comparisons can be used to produce the homology model of target protein successively, and can adopt the such model of various instrument evaluations of exploitation for this purpose.

For the albumen of known structure, it is right that several instruments and resource can be used for retrieval and produce texture ratio.For example the albumen of SCOP superfamily has carried out the structure comparison, and those comparisons can obtain and can download.These comparisons can be used for, structurally with function on corresponding amino-acid residue in the albumen of superfamily of prediction same structure.This information, together with being derived from the homology modeling and the information of the search that distributes, when from a kind of albumen with targeted mutagenesis the relation of moving to get close to or during not closely related homologue, can be used for prediction which residue is suddenlyd change.

When describing multiple beta-Polyglucosidase of the present invention, use following nomenclature so that reference.In all situations, the IUPAC single-letter or the trigram amino acid abbreviations of generally acknowledging have been used.

Replace. for aminoacid replacement, adopted following nomenclature: [original amino acid, site, the amino acid of replacement].Therefore, the replacement of 226 usefulness L-Ala is designated as " Thr226Ala " or " T226A " to Threonine in the site.A plurality of sudden changes are by adding mark ("+") separately, for example, " Gly205Arg+Ser411Phe " or " G205R+S411F ", representative respectively in the site 205 usefulness arginine (R) substituted glycinic acids (G) and in the site 411 usefulness phenylalanines (F) replacements Serine (S).

Disappearance. for aminoacid deletion, adopted following nomenclature: [original amino acid, site *].Therefore, 195 disappearance glycine are designated as " Gly195* " or " G195* " in the site.A plurality of disappearances are separated by adding mark ("+"), for example, and " Gly195*+Ser411* " or " G195*+S411* ".

Insert. for aminoacid insertion, adopted following nomenclature: [original amino acid, site, primary amino acid, the new amino acid that inserts].Therefore, after the glycine in site 195, insert Methionin and be designated as " Gly195GIyLys " or " G195GK ".A plurality of amino acid whose insertions are designated as [original amino acid, site, primary amino acid, the new amino acid #1 that inserts, the new amino acid #2 that inserts; Deng].For example, after the glycine in site 195, insert Methionin and L-Ala is designated as " Gly195GIyLysAla " or " G195GKA ".

In these situations, the amino-acid residue of insertion is by before the amino-acid residue that is inserted, and the site that lowercase is added amino-acid residue is numbered and is numbered.In above-mentioned example, so described sequence can be:

Parental generation	Variant
			195	195 195a 195b
G	G-K-A

Degeneracy mark (Degenerate indication). for the degeneracy mark, wherein insert the amino-acid residue identical, occur degeneracy in the name with already present amino-acid residue.For example, after glycine, insert glycine in the above-mentioned example and can be expressed as " G195GG ".Suppose that L-Ala is present in site 194, same actual change can be expressed as " A194AG " equally:

	Parental generation	Variant
			Numbering I	194 195	194 195 195a

Sequence	A-G	G-K-A
			Numbering II		194 194a 195

Such example is apparent to a skilled reader, and the mark of the insertion correspondence of mark " G195GG " and this class thereby refer to comprise this equal degeneracy mark.

If the aminoacid sequence sections repeats at the parental generation polypeptide and/or in described variant, equal degeneracy mark appears, and when the change of enumerating except that inserting, also like this such as the situation of disappearance and/or replacement.For example, two successive amino acid of disappearance " AG " can be designated as " A194*+G195* " or " A196*+G197* " in the sequence " AGAG " of site 194-97:

	Parental generation	Variant
			Numbering I	194 195 196 197	194 195
Sequence	A-G-A-G	A-G
			Numbering II		196 197

A plurality of modifications. the variant that comprises a plurality of modifications adds mark ("+") separately, and for example, " Arg170Tyr+GlyS95Glu " or " R170Y+G195E " is expressed as site 170 and 195 and replaces arginine and glycine with tyrosine and L-glutamic acid respectively.Thus, " Tyr167Giy; Ala; Ser; Thr+Arg170Gly; Ala; Ser, Thr " is designated as following variant: " Tyr167Gly+Arg 170Gly ", " Tyr 167Gly+Arg 170Ala ", " Tyr167Gly+Arg 170Ser ", " Tyr 167Gly+Arg 170Thr ", " Tyr 167Ala+Arg 170Gly ", " Tyr167Ala+Arg 170Ala ", " Tyr167Ala+Arg 170Ser ", " Tyr167Ala+Arg 170Thr ", " Tyr167Ser+Arg 170Gly ", " Tyr 167Ser+Arg 170Ala ", " Tyr167Ser+Arg 170Ser ", " Tyr167Ser+Arg 170Thr ", " Tyr167Thr+Arg170Gly ", " Tyr167Thr+Arg170Ala ", " Tyr167Thr+Arg170Ser " and " Tyr167Thr+Arg170Thr ".

This nomenclature is especially relevant with the modification that comprises replacement, inserts or lack amino-acid residue, and described amino-acid residue has special ubiquity (specific common properties).It is amino acid modified that such modification refers to guard.The conservative example of modifying is within basic aminoacids group (arginine, Methionin and Histidine), acidic amino acid group (L-glutamic acid and aspartic acid), polare Aminosaeren group (glutamine and l-asparagine), hydrophobic amino acid group (leucine, Isoleucine and Xie Ansuan), aromatic amino acid group (phenylalanine, tryptophane and tyrosine) and p1 amino acid group (glycine, L-Ala, Serine, Threonine and methionine(Met)).Usually not changing the amino acid modified of specific activity is being known in the art, and for example, by H.Neurath and R.L.Hill, 1979, In, The Proteins, Academic Press, New York describes.The most normal generation changes into Ala/Ser, Val/Ile, Asp/Glu, Thr/Ser, Ala/Gly, Ala/Thr, Ser/Asn, Ala/Val, Ser/Gly, Tyr/Phe, Ala/Pro, Lys/Arg, Asp/Asn, Leu/Ile, Leu/Val, Ala/Glu and Asp/Gly and reverse (Taylor, 1986, Journal of TheoreticalBiology 119:205-218; Http:// www.compbio.dundee.ac.uk/papers/amas/Amas3d.html).

Parental generation Beta-Polyglucosidase

In the present invention, described parental generation beta-Polyglucosidase is the polypeptide that (a) comprises aminoacid sequence, and the amino acid/11-842 of described amino acid and SEQ ID NO:2 or the amino acid/11-844 of SEQ ID NO:70 have at least 70% identity; Or (b) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the low stringency condition and the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or the hybridization of their complementary strand.

Aspect first, parental generation beta-Polyglucosidase comprises aminoacid sequence, the amino acid/11-844 of the amino acid/11-842 of described aminoacid sequence and SEQ ID NO:2 or SEQ ID NO:70 (promptly, described mature polypeptide) has about at least 70% identity degree, preferably about at least 75%, more preferably about at least 80%, more preferably about at least 85%, even more preferably about at least 90%, most preferably about at least 95%, and even most preferably about at least 97%, described aminoacid sequence has beta-glucosidase activity (hereinafter being called " homeopeptide ").In preferred embodiments, described homeopeptide has aminoacid sequence, its amino acid/11-844 with the amino acid/11-842 of SEQ ID NO:2 or SEQ ID NO:70 have 5 amino acid whose different, preferred 4 amino acid, more preferably 3 amino acid, more preferably 2 amino acid also, and 1 amino acid most preferably.In order to realize purpose of the present invention, the identity degree between two aminoacid sequences by the Clustal method (Higgins, 1989, C4BI055:151-153), use LASERGENE with identity table and following a plurality of comparison parameters ^TMMEGALIGN ^TMSoftware (DNASTAR, Inc., Madison, WI) determine: breach (gap) was penalized 10 fens and notch length was penalized 10 fens.Pairing comparison parameter is Ktuple=1, breach point penalty=3, window (window)=5 and diagonal lines (diagonal)=5.

Substantially (substantially) homologous parental generation beta-Polyglucosidase can have one or more aminoacid replacement, disappearance or interpolation.These change preferred less natural (minor nature), and it is that foregoing conserved amino acid replaces and three-Wei of described albumen of not remarkably influenced or polypeptide folds or active other replacements; Be generally 1 to about 30 amino acid whose little disappearances; And the little extension of amino-end or carboxyl-end, such as the little connection peptides of the about 20-25 of methionine residues, the as many as residue of amino-end or be convenient to the little extension (affinity labelling) of purifying, such as poly--Histidine district (poly-histidine tract), or albumin A (Nilsson et al., 1985, EMBO J.4:1075; Nilsson et al., 1991, MethodsEnzymol.198:3.Also referring to, usually, Ford et al, 1991, Protein Expression andPurification 2:95-107.

Though above-mentioned change be preferably less natural, such change also can be real natural, such as the extension of the syzygy of as many as 300 or more a plurality of amino acid whose bigger polypeptide as amino-end or carboxyl-end.

Except 20 standard amino acid, off-gauge amino acid (such as 4-Hydroxyproline, 6-N-methyllysine, 2-aminoisobutyric acid, isovaline and alpha-methyl Serine) can replace the amino-acid residue of wild-type beta-Polyglucosidase.A limited number of non-conserved amino acid, can't help genetic code amino acids coding and non-natural amino acid and can replace amino-acid residue." non-natural amino acid " after albumen is synthetic through modifying, and/or have the chemical structure that is different from standard amino acid at their side chain.Non-natural amino acid can chemosynthesis, and it is preferred commercial available, and comprise pipecolic acid (pipecolic acid), thiazolidine carboxylic acid (thiazolidine carboxylic acid), dehydroproline (dehydroproline), 3-and 4-methylproline and 3,3-dimethyl proline(Pro).

Preferably, parental generation beta-Polyglucosidase comprises the aminoacid sequence of SEQ ID NO:2 or SEQ ID NO:70; Or its allelic variant; Or it has the fragment of beta-glucosidase activity.In preferred embodiments, the parental generation polypeptide comprises the aminoacid sequence of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, the parental generation polypeptide comprises the amino acid/11-842 of SEQ ID NO:2 or the amino acid/11-844 of SEQ ID NO:70; Or its homotopic variant; Or it has the fragment of beta-glucosidase activity.In another preferred embodiment, the parental generation polypeptide comprises the amino acid/11-842 of SEQ ID NO:2 or the amino acid/11-844 of SEQ ID NO:70.In another preferred embodiment, the parental generation polypeptide is by the aminoacid sequence of SEQ ID NO:2 or SEQ ID NO:70; Or the fragment that its homotopic variant or its have a beta-glucosidase activity is formed.In another preferred embodiment, the parental generation polypeptide is made up of the aminoacid sequence of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, the parental generation polypeptide is by the amino acid/11-842 of SEQ ID NO:2 or amino acid/11-844 or its homotopic variant of SEQ ID NO:70; Or its fragment with beta-glucosidase activity is formed.In another preferred embodiment, the parental generation polypeptide is made up of the amino acid/11-842 of SEQ ID NO:2 or the amino acid/11-844 of SEQID NO:70.In another preferred embodiment, the parental generation polypeptide is by being included in nucleotide sequence coded among the intestinal bacteria DSM 14240, and wherein said nucleic acid sequence encoding has the polypeptide of beta-glucosidase activity.In another preferred embodiment, the parental generation polypeptide is by the mature polypeptide encoded district coding that is included among the intestinal bacteria DSM 14240.In another preferred embodiment, the parental generation polypeptide is by being included in nucleotide sequence coded among the plasmid pEJG113, described plasmid pEJG113 is included among the intestinal bacteria NRRL B-30695, and wherein said nucleic acid sequence encoding has the polypeptide of beta-glucosidase activity.In another preferred embodiment, the parental generation polypeptide is that described plasmid pEJG113 is included among the intestinal bacteria NRRLB-30695 by the mature polypeptide encoded district coding that is included among the plasmid pEJG113.

The fragment of SEQ ID NO:2 or SEQ ID NO:70 is to have one or more amino acid whose polypeptide, and described amino acid is the N-terminal of aminoacid sequence from then on and/or carboxyl-terminal deletion.Preferably, fragment contains at least 770 amino-acid residues, more preferably at least 800 amino-acid residues, and at least 830 amino-acid residues most preferably.

Aspect second, parental generation beta-Polyglucosidase is by nucleotide sequence coded, described nucleotides sequence is listed under the low stringency condition, stringency condition in preferred, more preferably-Gao stringency condition, also more preferably high stringency condition, and under the most preferably very high stringency condition, hybridize with nucleotide probe, described nucleotide probe under identical condition with (i) Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQID NO:71, (ii) genome nucleotide sequence, it comprises the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, (iii) (i) or subsequence (ii), or (iv) (i), (ii) or complementary strand (iii) hybridization (J.Sambrook, E.F.Fritsch, and T.Maniatus, 1989, Molecular Cloning, A Laboratory Manual, 2d edition, Cold Spring Harbor, New York).The subsequence of SEQ ID NO:1 can be at least 100 successive Nucleotide, or preferred at least 200 successive Nucleotide.And described subsequence codified has the polypeptide fragment of beta-glucosidase activity.

The subsequence of SEQ ID NO:1 or SEQ ID NO:71, or its homologue, be from 5 '-and/or the nucleotide sequence of the one or more Nucleotide of 3 '-terminal deletion.Preferably, subsequence comprises at least 2310 Nucleotide, more preferably at least 2400 Nucleotide, and at least 2490 Nucleotide most preferably.

The parental generation polypeptide also can be the homotopic variant of the polypeptide with beta-glucosidase activity, and homotopic variant means any in two or more replacement forms of the gene that occupies identical chromosomal foci.Homotopic variation takes place natively by sudden change, and can produce polymorphism (polymorphism) in population.Transgenation can be the polypeptide that reticent (not changing encoded polypeptides) or codified have the aminoacid sequence of change.The homotopic variant of polypeptide is by the allele variant coding of gene.

The nucleotide sequence of SEQ ID NO:1 or its subsequence, and the aminoacid sequence of SEQ ID NO:2 or SEQ IDNO:70, or its fragment can be used for designing nucleotide probe, in the bacterial strain of identifying and never belonging to together or plant, according to method well-known in the art, clones coding has the DNA of the parental generation polypeptide of beta-glucosidase activity.Especially, such probe can be used for belonging to target or the genomic dna or the cDNA of kind are hybridized, and is the Southern trace step of standard then, to identify and to be separated in wherein corresponding gene.Such probe can be considerably shorter than described complete sequence, but should be at least 15, and preferably at least 25, and the more preferably length of at least 35 Nucleotide.Also can adopt long probe.Dna probe and rna probe can adopt.Usually the described probe of mark is used to detect corresponding gene (for example, usefulness ³²P, ³H, ³⁵S, vitamin H or avidin (avidin)).

But from genomic dna or the cDNA screening DNA that such other biological system is equipped with, described DNA and above-mentioned probe hybridization, and coding has the parental generation polypeptide of beta-glucosidase activity.Genomic dna or from other DNA of such other biological body can pass through agarose or polyacrylamide gel electrophoresis, or other separation methods separates.DNA or separated DNA from described library can be transferred to and are fixed on soluble cotton (nitrocellulose) or other suitable carriers materials.In order to identify and SEQ ID NO:1 or SEQ ID NO:71, or its subsequence homologous clone or DNA, described solid support material is used for the Southern trace.In order to realize purpose of the present invention, the described nucleotide sequence of hybridization expression, in low stringency condition to the very high stringency condition, nucleotide probe hybridization with mark, described nucleotide probe is corresponding to the nucleotide sequence that shows in SEQ ID NO:1 or SEQ ID NO:71, its complementary strand, or its subsequence.The molecule that the probe of reflectivity-mark is hybridized with it can be used, and for example, X-ray film detects.

In preferred embodiments, described nucleotide probe is a nucleotide sequence, the polypeptide of its coding SEQ IDNO:2 or SEQ ID NO:70, or its subsequence.In another preferred embodiment, described nucleotide probe be SEQ ID NO:1 or SEQ ID NO:71. in another preferred embodiment, described nucleotide probe is the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71.In another preferred embodiment, described nucleotide probe is included in the nucleotide sequence among the intestinal bacteria DSM 14240, and wherein said nucleic acid sequence encoding has the polypeptide of beta-glucosidase activity.In another preferred embodiment, described nucleotide probe is included in the mature polypeptide encoded district among the intestinal bacteria DSM 14240.In another preferred embodiment, described nucleotide probe is included in the nucleotide sequence among the plasmid pEJG113, described plasmid pEJG113 is included among the intestinal bacteria NRRL B-30695, and wherein said nucleic acid sequence encoding has the polypeptide of beta-glucosidase activity.In another preferred embodiment, described nucleotide probe is included in the mature polypeptide encoded district among the plasmid pEJG113, and described plasmid pEJG113 is included among the intestinal bacteria NRRL B-30695.

For at least 100 Nucleotide long probes of length, low stringency condition to very high stringency conditional definition is, at 42 ℃, at 5 * SSPE, 0.3%SDS, 200 μ g/ml salmon sperm DNA shearing and sex change, for low stringency 25% methane amide, in the neutralization-Gao stringency 35% methane amide, in high and very high stringency 50% methane amide, carrying out prehybridization and hybridization, is the Southern trace step of standard then.

Long probe at least 100 Nucleotide of length, described solid support material is finally with 0.2 * SSC, 0.2%SDS, preferably at least at 50 ℃ (low stringencies), more preferably at least at 55 ℃ (middle stringencies), more preferably at least 60 ℃ (in-Gao stringency), even more preferably at least at 65 ℃ (high stringencies), and most preferably at least 70 ℃ (very high stringency) washing three times, each 15 minutes.

For the short probe of about 15 Nucleotide of length to about 70 Nucleotide, the stringency conditional definition is than the T that calculates with Bolton and McCarthy (1962, Proceedings of the National Academy ofSciences USA 48:1390) _m Low 5 ℃ to 10 ℃, at 0.9M NaCl, 0.09MTris-HCl pH 7.6,6mM EDTA, 0.5%NP-40,1 * denhardt solution (Denhardt ' ssolution), 1mM trisodium phosphate (sodium pyrophosphate), 1mM monobasic sodium phosphate (sodiummonobasic phosphate) is in the yeast rna of 0.1mM ATP and the every ml of 0.2mg, carrying out prehybridization, hybridization and post-hybridization washing (washing post-hybridization), is the Southern trace step of standard then.

To the short probe of about 70 Nucleotide, described solid support material adds among the 0.1%SDS at 6 * SSC and washed one time 15 minutes, and is being lower than the T of calculating with 6 * SSC for about 15 Nucleotide of length _m5 ℃ to 10 ℃ washed twice, each 15 minutes.

Parental generation beta-Polyglucosidase can obtain from the microorganism of any genus.In order to realize purpose of the present invention, the term of this application " from ... in obtain " together with the source that provides, can refer to produce by described source or by cell, in described cell, insert nucleotide sequence from described source by nucleotide sequence coded parental generation beta-Polyglucosidase.In preferred embodiments, parental generation beta-Polyglucosidase be secreted into extracellular.

Parental generation beta-Polyglucosidase can be fungi beta-Polyglucosidase.In a more preferred embodiment, described fungi beta-Polyglucosidase is a yeast beta-Polyglucosidase, such as Candida (Candida), genus kluyveromyces (Kluyveromyces), Pichia (Pichia), saccharomyces (Saccharomyces), Schizosaccharomyces (Schizosaccharomyces) or Yarrowia beta-Polyglucosidase.In another preferred embodiment, described fungi beta-Polyglucosidase is a filamentous fungus beta-Polyglucosidase, such as the mould genus of branch top spore (Acremonium), Agaricus (Agaricus), Alternaria (Alternaria), Aspergillus (Aspergillus), grape seat chamber Pseudomonas (Botryospaeria), Ceriporiopsis, Chaetomidium, Claviceps (Claviceps), cochliobolus belongs to (Cochliobolus), Coprinopsis, Coptotermes, Corynascus, Cryphonectria, Diplodia (Diplodia), Exidia (Exidia), fusarium (Fusarium), Gibberella (Gibberella), Holomastigotoides, Humicola (Humicola), rake Pseudomonas (Irpex), Lentinula, Leptospaeria, Magnaporthe, Melanocarpus, Meripilus, myceliophthora (Myceliophthora), Neurospora (Neurospora), Penicillium (Penicillium), Phanerochaete, Poitrasia, false black Peziza (Pseudoplectania), false Trichonympha (Pseudotrichonympha), Rhizomucor (Rhizomucor), the capital spore belongs to (Scytalidium), Talaromyces, thermophilic ascomycete belongs to (Thermoascus), Thielavia (Thielavia), Trichoderma (Trichoderma), the Peziza that becomes mildewed (Trichophaea), Verticillium (Verticillium), Volvariella (Volvariella) or Xylaria (Xylaria) beta-Polyglucosidase.

In a more preferred embodiment, parental generation beta-Polyglucosidase is saccharomyces carlsbergensis (Saccharomycescarlsbergensis), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharomyces diastaticus (Saccharomycesdiastaticus), Saccharomyces douglasii, Crewe not yeast (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or Saccharomyces oviformis beta-Polyglucosidase.

In another preferred embodiment, parental generation beta-Polyglucosidase is Acremoniumcellulolyticus, microorganism Aspergillus aculeatus (Aspergillus aculeatus), Aspergillus awamori (Aspergillus awamori), Aspergillus fumigatus (Aspergillus fumigatus), smelly aspergillus (Aspergillus foetidus), Aspergillus fumigatus (Aspergillusfumigatus), aspergillus japonicus (Aspergillus japonicus), Aspergillus nidulans (Aspergillus nidulans), aspergillus niger (Aspergillus niger), aspergillus oryzae (Aspergillus oryzae), bar spore shape sickle spore (Fusariumbactridioides), Fusarium cerealis, Fusarium crookwellense, machete sickle spore (Fusariumculmorum), fusarium graminaria (Fusarium graminearum), Fusarium graminum, different spore sickle spore (Fusarium heterosporum), albizzia sickle spore (Fusarium negundi), point sickle spore (Fusarium oxysporum), racemosus sickle spore (Fusarium reticulatum), pink sickle spore (Fusariumroseum), Williams Elder Twig sickle spore (Fusarium sambucinum), colour of skin sickle spore (Fusariumsarcochroum), fusarium solanae (Fusarium solani), intend branch spore sickle spore (Fusariumsporotrichioides), Fusarium sulphureum, Fusarium torulosum, Fusariumtrichothecioides, Fusarium venenatum, ash humicola lanuginosa (Humicola grisea), Humicolainsolens, Humicola lanuginosa, milky white rake bacterium (Irpex lacteus), rice black wool mould (Mucormiehei), the thermophilic silk mould (Myceliophthora thermophila) of ruining, Neuraspora crassa (Neurosporacrassa), penicillium funiculosum (Penicillium funiculosum), penicillium purpurogenum (Penicilliumpurpurogenum), Phanerochaete chrysosporium, Split-gill (Schizophyllumcommune), Sclerotium rolfsii (Sclerotium rolfsii), Sporotrichum cellulophilum, Talaromyces emersonii, autochthonal shuttle spore mould (Thielavia terrestris), Trichodermaharzianum, healthy and free from worry wood mould (Trichoderma koningii), Trichoderma longibrachiatum, Trichoderma reesei or viride (Trichoderma viride) beta-Polyglucosidase.

In preferred embodiment also, described parental generation beta-Polyglucosidase is an aspergillus oryzae beta-Polyglucosidase, and the aspergillus oryzae beta-Polyglucosidase of SEQ ID NO:2 or its mature polypeptide most preferably.In another the most preferred embodiment, described parental generation beta-Polyglucosidase is by being contained in the nucleotide sequence coded of intestinal bacteria DSM14240, wherein said nucleotide sequence coded polypeptide with beta-glucosidase activity.In another the most preferred embodiment, described parental generation beta-Polyglucosidase is by the mature polypeptide encoded district coding that is contained in intestinal bacteria DSM 14240.

In an also preferred embodiment, parental generation beta-Polyglucosidase is an Aspergillus fumigatus beta-Polyglucosidase, and the Aspergillus fumigatus beta-Polyglucosidase of SEQ ID NO:70 or its mature polypeptide most preferably.In another the most preferred embodiment, parental generation beta-Polyglucosidase is by being included in nucleotide sequence coded among the plasmid pEJG113, described plasmid pEJG113 is included among the intestinal bacteria NRRL B-30695, wherein said nucleotide sequence coded polypeptide with beta-glucosidase activity.In another the most preferred embodiment, parental generation beta-Polyglucosidase is by the mature polypeptide encoded district coding that is included among the plasmid pEJG113, and described plasmid is included among the intestinal bacteria NRRL B-30695.

Be appreciated that for above-mentioned bacterial classification, the present invention includes its perfect state and imperfect state and other taxonomic equivalents, for example, anamorph, and no matter their known kind names.Those skilled in the art will easily distinguish the identity of suitable equivalent.

The bacterial strain of these bacterial classifications is easily obtained at many culture collections center by the public, such as American type culture collection (the American Type Culture Collection) (ATCC), DeutscheSammiung von Mikroorganismen und Zellkulturen GmbH (DSM), CentraalbureauVoor Schimmelcultures (CBS) and agricultural research institute preservation center (Agricultural ResearchService Patent Culture Collection, Northern Regional Research Center) are (NRRL).

Parental generation beta-Polyglucosidase also can be identified from other sources and be obtained, described source from nature (for example comprises, soil, compost, water etc.) isolating microorganism or directly use the DNA sample that above-mentioned probe obtains from natural materials (for example, soil, compost, water etc.).Directly the method from natural living environment separate microorganism and DNA is well-known in the art.So the nucleotide sequence of coding beta-Polyglucosidase can be by similarly screening another kind of microorganism or blended DNA sample obtains.In case detect the nucleotide sequence of coding beta-Polyglucosidase with suitable probe as herein described, this sequence can by use the known method of those of ordinary skill in the art separate or clone (referring to, for example, J.Sambrook, E.F.Fritsch, and T.Maniatus, 1989, Molecular Cloning, A LaboratoryManual, 2d edition, Cold Spring Harbor, New York).

As defined herein, " isolating " beta-Polyglucosidase is the polypeptide of essentially no other non--beta-Polyglucosidase polypeptide, for example, at least about 20% purity, preferably about at least 40% purity, more preferably about 60% purity, also more preferably about 80% purity, most preferably about 90% purity and even most preferably about 95% purity, as measuring by SDS-PAGE.

Parental generation beta-Polyglucosidase also can comprise the fusion polypeptide that the polypeptide of fusion maybe can cut, and wherein another kind of polypeptide is blended in described polypeptide or its segmental N-end or C-end.The polypeptide that merges is that the nucleotide sequence (or its part) by the another kind of polypeptide of will encoding is blended in nucleotide sequence of the present invention (or its part) and is prepared.The method that produces fusion polypeptide is well-known in the art, and comprises that the encoding sequence with coding said polypeptide connects, so that they are arranged in framework, and the polypeptide of under the control of same promotor and terminator, expressing described fusion.Fusion rotein also can be used interior albumen (intein) method and make up, and wherein merges to produce (Cooperetal, 1993, EMBOJ 12:2575-2583 after translation; Dawsonet al, 1994, Science 266:776-779).

Variant

In the present invention, the isolating variant of parental generation beta-Polyglucosidase is included in the site 142 corresponding to the amino acid/11 to 842 of SEQ ID NO:2,183,266 and 703 or corresponding to the site 142 of the amino acid/11 to 844 of SEQ ID NO:70,183, the replacement in one or more sites of 266 and 705, wherein said variant has the beta-glucosidase activity, comprise aminoacid sequence, the aminoacid sequence of itself and parental generation beta-Polyglucosidase has about at least 70%, preferably about at least 75%, more preferably about at least 80%, more preferably about at least 85%, also more preferably about at least 90%, most preferably about at least 95%, and even about at least 97% identity degree most preferably.In order to realize purpose of the present invention, the identity degree of two aminoacid sequences is used the LASERGENE with identity table and following a plurality of comparison parameters by Clustal method (Higgins, 1989, CABIOS 5:151-153) ^TMMEGALIGN ^TMSoftware (DNASTAR, Inc., Madison, WI) determine: breach was penalized 10 fens and notch length was penalized 10 fens.Pairing comparison parameter is Ktuple=1, breach point penalty=3, window (window)=5 and diagonal lines (diagonal)=5.

The primary amino acid of parental generation beta-Polyglucosidase can be identified (Cunningham and Wells, 1989, Science 244:1081-1085) such as positional mutation or L-Ala-scanning sudden change according to method well-known in the art.In a kind of method in back, single alanine mutation is introduced at intramolecular each residue, and the biological activity (that is beta-glucosidase activity) of measuring the mutating molecule that obtains is to identify the active crucial amino-acid residue for described molecule.Also referring to, Hilton et al, 1996, J.Biol Chem.271:4699-4708.The interactional avtive spot of described enzyme or other biological also can be measured by the physical analysis of structure, as the method by nucleus magnetic resonance (nuclear magnetic resonance), crystallography (crystallography), electron diffraction (electron diffraction) or photoaffinity labeling (photoaffinitylabeling), measure together with the contact site amino acid that sudden change is inferred.Referring to, for example, de Vos et al., 1992, Science 255:306-312; Smith et al, 1992, J.Mol.Biol.224:899-904; Wlodaver et al, 1992, FEBS Lett.309:59-64.The identity of primary amino acid also can be inferred by the identity analysis of the polypeptide relevant with polypeptide of the present invention.

Can carry out single or multiple aminoacid replacement, and use known sudden change, reorganization and/or rearrangement, detect succeeded by relevant screening step, described screening step such as those by Reidhaar-Olson and Sauer, 1988, Science 241:53-57; Bowie and Sauer, 1989, Proc Natl Acad SciUSA 86:2152-2156; WO 95/17413 or WO 95/22625 are disclosed.Other methods that can adopt comprise fallibility PCR (error-prone PCR), phage display (phage display) (for example, Lowman et al, 1991, Biochem.30:10832-10837; U.S. Patent No. 5,223,409; WO92/06204) and regional rite-directed mutagenesis (region-directed mutagenesis) (Derbyshire et al, 1986, Gene 46:145, Ner et al, 1988, DNA 7:127).

Sudden change/rearrangement can be used the screening method combination of high yield, automatization, to detect the activity by the polypeptide of host cell expression, the clone, sudden change.The dna molecular of the sudden change of coding active polypeptide can be used the standard method in present technique field and reclaim from host cell, and order-checking apace.These methods allow important single amino acids residue in the rapid detection target polypeptides, and can be applicable to the polypeptide of unknown structure.

In preferred embodiments, the number of aminoacid replacement comprises preferred 4 replacements in the variant of the present invention, more preferably 3 replacements, also more preferably 2 replacements, and most preferably 1 replacement.In another preferred embodiment, in the variant of the present invention the number of aminoacid replacement by preferred 4 replacements, also more preferably 3 replacements, also more preferably 2, and most preferably 1 replace and form.

In preferred embodiments, variant of the present invention is made up of 741 to 750,751 to 760,761 to 770,771 to 780,781 to 790,791 to 800,801 to 810,811 to 820,821 to 830,831 to 840,841 to 850,851 to 860,861 to 870,871 to 880,881 to 890,891 to 900,901 to 910,911 to 920,921 to 930,931 to 940 or 941 to 950 amino acid.

Variant of the present invention can further comprise the one or more disappearances and/or the insertion of described aminoacid sequence.

In preferred embodiments, the variant of parental generation beta-Polyglucosidase is included in corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ IDNO:2 and 703 or corresponding to the replacement in one or more sites of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, the variant of parental generation beta-Polyglucosidase is included in corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ IDNO:2 and 703 or corresponding to the replacement in two or more sites of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, the variant of parental generation beta-Polyglucosidase is included in corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQID NO:2 and 703 or corresponding to the replacement in three or three above sites of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, the variant of parental generation beta-Polyglucosidase comprises at least corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 or corresponding to the replacement in the site of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

In preferred embodiments, described variant is included in the replacement corresponding to the site in the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In a more preferred embodiment, described variant is included in the site corresponding to the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In preferred embodiment also, described variant comprises that Ser is as at the substituent corresponding to the site in the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In a most preferred embodiment, described variant comprises the replacement G142S of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.

In another preferred embodiment, described variant is included in the replacement corresponding to the site in the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, described variant is included in the site corresponding to the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg is as at the substituent corresponding to the site in the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement Q183R of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ IDNO:70.

In another preferred embodiment, described variant is included in the replacement corresponding to the site in the site 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, described variant is included in the site corresponding to the site 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gl y, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Gln is as at the substituent corresponding to the site in the site 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement H266Q of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ IDNO:70.

In another preferred embodiment, described variant is included in the replacement corresponding to the site in the site 703 of the amino acid/11 to 842 of SEQ ID NO:2.In another preferred embodiment, described variant is included in the site corresponding to the site 703 of the amino acid/11 to 842 of SEQ ID NO:2, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Gly is as at the substituent corresponding to the site in the site 703 of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement D703G of the amino acid/11 to 842 of SEQID NO:2.

In another preferred embodiment, described variant is included in the replacement corresponding to the site in the site 705 of the amino acid/11 to 844 of SEQ ID NO:70.In another preferred embodiment, described variant is included in the site corresponding to the site 705 of the amino acid/11 to 844 of SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Gly is as at the substituent corresponding to the site in the site 705 of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 183.In another preferred embodiment, described variant is included in corresponding to the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ IDNO:2 or SEQ ID NO:70 and 183 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser and Arg are as the substituent in the site of the site 142 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ ID NO:70 and 183.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described variant is included in corresponding to the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ IDNO:2 or SEQ ID NO:70 and 266 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser and Gln are as the substituent in the site of the site 142 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ ID NO:70 and 266.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 142 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser and Gly are as the substituent in the site of the site 142 of the amino acid/11 to 842 that corresponds respectively to SEQ IDNO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 142 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser and Gly are as the substituent in the site of the site 142 of the amino acid/11 to 844 that corresponds respectively to SEQ IDNO:70 and 705.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described variant is included in corresponding to the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ IDNO:2 or SEQ ID NO:70 and 266 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg and Gln are as the substituent in the site of the site 183 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ ID NO:70 and 266.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg and Gly are as the substituent in the site of the site 183 of the amino acid/11 to 842 that corresponds respectively to SEQ IDNO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg and Gly are as the substituent in the site of the site 183 of the amino acid/11 to 844 that corresponds respectively to SEQ IDNO:70 and 705.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Gln and Gly are as the substituent in the site of the site 266 of the amino acid/11 to 842 that corresponds respectively to SEQ IDNO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg and Gly are as the substituent in the site of the site 266 of the amino acid/11 to 844 that corresponds respectively to SEQ IDNO:70 and 705.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described variant is included in corresponding to the site 142,183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQID NO:2 or SEQ ID NO:70 and 266 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser, Arg and Gln are as the substituent in the site of the site 142,183 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQID NO:2 or SEQ ID NO:70 and 266.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 142,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser, Gln and Gly are as the substituent in the site of the site 142,266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 142,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser, Gln and Gly are as the substituent in the site of the site 142,266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg, Gln and Gly are as the substituent in the site of the site 183,266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Arg, Gln and Gly are as the substituent in the site of the site 183,266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 142,183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser, Arg and Gly are as the substituent in the site of the site 142,183 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 142,183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser, Arg and Gly are as the substituent in the site of the site 142,183 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described variant is included in corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Ash, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described variant comprises that Ser, Arg, Gln and Gly are as the substituent in the site of the site 142,183,266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described variant is included in the replacement corresponding to the site of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described variant is included in corresponding to the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, the variant that comprises Arg and Gly is as the substituent in the site of the site 142,183,266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In a more preferred embodiment, described variant comprises the replacement of G142S, Q183R, H266Q and D703G (or D705G) of the amino acid/11 to 844 of amino acid/11 to 842 that two or more are selected from SEQ IDNO:2 or SEQ ID NO:70.

In a most preferred embodiment, described variant comprises the replacement G142S+Q183R of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement G142S+H266Q of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement G142S+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement Q183R+H266Q of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement Q183R+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.

In another the most preferred embodiment, described variant comprises the replacement G142S+Q183R of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement G142S+H266Q of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement G142S+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement Q183R+H266Q of the amino acid/11 to 844 of SEQID NO:70.In another the most preferred embodiment, described variant comprises the replacement Q183R+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In a most preferred embodiment, described variant comprises the replacement G142S+Q183R+H266Q of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement G142S+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement Q183R+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement G142S+Q183R+D703G of the amino acid/11 to 842 of SEQ ID NO:2.

In a most preferred embodiment, described variant comprises the replacement G142S+Q183R+H266Q of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement G142S+H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement Q183R+H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described variant comprises the replacement G142S+Q183R+D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In another the most preferred embodiment, described variant comprises the replacement G142S+Q183R+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described variant comprises the replacement G142S+Q183R+H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In another the most preferred embodiment, the variant of replacement G142S+Q183R+H266Q+D703G that comprises the amino acid/11 to 842 of SEQ ID NO:2, by being included in nucleotide sequence coded among the pSATe111BG53, described pSATe111BG53 is included among the intestinal bacteria NRRL B-30652.

As defined herein, " the isolating variant " of parental generation beta-Polyglucosidase is that (essentially) do not have the polypeptide of other non--beta-Polyglucosidase polypeptide basically, for example, at least about 20% purity, preferably about at least 40% purity, more preferably about 60% purity, also more preferably about 80% purity, most preferably about 90% purity and even most preferably about 95% purity, as measuring by SDS-PAGE.

Plasmid

One or more plasmids that are used to prepare beta-Polyglucosidase variant can be any plasmid or the carrier through the recombinant DNA step.The plasmid that comprises the nucleotide sequence of coding beta-Polyglucosidase can be by being connected to described nucleotide sequence in the suitable plasmid, or be prepared by other suitable methods.Described plasmid preferably comprises one or more selectable marks described here (selectablemarkers), and it allows easily to screen cell transformed.The selection of plasmid usually depends on it with the host cell that imports.

In the present invention, described plasmid can be the plasmid of a kind of self-replicating (autonomous replication), that is, the plasmid that exists as extrachromosomal (extrachromosomal) entity, its duplicate and THE REPLICATION OF CHROMOSOME are distinguished to some extent.

Described plasmid replicon can be any plasmid replicon, the self-replicating of its mediation performance function in cell.Term " plasmid replicon " is defined herein as and can makes plasmid or the carrier sequence at replication in vitro.The example of useful plasmid replicon is the 2micron origin that duplicates in yeast cell, ARS1, ARS4, the combination of ARS1 and CEN3, and the combination of ARS4 and CEN6.The example of useful plasmid replicon is AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67 in filamentous fungal cells; Cullen et al., 1987, Nucleic Acids Research 15:9163-9175; WO00/24883).According to disclosed method in WO 00/24883, can realize the separation of AMA1 gene and comprise the plasmid of this gene or the structure of carrier.

The linearizing of described plasmid (linearizing) can be directed to any site in the described plasmid.Described plasmid can pass through the known any suitable method linearizing in present technique field, for example, and with one or more restriction enzyme digestion.The linearizing end of described plasmid can be filled with Nucleotide, as by Pomponel al., and 1989, Gene 83:15-24 is described.Yet, preferably do not fill described linearizing end, because it can produce frameshit (frameshift).

In order to simplify screening method, described plasmid is preferably expression vector, and wherein said nucleotide sequence is operably connected to DNA and transcribes required additional section.Usually, described expression vector is derived from plasmid, clay (cosmid) or phage (bacteriophage), maybe can comprise arbitrarily or all these elements.In order to realize purpose of the present invention, term " plasmid " and " carrier " can adopt with exchanging.

Dna fragmentation

Make up the library of the dna fragmentation of (or " rearrangement ") with the homologous region of linearizing plasmid at random by recombinating in the body, can be prepared by any suitable method.For example, the pcr amplification (for example, fallibility PCR) of the plasmid that described dna fragmentation can be by comprising described nucleotide sequence, the application specific primer is prepared, for example, as in U.S. Patent No. 4,683,202 or Saiki et al, 1988, described in the Science239:487-491.Described dna fragmentation also can be from the plasmid that comprises required nucleotide sequence by separating with restriction enzyme digestion, and then application examples as, electrophoresis separates.

Described dna fragmentation replacedly, can be by the synthetic preparation of the standard method of having set up, for example, by Beaucage and Caruthers, 1981, the phosphoamidite method that Tetrahedron Letters 22:1859-1869 describes, or by Matthes et al, 1984, the method that EMBO Journal 3:801-805 describes.According to the phosphoamidite method, synthetic oligonucleotide on automatic dna synthesizer, purifying, annealing, connection, and be cloned into suitable plasmid.

Described dna fragmentation also can be synthetic DNA and genomic dna mixed source, synthetic DNA and cDNA mixed source, or genomic dna and cDNA mixed source, it connects by the fragment with synthetic DNA, genomic dna or cDNA source and prepares, and described fragment secundum legem method is corresponding to the various piece of complete nucleotide sequence.

The library of dna fragmentation comprises one or more sudden changes of described nucleotide sequence, wherein said fragment comprises at least two kinds of zones, 5 ' of the dna fragmentation in 5 ' of the breach of one or more and linearizing nucleotide sequence and/or plasmid sequence-district or 3 '-homologous zone, district and one or more and described library-district or 3 '-district's homologous second area.

The zone of described dna fragmentation can be any sequence, itself and described nucleotide sequence and/or plasmid sequence homology.

In preferred embodiments, the zone of described dna fragmentation is 5 '-district and/or 3 '-district that flank links to each other with the gene of coding beta-Polyglucosidase; Or 5 '-district and/or the 3 '-district of the gene of coding beta-Polyglucosidase.

In another embodiment preferred of the present invention, described one or more dna fragmentations cause low, in or prepare under the condition of high random mutation frequency.In order to obtain low mutation frequency, the pcr amplification method preparation that described nucleotide sequence (comprising described dna fragmentation) can be by standard (US4,683,202 or Saiki et al., 1988, Science 239:487-491).In or high mutation frequency can be by implementing pcr amplification under the condition that fidelity of reproduction duplicate by heat-staple polysaccharase and the mistake that increases Nucleotide mix and obtain reducing, for example, by Deshler, 1992, GATA 9:103-106; Leung et al, 1989, BioTechniques 1:11-15 is described.

Described pcr amplification can be used suitable physics or chemical mutagen (mutagenizing agent) and the combination of sudden change step, and described mutagenic compound are for example induced conversion (transition), transversion (transversion), inversion (inversion), chaotic (scrambling), disappearance and/or inserted.

In preferred embodiments, the dna fragmentation that to reset preferably has the length of about 15bp to 8kb, more preferably about 30bp to 6kb, also more preferably about 40bp to 6kb, also more preferably about 80bp to 4kb, most preferably about 100bp to 2kb is can optimally interacting with linearizing plasmid.

The fungal cell

Mixture importing fungal cell wherein with plasmid/fragment nucleotide sequence can be any fungal cell useful among the present invention." reorganization fungal cell " is defined herein as the cell of the rearrangement that can mediate a large amount of homologous nucleotide sequences.

In preferred embodiments, described fungi reconstitution cell is a yeast cell.In a more preferred embodiment, described yeast reconstitution cell is Candida, Hansenula (Hansenula), genus kluyveromyces, Pichia, saccharomyces, Schizosaccharomyces or the mould cell of Western alpine yarrow.

In a most preferred embodiment, described yeast reconstitution cell is Kluyveromyces lactis (Kluyveromyces lactis), saccharomyces carlsbergensis, yeast saccharomyces cerevisiae, saccharomyces diastaticus, Saccharomycesdouglasii, Crewe not yeast, promise ground yeast, Saccharomyces oviformis or Yarrowialipolytica cell.

In another preferred embodiment, described fungi reconstitution cell is a filamentous fungal cells.In a more preferred embodiment, described filamentous fungus reconstitution cell is a mould genus of top spore, Aspergillus, fusarium, Humicola, Mucor, myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium or Trichoderma cell.

In a most preferred embodiment, the filamentous fungus reconstitution cell is Aspergillus awamori, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.In another the most preferred embodiment, described filamentous fungus reconstitution cell is bar spore shape sickle spore, Fusarium cerealis, Fusariumcrookwellense, machete sickle spore, fusarium graminaria, Fusarium graminum, different spore sickle spore, albizzia sickle spore, sharp sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, intends branch spore sickle spore, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides or Fusarium venenatum cell.In another the most preferred embodiment, described filamentous fungus reconstitution cell is Humicola insolens, Humicola lanuginosa, rice black wool mould (Mucormiehei), thermophilicly ruin that silk mould (Myceliophthora thermophila), a Neuraspora crassa, penicillium purpurogenum, autochthonal shuttle spore are mould, Trichoderma harzianum, healthy and free from worry wood are mould, Trichoderma longibrachiatum, Trichoderma reesei or viride cell.

In another the most preferred embodiment, described aspergillus cell is the aspergillus oryzae cell.

In another the most preferred embodiment, described aspergillus cell is the aspergillus niger cell.

In another the most preferred embodiment, described Fusarium venenatum cell is Fusarium venenatum A3/5, it is originally as fusarium graminaria ATCC 20334 preservations, and recently by Yoder and Christianson, 1998, Fungal Genetics and Biology23:62-80 and O ' Donnell et al., 1998, Fungal Genetics and Biology 23:57-67 heavily is categorized as Fusarium venenatum; And the taxonomy equivalent of Fusarium venenatum, and no matter the kind name of their common general knowledge.In another the most preferred embodiment, the morphological mutant (morphological mutant) that described Fusarium venenatum cell is Fusarium venenatum A3/5 or Fusarium venenatum ATCC 20334 is as disclosed in WO 97/26330.

The fungal cell can form protoplastis by comprising, transform protoplastis and in a manner known way the method for regenerative cell's wall transform.The suitable step that transforms Aspergillus and Trichoderma host cell is at EP 238023 and Yelton et al., and 1984, describe among the Proceedings of the National Academy ofSciences USA 81:1470-1474.The suitable method that transforms the fusarium bacterial classification is by Malardier et al., and 1989, Gene 78:147-156 and WO 96/00787 describe.Yeast can be used by Becker and Guarente, In Abelson, J.N. and Simon, M.I., editors, Guide to YeastGenetics and Molecular Biology, Methods in Enzymology, Volume 194, pp 182-187, Academic Press, Inc., New York; Ito et al., 1983, Journal of Bacteriology 153:163 and Hinnen et al., 1978, the step of describing among the Proceedings of the National Academy of Sciences USA 75:1920 transforms.

Reorganization in the body

A large amount of variants or homologous gene can be combined in the conversion, from homologous gene, to produce gene mosaic (gene chimera) effectively.Reset these genes, encode improved variant or wild type gene, the mosaic that generation can be expressed is used the best of breed of useful sudden change to identify those mosaics by screening then.This method with the quantity of getable further improved variant, comparing with the method for only using random mutation has increased many-doubly (in order to look back, referring to Kuchner and Arnold, 1997, TIBTech 15:523-530).Random mutation will suddenly change and import the target nucleotide sequence, and (deleterious mutation) is more than useful sudden change for the detrimental mutation of generation.In such sudden change circulation wheel (iterative round), detrimental mutation accumulates sooner than useful sudden change, has shielded the evaluation of useful sudden change in the process of screening significantly.Two or more homologous nucleotide sequences that in their nucleotide sequence, contain a plurality of single nucleotide alterations, reorganization at random between them may allow all that to be included in the Nucleotide in the variant to change, and described variant will be from separated from one another and be replaced and any sudden change of being present in other variants is made up at random.The rearrangement of this sudden change provides a kind of method, can make up at random mutually from the sudden change of different parental generation sequences by this method, to be increased in the possibility that combination Nucleotide changes in the mononucleotide sequence.

Using a plurality of overlapping fragmentses of the effective reorganization of recombination method in the body, is to produce chimeric method from variant or homologous gene.Little lap as 15bp is enough for reorganization, and can be applied to or even reset in the very simple zone of not closely related gene.In reset in the zone, the big section of non--homologous dna, use is classified randomly in the method for their end extension homology.

Preferred at least one to reset circulation be the circulation of backcrossing (backcrossing cycle) that the one or more dna fragmentations with initial application carry out, described dna fragmentation can be the wild-type dna fragmentation.This has just eliminated unessential (non-essential) sudden change.Unessential sudden change also can be eliminated as the input DNA material of initial application by using the wild-type dna fragmentation.

Nucleotide sequence more than two sections can be reset simultaneously, and it is advantageous that and can prepare a large amount of diverse variants apace, and need not increase circulation step.When a plurality of fragment is recombinated in same zone, described segmental a plurality of laps can automatically increase the frequency that DNA exchanges, but it is also important that in the overlap to have a large amount of relatively permutoid at random (random crossover), to reconfigure the approaching variant/difference in position.

Little lap as 15bp is enough effectively recombinated between two fragments.Therefore, overlapping in 15 to 5000bp scopes, preferred 30bp to 500bp, especially 30bp to 100bp be suitable for of the present invention.

In the present invention, preferred two sections or more overlapping fragments, more preferably 2 to 50 overlapping fragmentses, and 2 to 10 overlapping fragmentses most preferably can be advantageously used for the dna fragmentation of resetting in the circulation.

Except allow producing chimeric gene, using overlapping fragments is the useful method that reset in the zone, and reset in described zone is by producing little lap between from the dna fragmentation of different zones, and screens that the combination of its optimum carries out.For example, in the situation of 3 dna fragmentations, described overlapping region can be as follows: first segmental first end is overlapping with described first end of linearizing plasmid, second segmental first end is overlapping with first segmental second end, and second segmental second end and the 3rd segmental first end are overlapping, the 3rd segmental first end (as mentioned above) is overlapping with second segmental second end, and second end of the 3rd segmental second end and described linearizing plasmid is overlapping.

Be appreciated that when using two sections or more dna fragmentations to have the successive lap between the end of preferred described plasmid and dna fragmentation as parent material (starting material).

Though preferably reset the homologous nucleotide sequence, also may reset two or more linearizing plasmids that comprise the homologous nucleotide sequence of coded polypeptide with the form of dna fragmentation and linearizing plasmid.Yet, in such a case importantly in different sites with described plasmid linearization.

In the present invention, two or more linearizing plasmids and one or more homologous dna fragment can be used as the parent material that will reset.Ratio between linearizing plasmid and the homologous dna fragment preferably is in 20: 1 to 1: 50 the scope, preferred 2: 1 to 1: 10 (the mol plasmid: the mol fragment), and the special concentration of DNA of 1pM to 10M.

By the lap between the described fragment of disappearance in plasmid, linearizing plasmid can have breach.Repairing described breach in plasmid just needs, and except that the end with described fragment and plasmid jaggy reconfigures, described fragment is reconfigured mutually, to reconstitute the plasmid of annular, self-replicating.In preferred embodiments; the linearizing of described plasmid or carrier produces enough breach in the encoding sequence of described nucleotide sequence; homologous recombination with the corresponding zone that promotes described dna fragmentation and described nucleotide sequence produces the plasmid that annular duplicates again.

Nucleotide sequence

The present invention also relates to the nucleotide sequence of the variant of separated coding beta-Polyglucosidase, wherein said nucleotide sequence is modified by the replacement in one or more sites, described site is corresponding to the site 142 in the amino acid/11-842 of SEQ ID NO:2,183,266 and 703 or corresponding to the site 142 in the amino acid/11-844 of SEQ ID NO:70,183,266 and 705, wherein said beta-Polyglucosidase is the polypeptide of (a) aminoacid sequence, the amino acid/11-844 of the amino acid/11-842 of described amino acid and SEQ ID NO:2 or SEQ ID NO:70 has at least 70%, preferably about at least 75%, more preferably about at least 80%, more preferably about at least 85%, also more preferably about at least 90%, most preferably about at least 95%, and even about at least 97% identity most preferably; (ii) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the low stringency condition, preferably low-middle stringency condition, more preferably middle stringency condition, also more preferably in-Gao stringency condition, most preferably high stringency condition, or even most preferably very high stringency condition under, with the Nucleotide 58 to 2583 of (i) SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, the genome nucleotide sequence that (ii) comprises the Nucleotide 58 to 2589 of the Nucleotide 58 to 2583 of SEQ ID NO:1 or SEQ ID NO:71, or (iii) (i) or the hybridization of complementary strand (ii), wherein said variant has the beta-glucosidase activity.

The nucleotide sequence of the variant of separated coding beta-Polyglucosidase of the present invention can further comprise the one or more disappearances and/or the insertion of described sequence.

In preferred embodiments, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement in one or more sites, and described site is corresponding to the site in the amino acid/11-842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement in two or more sites, and described site is corresponding to the site in the amino acid/11-842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement in three or three above sites, and described site is corresponding to the site in the amino acid/11-842 of SEQ IDNO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises at least corresponding to the site in the amino acid/11-842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the replacement in the site of the site in the amino acid/11-844 of SEQID NO:70 142,183,266 and 705.

In preferred embodiments, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site in the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In a more preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the site corresponding to the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In preferred embodiment also, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser is as at the substituent corresponding to the site in the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In a most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site in the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the site corresponding to the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg is as at the substituent corresponding to the site in the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQID NO:70.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site in the site 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the site corresponding to the site 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Gln is as at the substituent corresponding to the site in the site 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement H266Q of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQID NO:70.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site in the site 703 of the amino acid/11 to 842 of SEQ ID NO:2.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the site corresponding to the site 703 of the amino acid/11 to 842 of SEQ ID NO:2, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Gly is as at the substituent corresponding to the site in the site 703 of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement D703G of the amino acid/11 to 842 of SEQ ID NO:2.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site in the site 705 of the amino acid/11 to 844 of SEQ ID NO:70.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the site corresponding to the site 705 of the amino acid/11 to 844 of SEQ ID NO:70, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Gly is as at the substituent corresponding to the site in the site 705 of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 183.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQID NO:2 or SEQ ID NO:70 and 183 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, S er, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser and Arg are as the substituent in the site of the site 142 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ ID NO:70 and 183.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQID NO:2 or SEQ ID NO:70 and 266 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser and Gln are as the substituent in the site of the site 142 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ ID NO:70 and 266.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser and Gly are as the substituent in the site of the site 142 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Glv, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser and Gly are as the substituent in the site of the site 142 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQID NO:2 or SEQ ID NO:70 and 266 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg and Gln are as the substituent in the site of the site 183 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ IDNO:70 and 266.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg and Gly are as the substituent in the site of the site 183 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg and Gly are as the substituent in the site of the site 183 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Gln and Gly are as the substituent in the site of the site 266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg and Gly are as the substituent in the site of the site 266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,183 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser, Arg and Gln are as the substituent in the site of the site 142,183 of the amino acid/11 to 844 of amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 or SEQ ID NO:70 and 266.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser, Gln and Gly are as the substituent in the site of the site 142,266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser, Gln and Gly are as the substituent in the site of the site 142,266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Glv, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg, Gln and Gly are as the substituent in the site of the site 183,266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Arg, Gln and Gly are as the substituent in the site of the site 183,266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,183 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser, Arg and Gly are as the substituent in the site of the site 142,183 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gl y, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser, Arg and Gly are as the substituent in the site of the site 142,183 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises that Ser, Arg, Gln and Gly are as the substituent in the site of the site 142,183,266 of the amino acid/11 to 842 that corresponds respectively to SEQ ID NO:2 and 703.

In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in the replacement corresponding to the site of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.In another preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it is included in corresponding to the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 site, with the replacement of Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it variant that comprises Arg and Gly is as the substituent in the site of the site 142,183,266 of the amino acid/11 to 844 that corresponds respectively to SEQ ID NO:70 and 705.

In a more preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement of G142S, Q183R, H266Q and D703G (or D705G) of the amino acid/11 to 844 of amino acid/11 to 842 that two or more are selected from SEQ ID NO:2 or SEQ ID NO:70.

In a most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+H266Q of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R+H266Q of the amino acid/11 to 842 of SEQ IDNO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.

In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+H266Q of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R+H266Q of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R+D705G of the amino acid/11 to 844 of SEQID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In a most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R+H266Q of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R+D703G of the amino acid/11 to 842 of SEQ ID NO:2.

In a most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R+H266Q of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement Q183R+H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R+D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2.In another the most preferred embodiment, described isolating nucleotide sequence coded beta-Polyglucosidase variant, it comprises the replacement G142S+Q183R+H266Q+D705G of the amino acid/11 to 844 of SEQ ID NO:70.

In another the most preferred embodiment, the nucleotide sequence of described separated coding beta-Polyglucosidase variant, by being included in nucleotide sequence coded among the pSATe111BG53, described beta-Polyglucosidase variant comprises the replacement G142S+Q183R+H266Q+D703G of the amino acid/11 to 842 of SEQ ID NO:2, and described pSATe111BG53 is included among the intestinal bacteria NRRL B-30652.

Term " isolating nucleotide sequence " in this application is meant the nucleotide sequence that does not have other nucleotide sequences substantially, for example, at least about 20% purity, preferably about at least 40% purity, more preferably about 60% purity, also more preferably about 80% purity, most preferably about 90% purity is as measuring by agarose electrophoresis.For example, isolating nucleotide sequence can obtain by being applied to engineered standard clone step, with described nucleotide sequence from its natural position, be repositioned onto the different site that it will be replicated.Described clone's step can comprise: the nucleotide fragments that excises and separate the required nucleotide sequence that comprises coding said polypeptide, described fragment is inserted carrier molecule, with with the reorganization vector integration go into host cell, in this host cell, a plurality of copies of described nucleotide sequence or clone will be replicated.Described nucleotide sequence can be genome, cDNA, RNA, semi-synthetic, synthetic source, or it makes up arbitrarily.

Nucleic acid construct

The present invention also relates to nucleic acid construct, it comprises the nucleotide sequence of the beta-Polyglucosidase variant of the present invention of encoding, it is operably connected to one or more control sequences, described control sequence in proper host cell, with the matched condition of described control sequence under instruct encoding sequence to express.Expression can be regarded as comprise any with produce the relevant step of polypeptide, include but not limited to, transcribe, post transcriptional modificaiton (posttranscriptional modification), translation, posttranslational modification (post-translationalmodification) and secretion.

" nucleic acid construct " is defined as strand or double-stranded nucleic acid molecule in this article, and it separates the gene from natural generation, or it has been modified containing the section of nucleic acid, and described section makes up in non-existent mode in the nature and and puts (juxtapose).When described nucleic acid construct contained required all control sequences of the encoding sequence of expressing variant of the present invention, term nucleic acid construct and term expression cassette were synonyms.Term " encoding sequence " is defined herein as nucleotide sequence, and it directly indicates the aminoacid sequence of its protein product.The border of genome encoding sequence is usually by the ATG initiator codon (eukaryote) of the upstream of 5 ' the terminal open reading frame that just is positioned at mRNA, or interchangeable initiator codon such as GTG and TTG and the Transcription Termination subsequence in downstream that just is positioned at 3 ' the terminal open reading frame of mRNA are determined.Encoding sequence can include, but are not limited to the nucleotide sequence of DNA, cDNA and reorganization.

The encode isolated nucleic acid sequences of beta-Polyglucosidase variant of the present invention can be operated in every way so that the expression of described variant to be provided.It is that need or necessary that operation before the described nucleotide sequence insertion carrier be can be, and this depends on expression vector.Using the method for recombinant DNA method modification of nucleic acids sequence, is being well-known in the art.

Term " control sequence " is defined as in this article, comprises all essential or favourable compositions for expressing beta-Polyglucosidase variant of the present invention.Each control sequence can be natural or external source for the nucleotide sequence of the described variant of coding.Above-mentioned control sequence comprises, but be not limited to leader sequence (leader), polyadenylation sequence (polyadenylation sequence), propeptide sequence (propeptide sequence), promotor (promoter), signal peptide sequence (signal peptide sequence) and transcription terminator (transcription terminator).Bottom line, described control sequence comprise promotor and transcribe signal and transcription termination signal.Described control sequence can provide with joint, is used to introduce concrete restriction site (restriction sites) so that the coding region of described control sequence with the nucleotide sequence of coding variant beta-Polyglucosidase of the present invention is connected.Term " is operably connected " and is defined as a kind of structure (configuration) in this article, and wherein control sequence compatibly is positioned at the site with respect to the encoding sequence of dna sequence dna, so that described control sequence instructs the expression of variant beta-Polyglucosidase.

Described control sequence can be suitable promoter sequence, and it is discerned by the host cell of expressing described nucleotide sequence.Described promoter sequence comprises transcriptional control sequence (transcriptional controlsequences), and it mediates the expression of described variant beta-Polyglucosidase.Described promotor can be any nucleotide sequence, it shows transcriptional activity in the preferential host cell of selecting, it comprises mutant promotor (mutant), by promotor of brachymemma (truncated) and heterozygote promotor (hybrid promoter), described promotor can be outside Codocyte or in the cell with the gene of described host cell homology or allogenic polypeptide obtain.

Instructing the example of the suitable promotor that constructs of the present invention transcribes in filamentous fungal host cell, is from aspergillus oryzae TAKA amylase, Man Hegen Mucor (Rhizomucor miehei) aspartate protease (aspartic proteinase), the neutral alpha-amylase (neutral alpha-amylase) of aspergillus niger, aspergillus niger acid acceptance alpha-amylase (acid stable alpha-amylase), aspergillus niger or Aspergillus awamori glucoamylase (glucoamylase) are (glaA), Man Hegen miehei lipase (lipase), aspergillus oryzae Sumizyme MP (alkaline proteinase), aspergillus oryzae triosephosphate isomerase (triose phosphate isomerase), Aspergillus nidulans acetamidase (acetamidase), Fusarium venenatum amyloglucosidase (amyloglucosidase), trypsinase-sample proteolytic enzyme (trypsin-like proteinase) (WO96/00787) for point sickle spore, Trichoderma reesei beta-Polyglucosidase, Trichoderma reesei cellobiose hydrolase I, Trichoderma reesei endoglucanase i, Trichoderma reesei EG II, Trichoderma reesei EG III, Trichoderma reesei EG IV, Trichoderma reesei EGV, Trichoderma reesei xylanase I, Trichoderma reesei xylanase I I, Trichoderma reesei beta-zytase and NA2-tpi promotor (from the heterozygote of the promotor of neutral alpha-amylase of aspergillus niger and aspergillus oryzae phosphotriose isomerase gene); Its equivalent; And the mutant promotor, by the promotor of brachymemma and heterozygote promotor.

In yeast host, useful promotor from yeast saccharomyces cerevisiae enolase (enolase) (ENO-1), yeast saccharomyces cerevisiae galactokinase (galactokinase) (GAL1), yeast saccharomyces cerevisiae alcoholdehydrogenase (alcoholdehydrogenase)/glyceraldehyde 3-phosphate dehydro-genase (glyceraldehyde-3-phosphatedehydrogenase) (ADH1, ADH2/GAP), yeast saccharomyces cerevisiae triosephosphate isomerase (TPI), brewing yeast metallothionein (metallothionine) (CUP1) and in the gene of yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase (3-phosphoglycerate kinase) obtains.The useful promotor of other of yeast host cell is by Romanos et al., and 1992, Yeast 8:423-488 describes.

Described control sequence also can be suitable transcription termination sequence, promptly by the sequence of host cell identification to stop transcribing.Described terminator sequence operationally with 3 ' terminal connection of the nucleotide sequence of the described variant of coding.Any have the terminator of function to can be used for the present invention in the preferential host cell of selecting.

The preferred terminator of filamentous fungal host cell obtains from the gene of aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthetase (anthranilate synthase), aspergillus niger alpha-glucuroide (alpha-glucosidase) and sharp sickle spore trypsinase-sample proteolytic enzyme.

The terminator of preferred yeast host cell obtains from the gene of yeast saccharomyces cerevisiae enolase, brewing yeast cell pigment C (cytochrome C) (CYC 1) and yeast saccharomyces cerevisiae glyceraldehyde 3-phosphate dehydro-genase.The useful terminator of other of yeast host cell passes through Romanos et al., and 1992, the literary composition that sees before is described.

Described control sequence also can be suitable leader sequence (leader sequence), i.e. the zone of not translating of mRNA, and it is important for the translation by host cell.Described leader sequence operationally with 5 ' terminal connection of the nucleotide sequence of the described variant beta-Polyglucosidase of coding.Any have the leader sequence of function to can be used for the present invention in the preferential host cell of selecting.

The leader sequence of preferred filamentous fungal host cell obtains from the gene of aspergillus oryzae TAKA amylase and Aspergillus nidulans triosephosphate isomerase.

The leader sequence of suitable yeast host cell obtains from the gene of yeast saccharomyces cerevisiae enolase (ENO-1), yeast saccharomyces cerevisiae glycerol 3-phosphate acid kinase, the yeast saccharomyces cerevisiae alpha-factor and yeast saccharomyces cerevisiae alcoholdehydrogenase/glyceraldehyde 3-phosphate dehydro-genase (ADH2/GAP).

Described control sequence to be can be the polyadenylation sequence, promptly operationally with 3 ' the terminal sequence that is connected of described polypeptid coding sequence, and when its quilt was transcribed, it was identified as signal so that the polyadenylic acid residue is added on the mRNA that transcribes by host cell.Any have the polyadenylation sequence of function to can be used for the present invention in the preferential host cell of selecting.

The polyadenylation sequence of preferred filamentous fungal host cell obtains from the gene of aspergillus oryzae TAKA amylase, aspergillus niger glucoamylase, Aspergillus nidulans anthranilate synthetase, sharp sickle spore trypsinase-sample proteolytic enzyme and aspergillus niger alpha-glucuroide.

The useful polyadenylation sequence of yeast host cell is by Guo and Sherman, and 1995, Molecular Cellular Biology 15:5983-5990 describes.

Described control sequence also can be the signal peptide coding region territory, and the aminoacid sequence that its coding is connected with the N-terminal of variant beta-Polyglucosidase and guides encoded polypeptides to enter the Secretory Pathway (secretory pathway) of cell.5 ' end of the encoding sequence of described nucleotide sequence can comprise signal peptide coding region natively, and described signal peptide coding region is read in the frame in translation natively, is connected with the part of coding region, described coding region coding excretory variant beta-Polyglucosidase.Replacedly, 5 ' end of encoding sequence can comprise signal peptide coding region, and it is an external source for described encoding sequence.It is essential that the signal peptide coding region of described external source can be, and wherein said encoding sequence does not contain signal peptide coding region natively.Replacedly, the signal peptide coding region of described external source can be replaced the natural signals peptide-coding region simply, to strengthen the secretion of described variant beta-Polyglucosidase.Yet the signal peptide coding region of Secretory Pathway that the expressed polypeptide of any guidance enters the host cell of preferential selection can be used for the present invention.

The effective signal peptide coding region of filamentous fungal host cell is the signal peptide coding region that obtains from the gene of aspergillus oryzae TAKA amylase, aspergillus niger neutral starch enzyme, aspergillus niger glucoamylase, Man Hegen Mucor aspartate protease, Humicola insolens Cel45A cellulase and Humicola lanuginosa lipase.

The useful signal peptide of yeast host cell obtains from the gene of the yeast saccharomyces cerevisiae alpha-factor (alpha-factor) and yeast saccharomyces cerevisiae saccharase (invertase).Other useful signal peptide coding regions pass through Romanoset al., and 1992, the literary composition that sees before is described.

Described control sequence also can be preceding peptide-coding region, and its coding is positioned at the aminoterminal aminoacid sequence of variant beta-Polyglucosidase.The polypeptide that obtains is called as preferment (proenzyme) or preceding polypeptide (propolypeptide) (or being called proenzyme (zymogen) in some cases).Before polypeptide non-activity normally, and can be converted into sophisticated active polypeptide by with (autocatalytic) cutting of catalytic or autocatalysis on the polypeptide in the past of described polypeptide.Described polypeptid coding area can obtain from the gene of the yeast saccharomyces cerevisiae alpha-factor, Man Hegen Mucor aspartate protease and thermophilic rMtL (laccase) (WO 95/33836).

Signal peptide district and propetide district appear at the N-terminal of polypeptide, and and then described propetide district is positioned at the N-terminal of polypeptide, and and then described signal peptide district is positioned at the N-terminal in propetide district.

Also need to add regulating and controlling sequence, it allows the expression of the described variant beta-Polyglucosidase of regulation and control, with respect to the growth of described host cell.The example of regulator control system is those responses stimulator (stimulus) chemistry or physics, comprises the existence of regulating compound, the regulator control system that makes described expression of gene open or close.In yeast, can adopt ADH2 system or GAL1 system.In filamentous fungus, TAKA alpha-amylase promotor, aspergillus niger glucoamylase promotor and aspergillus oryzae glucoamylase promotor can be used as regulating and controlling sequence.The example of other regulating and controlling sequences is those regulating and controlling sequences that allow gene amplification.In eukaryotic system, these regulator control systems comprise Tetrahydrofolate dehydrogenase (dihydrofolate reductase) gene, it is amplified under the condition that Rheumatrex (methotrexate) exists, and metallothionein(MT) (metallothionein) gene, and it increases with heavy metal.In these situations, the nucleotide sequence of the described variant beta-Polyglucosidase of encoding operationally is connected with described regulating and controlling sequence.

Expression vector

The present invention also relates to recombinant expression vector, it comprise the variant beta-Polyglucosidase of the present invention of encoding nucleotide sequence, promotor, transcribe and the translation termination signal.Above-mentioned multiple Nucleotide and control sequence can be combined to produce recombinant expression vector, it can comprise one or more restriction sites easily, to allow to insert or replace the nucleotide sequence of the described variant of coding on these sites.Replacedly, described nucleotide sequence can be expressed by described nucleotide sequence or the nucleic acid construct that comprises described sequence are inserted in the carrier be suitable for expressing.In the process of creating described expression vector, make described encoding sequence be arranged in described carrier, so, described encoding sequence operationally is connected with the control sequence that is suitable for expressing.

Described recombinant expression vector can be any carrier (for example, plasmid or virus), and it can pass through recombinant DNA method easily, and described nucleotide sequence is expressed.The selection of described carrier depends on described carrier and the consistency (compatibility) that is imported into the host cell of described carrier usually.Described carrier can be the plasmid or the closed cyclic plasmid of wire.

Carrier of the present invention preferably comprises one or more selectable marks, and it allows easily to select cell transformed.The selectable gene that is labeled as, the product of this gene can offer sterilant (biocide) or virus resistance (viral resistance), preventing from heavy metal (resistance to heavy metals), auxotrophic former nutrition (prototrophy to auxotrophs) etc.Suitable ADE2, HIS3, LEU2, LYS2, MET3, TRP1 and the URA3 of being labeled as of yeast host cell.The selectable mark of using in filamentous fungal host cell comprises; but be not limited to amdS (acetamidase); argB (ornithine transcarbamylase (omithine carbamoyltransferase)); bar (phosphinothricin acetyltransferase (phosphinothricin acetyltransferase)); hph (hygromix phosphotransferase (hygromycinphosphotransferase)); niaD (nitrate reductase (nitrate reductase)); pyrG (Orotidine-5 '-'-phosphate decarboxylase (orotidine-5 '-phosphate decarboxylase)); sC (sulfuric acid adenylyl transferase (sulfate adenyltransferase)); trpC (anthranilate synthetase), with and Equivalent.What be preferred for the Aspergillus cell is the amdS of Aspergillus nidulans or aspergillus oryzae and the bar gene of pyrG gene and streptomyces hygroscopicus (Streptomyces hygroscopicus).

Described carrier can be spontaneous (autonomously replicating) carrier that duplicates, the i.e. carrier that exists as extrachromosomal entity, duplicating of it is different from THE REPLICATION OF CHROMOSOME, for example, plasmid, extrachromosomal element (element), mini-chromosome (minichromosome) or artificial chromosome.Described plasmid can comprise any method (means) of guaranteeing self-replacation (self-replication).Replacedly, it is integrated into genome when being imported into host cell in described year, and duplicates with the karyomit(e) that is integrated into described carrier.In addition, can adopt single carrier or plasmid or contain two or more carriers or the plasmid of genomic total DNA of host cell to be imported jointly, or transposon (transposon).

Carrier of the present invention preferably contains element, and described element allows the genome of described vector integration to host cell, or spontaneously duplicates described carrier and do not rely on genome in described cell.

In order to be integrated into described host cell gene group, described carrier can be dependent on the nucleotide sequence of the described variant of coding, or by homologous or nonhomologous reorganization described carrier stably is integrated into any other element in the genome.Replacedly, described carrier can comprise additional nucleotide sequence, is used in reference to conducting and crosses the genome that homologous recombination is integrated into host cell.Described additional nucleotide sequence makes described carrier be integrated into the host cell gene group in chromosomal accurate position.In order to improve the possibility of integrating in accurate position, described integrated element should preferably contain the nucleic acid of sufficient amount, as 100 to 10,000 base pair, preferred 400 to 10,000 base pairs and 800 to 10,000 base pairs most preferably, described nucleic acid and corresponding target sequence height homology are to strengthen the possibility of homologous recombination.Described integrated element can be any sequence of target sequence homologous in the genome with described host cell.In addition, described integrated element can be nucleotide sequence non--coding or coding.On the other hand, described carrier can be integrated in the genome of described host cell by non--homologous recombination.

Duplicate for spontaneous, described carrier can further comprise replication orgin (origin of replication), and it can make spontaneous the duplicating in described host cell of described plasmid.The example of the replication orgin of using in yeast host cell is the 2micron replication orgin, the combination of ARS1, ARS4, ARS1 and CEN3, and the combination of ARS4 and CEN6.Described replication orgin can be the replication orgin with sudden change, described sudden change make its function that in described host cell, has temperature-susceptibility (referring to, for example, Ehrlich, 1978, Proceedings of the National Academy of Sciences USA 75:1433).The example of the plasmid replicon of using in filamentous fungal cells is AMA1 and ANS1 (Gems et al., 1991, Gene 98:61-67; Cullen et al., 1987, Nucleic Acids Research 15:9163-9175; WO00/24883).Separation of AM A1 gene and structure contain the plasmid or the carrier of this gene, can implement according to disclosed method in WO 00/24883.

The nucleotide sequence of the present invention that surpasses a copy can be inserted host cell, to increase the generation of beta-Polyglucosidase variant.Be integrated into the host cell gene group by at least one additional copy with described sequence, perhaps be contained in the described nucleotide sequence by the selectable marker gene that can increase, wherein cell contains the copy of the amplification of selectable marker gene, and the additional copy of described nucleotide sequence thus, can select by cultivating described cell under the condition that exists at suitable selectivity reagent, the copy number of described nucleotide sequence can obtain increasing.

Be used to connect said elements to make up the step of recombinant expression vector of the present invention, be those skilled in the art known (referring to, for example, Sambrook et al., 1989, literary composition sees before).

Host cell

The present invention also relates to comprise the recombinant host cell of the nucleotide sequence of coding variant beta-Polyglucosidase, its reorganization that is conveniently used in described variant produces.The carrier that comprises nucleotide sequence of the present invention is introduced into host cell, thus described carrier as chromosomal integral part, or keep as oneself's-duplicate extrachromosomal carrier, as described earlier.Term " host cell " comprises the offspring of any parental cell, and it is inequality with parental cell owing to the sudden change that takes place in the reproduction process.Host cell be chosen in gene and the source thereof that depends on coding said polypeptide to a great extent.

Described host cell can be any eukaryotic cell, for example Mammals, insect, plant or fungal cell.

Described host cell can be any fungal cell.Comprise Ascomycota (phyla Ascomycota) as " fungi " of using in this article, Basidiomycota (Basidiomycota), chytrid door (Chytridiomycota) and Zygomycota (Zygomycota) (as by Hawksworth et al. at Ainsworth and Bisby ' sDictionary of The Fungi, 8th edition, 1995, CAB International, University Press, Cambridge, defined among the UK), and oomycetes door (Oomycota) is (as at Hawksworth et al., 1995, the literary composition that sees before, page 171 is quoted) and fungi (the Hawksworth etal. of all mitospores, 1995, literary composition sees before).

In preferred embodiments, described fungal host cells is a yeast cell.Comprise ascosporogenous yeast (ascosporogenous yeast) (Endomycetale (Endomycetales)), produce load yeast (basidiosporogenous yeast) and belong to the yeast of imperfect fungi (Fungi Imperfecti) (gemma guiding principle (Blastomycetes)) as " yeast " used in this article.Because being sorted in, zymic can change in the future, in order to realize purpose of the present invention, yeast is defined as at Biology and Activities of Yeast (Skinner, F.A., Passmore, S.M. and Davenport, R.R., eds, Soc.App.Bacteriol.Symposium SeriesNo.9,1980) described in.

In a more preferred embodiment, described yeast host cell is Candida, Hansenula, genus kluyveromyces, Pichia, saccharomyces, Schizosaccharomyces or the mould cell of Western alpine yarrow.

In a most preferred embodiment, described yeast host cell is saccharomyces carlsbergensis (Saccharomyces carlsbergensis), yeast saccharomyces cerevisiae (Saccharomyces cerevisiae), saccharomyces diastaticus (Saccharomyces diastaticus), Saccharomyces douglasii, Crewe not yeast (Saccharomyces kluyveri), promise ground yeast (Saccharomyces norbensis) or Saccharomycesoviformis cell.In another the most preferred embodiment, described yeast host cell is a lactic acid Kluyveromyces lactis cell.In another the most preferred embodiment, described yeast host cell is a Yarrowia lipolytica cell.

In another preferred embodiment, described fungal host cells is a filamentous fungal cells." filamentous fungus " comprises the fungi of all thread forms and oomycetes subphylum (as by Hawksworth et al., 1995, the literary composition that sees before is defined).Described filamentous fungus is a feature with the mycelia body wall of being made up of chitin (chitin), Mierocrystalline cellulose, dextran (glucan), chitosan (chitosan), mannosans (mannan) and other complex polysaccharide classes (complex polysaccharides) (mycelial wall) usually.Prolong (hyphal elongation) by mycelia and nourish and grow (vegetative growth), and carbon katabolism (carboncatabolism) is obligate aerobic (obligately aerobic).In contrast, yeast then be that gemmation (budding) by unicellular thalline carries out such as nourishing and growing of yeast saccharomyces cerevisiae, and carbon katabolism is (fermentative) that can be fermentation.

In a more preferred embodiment, described filamentous fungal host cell is, but be not limited to the cell of the mould genus of branch top spore, Aspergillus, fusarium, Humicola, Mucor, myceliophthora, Neurospora, Penicillium, Thielavia, Tolypocladium or Trichoderma.

In a most preferred embodiment, described filamentous fungal host cell is Aspergillus awamori, smelly aspergillus, aspergillus japonicus, Aspergillus nidulans, aspergillus niger or aspergillus oryzae cell.In another the most preferred embodiment, described filamentous fungal host cell is bar spore shape sickle spore, Fusarium cerealis, Fusariumcrookwellense, machete sickle spore, fusarium graminaria, Fusarium graminum, different spore sickle spore, albizzia sickle spore, sharp sickle spore, racemosus sickle spore, pink sickle spore, Williams Elder Twig sickle spore, colour of skin sickle spore, intends branch spore sickle spore, Fusarium sulphureum, Fusarium torulosum, Fusarium trichothecioides or Fusarium venenatum cell.In one even the most preferred embodiment, described filamentous fungal host cell is Fusarium venenatum (Nirenberg sp.nov.) cell.In another the most preferred embodiment, described filamentous fungal host cell is that Humicola insolens, Humicolalanuginosa, rice black wool mouldly, thermophilic ruin that mould, the Neuraspora crassa of silk, penicillium purpurogenum, autochthonal shuttle spore mould (Thielavia terrestris), Trichoderma harzianum, healthy and free from worry wood are mould, Trichodermalongibrachiatum, Trichoderma reesei or viride cell.In another even the most preferred embodiment, described filamentous fungal host cell is Trichoderma reesei RutC30.

Can be according to step transformed eukaryotic mycetocyte described here.

Production method

The present invention also relates to produce the method for beta-Polyglucosidase variant, comprising:

(a) under the condition that is suitable for described variant expression, cultivate host cell, wherein said host cell comprises nucleotide sequence, it is modified by the replacement in one or more sites, described one or more site is corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 or corresponding to the site 142,183,266 and 705 of the amino acid/11 to 844 of SEQ ID NO:70, as described here; With

(b) from substratum, reclaim described variant.

In production method of the present invention, described host cell produces in the nutritional medium of described variant beta-Polyglucosidase being suitable for, and cultivates with method well-known in the art.For example; described cell can be by shake-flask culture, little-scale or big-scale fermentation (comprising successive, batch formula, fed-batch or solid-state fermentation); in laboratory or industrial fermentation jar, in suitable medium and under described expression of polypeptides of permission and/or the isolating condition, cultivate.Method well-known in the art is adopted in described cultivation, takes place in the suitable nutritional medium that comprises carbon source, nitrogenous source and inorganic salt.Suitable medium can obtain from commercial provider, or is prepared according to the composition of delivering (for example, in the catalogue of American Type CultureCollection).If described polypeptide is secreted in the nutritional medium, described polypeptide can directly reclaim from substratum, if described polypeptide is not secreted, it can reclaim from cell lysate (cell lysate) so.

In the embodiment of a replacement, do not reclaim described beta-Polyglucosidase variant, but would rather will express the source of the host cell of the present invention of variant as described variant.

That described variant beta-Polyglucosidase can adopt is well-known in the art, described polypeptide is had specific method detects.These detection methods can comprise that using specific antibody, product form or enzyme substrates disappears.For example, the proteolytic enzyme analysis can be used for measuring the activity of described polypeptide, and is described in an embodiment as this paper.

The polypeptide that obtains can reclaim by method well-known in the art.For example, described polypeptide can reclaim from nutritional medium by the method for routine, and described ordinary method includes, but are not limited to collect, centrifugal, filtration, extraction, spraying drying, evaporation or precipitation.

Polypeptide of the present invention can carry out purifying by the whole bag of tricks well-known in the art, described method comprises, but (for example be not limited to chromatography, ion-exchange, affine, hydrophobic, chromatofocusing and size exclusion), electrophoretic method (for example, preparation isoelectrofocusing (preparative isoelectric focusing)), solvability difference (for example, ammonium sulfate precipitation), SDS-PAGE or extraction (extraction) (referring to, for example, ProteinPurification, J.-C.Janson and Lars Ryden, editors, VCH Publishers, New York, 1989).

Other polypeptide with Beta-glucosidase activity

The present invention also relates to have the isolated polypeptide of beta-glucosidase activity, wherein said amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different in one or more sites, and described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.

In preferred embodiments, the amino acid/11-842 of described amino acid sequence of polypeptide and SEQ ID NO:2 or the amino acid/11-844 of SEQ ID NO:70 have preferred 4 amino acid whose different, more preferably 3 amino acid, more preferably 2 amino acid also, and 1 amino acid most preferably.

In preferred embodiments, described polypeptide is made up of 741 to 750,751 to 760,761 to 770,771 to 780,781 to 790,791 to 800,801 to 810,811 to 820,821 to 830,831 to 840,841 to 850,851 to 860,861 to 870,871 to 880,881 to 890,891 to 900,901 to 910,911 to 920,921 to 930,931 to 940 or 941 to 950 amino acid.

In preferred embodiments, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID

NO:70 is different in one or more sites, and described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different in two or more sites, and described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different in the site more than three or three, and described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQID NO:70 are at least corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or different corresponding to the site of the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.

In preferred embodiments, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ IDNO:70 are different corresponding to the site in the site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In a more preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, site corresponding to the site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In preferred embodiment also, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 differ Ser in the site corresponding to the site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In a most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, the site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Ser.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different corresponding to the site in the site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, site corresponding to the site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQID NO:2 or SEQ ID NO:70 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 differ Arg in the site corresponding to the site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, the site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Arg.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different corresponding to the site in the site 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, site corresponding to the site 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQID NO:2 or SEQ ID NO:70 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 differ Gln in the site corresponding to the site 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, the site 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Gln.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site in the site in the amino acid/11 to 842 of SEQ ID NO:2 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 703.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 703.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site 703 in the amino acid/11 to 842 of SEQ ID NO:2 differs Gly.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site in the site in the amino acid/11 to 844 of SEQ ID NO:70 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 705.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Gly in the site corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 705.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site 705 in the amino acid/11 to 844 of SEQ ID NO:70 differs Gly.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different corresponding to the site of the site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 183.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, corresponding to site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 183 site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ IDNO:70 are differing Ser and Arg corresponding to site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 183 site respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, the site 142 and 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Ser and Arg respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different corresponding to the site of the site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, corresponding to site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ IDNO:70 are differing Ser and Gln corresponding to site 142 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, the site 142 and 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Ser and Gln respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 142 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142 and 703.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Ser and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 142 and 703 differs Ser and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site 142 in the amino acid/11-844 of SEQ ID NO:70 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 142 and 705.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Ser and Gly in the site corresponding to the site 142 in the amino acid/11-844 of SEQ ID NO:70 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site 142 and 705 in the amino acid/11-844 of SEQ ID NO:70 differs Ser and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different corresponding to the site of the site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, corresponding to site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ IDNO:70 are differing Arg and Gln corresponding to site 183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, the site 183 and 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Arg and Gln respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 183 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 183 and 703.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Arg and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 183 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 183 and 703 differs Arg and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site 183 in the amino acid/11-844 of SEQ ID NO:70 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 183 and 705.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Arg and Gly in the site corresponding to the site 183 in the amino acid/11-844 of SEQ ID NO:70 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site 183 and 705 in the amino acid/11-844 of SEQ ID NO:70 differs Arg and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 266 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 266 and 703.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Gln and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 266 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 266 and 703 differs Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site 266 in the amino acid/11-844 of SEQ ID NO:70 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, in site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 266 and 705.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Gln and Gly in the site corresponding to the site 266 in the amino acid/11-844 of SEQ ID NO:70 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site 266 and 705 in the amino acid/11-844 of SEQ ID NO:70 differs Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different corresponding to the site of the site 142,183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70, corresponding to site 142,183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site, differ Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are differing Ser, Arg and Gln corresponding to site 142,183 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 and 266 site respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 or SEQID NO:70, the site 142,183 and 266 in the amino acid/11-844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70 differs Ser, Arg and Gln respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 142,266 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,266 and 703 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Ser, Gln and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,266 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 142,266 and 703 differs Ser, Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site in the amino acid/11-844 of SEQ ID NO:70 142,266 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, site corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 142,266 and 705 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Ser, Gln and Gly in the site corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,266 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site in the amino acid/11-844 of SEQ ID NO:70 142,266 and 705 differs Ser, Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 183,266 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 183,266 and 703 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Arg, Gln and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 183,266 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 183,266 and 703 differs Arg, Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site in the amino acid/11-844 of SEQ ID NO:70 183,266 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, site corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 183,266 and 705 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Arg, Gln and Gly in the site corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 183,266 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site in the amino acid/11-844 of SEQ ID NO:70 183,266 and 705 differs Arg, Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183 and 703 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Ser, Arg and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183 and 703 differs Ser, Arg and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site in the amino acid/11-844 of SEQ ID NO:70 142,183 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, site corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 142,183 and 705 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Ser, Arg and Gly in the site corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site in the amino acid/11-844 of SEQ ID NO:70 142,183 and 705 differs Ser, Arg and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 are different corresponding to the site of the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703.In another preferred embodiment, described amino acid sequence of polypeptide and SEQID NO:2, site corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2 differ Ser, Arg, Gln and Gly in the site corresponding to the site in the amino acid/11 to 842 of SEQID NO:2 142,183,266 and 703 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:2, the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 differs Ser, Arg, Gln and Gly respectively.

In another preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 are different corresponding to the site of the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705.In another preferred embodiment, described amino acid sequence of polypeptide and SEQID NO:70, site corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 142,183,266 and 705 differs Ala, Arg, Asn, Asp, Cys, Gln, Glu, Gly, His, Ile, Leu, Lys, Met, Phe, Pro, Ser, Thr, Trp, Tyr or Val.In another also preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70 differ Ser, Arg, Gln and Gly in the site corresponding to the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705 respectively.In another the most preferred embodiment, described amino acid sequence of polypeptide and SEQ ID NO:70, the site in the amino acid/11-844 of SEQ ID NO:70 142,183,266 and 705 differs Ser, Arg, Gln and Gly respectively.

Described polypeptide is made up of 741 to 750,751 to 760,761 to 770,771 to 780,781 to 790,791 to 800,801 to 810,811 to 820,821 to 830,831 to 840,841 to 850,851 to 860,861 to 870,871 to 880,881 to 890,891 to 900,901 to 910,911 to 920,921 to 930,931 to 940 or 941 to 950 amino acid.

Described isolated polypeptide, compare with the polypeptide of SEQ ID NO:2 or SEQ ID NO:70, has one or more improved character, wherein said improved character is selected from heat activity, thermostability, pH activity, pH stability, substrate specificity, product specificity and chemical stability, as described here.

The isolating nucleotide sequence of aforementioned polypeptides the present invention also relates to encode, the nucleic acid construct, expression vector and the host cell that comprise described nucleotide sequence, with according to same disclose of this paper for the variant of beta-Polyglucosidase, produce the method for polypeptide with beta-glucosidase activity.

Biomass is degraded to monose, disaccharides and polysaccharide

Beta-Polyglucosidase variant of the present invention and host cell, can be used for from biomass produce monose, disaccharides and polysaccharide as chemical or fermentation raw material to produce ethanol, plastics or other products or intermediate.Described beta-Polyglucosidase variant can be the form of removing cell or not removing the thick fermented liquid of cell, or is the form of the zymin of half-purifying or purifying.Replacedly, host cell of the present invention can be used as the source of variant in the fermenting process of biomass.

Biomass can comprise, but be not limited to, timber resources (wood resource), municipal solid waste, waste paper and crop residue (referring to, for example, Wiselogel et al., 1995, at Handbook onBioethanol (Charles E.Wyman, editor), pp.105-118, Taylor﹠amp; Francis, Washington D.C.; Wyman, 1994, Bioresource Technology 50:3-16; Lynd, 1990, Applied Biochemistry and Biotechnology 24/25:695-719; Mosier et al, 1999, Recent Progress in Bioconversion of Lignocellulosics, Advances in BiochemicalEngineering/Biotechnology, T.Scheper, managing editor, Volume 65, pp.23-40, Springer-Verlag, New York).

Topmost polysaccharide is a Mierocrystalline cellulose in the primary cell wall of biomass (primary cell wall), second abundant be half-Mierocrystalline cellulose (hemi-cellulose), the 3rd is pectin (pectin).The secondary cell wall (secondary cell wall) that produces after cell stops growing also contains polysaccharide, and by usually strengthening with the polymeric of hemicellulose covalent cross-linking is wooden.Mierocrystalline cellulose is the homopolymer (homopolymer) of anhydro cellobiose (anhydrocellobiose), thereby become beta-(the 1-4)-D-dextran of wire, and hemicellulose comprises all cpds, the xylan (xylan) of a series of such as having (spectrum) substituent compound branched structure, xyloglucan (xyloglucan), araboxylan (arabinoxylan) and mannosans (mannan).Though (polymorphous) that Mierocrystalline cellulose is normally polymorphic finds Mierocrystalline cellulose insoluble crystalline matrix (crystalline matrix) mainly as parallel dextran chain (parallel glucan chain) in plant tissue.Hemicellulose is connected by hydrogen bond with Mierocrystalline cellulose and other hemicelluloses usually, and this has promoted the stable of cell walls matrix (cell wall matrix).

The glycosylhydrolase of three kinds of main types (glycohydrolase) is used for cellulolytic biomass:

(1) " interior-1,4-beta-dextranase " or 1,4-beta-D-dextran-4-glucan hydrolase (EC3.2.1.4), it acts on soluble and insoluble 1 randomly, the 4-beta-dextran substrate.

(2) " outer-1,4-beta-D-dextranase ", it comprises 1,4-beta-D-dextran glucose lytic enzyme (EC3.2.1.74), it is from 1, and the 4-beta-D-dextran discharges D-glucose and hydrolysis D-cellobiose lentamente; And cellobiose hydrolase (1,4-beta-D-Sephacel disaccharide-hydrolysing enzymes, EC 3.2.1.91), it is from 1, and the 4-beta-dextran discharges the D-cellobiose.

(3) " beta-D-Polyglucosidase " or beta-D-glucoside glucose lytic enzyme (EC 3.2.1.21), it act as and discharge the D-glucose unit from cellobiose and soluble cellodextrin (cellodextrin), and a series of glucosides.

This three fermentoid acts synergistically together, cause separating effectively crystalline substance (decrystallization) and hydrolysis from the natural cellulose of biomass to produce recuding sugars.

Beta-Polyglucosidase variant of the present invention can be used together with the above-mentioned enzyme of mentioning, with the cellulose components of further degradation biological amount substrate (referring to, for example, Brigham et al., 1995, Handbook onBioethanol (Charles E.Wyman, editor), pp.119-141, Taylor﹠amp; Francis, Washington D.C.; Lee, 1997, Journal of Biotechnology 56:1-24).

Ethanol can and be converted into ethanol with the carbohydrate that discharges by the enzymic degradation biomass and prepare.This class ethanol usually is called as bio-ethanol (bioethanol) or biofuel (biofuel).It can be used as fuel dope or supplement (extender) being less than 1% in the mixture of 100% (fuel surrogate).

Detergent composition

Can add beta-Polyglucosidase variant of the present invention, it becomes the composition of detergent composition thus.

Detergent composition of the present invention, can be configured to the detergent composition of hand washing or machine washing, it comprises the laundry additive composition that is suitable for pre--fabric that processing is made dirty, fabric softener composition with the rinsing adding, or be configured to detergent composition, the clean operation that is used for general family's stiff dough, or be used to hand-wash by preparation or the operation of the plate of machine-washing.

Aspect concrete, the invention provides the detergent additives that contains proteolytic enzyme of the present invention.Described detergent additives, and described detergent composition can comprise one or more other enzyme, as another kind of proteolytic enzyme, as Sumizyme MP, lipase, at (cutinase), amylase, carbohydrase, cellulase, polygalacturonase (pectinase), mannase, arabinase (arabinase), Galactanase (galactanase), zytase, oxydase from genus bacillus, for example, laccase and/or peroxidase.

Usually, the character of selected enzyme should adapt with selected washing composition, (be optimal pH, with other the enzyme composition and non--enzyme composition etc. adapts, and described enzyme should exist with significant quantity.

Proteolytic enzyme: suitable proteolytic enzyme comprises those animals, plant or microbe-derived.Comprise mutant chemically modified or protein engineering.Described proteolytic enzyme can be serine protease or metalloprotease, preferred alkaline microbial protease or trypsinase-sample proteolytic enzyme.The example of Sumizyme MP is subtilisin (subtilisin), especially those are derived from genus bacillus, for example, subtilisin Novo, subtilisin Carlsberg, subtilisin 309, subtilisin 147 and subtilisin 168 (in WO 89/06279, describing).The example of trypsinase-sample proteolytic enzyme be trypsin for example, derive from pig or ox) and the sickle oxysporum protease in WO 89/06270 and WO 94/25583, described.

The example of useful proteolytic enzyme is at WO 92/19729, WO 98/20115, WO 98/20116, with the variant of describing among the WO 98/34946, especially has the variant of replacement: 27,36,57,76,87,97,101,104,120,123,167,170,194,206,218,222,224,235 and 274 in one or more following sites.

Preferred commercial available proteolytic enzyme comprises Alcalase ^TM, Savinase ^TM, Primas ^TM, Duralase ^TM, Esperase ^TMAnd Kannase ^TM(Novo Nordisk A/S), Maxatase ^TM, Maxacal ^TM, Maxapem ^TM, Properase ^TM, Purafect ^TM, Purafect OxP ^TM, FN2 ^TMAnd FN3 ^TM(Genencor International Inc.).

Suitable lipase comprises those bacterial origins or originated from fungus.Comprise mutant chemically modified or protein engineering.The example of useful lipase comprises the lipase from Humicola (different name is thermophilic mould genus), for example from H.lanuginosa (T.lanuginosus), described at EP 258068 and EP 305216, or from H insolens, described at WO 96/13580; Pseudomonas lipase, for example from Pseudomonas alcaligenes (P.alcaligenes) or pseudomonas pseudoalcaligenes (P.pseudoalcaligenes) (EP 218272), pseudomonas cepacia (P.cepacia) (EP 331376), (GB 1 for Pseudomonas stutzeri (P.stutzeri), 372,034), Pseudomonas fluorescens (P.fluorescens), pseudomonad strain SD 705 (WO 95/06720 and WO 96/27002), P.wisconsinensis (WO96/12012); Genus bacillus lipase, for example from subtilis (Dartois et al.1993, Biochemica et Biophysica Acta, 1131:253-360), bacstearothermophilus (JP64/744992) or bacillus pumilus (B.pumilus) (WO 91/16422).

Other examples are lipase Variant as those described in WO 92/05249, WO 94/01541, EP 407225, EP 260105, WO 95/35381, WO 96/00292, WO 95/30744, WO 94/25578, WO 95/14783, WO 95/22615, WO 97/04079 and the WO 97/07202.

Preferred commercial available lipase comprises Lipolase ^TMWith Lipolase Ultra ^TM(NovoNordisk A/S).

Amylase:Suitable amylase (α-and/or B-) comprises those bacterial origins or originated from fungus.Comprise mutant chemically modified or protein engineering.Proteolytic enzyme comprises, for example, the α-Dian Fenmei that obtains from genus bacillus, the concrete bacterial strain of Bacillus licheniformis for example at GB 1,296, describes in detail in 839.

Useful diastatic example is the variant of describing in WO 94/02597, WO 94/18314, WO96/23873, WO 97/43424, especially has the variant of replacement in one or more following sites: 15,23,105,106,124,128,133,154,156,181,188,190,197,202,208,209,243,264,304,305,391,408 and 444.

Commercial available amylase is Duramyl ^TM, Termamyl ^TM, Fungamyl ^TMAnd BAN ^TM(Novo Nordisk A/S), Rapidase ^TMAnd Purastar ^TM(from genencor International Inc.).

Cellulase:Suitable cellulase comprises those bacterial origins or originated from fungus.Comprise mutant chemically modified or protein engineering.Suitable cellulase comprises the cellulase from bacillus, Rhodopseudomonas, Humicola, fusarium, Thielavia, the mould genus of branch top spore, for example by Humicolainsolens, thermophilic ruin that the mould and sharp sickle spore of silk produces at US 4,435,307, US 5,648, and 263, US5,691,178, US 5,776,757 and WO 89/09259 in disclosed fungal cellulase.

Specially suitable cellulase is alkalescence or the neutral cellulase with color maintenance (colour care) benefit.The example of such cellulase is the cellulase of describing in EP 0 495 257, EP 0 531 372, WO96/11262, WO 96/29397, WO 98/08940.Other examples are cellulase variants, as those at WO 94/07998, described in EP 0 531 315, US 5,457,046, US 5,686,593, US 5,763,254, WO 95/24471, WO 98/12307 and the PCT/DK98/00299.

Commercial available cellulase comprises Celluzyme ^TMAnd Carezyme ^TM(Novo NordiskA/S), Clazinase ^TMWith Puradax HA ^TM(genencor International Inc.) and KAC-500 (B) ^TM(Kao Corporation).

Peroxidase/oxydase:Suitable peroxidase/oxydase comprises those plants, bacterium or originated from fungus.Comprise mutant chemically modified or protein engineering.

The example of useful peroxidase comprises the peroxidase from Coprinus (Coprinus), for example from Coprinus cinereus (C.cinereus) and variant thereof, as those described in WO 93/24618, WO 95/10602 and the WO 98/15257.

Commercial available peroxidase comprises Guardzyme ^TM(Novo Nordisk A/S).

Described detergent enzyme can contain the independently additive of one or more enzymes by adding, or comprises the additive of the combination of all described enzymes by adding, is contained in the detergent composition.Detergent additives of the present invention, promptly the additive of additive or combination independently can be formulated as, for example particle, liquid, slurry (slurry) etc.Preferred detergent additives is formulated as particle, right and wrong-atomizing (non-dusting) particle especially, liquid, especially stable liquid, or slurry.

Non--atomizing particle is passable, for example, as at US 4,106, disclosed being prepared in 991 and 4,661,452, and can at random coat (coat) by method well-known in the art.The example of wax coating material (waxy coating material) be poly-(oxyethane) product with molecular-weight average of 1000 to 20000 (polyoxyethylene glycol (polyethyleneglycol), PEG); Nonyl phenol (ethoxylated nonylphenols) with ethoxylation of 16 to 50 ethylene oxide units; The Fatty Alcohol(C12-C14 and C12-C18) of ethoxylation, wherein said alcohol comprise 12 to 20 carbon atoms, and 15 to 80 ethylene oxide units are wherein arranged; Aliphatic alcohols; Lipid acid; Monoglyceride and triglyceride and triglyceride level with lipid acid.The example that is suitable for the film forming coating material (film-forming coating material) used with fluidization provides in GB1483591.Liquid enzyme formulation can, for example, according to the method for having set up, by adding polyvalent alcohol (polyol), as propylene glycol (propylene glycol), sugar or sugar alcohol (sugar alcohol), lactic acid or boric acid (boric acid) stabilization.The enzyme of protection can be prepared according to disclosed method in EP 238,216.

Detergent composition of the present invention can be any form easily, for example, and bar, sheet, powder, particle, paste or liquid.Liquid washing agent can be water-based, comprises the water of as many as 70% and the organic solvent of 0-30% usually; Or be non--water-based.

Described detergent composition comprises one or more tensio-active agents (surfactant), and it is non--ionic, comprises partly-polar (semi-polar) and/or anionic and/or cationic and/or zwitterionic (zwitterionic).Described tensio-active agent exists with the level of 0.1% to 60% (calculating by weight) usually.

When comprising therein, described washing composition comprises about 1% to about 40% anion surfactant usually, alkylbenzene sulfonate (linear alkylbenzenesulfonate) such as wire, alpha-alkene sulfonate (alpha-olefinsulfonate), alkyl sulfuric ester (alkyl sulfate) (fatty alcohol sulfate (fatty alcohol sulfate)), alcohol ethoxy sulfuric ester (alcohol ethoxysulfate), secondary alkyl sulfonate (secondary alkanesulfonate), alpha-sulfo methyl ester (alpha-sulfo fatty acid methylester), alkyl-or alkenyl succinic acid (alkenylsuccinic acid) or soap.

When comprising therein; described washing composition comprises non--ionic surface active agent of about 0.2% to about 40% usually; such as alcohol ethoxylates; nonyl phenol ethoxy compound (nonyl phenolethoxylate); alkyl poly glucoside (alkyl polyglycoside); alkyl dimethyl amine oxide (alkyldimethylamineoxide); the fatty monoethanol amide of ethoxyquin (ethoxylated fatty acidmonoethanolamide); fatty monoethanol amide (fatty acid monoethanolamide); polyhydroxylated alkyl fatty acid amide (polyhydroxy alkyl fatty acid amide), or N-acyl group N alkyl (N-acyl N-alkyl) derivative of glycosamine (glucosamine) (" glucamide (glucamides) ").

Described washing composition can comprise washing builder (detergent builder) or the complexing agent (complexing agent) of 0-65%, such as zeolite (zeolite), diphosphate (diphosphate), triphosphate (triphosphate), phosphoric acid salt (phosphonate), carbonate (carbonate), Citrate trianion (citrate), nitrilotriacetic acid (nitrilotriacetic acid), with ethylenediamine tetraacetic acid (EDTA) (ethylenediaminetetraaceticacid), Diethylene triamine pentaacetic acid (diethylenetriaminepentaacetic acid), alkyl-or alkenyl succinic acid, silicate of solubility (silicate) or layered silicate (for example from Hoechst SKS-6).

Described washing composition can comprise one or more polymkeric substance.Example is carboxymethyl cellulose (carboxymethylcellulose), poly-(ethene arsenic pyrrolidone) (poly (vinylpyrrolidone)), poly-(ethylene glycol) (poly (ethylene glycol)), poly-(vinyl alcohol) (poly (vinyl alcohol)), poly-(vinylpyridine-N-oxide compound) (poly (vinylpyridine-N-oxide)), poly-(ethene imidazoles) (poly (vinylimidazole)), polycarboxylate (polycarboxylates), such as polyacrylic ester (polyacrylate), toxilic acid/acrylic copolymer (maleic/acrylic acid copolymer) and dodecyl methyl acrylate/acrylic copolymer (lauryl methacrylate/acrylic acid copolymer).

Described washing composition can comprise bleaching system (bleaching system), and described bleaching system can comprise H ₂O ₂The source, such as perborate (perborate) or percarbonate (percarbonate), its can with the bleach-activating agent (peracid-forming bleach activator) that forms peracid, as tetraacetyl ethylene diamine (tetraacetylethylenediamine) or acyloxy benzene sulfonate in the ninth of the ten Heavenly Stems (nonanoyloxybenzene sulfonate) combination.Replacedly, described bleaching system can comprise for example peroxy acid of amides, acid imide or sulfone class.

The enzyme of detergent composition of the present invention can be used conventional stablizer and carry out stabilization, described stablizer, for example, polyvalent alcohol such as propylene glycol or glycerine, sugar or sugar alcohol, lactic acid, boric acid or boric acid derivatives, for example, aromatic boric acid ester (aromatic borate ester) or phenyl-boron dihydroxide derivative such as 4-formylphenyl (formylphenyl) boric acid, and described composition preparing described in WO 92/19709 and WO 92/19708 for example.

Described washing composition also can contain other conventional detergent ingredients, for example fiber conditioning agent (fabricconditioners) comprises clay (clay), whipping agent (foam booster), suds suppressor (suds suppressor), anticorrosive agent (anti-corrosion agent), outstanding dirty agent (soil-suspending agent), the anti-soil dirt is deposited reagent (anti-soil redeposition agent) again, dyestuff (dye), sterilant (bactericide), white dyes (optical brightener), hydrotrote (hydrotrope), tarnish inhibitor (tarnish inhibitor) or spices (perfume).

In described detergent composition, any enzyme, enzyme especially of the present invention can add with the amount corresponding to every liter of washings of zymoprotein (wash liquor) of 0.01-100mg, every liter of washings of zymoprotein of zymoprotein every liter of washings, the especially 0.1-1mg of preferred 0.05-5mg.

Enzyme of the present invention can additionally be incorporated among the WO 97/07202 in the disclosed detergent formulation, and WO97/07202 is incorporated herein by reference at this.

Plant

The present invention also relates to genetically modified plant, plant part or vegetable cell, it transforms with the nucleotide sequence of coding variant beta-Polyglucosidase of the present invention, to express and to produce the described variant of recyclable amount.Described polypeptide can reclaim from plant or plant part.Replacedly, can use described plant that comprises the variant of recombinating or plant part to improve the quality of food (food) or feed (feed), for example, improve nutritive value (nutritional value), palatability (palatability) and rheol (rheological) character, or destroy the factor (antinutritive factor) of anti-trophicity.

Genetically modified plant can be the variant of dicots (dicotyledonous) (dicotyledons) or monocotyledonous (monocotyledons) or its engineering.Monocotyledonous example is a grass (grasses), as English grass (meadow grass) (bluegrass (blue grass), annual bluegrass belongs to (Poa)); Forage grass (forage grass) is as festuca (Festuca), lolium (Lolium); Cold ground type herbage (temperate grass) is as Agrostis; And cereal, for example, wheat, oat, rye, barley, rice (rice), Chinese sorghum and Zea mays (maize) (corn).

The example of dicotyledons is tobacco (tobacco), beans (legumes), as lupine (lupins), potato, sugar beet (sugar beet), pea, (cruciferous) plant of beans (bean) and soybean (soybean) and Cruciferae (Cruciferae (family Brassicaceae)), as Cauliflower (cauliflower), Semen Brassicae campestris (rape seed) and the model organism Arabidopis thaliana (Arabidopsis thaliana) that is closely related.

The example of plant part is stem (stem), callus (callus), leaf (leave), root (root), fruit (fruits), seed (seed) and stem tuber (tuber), and the independent body that comprises these parts, for example, epidermis (epidermis), mesophyll (mesophyll), parenchyma (parenchyma), vascular tissue (vasculartissues), meristematic tissue (meristems).And concrete vegetable cell compartment (compartments), also be considered to plant part as chloroplast(id) (chloroplast), apoplast (apoplast), plastosome (mitochondria), vacuole (Vacuole), peroxysome (peroxisome) and tenuigenin (cytoplasm).In addition, any vegetable cell, whatsoever tissue-derived, all be considered to plant part.Similarly, plant part also is considered to plant part as separating with concrete tissue and the cell that promotes application of the present invention, for example embryo (embryos), endosperm (endosperms), aleuron (aleurone) and kind skin (seed coat).

The filial generation of above-mentioned plant, plant part and vegetable cell is also included within the scope of the present invention.

Express the genetically modified plant or the vegetable cell of variant of the present invention, can make up according to method well-known in the art.In brief, described plant or vegetable cell are integrated into the plant host genome by the expression construct with one or more codings variant of the present invention, and the plant or the vegetable cell of the improvement that propagation obtains in genetically modified plant or vegetable cell make up.

Easily, described expression construct is a nucleic acid construct, it comprises the nucleotide sequence of the variant of the present invention of encoding, and described nucleotide sequence operationally is connected with the necessary suitable regulating and controlling sequence of the described nucleotide sequence of expression in preferential plant of selecting or plant part.In addition, described expression construct can comprise selectable mark, and it is used to differentiate the host cell that has been integrated into expression construct and this construct is imported the required dna sequence dna of described plant (latter depends on the DNA introduction method that is adopted).

Regulating and controlling sequence, as promotor and terminator sequence and the signal sequence of choosing wantonly or the selection of transhipment (transit) sequence, for example, when, where and on the basis of how to express to determine at the described polypeptide of needs, for example, the gene of expressing coding polypeptide of the present invention can be (constitutive) or the inductive (inducible) of composing type, or can be development-specific, phasic specificity or tissue-specific, but and concrete tissue or the plant part of gene product target, as seed or leaf.Regulating and controlling sequence is, for example, by Tagueet al., 1988, Plant Physiology 86:506 is described.

For constitutive expression, can use 35S-CaMV promotor, corn ubiquitin (maize ubiquitin) 1 promotor and rice actin (rice actin) 1 promotor (Franck et al., 1980, Cell 21:285-294; Christensen et al., 1992, Plant Mo.Biol.18:675-689; Zhang et al., 1991, Plant Cell3:1155-1165).Organ specific promotor can be, for example, and from storage tissue (storage sink tissue), as the promotor (Edwards﹠amp of seed, potato rhizome and fruit; Coruzzi, 1990, Ann.Rev.Genet.24:275-303), or from metabolic pool tissue (metabolic sink tissues), as meristematic tissue (Ito et al., 1994, Plant Mol.Biol.24:863-878), the promotor of seed-specific, such as gluten (glutelin) promotor from rice, prolamine (prolamin) promotor, sphaeroprotein (globulin) promotor or albumin (albumin) promotor (Wu et al., 1998, Plant and CellPhysiology 39:885-889), broad bean promotor (Conrad et al. from the seed protein gene of the unknown of legumin (legumin) B4 and broad bean (Vicia faba), 1998, Journal of Plant Physiology152:708-711), promotor (Chen et al. from seed oil body protein (body protein), 1998, Plant and Cell Physiology 39:935-941), storage protein apA promotor from colea (Brassica napus), or the promotor of any other seed-specific well-known in the art, for example, described in the WO 91/14772.In addition, promotor can be the specific promotor of leaf, as rbcs promotor (Kyozuka et al. from rice or tomato, 1993, Plant Physiology 102:991-1000), chlorella virus (chlorella virus) VITAMIN B4 methyltransgerase (adeninemethyltransferase) gene promoter (Mitra and Higgins, 1994, Plant Molecular Biology26:85-93), or from aldP gene promoter (the Kagaya et al. of rice, 1995, Molecular andgeneral genetics 248:668-674), or wound inductive promotor, as potato pin2 promotor (Xuet al., 1993, Plant Molecular Biology 22:573-588).Similarly, described promotor can be induced by abiotic processing, described abiotic processing such as temperature, arid or salinity change, or the material of the described promotor of activation by exogenous application induces, and for example ethanol, oestrogenic hormon (oestrogens), plant hormone (plant hormones) are as ethene, dormin (abscisic acid), gibberic acid (gibberellic acid) and/or heavy metal.

The promotor enhancer element also is used in the more high expression level of realizing polypeptide of the present invention in the described plant.For example, described promotor enhancer element can be intron (intron), its be placed in promotor and the nucleotide sequence of the polypeptide of the present invention of encoding between.For example, Xu et al., 1993, the literary composition that sees before, first intron that discloses rice actin 1 gene strengthens the application of expressing.

Any other part of selectable marker gene and described expression construct, can be selected from available in the art those.

Described nucleic acid construct, according to routine techniques well-known in the art, be integrated into Plant Genome, the conversion, microinjection (microinjection), particle bombardment (particle bombardment), the biological projectile that comprise edaphic bacillus (Agrobacterium)-mediation transform (biolistic transformation) and electroporation (Gasser et al., 1990, Science 244:1293; Potrykus, 1990, Bio/Technology 8:535; Shimamoto et al., 1989, Nature 338:274).

At present, the transgenosis (genetransfer) of Agrobacterium tumefaciens (Agrobacterium tumefaciens)-mediation, be to produce the method for preferential selection of transgenosis dicotyledons (in order to investigate, referring to Hooykas and Schilperoort, 1992, Plant Molecular Biology 19:15-38), and it also can be used for transforming monocots, though normally preferred for other method for transformation of these plants.At present, produce the method for the preferential selection of transgenosis dicotyledons, be with particle (scribbling the gold or tungsten particle of the microcosmic of transfering DNA) bombardment embryonic callus (embryonic calli) or developmental plumule (developing embryos) (Christou, 1992, Plant Journal2:275-281; Shimamoto, 1994, Current Opinion Biotechnology 5:158-162; Vasil et al., 1992, Bio/Technology 10:667-674).The interchangeable method of transforming monocots is based on protoplast transformation, as by Omirulleh et al., and 1993, described in the Plant Molecular Biology 21:415-428.

After the conversion, screening has the transformant that is integrated into expression construct wherein, and it is regenerated in whole plant according to the method for knowing in the art.Step of converting usually is in the regenerated process or in the generation of back, by using, for example, with two T-DNA construct cotransformations or select gene (selectiongene) with specific recombinase (recombinase) locus specificity ground excision independently, selective removal selects gene to design.

The present invention also relates to produce the method for variant of the present invention, comprise that (a) cultivates genetically modified plant or vegetable cell, it comprises the nucleotide sequence of the variant of encoding, and described variant has beta-glucosidase activity of the present invention helping to produce under the condition of described variant; (b) reclaim described variant.

Other application

Beta-Polyglucosidase variant of the present invention, also can be used as biopolishing agent (biopolishing agent) and be used to handle textiles, and be used for reducing fluffing (fuzz), balling-up (pilling), quality changes (texturemodification) and sand washing (N.K.Lange, in P.Suominen, T.Reinikainen (Eds.), Trichoderma reesei Cellulases and Other Hydrolases, Foundation for Biotechnicaland Industrial Fermentation Research, Helsinki, 1993, pp.263-272).In addition, described variant also can be used for the bio-pulping (biopulping) or the peeling (debarking) of wood working, fibre modification in the papermaking (fiber modification), the refining energy cost of bleaching and minimizing, plain boiled water is handled (whitewater treatment), for reclaiming waste water (wastewater recycling), reclaim (lignocellulosic) fiber of lignocellulose, such as deinking (deinking) and processing secondary fiber (secondaryfiber), with using the timber resistates is important (SD, Mansfield and A.R.Esteghlalian are at S.D, Mansfield and J.N.Saddler (Eds.), Applications of Enzymes toLignocellulosics, ACS Symposium Series 855, Washington, D.C., 2003, pp.2-29).

The present invention further describes by following embodiment, and described embodiment should not regard the restriction to scope of the present invention as.

Embodiment

Material

As the chemical of damping fluid and substrate is the commodity of SILVER REAGENT (reagent grade) at least.

Bacterial strain

Described yeast strain yeast saccharomyces cerevisiae YNG318 (MATa, ura3-52, leu-2 Δ 2, pep4 Δ 1, his4-539, cir ⁺) be used to express aspergillus oryzae and Aspergillus fumigatus beta-Polyglucosidase and their variant.The bacterial isolates that is used to produce plasmid is the super competent cell of Epicurian coli XL-10Gold (ultracompetentcell), Epicurian coli XL 1-Blue subclone-competent cell and Epicurian coli SURE electroporation-competent cell (Stratagene, La Jolla, CA).Aspergillus oryzae Jal250 bacterial strain (WO 99/61651) is used to express aspergillus oryzae beta-Polyglucosidase.Aspergillus fumigatus PaHa34 is as the source of the GH3A beta-of family Polyglucosidase.

Substratum and solution

The YPD substratum is made up of every liter of 10g yeast extract, 20g bacto-tryptone (bacto tryptone) and 40ml 50% glucose.

Yeast is selected substratum, replenishes mixture (complete supplement mixture) (CSM, Qbiogene, Inc., Carlsbad, CA fully by every liter of 6.7g yeast nitrogen base (nitrogen base), 0.8g; Lack uridylic (uracil) and contain the VITAMIN B4 (adenine) of 40mg/ml), 5g casamino acids (casmino acid) (no amino acid), 100ml 0.5M succinate (succinate) pH 5.0,40ml 50% glucose, 1ml100mM CuS0 ₄, 50mg penbritin (ampicillin) and 25mg paraxin (chloramphenicol) forms.

Yeast is selected plate culture medium, add the 20g bacterium by every liter and use agar (bacto agar) and 150mg5-bromo-4-chloro-3-indoles-beta-D-glucopyranoside (X-Glc, INALCO SPA, Milano, Italy) but the yeast that lacks penbritin and paraxin selects substratum to form.

The M400 substratum is by every liter of 50g maltodextrin (maltodextrin), 2g MgSO ₄7H ₂O, 2gKH ₂PO ₄, 4g citric acid, 8g yeast extract, 2g urea, 0.5ml AMG trace-metal solution and 0.5g CaCl ₂Form.

AMG trace-metal solution is by every liter of 14.3g ZnSO ₄7H ₂O, 2.5g CuSO ₄5H ₂O, 0.5gNiCl ₂6H ₂O, 13.8g FeSO ₄7H ₂O, 8.5g MnSO ₄H ₂O and 3g citric acid are formed.

1 * BS is by every liter of 2g MgSO ₄7H ₂O, 2g K ₂SO ₄With 10g KH ₂PO ₄Form.

Minimal medium aspergillus oryzae is selected dull and stereotyped by every liter of 6g NaNO ₃, 0.52g KCl, 1.52gKH ₂PO ₄, 1ml COVE trace element solution, 20g agar Noble, 20ml 50% glucose, 2.5ml 20%MgSO ₄7H ₂O forms.

COVE trace element solution (trace elements solution) is by every liter of 0.04gNaB ₄O ₇10H ₂O, 0.4g CuSO ₄5H ₂O, 1.2g FeSO ₄7H ₂O, 0.7g MnSO ₄H ₂O, 0.8gNa ₂MoO ₂2H ₂O and 10g ZnSO ₄7H ₂O

The yeast lysis buffer is made up of 1% sodium lauryl sulphate (SDS), 10mM Tris-HCI and 1mMEDTA, pH 8.0.

The Solanum tuberosum dextrosum substratum is made up of the Solanum tuberosum dextrosum (Difco) of every liter 39 gram.

The PDA flat board is made up of the potato dextrose agar (Difco) of every liter 39 gram.

The MDU2BP substratum is by every liter of 45g maltose, 1g MgSO ₄7H ₂O, 1g NaCl, 2gK ₂SO ₄, 12g KH ₂PO ₄, 7g yeast extract, 2g urea and 0.5ml AMG trace-metal solution, pH to 5.0 forms.

Preparation plasmid DNA and dna sequencing

Use BioRobot 9600 (QIAGEN, Inc., Chatsworth, CA) preparation from the plasmid DNA of coli strain.

(Applied Biosystems, Foster City CA) go up application dyestuff terminator chemistry (Giesecke et al., 1992, Journal of Virol.Methods 38:47-60) and carry out dna sequencing at ABI3700.Sequence is used phred/phrap/consed and sequence-specific primer assembles (University ofWashington, Seattle WA).

Embodiment 1: make up pSATe111 yeast saccharomyces cerevisiae expression vector

2, the 605bp dna fragmentation, it comprises that (SEQ ID NO:1 is the cDNA sequence to the section of aspergillus oryzae beta-Polyglucosidase encoding sequence from the ATG initiator codon to the TAA terminator codon, and SEQ ID NO:2 is a deduced amino acid), with pJaL660 (WO 2002/095014) is template, increases by PCR with primer 992127 (justice is arranged) that shows below and 992328 (antisenses).

992127：5′-GCAGATCTACCATGAAGCTTGGTTGGATCGAG-3′(SEQ ID NO：3)

Primer 992127 has BglII site, upstream to 992328:5 '-GCCTCGAGTTACTGGGCCTTAGGCAGCGAG-3 ' (SEQ ID NO:4), and primer 992328 has Xho I site, downstream.

Described amplified reaction (50 μ l) is by containing MgCl ₂1 * PCR damping fluid (Roche AppliedScience, Manheim, Germany), Pwo archaeal dna polymerase (the Roche AppliedScience of 0.25mM dNTPs, 50 μ M primers, 992127,50 μ M primers 992328,80ng pJaL660 and 2.5 units, Manheim Germany) forms.Described Eppendorf Mastercycler 5333 (the Eppendorf Scientific that is reflected at, Inc., Westbury, NY) incubation in, its program is 1 and circulates in 94 ℃ and carried out 5 minutes, be 25 circulations then, each circulation is carried out 60 seconds, 55 ℃ for 94 ℃ and is carried out carrying out in 60 seconds and 72 ℃ 120 seconds (10 minutes final extensions).Then with described PCR product, use PCR-BluntII-TOPO Cloning Kit (Invitrogen, Carlsbad, CA), according to the operation instruction of manufacturers, subclone in the PCR-Blunt II-TOPO carrier to produce plasmid pSATe101 (Fig. 1).Plasmid pSATe101 is with BglII and Xho I digestion, to discharge described beta-Polyglucosidase gene.

Reaction product is on 1.0% sepharose, using 40mM Tris-acetate-1mM EDTA (TAE) damping fluid separates, wherein 2.6kb product band is excised from described gel, and application QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia CA) carries out purifying according to the operation instruction of manufacturers.

With the digestion of described 2.6kb PCR product and be cloned into the Bam HI of (Labbe and Thiele, 1999, Methods Enzymol.306:145-53) among the available copper inductive 2 μ m Yeast expression carrier pCu426 and Xho I site to produce pSATe111 (Fig. 2).

Embodiment 2: make up the pMJ04 expression vector

Expression vector pMJ04 passes through from Trichoderma reesei RutC30 (Montenecourt and Eveleigh, 1979, Adv.Chem.Ser. 181:289-301) in the genomic dna, primer 993429 (antisense) that application shows below and 993428 (justice is arranged), plain disaccharide-hydrolysing enzymes 1 gene (cbhl) terminator of pcr amplification Trichoderma reesei outer fiber makes up.Described antisense primer is designed to have Pac I site at 5 '-end, and has adopted primer to have Spe I site at 3 '-end.

Primer 993429 (antisense):

5′-AACGTTAATTAAGGAATCGTTTTGTGTTT-3′(SEQ ID NO：5)

Primer 993428 (justice is arranged):

5′-AGTACTAGTAGCTCCGTGGCGAAAGCCTG-3′(SEQ ID NO：6)

Trichoderma reesei RutC30 genomic dna is used DNeasy Plant Maxi Kit, and (Qiagen, Chatsworth CA) separate.

Described amplified reaction (50 μ l) is by containing MgCl ₂1 * ThermoPol reaction buffer (NewEngland Biolabs, Beverly, MA), Vent archaeal dna polymerase (the New England Biolabs of 0.3mM dNTPs, 100ng Trichoderma reeseiRutC30 genomic dna, 0.3 μ M primer, 992127,0.3 μ M primer 992328 and 2 units, Beverly MA) forms.Described Eppendorf Mastercycler 5333 (Eppendorf Scientific, Inc., the Westbury of being reflected at, NY) incubation in, its program is as follows: 5 circulations, each circulates in 94 ℃ and carried out 30 seconds, carried out 30 seconds at 50 ℃, carried out 60 seconds at 72 ℃; Be 25 circulations then, each circulation is carried out 30 seconds, 65 ℃ for 94 ℃ and is carried out carrying out in 30 seconds and 72 ℃ 120 seconds (5 minutes final extensions).Described reaction product is used the TAE damping fluid and is separated on 1.0% sepharose, wherein 229bp product band is excised from described gel, and uses QIAquick Gel Extraction Kit and carry out purifying.

The PCR fragment that obtains is digested with Pac I and Spe I, and (Roche, Indianapolis IN) are connected among the pAILo01 that digests with same restriction enzyme, to produce pMJ04 (Fig. 3) with Rapid Ligation Kit.

Embodiment 3: make up the pCaHj568 expression vector

Expression plasmid pCaHj568 is made up by pCaHjl70 (United States Patent (USP) 5,763,254) and pMT2188.Plasmid pCaHjl70 comprises Humicola insolens EGV (EGV) coding region.Plasmid pMT2188 makes up as follows: the pUC19 replication orgin carries out pcr amplification from pCaHj483 with the primer 142779 that shows below and 142780.Primer 142780 imports Bbu I site in the PCR fragment.142779：5′-TTGAATTGAAAATAGATTGATTTAAAACTTC-3′(SEQ ID NO：7)142780：5′-TTGCATGCGTAATCATGGTCATAGC-3′(SEQ ID NO：8)

(Roche Molecular Biochemicals, Basel Switserland) are used for operation instruction according to manufacturers, carry out described amplification and subsequent P CR amplification in Expand PCR system.On 1% sepharose, use the TAE damping fluid and separate the PCR product, separate and application Jetquick gel extractionspin kit (Genomed, Wielandstr, Germany) purifying 1160bp fragment.

(CA), the primer 140288 and 142778 below using increases the URA3 gene for Invitrogen, Carlsbad from described yeast saccharomyces cerevisiae cloning vector pYES2.Primer 140288 imports described PCR fragment with Eco RI site.

140288：5′-TTGAATTCATGGGTAATAACTGATAT-3′(SEQ ID NO：9)142778：5′-AAATCAATCTATTTTCAATTCAATTCATCATT-3′(SEQ ID NO：10)

On 1% sepharose, use the TAE damping fluid and separate the PCR product, separate and application Jetquickgel extraction spin kit purifying 1126bp fragment.

Described two PCR fragments are merged by mixing, and use the primer 142780 and 140288 that shows above and increase by overlay method (overlap method) montage (Horton et al., 1989, Gene 77:61-68).On 1% sepharose, use the TAE damping fluid and separate the PCR product, separate and application Jetquick gel extraction spin kit purifying 2263bp fragment.

The fragment that obtains is with Eco RI and BbuI digestion, and is connected on the fragment with the maximum of the pCaHj483 of same enzymic digestion.Connect mixture and be used for transforming by Mandel and Higa, 1970, the method for J.Mol.Biol.45:154 is prepared into the negative coli strain DB6507 (ATCC 35673) of competent pyrF-.On the solid M9 substratum that adds every liter of 1g casein amino acid, 500 μ g VitB1s (thiamine) and 10mg kantlex, screen transformant (Sambrook et al., 1989, MolecularCloning, A Laboratory Manual, 2nd edition, Cold Spring Harbor LaboratoryPress).Separation quality grain from a transformant, and called after pCaHj527 (Fig. 4).

The NA2-tpi promotor that exists among the pCaHj527 is carried out rite-directed mutagenesis by simple PCR method.Nucleotide 134-144 using mutant primer 141223 is converted into CCGTTAAATTT from GTACTAAAACC:

Primer 141223:5 '-GGATGCTGTTGACTCCGGAAATTTAACGGTTTGGTCTTGCATCCC-3 ' (SEQ ID NO:11)

Nucleotide 423-436 using mutant primer 141222 changes CGGCAATTTAACGG into from ATGCAATTTAAACT:

Primer 141222:5 '-GGTATTGTCCTGCAGACGGCAATTTAACGGCTTCTGCGAATCGC-3 ' (SEQ ID NO:12)

The plasmid called after pMT2188 (Fig. 5) that produces.

Humicola insolens EGV coding region as Bam HI-SalI fragment, is transformed into the pMT2188 with Bam HI and Xho I digestion, to produce pCaHj568 (Fig. 6) from pCaHjl70.

Embodiment 4: make up the pMJ05 expression vector

Expression plasmid pMJ05, the primer HiEGV-F and the HiEGV-R that show below pCaHj568 uses make up by pcr amplification 915bp Humicola insolens EGV (EGV) coding region.

HiEGV-F (justice is arranged): 5 '-AAGCTTAAGCATGCGTTCCTCCCCCCTCC-3 ' (SEQ IDNO:13)

HiEGV-R (antisense): 5 '-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3 ' (SEQ ID NO:14)

Described amplified reaction (50 μ l) is made up of the Vent archaeal dna polymerase of l * ThermoPol Reaction Buffer, 0.3mM dNTPs, 10ng pCaHj568 plasmid, 0.3 μ M HiEGV-F primer, 0.3 μ M HiEGV-R primer and 2 units.Describedly be reflected at incubation on the Eppendorf Mastercycler 5333, its program is as follows: 5 circulations, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carried out 60 seconds at 50 ℃ at 72 ℃, be 25 circulations then, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carry out 120 seconds (5 minutes final extend) at 65 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 937bp product band.

The fragment of using this 937bp purifying adopts following primer to carry out follow-up amplification as template DNA:

HiEGV-R (antisense): 5 '-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3 ' (SEQID NO:15)

HiEGV-F-overlap (justice is arranged): 5 '-

ATGCGTTCCTCCCCCC TCC-3 ' (SEQ ID NO:16)

The Trichoderma reesei cbh1 promotor homology of primer sequence that italic is represented and 17bp, and the Humicola insolens EGV coding region homology of underlined primer sequence and 29bp.36bp lap between described promotor and the described encoding sequence, permission will comprise the 994bp fragment of Trichoderma reesei cbh1 promotor, merge with the 918bp fragment that comprises Humicola insolens EGV open reading frame.

Described amplified reaction (50 μ l) is made up of the Vent archaeal dna polymerase of PCR fragment, 0.3 μ M HiEGV-F-overlap primer, 0.3 μ MHiEGV-R primer and 2 units of the 937bp purifying of l * ThermoPol Reaction Buffer, 0.3mM dNTPs, 1 μ l.Describedly be reflected at incubation on the EppendorfMastercycler 5333, its program is as follows: 5 circulations, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carried out 60 seconds at 50 ℃ at 72 ℃, be 25 circulations then, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carry out 120 seconds (5 minutes final extend) at 65 ℃ at 72 ℃.

On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 945bp product band.

Carry out independent pcr amplification Trichoderma reesei cbh1 promoter sequence, it is extended by the 994bp upstream from the ATG initiator codon of the gene of Trichoderma reesei RutC30 genomic dna, uses following primer (it is to have Sal I restriction site at its 5 '-end that adopted design of primers is arranged):

TrCBHIpro-F (justice is arranged): 5 '-AAACGTCGACCGAATGTAGGATTGTTATC-3 ' (SEQID NO:17)

TrCBHIpro-R (antisense): 5 '-GATGCGCAGTCCGCGGT-3 ' (SEQ ID NO:18)

Described amplified reaction (50 μ l) is made up of the Vent archaeal dna polymerase of Trichoderma reesei RutC30 genomic dna, 0.3 μ M TrCBHIpro-F primer, 0.3 μ M TrCBHIpro-R primer and 2 units of l * ThermoPol Reaction Buffer, 0.3mM dNTPs, 100ng.Describedly be reflected at incubation on the Eppendorf Mastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carry out 120 seconds (5 minutes final extensions) at 55 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 998bp product band.

The PCR fragment of this 998bp purifying is used following primer and is carried out follow-up amplification as template DNA:

TrCBHIpro-F：5′-AAACGTCGACCGAATGTAGGATTGTTATC-3′(SEQ ID NO：19)

TrCBHIpro-R-overlap：5′-GGAGGGGGGAGGAACGCAT -3′(SEQ ID NO：20)

The Trichoderma reesei cbh1 promotor homology of sequence that italic is represented and 17bp, and the Humicola insolens EGV coding region homology of underlined primer sequence and 29bp.36bp lap between described promotor and the described encoding sequence, permission will comprise the 994bp fragment of Trichodermareesei cbh1 promotor, merge with the 918bp fragment that comprises Humicola insolens EGV open reading frame.

Described amplified reaction (50 μ l) is made up of the Vent archaeal dna polymerase of PCR fragment, 0.3 μ M TrCBHlpro-F primer, 0.3 μ MTrCB Hlpro-R-overlap primer and 2 units of the 998bp purifying of l * ThermoPol Reaction Buffer, 0.3mM dNTPs, 1 μ l.Describedly be reflected at incubation on the EppendorfMastercycler 5333, its program is as follows: 5 circulations, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carried out 60 seconds at 50 ℃ at 72 ℃, be 25 circulations then, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carry out 120 seconds (5 minutes final extend) at 65 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 1017bp product band.

Described 1017bp Trichoderma reesei cbhl promotor PCR fragment and described 945bpHumicola insolens EGV PCR fragment are as template DNA, adopt following primer to carry out follow-up amplification, merge accurately overlapping PCR is used in 994bp Trchoderma reesei cbh1 promotor and 918bpHumicola insolens EGV coding region.

TrCBHIpro-F：5′-AAACGTCGACCGAATGTAGGATTGTTATC-3′(SEQ ID NO：21)

HiEGV-R：5′-CTGCAGAATTCTACAGGCACTGATGGTACCAG-3′(SEQ IDNO：22)

Described amplified reaction (50 μ l) is made up of the Vent archaeal dna polymerase of 1 * ThermoPol Reaction Buffer, 0.3mM dNTPs, 0.3 μ M TrCBHlpro-F primer, 0.3 μ M HiEGV-R primer and 2 units.Describedly be reflected at incubation on the Eppendorf Mastercycler 5333, its program is as follows: 5 circulations, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carried out 60 seconds at 50 ℃ at 72 ℃, be 25 circulations then, each 94 ℃ carry out 30 seconds, carried out 30 seconds and carry out 120 seconds (5 minutes final extend) at 65 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick GelExtraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 1926bp product band.

With the 1926bp fragment that obtains, use the operation instruction of ZeroBlunt TOPO PCR Cloning Kit according to manufacturers, be cloned into the pCR-Blunt-II-TOPO carrier (Invitrogen, Carlsbad, CA).With the plasmid that obtains with Not I and SalI digestion, with the 1926bp fragment purification and be connected to also pMJ04 expression vector, with generation pMJ05 (Fig. 7) with two kinds of same restriction enzymes digestion.

Embodiment 5: make up the pSMail30 expression vector

(SEQ ID NO:1 is a dna sequence dna to the ATG initiator codon of crossing over aspergillus oryzae beta-Polyglucosidase encoding sequence, and SEQ ID NO:2 is a deduced amino acid to the 2586bp dna fragmentation of TAA terminator codon; Intestinal bacteria DSM 14240),, increase by PCR as template with pJaL660 (WO 2002/095014) with primer 993467 (justice is arranged) that shows below and 993456 (antisenses).In 5 ' tip designs Spe I site of antisense primer, so that connect.The Trichoderma reesei cbh1 promotor homology of primer sequence that italic is represented and 24bp, underlined sequence then with the aspergillus oryzae beta-Polyglucosidase coding region homology of 22bp.

Primer 993467:5 '-

ATGAAGCTTGGTTGG ATCGAGG-3 ' (SEQ ID NO:23)

Primer 993456:5 '-ACTAGTTTACTGGGCCTTAGGCAGCG-3 ' (SEQ ID NO:24)

Described amplified reaction (50 μ l) by the Pfx amplification buffer (Invitrogen, Carlsbad, CA), the pJaL660 of 0.25mM dNTPs, 10n, 6.4 μ M primers, 993467,3.2 μ M primers 993456,1mMMgCl ₂Pfx polysaccharase (Invitrogen, Carlsbad, Califomia) composition with 2.5 units.Describedly be reflected at incubation on the Eppendorf Mastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 60 seconds, carried out 60 seconds and carry out 180 seconds (15 minutes final extensions) at 55 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 2586bp product band.

Carry out independent pcr amplification Trichoderma reesei cbh1 promoter sequence, extend its 1000bp upstream by the ATG initiator codon of this gene, and primer 993453 (justice is arranged) that application shows below and primer 993463 (antisense) are to produce 1000bp PCR fragment.The Trichoderma reesei cbh1 promotor homology of primer sequence that italic is represented and 24bp, underlined sequence then with the aspergillus oryzae beta-Polyglucosidase coding region homology of 22bp.The 1000bp fragment that 46bp lap between described promotor and the described encoding sequence, permission will comprise Trichoderma reesei cbh1 promotor accurately merges with the 2586bp fragment that comprises aspergillus oryzae beta-Polyglucosidase open reading frame.

Primer 993453：5′-GTCGACTCGAAGCCCGAATGTAGGAT-3′(SEQ ID NO：25)

Primer 993463：5′- CCTCGATCCAACCAAGCTTCAT

-3′(SEQ ID NO：26)

Described amplified reaction (50 μ l) is by Trichoderma reesei RutC30 genomic dna, 6.4 μ M primers, 993453,3.2 μ M primers 993463, the 1mM MgCl of Pfx amplification buffer, 0.25mM dNTPs, 100ng ₂Form with the pfx polysaccharase of 2.5 units.Describedly be reflected at incubation on the EppendorfMastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 60 seconds, carried out 60 seconds and carry out 180 seconds (15 minutes final extensions) at 55 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 1000bp product band.

Described purifying fragment is as template DNA, primer 993453 (justice is arranged) and primer 993456 (antisense) that employing shows above carry out follow-up amplification, accurately 1000bp Trichoderma reesei cbh1 promotor and 2586bp aspergillus oryzae beta-Polyglucosidase are merged by overlapping PCR.

Described amplified reaction (50 μ l) is by Pfx amplification buffer, 0.25mM dNTPs, 6.4 μ M primers, 993453,3.2 μ M primers 993456,1mM MgCl ₂Form with the Pfx polysaccharase of 2.5 units.Describedly be reflected at incubation on the Eppendorf Mastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 60 seconds, carried out 60 seconds and carry out 240 seconds (15 minutes final extensions) at 60 ℃ at 72 ℃.

The 3586bp fragment that obtains digests with SalI and Spe I, and is connected to the pMJ04 with two kinds of same restriction enzymes digestion, to produce pSMail30 (Fig. 8).

Embodiment 6: make up pSMai135

Described aspergillus oryzae beta-Polyglucosidase coding region (lacks the natural signals sequence of inferring, referring to Fig. 9) from Lys-20 to the TAA terminator codon, as template, carry out pcr amplification with pJaL660 (WO 2002/095014) with primer 993728 (justice is arranged) and the primer 993727 (antisense) that shows below.The Humicola insolens EGV signal sequence homology of sequence that italic is represented and 20bp, underlined sequence then with the aspergillus oryzae beta-Polyglucosidase coding region homology of 22bp.With the 5 ' end of Spe I site design at antisense primer.

Primer 993728:5 '-

AAGGATGATCTCGCGTACTC CC-3 ' (SEQ ID NO:27)

Primer 993727:5 '-GACTAGTCTTACTGGGCCTTAGGCAGCG-3 ' (SEQ ID NO:28)

Described amplified reaction (50 μ l) is by pJaL660,6.4 μ M primers, 993728,3.2 μ M primers 993727, the 1mM MgCl of Pfx amplification buffer, 0.25mM dNTPs, 10ng ₂Form with the Pfx polysaccharase of 2.5 units.Describedly be reflected at incubation on the Eppendorf Mastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 60 seconds, carried out 60 seconds and carry out 180 seconds (15 minutes final extensions) at 55 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquickGel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 2523bp product band.

(the ATG initiator codon is to Ala-21 for the Trichoderma reesei cbhl promotor of 1000bp and the EGV signal sequence that 63bp infers to increase to carry out independent pcr amplification, Figure 10, SEQID NO:29), the primer 993724 (justice is arranged) and the primer 993729 (antisense) that show below of application.The Humicola insolens EGV signal sequence homology of primer sequence that italic is represented and 20bp, and the aspergillus oryzae beta-Polyglucosidase coding region homology of underlined primer sequence and 22bp.Plasmid pMJ05, the Humicola insolens EGV coding region that it is included under the control of cbhl promotor is used as template and comprises Trichoderma reesei cbhl promotor/segmental 1063bp fragment of Humicolainsolens EGV signal sequence with generation.The lap of 42bp, between Trichoderma reesei cbhl promotor/Humicola insolens EGV signal sequence and described encoding sequence, share, with the correct connection between the ATG initiator codon that described promotor and 2523bp aspergillus oryzae beta-Polyglucosidase are provided.

Primer 993724:5 '-ACGCGTCGACCGAATGTAGGATTGTTATCC-3 ' (SEQ ID NO:30)

Primer 993729:5 '- GGGAGTACGCGAGATCATCCTT

-3 ' (SEQ ID NO:31)

Described amplified reaction (50 μ l) is by Pfx amplification buffer, 0.25mM dNTPs, 10ng/ μ lpMJ05,6.4 μ M primers, 993728,3.2 μ M primers 993727,1mM MgCl ₂Form with the Pfx polysaccharase of 2.5 units.Describedly be reflected at incubation on the EppendorfMastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 60 seconds, carried out 60 seconds and carry out 240 seconds (15 minutes final extensions) at 60 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquickGel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 1063bp product band.

Described overlapping fragments is as template, use previously described primer 993724 (justice is arranged) and primer 993727 (antisense) increases, will comprise the 1063bp fragment of Trichoderma reesei cbhl promotor/Humicolainsolens EGV signal sequence, 2523bp fragment with comprising aspergillus oryzae beta-Polyglucosidase open reading frame accurately merges by overlapping PCR.

Described amplified reaction (50 μ l) is by Pfx amplification buffer, 0.25mM dNTPs, 6.4 μ M primers, 993724,3.2 μ M primers 993727,1mM MgCl ₂Form with the Pfx polysaccharase of 2.5 units.Describedly be reflected at incubation on the EppendorfMastercycler 5333, its program is as follows: 30 circulations, each 94 ℃ carry out 60 seconds, carried out 60 seconds and carry out 240 seconds (15 minutes final extensions) at 60 ℃ at 72 ℃.On 1.0% sepharose, use the TAE damping fluid and separate described reaction product,, and use QIAquick Gel Extraction Kit, carry out purifying according to the operation instruction of manufacturers wherein from described gel excision 3591bp product band.

Resulting 3591bp fragment digests with Sal I and Spe I, and is connected to the pMJ04 with same restriction enzyme digestion, to produce pSMai135 (Figure 11).

Embodiment 7: make up pALFd1 yeast saccharomyces cerevisiae expression vector

Plasmid pALFd1 produces from pSATe111, with the secretion signal of exchange natural rice aspergillus beta-Polyglucosidase secretion signal and Humicola insolens EGV, increases aspergillus oryzae beta-Polyglucosidase and produces in yeast saccharomyces cerevisiae and secrete.Plasmid pSATe111 digests to discharge 2.6kb fragment (aspergillus oryzae beta-Polyglucosidase) and 6kb (remaining described carrier) fragment with Xho I and Spe I.Described digestion is used the TAE damping fluid and is operated in 0.7% sepharose, and described 6kb fragment, use QIAquick Gel Extraction Kit (QIAGEN Inc., Valencia, CA), operation instruction according to manufacturers, separate by gel-purified, and be connected in the 2.6kb PCR fragment that contains aspergillus oryzae beta-Polyglucosidase coding region (lacking described secretory signal sequence) and Humicola insolens EGV signal sequence, its primer 993950 and 993951 that shows below pSMai135 uses increases.Described primer contains Spe I and Xho I restriction site at their end, is used for Spe I and the Xho I restriction site of follow-up subclone to pSATe111.

Primer 993950:5 '-AATCCGACTAGTGGATCTACCATGCGTTCCTCCCCCCTCC-3 ' (SEQ ID NO:32)

Primer 993951:5 '-GCGGGCCTCGAGTTACTGGGCCTTAGGCAGCG-3 ' (SEQ IDNO:33)

Described amplified reaction (100 μ l) is by PCR Thermo Pol damping fluid, 0.20mM dNTPs, and the Vent archaeal dna polymerase of 0.14 μ g pSMai135 plasmid DNA, 50 μ M primers, 993950,50 μ M primers 993951 and 2 units is formed.The described RoboCycler Gradient 40ThermalCycler (Stratagene that is reflected at, La Jolla, CA) incubation in, its program is as follows: a circulation, carried out 1 minute at 95 ℃, with 25 circulations, each 95 ℃ carry out 1 minute, carried out 1 minute and carry out 3 minutes (10 minutes final extend) at 60 or 64 ℃ at 72 ℃.Described reaction product is presented on 0.7% sepharose with the TAE damping fluid.The 2.6kb fragment that obtains is used PCR MinElute PCR Purification, and (QIAGEN, Chatsworth CA), carry out purifying according to the operation instruction of manufacturers.With the fragment combination of purifying, and, be connected among the pSATe111 with two kinds of same restriction enzyme digestion, to produce pALFd1 (Figure 12) with Spe I and Xho I digestion.

Embodiment 8: the main body of a court verdict storehouse (primarylibrary) that produces the beta-Polyglucosidase of sudden change in yeast saccharomyces cerevisiae

Be devoted in the process of aspergillus oryzae beta-Polyglucosidase evaluation for the zone of albumen thermostability key, described whole wild-type aspergillus oryzae beta-Polyglucosidase gene, employing suddenlys change with the fallibility PCR of Yeast expression carrier pSATe111 homologous sequence, and it can be through reorganization in the body between the homology zone of different fragments.This method is by the combination of linearizing carrier and PCR product, the plasmid that produce cyclic, duplicates.

Primer 992328 of Xian Shiing (from embodiment 1) and primer AoJa1660.2 below, be applied to fallibility pcr amplification from the beta-Polyglucosidase gene of pSATe101, to produce the sequence of sudden change, described sequence can be cloned into pSATe111, is used for heavily expressing described beta-Polyglucosidase at yeast.Primer AoJal660.2:5 '-AGGGTGAATGGGCGGAA-3 ' (SEQ ID NO:34)

Described fallibility pcr amplification (50 μ l) is by containing 1.5mM MgCl ₂1 * Taq damping fluid (PromegaCorporation, Madison, WI), 60ng pSATe101,0.16mM dATP, dCTP, dGTP and every kind of 0.07mM of dTTP, 50 μ M primer AoJA1660.2,50 μ M primers 992328,0.1mMMnCl ₂Taq archaeal dna polymerase (Promega Corporation, Madison, WI) composition with 5 units.Described amplified reaction is carried out incubation, as described at embodiment 1.

Plasmid pSATe111 is by producing breach with Eco RI and Sma I digestion, and (QIAGEN Inc., Valencia CA) carry out gel-purified to use the QiaexII resin then.Described digestion is by the aliquots containig with digestion, on 0.7% sepharose, use the TAE damping fluid and carry out classification, and verify with ethidium bromide staining, wherein obtain expecting 8, the fragment of 054bp (the notched carrier that contains the part of beta-Polyglucosidase encoding sequence) and 672bp (from described beta-Polyglucosidase gene).Use the described digest of QiaexII resin purification.

With 3 μ l aliquots containigs of above-mentioned PCR reaction, mix with the notched pSATe111 carrier of 0.5 μ l, be used for cotransformation to yeast saccharomyces cerevisiae YNG318 competent cell.The fragment of described cotransformation comprises the homologous sequence of 250bp at least endways, to promote the breach reparation of described expression plasmid.The competent cell of yeast saccharomyces cerevisiae YNG 318, before each transforms, according to YEASTMAKER yeast conversion rules (Yeast Transformation Protocol) (CLONTECH Laboratories, Inc., Palo Alto, CA) be prepared, it has following modification: (1) is used for the spend the night volume of yeast culture of insulation (16-20 hour) of inoculation is 100-1,000 μ l; (2) transforming back recovery cell carried out 45 minutes at 30 ℃ in the YPD substratum; (3) the five equilibrium transformation mixture is used to be coated on yeast and selects substratum, and with the residuum of transformant speed controlled (controlled rate) refrigerator (Nalge NuncInternational, Rochester, NY) in, be chilled in-80 ℃.

Dull and stereotyped about 4 days of 30 ℃ of insulations.After the insulation, the bacterium colony that produces active beta-Polyglucosidase becomes blueness, because beta-Polyglucosidase hydrolysis X-Glc.The activity in described library is estimated by the percentage ratio of the blue colonies that obtains.Described library is 67% active.

Embodiment 9: screening beta-Polyglucosidase library

Go up to launch at Genetix QTray ' s (22 * 22cm culture dish (Petridishes), Genetics Ltd., Hampshire, United Kingdom) in main beta-Polyglucosidase library, and 30 ℃ of incubations 5 days.Use Genetix QPix (Genetix Ltd., Hampshire, United Kingdom), active bacterium colony is used the X-Glc selection and is chosen into the 96-orifice plate that contains yeast selection substratum.Dull and stereotyped 30 ℃ of insulations 7 days.To screen damping fluid (0.1M succinate pH 5) before the screening beginning, add described growth flat board.Application ORCA robot (Beckman Coulter, Fullerton, CA), with described growth flat board transfer to Multimek (Beckman Coulter, Fullerton, CA), from described growth flat board, take a sample, and be mixed into 96-hole polycarbonate v-base plate.From the v-base plate, take a sample then, and be assigned to 96-hole flat underside, be used for p-nitrophenyl-beta-D-glucopyranoside, carry out initial flat board test at ambient temperature at 0.1M succinate pH 5 as substrate.Described v-base plate is transferred to the 96-hole heat block (heating block) of customization, and at 65 ℃ of incubations 10 minutes altogether.From through taking a sample the v-base plate of heat block, and be assigned to empty 96-hole flat underside, be used for p-nitrophenyl-beta-D-glucopyranoside at 0.1M succinate pH 5 at ambient temperature, carrying out final flat board test as substrate.With described initial and final test flat board, (Labsystems, Vantaa Finland), wherein add p-nitrophenyl-beta-D-glucopyranoside substrate to transfer to Multidrop then.Reach predetermined test soaking time (30-120 minute) afterwards, with the described initial and dull and stereotyped usefulness of final test 2M Tris pH 8 damping fluid quenchings (quench).(Molecular Devices, Sunnyvale CA) read two flat boards at 405nm to use the Spectramax flat bed reader.The ratio that finally reads and initially read, (Microsoft Corporation, Redmond WA) calculate, to measure per-cent residual activity (%RA) to use Microsoft Excel.Measure based on %RA, the library that screening makes up in embodiment 8 produces two variant: BG13 and BG14.Residual activity by these variants produce is respectively 13% and 17% for BG13 and BG14.

The library of the rearrangement of embodiment 10:beta-Polyglucosidase variant BG13 and BG14

For the beta-Polyglucosidase variant BG13 that resets embodiment 9 and the DNA of BG14, isolated plasmid dna from described variant.With every kind of variant at 30 ℃, the paraxin that contains 75 μ g with antipollution 3ml yeast culture base in overnight growth.With 100 μ l from the sample of overnight culture centrifugal 3 minutes at 13,200 * g.Discard the supernatant of gained, and from remaining precipitation, according to by Kaiser and Auer, 1993, BioTechniques 14 (4): the 552 rules DNA isolation of describing, except using the yeast lysis buffer of 20 μ l.

From the aspergillus oryzae beta-Polyglucosidase gene of variant BG13 and BG14, use following primer and increase by PCR:

pSATe1115′nested primer：5′-GACATTTTTGCTGTCAGTCA-3(SEQ ID NO：35)

pSATe1113′nested primer：5′-AATGTTACATGCGTACACGC-3′(SEQ ID NO：36)

The DNA that application is rescued from variant BG13 carries out 3 PCR reactions as template, and uses the DNA that saves and carry out 5 PCR reactions as template from variant BG14.Described amplified reaction (100 μ l) by 0.5 μ l yeast plasmid DNA, do not contain MgCl ₂1 * AmpliTaq damping fluid, dATP, dCTP, dGTP and every kind of primer of every kind 125 μ M, 50pmole of dTTP, 1.5mM MgCl ₂AmpliTaq archaeal dna polymerase (PE Applied Biosystems, Foster City, CA) composition with 1 unit.Describedly be reflected at incubation among the EppendorfMastercycler 5333, its program is as follows: a circulation, carried out 5 minutes at 95 ℃; With 25 circulations, each 95 ℃ carry out 1 minute, carried out 1 minute and carried out 3 minutes at 50 ℃ at 72 ℃; And 72 ℃ of final extensions of carrying out 10 minutes.3 PCR reaction of BG13 and 5 PCR reactions of BG14 are made up, and (QIAGEN Inc., Valencia CA) carry out purifying with QIAquick PCR Purification Kit.With the DNA wash-out go into 30 μ l the EB damping fluid (QIAGEN Inc., Valencia, CA).The concentration of the PCR product of the purifying that obtains after the amplification of each variant by operating in the TAE damping fluid, and is observed in 0.7% sepharose with ethidium bromide staining and is verified.Each variant obtains the every microlitre of 125ng DNA.

In order to reset the DNA of BG13 and BG14 variant, BG13PCR product and the BG14PCR product of 3.2 μ l (400ng) and the notched pSATe111 combination of 2 μ l (400ng) with 3.2 μ l (400ng), description preparation among described notched pSATe111 such as the embodiment 8, make described plasmid produce breach except using Spe I and XhoI, be transformed into newly formed competent yeast saccharomyces cerevisiae YNG 318 cells then, described in embodiment 8.The library that is produced is 78% active, based on the percentage ratio of the blue colonies that produces.

Fully, picking and separated 6,336 active bacterium colonies in the library from then on, as described in the embodiment 9, this causes 6 strains to improve the separation of the variant of thermostability, and four strains wherein are named as BG40, BG41, BG42 and BG43.For the order-checking of the DNA that carries out variant BG40, BG41, BG42 and BG43, select the 100 μ l samples of substratum from yeast, according to Kaiser and Auer, 1993, the step of the literary composition that sees before, DNA isolation.With the operation instruction of separated DNA, be transformed into intestinal bacteria SURE electroporation-competent cell according to manufacturers.Isolated plasmid dna checks order then as previously mentioned.

Whole coding regions of every kind of aspergillus oryzae beta-Polyglucosidase variant gene, the following primer of using 0.5 μ l plasmid DNA and 3.2pmol checks order:

AoJa1660.1:5 '-GTITCGGCTCAGGACTG-3 ' site: 2492 forwards (SEQ ID NO:37)

AoJa1+660.1a:5 '-ACTTCCGCCCATTCACC-3 ' site: 141 reverse (SEQ ID NO:38)

AoJa1660.2:5 '-AGGGTGAATGGGCGGAA-3 ' site: 123 forwards (SEQ ID NO:39)

AoJa1660.2a:5 '-GGCGGAAATGCTCTTGT-3 ' site: 614 reverse (SEQ ID NO:40)

AoJa1660.3:5 '-GGATGGCGGTAGAAACT-3 ' site: 469 forwards (SEQ ID NO:41)

AoJa1660.3a:5 '-GCGGTCCAATCACTCAT-3 ' site: 861 reverse (SEQ ID NO:42)

AoJa1660.4:5 '-GCTACGGTTGCGAGAAT-3 ' site: 774 forwards (SEQ ID NO:43)

AoJa1660.4a:5 '-CTCAAGGGCAAGGCACC-3 ' site: 1232 reverse (SEQ ID NO:44)

AoJa1660.5:5 '-GGTGCCTTGCCCTTGAG-3 ' site: 1232 forwards (SEQ ID NO:45)

AoJa1660.5a:5 '-TTCGCTGCGGTCTTGAC-3 ' site: 1629 reverse (SEQ ID NO:46)

AoJa1660.6:5 '-GTGGAAGAACGGCGACA-3 ' site: 1591For (SEQ ID NO:47)

AoJa1660.6a:5 '-CCCAGCCGTAGTTAGAA-3 ' site: 2195Rev (SEQ ID NO:48)

AoJa1660.7:5 '-CGTCCCGATACACTCCC-3 ' site: 2019For (SEQ ID NO:49)

AoJa1660.7a:5 '-CCTGGAGCGGCAGTTTC-3 ' site: 2573Rev (SEQ ID NO:50)

AoJa1660.8:5 '-GGTCGGTGTCCTTAACGG-3 ' site 964 For (SEQ ID NO:51)

AoJa1.660.8a:5 '-ACTATCCTGCAAACACAAGC-3 ' site: 292Rev (SEQ ID NO:52)

AoJa1660.9:5 '-CCTTTCACTTGGGGCA-3 ' site 1802 For (SEQ ID NO:53)

AoJa1660.9a:5 '-GGAGTTACCAGACTCCTGGC-3 ' site 1756 Rev (SEQ ID NO:54)

AoJa1660.10a:5 '-ACCTTCCGAAACATGGTTAT-3 ' site 1132 Rev (SEQ ID NO:55)

Order-checking shows in isolating mutant, the consistent sudden change that causes aminoacid replacement is arranged.Variant BG40 has 5 sudden changes, and wherein 3 cause aminoacid replacement.First sudden change, it causes replacing G4S, finds in the signal peptide sequence of the prediction of beta-Polyglucosidase.3 sudden changes are found in described proteic avtive spot, but are had only 1 sudden change to cause aminoacid replacement: H266Q.Last sudden change is found in described proteic X-territory (X-domain): D365N.Described X-territory is the zone outside the avtive spot district.

Variant BG41 has 3 sudden changes, and wherein 2 cause aminoacid replacement: G142S and H266Q.All being substituted in the described proteic avtive spot found.

Variant BG42 has 3 sudden changes, and wherein 2 is reticent.The aminoacid replacement of unique reality is H266Q.

Variant BG43 has 3 sudden changes, and wherein 1 is reticent.The E-13V aminoacid replacement is arranged in the signal sequence of prediction, and the H266Q aminoacid replacement is then found at described proteic avtive spot.

In all isolating variants, unique common amino acid is substituted by H266Q.

Second of the improved variant of embodiment 11:beta-Polyglucosidase is taken turns rearrangement

In order to produce the library of resetting with previous isolating several mutant, the beta-Polyglucosidase coding region of BG41 and BG43 variant is used isolating as previously mentioned plasmid DNA and is increased.Carry out the 100ulPCR reaction, as described in example 10 above, except using ATP, dCTP, dGTP and every kind 200 μ M of dTTP and containing 1.5mM MgCl ₂1 * AmpliTaq damping fluid.The beta-Polyglucosidase inset (insert) (BG41 and BG43) of amplification carries out purifying, every kind of DNA concentration that obtains the estimation of the every microlitre of 125ng as described in embodiment 10.Also further amplification and purifying the coding region of BG13 and BG14 variant, be used for as described in embodiment 10, using the plasmid DNA of 1 μ l and resetting by in the PCR reaction.The output of the product of every kind of purifying is 1 for BG13, and the every microlitre of 250ng is the every microlitre of 125ng for BG14.

The primer of using as in embodiment 10, describing, as at the 5th kind of variant that produces called after BG2 described in the embodiment 8, and by as separate in the screening described in the embodiment 9.The DNA of variant BG2 also adds in the rearrangement that the DNA with BG13, BG14, BG41, BG43 carries out, but the analysis of back shows that BG2 is vacation-male.PCR product combination (every kind of 125ng with the purifying of every kind of mutant, except BG14 uses 12.5ng), pSATe111 with 400ng with sPe I/Xho I generation breach, be used for being transformed into the yeast saccharomyces cerevisiae YNG318 competent cell of 50 μ l, as described at embodiment 10 by the breach reparation.The library that obtains is 93.9% active, based on the percentage ratio of blue colonies.

As carrying out library screening described in the embodiment 9, except with flat board at 68 ℃ of incubations.Fully, from then on picking and separated 15 in the library, 439 active clones, this causes separating of variant BG47, BG48 and BG 49, p-nitrophenyl-beta-D-glucopyranoside of using as describing in embodiment 9 is as substrate, after 68 ℃ of incubations 10 minutes, it has 53%, 87% and 21% residual activity.

For the DNA with variant BG47, BG48 and BG 49 checks order,,, and be transformed in the intestinal bacteria XL-10Gold ultra competent cell except DNA isolation the sample of selecting substratum from the yeast of 500 μ l as in DNA isolation described in the embodiment 10.

The order-checking of these mutant shows that variant BG47 contains the aminoacid replacement at the E-13V of signal sequence, a silent mutation and two aminoacid replacement at G142S and H266Q in avtive spot.Variant BG48 contains just like the same sudden change of finding in variant BG41, adds in the avtive spot in the aminoacid replacement of A16T and X domain the replacement at D703G.Variant BG49 is identical with BG43.

Embodiment 12: produce site-specific random library at site G142 and H266

In the process that the best of being devoted to identify in the BG41 variant in site 142 and 266 replaces, the amino acid whose Nucleotide in will encode in BG41 G166S and these sites of H266Q carries out randomization by replacing them with NN (G/C).Therefore, pcr amplification is passed through in these amino acid whose zones of coding in aspergillus oryzae beta-Polyglucosidase gene, and transform in order to the pSATe111BG41 of Blp I digestion, so the amplification PCR fragment is when being transformed into yeast saccharomyces cerevisiae, can be through reorganization in the body, described amplification PCR fragment is except the Nucleotide of degenerating, with linearizing Yeast expression carrier pSATe111BG41 homology.This method is by the combination of linearizing carrier and PCR product, the plasmid that produce cyclic, duplicates.

(Nucleotide of degeneration is contained in its site at coded amino acid 143 to primer BG41SDMUpper, represent with runic) and primer BG41SDMLower (Nucleotide of degeneration is contained in its site at coded amino acid 266, represent with runic), show below, be used for from the described beta-Polyglucosidase of pSATe111BG41 pcr amplification gene, to produce the partial sequence of beta-Polyglucosidase gene, contain these randomized sites in the partial sequence of described beta-Polyglucosidase gene, and can be cloned into pSATe111BG41 and be used for expressing the beta-Polyglucosidase at yeast.

Primer BG41SDMUpper:

5′-GGTAGAAACTGGGAA

TTCTCACCAGATCCAGCCCTC-3′(SEQ ID NO：56)

Primer BG41LowerLower:

5′-GCCTACGCCGCTGTG

AGCGGTCCAATCACT-3′(SEQ ID NO：57)

Described amplified reaction (100 μ l) is by the mixture of 10mM dATP, dTTP, dGTP and the dCTP of pSATe111BG41, the 2 μ l of 1 * Pfx amplification buffer, 150ng, the 50mM MgSO of 3 μ l ₄, 50 μ M primer BG41SDMUpper, 50 μ M primer BG41LowerLower and 2.5 units Platinum Pfx archaeal dna polymerase (Invitrogen, Carlsbad CA) form.Described amplification condition is that 1 circulation was carried out 5 minutes at 95 ℃; 25 circulations, each 94 ℃ carry out 1 minute, carried out 1 minute and carried out 30 seconds at 52,55,58 or 61 ℃ at 72 ℃; With a final circulation, carried out 10 minutes at 72 ℃.Heat block carries out 4 ℃ of insulation circulations (soak cycle) then.

Plasmid pSATe111BG41 is by carrying out linearizing with Blp I digestion, and (QIAGEN Inc., Valencia CA), carry out purifying according to the operation instruction of manufacturers to use QIAquick Nucleotide Removal Kit then.With 4 above-mentioned PCR reaction combinations, use a QIAquickPCR Purification Kit purifying according to the operation instruction of manufacturers, and in the EB damping fluid of 10 μ l, carry out wash-out.Aliquots containig (3.5 μ g) and the linearizing pSATe111BG41 carrier combinations of 560ng with 7 μ l of the PCR product of purifying are used for corotation and dissolve yeast saccharomyces cerevisiae YNG318 competent cell, go into described in embodiment 8.Described library is 82.8% active.The high reactivity in this library shows that the randomization in G142 and H266 site is also unsuccessful.Yet this library is still as screening described in embodiment 9.

The third round of the improved variant of embodiment 13:beta-Polyglucosidase is reset

In order to obtain further improved variant, with previously described variant BG2, BG13, BG14 and BG48, and with the DNA of variant BG50, made up the library of resetting, described variant BG50 is produced by the generation in site-specific randomized library, as described in the embodiment 12, and by as separate in the screening described in the embodiment 9.The DNA of this variant is partly checked order, and have as being present in the same sudden change among its parental generation sequence B G41, but have extra sudden change: Q183R.Therefore, this variant is the sudden change product in the amplified reaction of described pSATe111BG41 carrier.The generation in described library is carried out as described in example 10 above.Described library screening is as carrying out described in the embodiment 9, except with flat board at 70 ℃ of incubations.Separating of variant BG52, BG53 and BG54 caused in described library, and it has 60%, 65%, 50% %RA respectively at 70 ℃.The order-checking of the DNA of these variants is carried out as described in example 10 above.Variant BG52 has the replacement identical with BG48 and the S-5P in the signal sequence of prediction replaces.Variant BG53 has the replacement identical with BG41, and increases the same D703G aminoacid replacement that exists among Q183R replacement and the BG48.BG54 contains following replacement: S-5P, G142S, Q183R and H266Q.

Table 1 has been summed up the variant that obtains by screening original library or rearrangement library and their aminoacid replacement.Table 2 has shown described variant at 65 ℃, 68 ℃ and 70 ℃, 10 minutes thermostability.Cause the sudden change in the dna sequence dna of aminoacid replacement to be represented with runic.Do not cause the sudden change in the dna sequence dna of aminoacid replacement to be represented with plain text.

The heat-staple Beta-Polyglucosidase of table 1. variant

The thermostability of table 2.Beta-Polyglucosidase variant

The sample of beta-Polyglucosidase in the same damping fluid of using, is diluted to relative to each other same activity in as embodiment 9.Described sample branch is gone into two polypropylene test tubes, and the sample of a part is immersed in the water-bath of controlled temperature and carries out incubation, and another part then carries out incubation in envrionment temperature, and it is for some time of 42 hours that the both grows.When incubation period finishes, two samples are placed 96 orifice plates.Methyl Umbrella ketone-beta-D-glucopyranoside (MUG) substrate (the MUG solution of 200 μ l, 0.5 μ M) is added the 96-orifice plate of described sample, and envrionment temperature incubation 15 minutes.Add 2M Tris pH 9.0 damping fluids and stop described reaction, and described flat board is read on photofluorometer, to obtain (RFU) in the relative fluorescence unit (Relative Fluorescent Unit) of excitation 365, emission 454.Described per-cent residual activity is used same as described in example 9 above method and is measured.Described result is displayed in Table 3.In general, relevant with described result result is displayed in Table 2.

The thermostability of the beta-Polyglucosidase variant of longer incubation time of table 3.

Suitable sudden change	The ID that other are suitable	At 55 ℃ of %RA that carry out 42hr	At 60 ℃ of %RA that carry out 15hr	At 60 ℃ of %RA that carry out 23.5hr	At 65 ℃ of %RA that carry out 1hr
						Aspergillus niger WT	ANBG	12％	0％	0％	5％
Aspergillus oryzae WT	AOBG	69％	2％	0％	0％
						H266Q	BG43	Do not finish	9％	Do not finish	1％
G142S；H266Q	BG41	88％	40％	35％	40％
						A16T；G142S； H266Q；D703G	BG48	87％	41％	37％	48％

Embodiment 14: make up the pAILo2 expression vector

Expression vector pAILol makes up by modifying pBANe6 (United States Patent (USP) 6,461,837), and described pBANe6 comprises NA2-tpi promotor, aspergillus niger amyloglucosidase terminator sequence (AMG terminator) and Aspergillus nidulans acetamidase gene (amdS).The modification of pBANe6 is undertaken by at first using three Nco I restriction sites of rite-directed mutagenesis elimination, and described three Nco I restriction sites are positioned at apart from amdS selective marker 2051,2722 and 3397bp.All variations are designed to " silence ", and the actual protein sequence of reservation amdS gene product is constant.The removal in these three sites, simultaneously according to the operation instruction of manufacturer use GeneEditor Site-Directed Mutagenesis Kit (Promega, Madison WI) carry out, and adopt following primer (underlined Nucleotide represent change base):

AMDS3NcoMut(2050)：5′-GTGCCCCATG ATACGCCTCCGG-3′(SEQ ID NO：58)

AMDS2NcoMut(2721)：5′-GAGTCGTATTTCCA AGGCTCCTGACC-3′(SEQ ID NO：59)

AMDSlNcoMut(3396)：5′-GGAGGCCATG AAGTGGACCAACGG-3′(SEQ ID NO：60)

To comprise the plasmid of the sequence variation of three kinds of all expections then, and carry out rite-directed mutagenesis, (Stratagene, La Jolla is CA) to eliminate in the site 1643 to use QuickChange Mutagenesis Kit

The Nco I restriction site of AMG terminator end.Following primer (base that underlined Nucleotide representative changes) is used for sudden change:

Upstream (upper) primer of aspergillus niger starch Glycosylase (AMG) terminator sequence is used to suddenly change:

5′-CACCGTGAAAGCCATG CTCTTTCCTTCGTGTAGAAGACCAGACAG-3′(SEQ ID NO：61)

Downstream (lower) primer of aspergillus niger starch Glycosylase (AMG) terminator sequence is used to suddenly change:

5′-CTGGTCTTCTACACGAAGGAAAG AGCATGGCTTTCACGGTGTCTG-3′(SEQ ID NO：62)

The final step of modifying pBANe6 is that the starting point at poly joint (polylinker) adds new Nco I restriction site, uses QuickChange sudden change test kit and following primer (base that underlined Nucleotide representative changes) to obtain pAILol (Figure 13).

The upstream primer of aspergillus niger amylase promotor (NA2-tpi) is used to suddenly change:

5 '-CTATATACACAACTGGATTTA CCATGGGCCCGCGGCCGCAGATC-3 ' (SEQ ID NO:63) be used to the to suddenly change downstream primer of aspergillus niger amylase promotor (NA2-tpi):

5′-GATCTGCGGCCGCGGGCCCA TGGTAAATCCAGTTGTGTATATAG-3′(SEQ ID NO：64)

The amdS gene isomorphism nest aspergillus pyrG gene swapping of pAILol.With the source of plasmid pBANe10 (Figure 14) as the pyrG gene, described pyrG gene is as selective marker.The analysis of the sequence of pBANe10 shows that the pyrG marks packets is contained in the Nsi I restricted fragment, does not comprise Nco I or Pac I restriction site.Because also there is Nsi I restriction site the amdS both sides, the strategy of exchange selective marker is the simple switched of Nsi I restricted fragment.Plasmid DNA from pAILol and pBANe10 digests with restriction enzyme Nsi I, and described product carries out purifying by agarose gel electrophoresis.To be connected to from the Nsi I fragment of the pBANe10 that contains the pyrG gene on the skeleton of pAILol to replace primary to contain the Nsi IDNA fragment of amdS gene.The clone of reorganization analyzes to determine that they have correct insertion body and correct direction thereof by restriction digestion.Screening has the clone with the pyrG gene of counterclockwise transcribing.Described novel plasmid called after pAILo2 (Figure 15).

Embodiment 15: the beta-Polyglucosidase BG41 and the BG48 variant subclone that will improve thermostability carry out the albumen sign in aspergillus oryzae

Coding region with beta-Polyglucosidase variant BG41 and BG48, subclone is to the aspergillus oryzae carrier pAILo02 with Nco I and PacI digestion, with the ATG of formation, with correct be connected of aspergillus niger amylase promotor (NA2-tpi) with aspergillus niger starch Glycosylase terminator sequence with described gene.Because described beta-Polyglucosidase coding region has two Nco I sites, described beta-Polyglucosidase gene subclone is realized to two primers that pAILo2 shows below designing, described primer is expanded described beta-Polyglucosidase gene in pSATe111, and also anneals with pAILo2 near Nco I and Pac I site.

Aoryzaebeta-Polyglucosidase Upper:

5′-

AAGCTTGGTTGGATC-3′(SEQ ID NO：65)

With pAILo2 annealing, and AAGCTTGGTTGGATC and pSATe111 annealing.

Aoryzaebeta-Polyglucosidase Lower:

5′-

TTACTGGGCCTTAGG-3′(SEQ ID NO：66)

With pAILo2 annealing, and TTACTGGGCCTTAGG and pSATe111 annealing.

For the DNA of increase variant BG41 and BG48, every kind of plasmid dna profiling of 0.5 μ l is used for the reaction of 100 μ l, comprise in the described reaction and contain 2mM MgSO ₄1 * ThermoPol reaction buffer, ATP, dGTP, dCTP and every kind of 0.05mM of dTTP, the Vent archaeal dna polymerase of every kind of primer of 50pmole (Aoryzaebeta-Polyglucosidase Upper and Aoryzaebeta-Polyglucosidase Lower primer) and 1 unit.Carry out two amplified reactions, wherein first reaction was carried out 5 minutes at 95 ℃ through 1 circulation; 25 circulations, each 95 ℃ carry out 1 minute, 50 ℃ carry out 1 minute, carried out 3 minutes at 72 ℃; Finally extend in 72 ℃ and carry out 10 minutes, and second be reflected at and carry out under the same condition, but annealing temperature is 56 ℃.The aliquots containig of every kind of PCR product is used the operation of TAE damping fluid on 0.7% sepharose, as described earlier, produces the band of about 3kb of expection.With two PCR reaction combinations, and use MinElute PCR Purification Kit purifying and described DNA is eluted to 10 μ l EB damping fluids.The output of the PCR product of every kind of purifying shows at 0.7% sepharose by using the TAE damping fluid, is estimated as the every microlitre of 250ng.

With Pac I digestion and at the plasmid pAILo2 of described Nco I site rustization, 95% ethanol by with the 3M sodium acetate pH 5.0 and 2 volumes of 0.1 volume comes concentrated-20 ℃ of precipitations of spending the night.Described sedimentary plasmid application whizzer centrifugal 15 minutes at 13,200 * g.Remove supernatant, and precipitate with 70% washing with alcohol of 1ml.With described precipitation centrifugal 15 minutes once more at 13,200 * g, remove supernatant then, dry described precipitation under vacuum, and be resuspended in 20 μ l water.Described plasmid has the concentration of the every microlitre of 80ng.Described enriched material shows on 0.7% sepharose by application TAE damping fluid to be verified.(Stratagene, La Jolla CA) finishes the clone of the pAILo2 carrier of above-mentioned beta-Polyglucosidase PCR product and digestion by using BD In-Fusion PCR Cloning Kit.

The expression vector of the coding region of containing variant BG41 or BG48 that obtains, called after pALFd3BG41 (Figure 16) and pALFd3BG48 (Figure 17) respectively.

Embodiment 16: express beta-Polyglucosidase variant BG41 and BG48 in aspergillus oryzae

The pALFd3BG48 plasmid DNA of the pALFd3BG41 of about 4.5 μ g and 6.25 μ g is used for transforming independently aspergillus oryzae Jal250 protoplastis.Aspergillus oryzae Jal250 protoplastis, according to Christensenet al., the preparation of the method for Bio/Technology6:1419-1422.

Transform aspergillus oryzae Jal250 with pALFd3BG41 and obtain 5 independently transformant, then obtain 15 independently transformant with the conversion of pALFd3BG48, wherein 9 are carried out further time cultivation.After independently transformant is transferred to the 100mm minimum medium and is selected dull and stereotyped four days with each, with spore from selecting flat board, transfer to contain the 24-orifice plate that useful 1 * BS is diluted to 1 to 5 M400 substratum, and at 34 ℃ of incubations.Behind the incubation 7 days, (Invitrogen, Carlsbad CA), according to the operation instruction of manufacturers, analyze every kind of supernatant of 10 μ l to use the 8-16%SDS-PAGE gel.The SDS-PAGE pattern of the culture of four pALFd3BG41 transformant shows the main band of about 120kDa, and it is corresponding to the molecular weight of aspergillus oryzae beta-Polyglucosidase.The SDS-PAGE pattern of the culture of six pALFd3BG48 transformant also shows the main band of about 120kDa.

Embodiment 17: the thermostability of measuring beta-Polyglucosidase variant BG41 and BG48 with cellobiose

The thermostability of beta-Polyglucosidase variant BG41 and BG48 (unpurified fermentation culture), by with described nutrient solution and 10mM cellobiose, in the 100mM sodium citrate buffer solution that contains 0.01%Tween-20, pH 5.0, be incubated to 21 hours at 65 ℃ and measure.

The result who measures beta-Polyglucosidase variant BG41 and BG48 thermostability shows that as shown in Figure 18, after for some time, described variant is obviously more stable than aspergillus niger beta-Polyglucosidase (Novozym 188) or aspergillus oryzae beta-Polyglucosidase.

Embodiment 18: make up the beta-Polyglucosidase variant with G142S replacement

To contain G to the Nucleotide zone that the A sudden change replaces with generation G142S, subclone is used for further characterizing the effect that this monamino acid replaces to the encoding sequence of pSATe111.Described G suddenlys change between the Spe of pSATe111 carrier I and the unique site of Bpu 1102I to A.Plasmid pSATe111 (about 50 μ g) and pSATe111BG41 (about 300 μ g) digest with Spe I and BlpI, and BlpI is the isoschizomers (isoschizomer) of Bpu1102I.This reaction obtains two fragments: one contain most pSATe111 (8146bp) and from contain G to the 580bp of the beta-Polyglucosidase encoding sequence of A sudden change than small segment.The pSATe111 of digestion handles with shrimp alkaline phosphotase, be used for by adding 1 * SAP damping fluid and 2 μ l of SAP (Roche Applied Science, Manheim, Germany), and 37 ℃ of described reactions of incubation 10 minutes, with the DNA product dephosphorylation of digestion, then by 85 ℃ of incubations 10 minutes with enzyme deactivation.Two digestion are all operated on 0.7% sepharose, and use QIAGEN gel-purified test kit, carry out purifying according to the operation instruction of manufacturers.

The pSATe111 of digestion is connected to the 580bp fragment that digests from pATe111BG41, contains the site of coded amino acid 142 in the described fragment, described amino acid/11 42 has the coding mutation that causes the G142S aminoacid replacement.(Roche AppliedScience, Manheim Germany), implement according to the operation instruction of manufacturers by using the Rapid dna ligation kit in connection.

With described ligation, according to the operation instruction of manufacturers, transform as XL1-Blue intestinal bacteria subclone-competent cell (Stratagene, La Jolla, CA).When transforming, separate as described in example 10 above and check order from the plasmid DNA of isolating bacterium colony, unique G to A suddenlys change in whole coding regions of described gene exists with checking.Subsequently, described plasmid DNA is transformed into the yeast competent cell, as described in example 8 above, it causes containing the separation of the beta-Polyglucosidase variant that G142S replaces.This beta-Polyglucosidase variant called after G142S mutant.Because BG43 only contains H266Q and replaces, and the G142S mutant only contains the G142S replacement, and the effect of G142S and each replacement of H266Q can characterize individually.

Embodiment 19: the effect that detects G142S and H266Q sudden change

Heat stability test was carried out 23 hours at 60 ℃, proved the synergistic effect of described sudden change.In the same damping fluid that the sample of described beta-Polyglucosidase variant is used, be diluted to relative to each other same enzymic activity in embodiment 9.Each sample branch is gone into two polypropylene test tubes, and the sample of a pipe is immersed in 60 ℃ of water-baths of controlled temperature and carries out incubation, and another part then carries out incubation in envrionment temperature, and it is for some time of 42 hours that the both grows.When incubation period finishes, two samples are placed 96 orifice plates.Methyl Umbrella ketone-beta-D-glucopyranoside (MUG) substrate (the MUG solution of 200 μ l, 0.5 μ M) is added the 96-orifice plate of sample, and envrionment temperature incubation 15 minutes.Add 2M Tris pH 9.0 damping fluids and stop described reaction, and described flat board is read on photofluorometer, with obtain excite 365, the relative fluorescence unit (RFU) of emission 454.Described per-cent residual activity is used same as described in example 9 above method and is measured.

Individually and be combined in one in the molecule sudden change G142S and the effect of H266Q in Figure 19, show.The independent mensuration of these sudden changes shows, their combinations in a molecule, than they independent any one, in damping fluid, have the thermostability of higher beta-glucosidase activity, as shown in Figure 19.Bar among the figure be the mathematics of these two aminoacid replacement add and.

Embodiment 20: identify glycosyl hydrolase family GH3A gene in the genome sequence of Aspergillus fumigatus

Application from the beta-Polyglucosidase protein sequence of microorganism Aspergillus aculeatus (Aspergillus aculeatus) (Accession No.P48825) as inquiry, carry out Aspergillus fumigatus portion gene group sequence (The Institute forGenomic Research, Rockville, MD) tblastn search (Altschul et al, 1997, NucleicAcids Res.25:3389-3402).Based on the high similarity degree of search sequence at amino acid levels, be the GH3A of the family homologue of inferring with several gene identification.Select the genome district of about 3000bp to be used for further research, described genome district and described search sequence have identity greater than 70% at amino acid levels.

Embodiment 21: extract the Aspergillus fumigatus genomic dna

Aspergillus fumigatus in the potato glucose substratum of 250ml, shaking in the bottle of band baffle plate, is grown with 240rpm at 37 ℃.Mycelium (mycelia) is by filtering, and washed twice is gathered in the crops with being chilled in the liquid nitrogen in TE damping fluid (10mM Tris-1mMEDTA).The refrigerated mycelium grinds to form fine powder by mortar and pestle, described fine powder is resuspended in pH 8.0 damping fluids that contain 10mM Tris, 100mM EDTA, 1%Triton X-100,0.5M Guanidinium hydrochloride (guanidine-HCl) and 200mM NaCl.The RNase A of no Dnase is added with the concentration that 20mg/ rises, with described lysate 37 ℃ of incubations 30 minutes.Cell debris is by centrifugal removal, and by using Qiagen Maxi 500 posts (QIAGEN Inc., Chatsworth, CA) DNA isolation.Described pillar is balance in the QBT of 10ml, with the QC of 30ml washing and with the QF wash-out of 15ml (all damping fluids are from QIAGEN Inc., Chatsworth, CA).DNA precipitates in Virahol, in 70% ethanol, washs, and by centrifugal recovery.Described DNA is resuspended in the TE damping fluid.

Embodiment 22: the clone's GH3A beta-of family Polyglucosidase gene also makes up the aspergillus oryzae expression vector

Two synthetic Oligonucleolide primers that design shows below, in the genomic dna with preparation from embodiment 21, the Aspergillus fumigatus gene of the GH3A beta-of the family Polyglucosidase that the pcr amplification coding is inferred.(BD Biosciences, Palo Alto CA) directly is cloned into expression vector pAILo2 with described fragment, need not restriction digestion and is connected to use InFusion Cloning Kit.

Forward primer: 5-ACTGGATTTACCATGAGATTCGGTTGGCTCG-3 (SEQID NO:67)

Reverse primer: 5 '-AGTCACCTCTAGTTACTAGTAGACACGGGGC-3 ' (SEQ ID NO:68) bold-type letter represents encoding sequence.The insertion site homology of remaining sequence and pAILo2.

Every kind of above-mentioned primer of 50picomoles is used for the PCR reaction, contains the mixture, the Platinum Pfx archaeal dna polymerase of 2.5 units, the 50mMMgSO of 1 μ l of 10mM dATP, dTTP, dGTP and dCTP of Aspergillus nidulans genomic dna, 1 * Pfx amplification buffer, the 1.5 μ l of 100ng in the described reaction ₄(CA), its final volume is 50 μ l for Invitrogen, Carlsbad with 10 * pCRx toughener solution of 2.5 μ l.Described amplification condition is a circulation, carries out 2 minutes at 94 ℃; With 30 circulations, each 94 ℃ carry out 15 seconds, carried out 30 seconds and carried out 3 minutes at 55 ℃ at 68 ℃.Heat block carries out 4 ℃ of insulations (soak) circulation then.

Described reaction product is used the TAE damping fluid, separates on 1.0% sepharose, wherein 3kb product band is excised from described gel, and uses QIAquick Gel Extraction Kit, carries out purifying according to the operation instruction of manufacturers.

Then described fragment being used Infusion Cloning Kit is cloned in the pAILo2 expression vector.Described carrier digests with Nco I and Pac I.Described fragment is carried out purifying by gel electrophoresis and Qiaquick gel-purified.The carrier of described gene fragment and digestion links together in reaction, obtains expression plasmid pEJG97 (Figure 20), and wherein the GH3A of family beta-Polyglucosidase gene transcription is under the control of NA2-tpi promotor.Described ligation (50 μ l) is by 1 * InFusion damping fluid (BDBiosciences, Palo Alto, CA), 1 * BSA (BD Biosciences, Palo Alto, CA), the Infusion enzyme of 1 μ l (dilution in 1: 10) (BD Biosciences, Palo Alto, CA), 150ng forms with the PCR product of the Aspergillus fumigatus beta-Polyglucosidase purifying of the pAILo2 of Nco I and PacI digestion and 50ng.Describedly be reflected at the room temperature incubation 30 minutes.The described reaction of 1 μ l be used for transformed into escherichia coli XL10SolopacGold cell (Stratagene, La Jolla, CA).The intestinal bacteria transformant that contains described pEJG97 plasmid detects by the described plasmid of restriction digestion.

Embodiment 23: the Aspergillus fumigatus genome sequence that characterizes the coding GH3A beta-of family Polyglucosidase

From the dna sequencing of the Aspergillus fumigatus beta-Polyglucosidase gene of pEJG97, use the primer step as previously mentioned and move (primer walking) strategy and carry out.Based on homogenic similarity from microorganism Aspergillus aculeatus, aspergillus niger and valley aspergillus (Aspergillus kawachii), make up the genetic model of Aspergillus fumigatus sequence.The aminoacid sequence (SEQ ID NO:70) of the Aspergillus fumigatus beta-Polyglucosidase gene of described nucleotide sequence (SEQ ID NO:69) and derivation shows in Figure 21.863 amino acid whose polypeptide of described genomic fragment coding, its by 62,55,58,63,58,58,63 and 8 introns of 51bp interrupt.The %G+C content of described gene is 54.3%.Use SignalP software program (Nielsen et al., 1997, Protein Engineering 10:1-6), predicted the signal polypeptide of 19 residues.The maturation protein of prediction comprises 844 amino acid, has the molecular weight of 91.7kDa.

Use Clustal W method (Higgins, 1989, C4BI055:151-153) the relatively comparison (comparative alignment) of mensuration beta-Polyglucosidase sequence, the LASERGENE that application has identity table and following a plurality of comparison parameters ^TMMEGALIGN ^TMSoftware (DNASTAR, Inc., Madison, WI) determine: breach was penalized 10 fens and notch length was penalized 10 fens.Pairing comparison parameter is Ktuple=1, breach point penalty=3, window (window)=5 and diagonal lines (diagonal)=5.Described comparison shows, the deduced amino acid of described Aspergillus fumigatus beta-Polyglucosidase gene, with the deduced amino acid of microorganism Aspergillus aculeatus (accession number P48825), aspergillus niger (accession number 000089) and valley aspergillus (accession number P87076) beta-Polyglucosidase, share 78%, 76% and 76% identity.

Embodiment 24: express the Aspergillus fumigatus GH3A beta-of family Polyglucosidase gene in aspergillus oryzae JAL250

Aspergillus oryzae Jal250 protoplastis is according to Christensen et al, and 1988, the method preparation of Bio/Technology6:1419-1422.The pEJG97 of 5 μ g (and pAILo2 is as vehicle Control) is used to transform aspergillus oryzae JAL250.

Transform aspergillus oryzae Jal250 with pEJG97 and obtain about 100 transformant.10 transformant are separated to independent PDA flat board.

5 PDA flat boards that converge in 10 transformant with 0.01%Tween 20 washings of 5ml, and are inoculated into 125ml glass individually and shake in the 25ml MDU2BP substratum in the bottle, and at 34 ℃, 250rpm incubation.Behind the incubation 5 days, from 0.5 μ l supernatant of each culture, (Invitrogen, Carlsbad CA), analyze according to the operation instruction of manufacturers to use 8-16%Tris-glycine SDS-PAGE gel.The SDS-PAGE pattern of described culture shows that one (name and be transformant 1) has the main band of about 130kDa in the transformant.

Embodiment 25: extract total RNA from aspergillus oryzae

The aspergillus oryzae transformant of describing among the embodiment 22 is with liquid nitrogen freezing, and is stored in-80 ℃.Subsequently, refrigerated is organized in the electric coffee grinder and grinds, and adds several dry ice and freezes to keep the powdered mycelium.Then, the material after grinding transfer to the conical tube of 50ml sterilization with scraper, its be equipped with in advance 20ml Fenozol (Active Motif, Inc., Carlsbad, CA).This mixture of short mix to be being dissolved as strong solution with described frozen material, and places 15 minutes in 50 ℃ of water-baths.The chloroform of 5ml deoxyribonuclease (Rnase) is added described mixture and vortex tempestuously.Then, described mixture was left standstill 10 minutes in room temperature.Again with described mixture 2700rpm Sorvall RT7 whizzer (Sorvall, Inc, Newtown, CT) in room temperature centrifugal 20 minutes.(top phase) transfers to new conical tube with the top phase, and adds isopyknic phenol-chloroform-primary isoamyl alcohol (25: 24: 1).With described mixture vortex and centrifugal 10 minutes.This step is repeated twice, extract so finish 3 phenol-chloroform isoamyl alcohols.Then, the phase transition of described top in new pipe, is added isopyknic chloroform: primary isoamyl alcohol (24: 1).With described mixture vortex and centrifugal 10 minutes once more.After centrifugal, with here approximately the water of 5ml transfer in the new Oak Ridge pipe, and add 0.5ml 3M sodium acetate pH 5.2 and 6.25ml Virahol.Described mixture is mixed, and room temperature incubation 15 minutes.Subsequently, described mixture 4 ℃ Sorvall RC5B (Sorvall, Inc, Newtown, CT) in, with 12,000 * g centrifugal 30 minutes.After centrifugal, remove supernatant and 18ml 70% ethanol is added above-mentioned precipitation carefully.Carried out another centrifugation step 10 minutes at 4 ℃, 12,000 * g.Careful supernatant and the air-dry precipitation removed.Described RNA is deposited in the water that 500 μ l diethyl pyrocarbonates (diethyl pyrocarbonate) (DEPC) handle resuspended.Here helped resuspended in 10 minutes 65 ℃ of heating.With described total RNA-80 ℃ of storages.Quantitatively and estimate the RNA quality Agilent Bioanalyzer 2100 (Englewood, CO) on, use the RNA chip and carry out.Material and reagent all in these rules all do not have RNAse.

Embodiment 26: clone Aspergillus fumigatus beta-Polyglucosidase cDNA sequence

The total RNA that extracts from the aspergillus oryzae transformant that contains pEJG97 is used to clone Aspergillus fumigatus beta-Polyglucosidase cDNA sequence (SEQ ID NO:71 is the cDNA sequence, and SEQ ID NO:70 is a deduced amino acid).From the mRNA of total RNA, (Austin TX), carries out purifying according to the operation instruction of manufacturers for Ambion, Inc. to use Poly (A) Purist Mag kit.Aspergillus fumigatus beta-Polyglucosidase cDNA sequence increases in two fragments then: 1, the 337bp dna fragmentation, it is across to 1 from the ATG initiator codon, 332 sites (being labeled as 5 ' fragment), with another 1,300bp dna fragmentation (mark 3 ' fragment), it is from 1,303 sites are across to terminator codon, adopt ProStar UltraHF RT-PCR system (Stratagene),, be used for 50 μ l reaction according to the operation instruction of manufacturers, described reactive applications 200ngpoly-A mRNA, 5 ' segmental primer Afuma (justice is arranged) and the segmental primer Afumd of Afumc (antisense) and 3 ' (justice is arranged) and Afumb (antisense), as follows:

Afuma：5′-GGCTCATGAGATTCGGTTGGCTCGAGGTC-3′(SEQ ID NO：72)

Afumc；5′-GCCGTTATCACAGCCGCGGTCGGGGCAGCC-3′(SEQ ID NO：73)

Afumd：5′-GGCTGCCCCGACCGCGGCTGTGATAACGGC-3′(SEQ ID NO：74)

Afumb：5′-GCTTAATTAATCTAGTAGACACGGGGCAGAGGCGC-3′(SEQ ID NO：75)

Primer Afuma has Bsp HI site, upstream, and primer Afumb has the Pac I site in downstream.Terminal 29 Nucleotide of 1,337 fragment 3 ' are consistent with 1,303 segmental 5 ' end.In described overlapping region, unique Sac II site is arranged.

With two fragments individually subclone to pCR4Blunt-TOPO carrier (Invitrogen, Carlsbad, CA), adopt Zero Blunt TOPO PCR clone test kit to be used for order-checking (Invitrogen, Carlsbad, CA), according to the operation instruction of manufacturers, produce plasmid pCR4Blunt-TOPOAfcDNA5 ' and pCR4Blunt-TOPOAfcDNA3 ', they contain 5 respectively ' with 3 ' fragment (Figure 22 and 23).

Two segmental whole coding regions of Aspergillus fumigatus beta-Polyglucosidase verify by order-checking, use the every kind of plasmid DNA of 0.5 μ l and the following primer of 3.2pmol:

BGLU1.for：5′-ACACTGGCGGAGAAGG-3′(SEQ IDNO：76)

BGLU2.for：5′-GCCCAGGGATATGGTTAC-3′(SEQ ID NO：77)

BGLU3.for：5′-CGACTCTGGAGAGGGGTTTC-3′(SEQ ID NO：78)

BGLU4.rev；5′-GGACTGGGTCATCACAAAG-3′(SEQ ID NO：79)

BGLU5.rev：5′-GCGAGAGGTCATCAGCA-3′(SEQ ID NO：80)

The M13 forward: 5 '-GTAAAACGACGGCCAGT-3 ' (SEQ ID NO:81)

M13 is reverse: 5 '-CAGGAAACAGCTATGA-3 ' (SEQ ID NO:82)

With the Aspergillus fumigatus beta-Polyglucosidase cDNA sequence that obtains, with by (the Rockville of Joint Genome Institute (TheInstitute for Genomic Research), when the Aspergillus fumigatus beta-Polyglucosidase cDNA sequence that genomic data MD) is derived compared, sequencing result showed the existence that several Nucleotide change.In the site 500, T is replaced by C, so described encoding sequence GTT becomes GCT, Xie Ansuan is replaced by L-Ala thus.In the site 903, T is replaced by C, so described encoding sequence CCC becomes CCT, yet this variation is reticent.In the site 2,191, G is replaced by C, so described encoding sequence CAG becomes GAG, L-glutamic acid is replaced by glutamine thus.At last, in the site 2,368, C is replaced by T, so described encoding sequence CTG becomes TTG, yet this variation also is reticent.

In case described two fragments are checked order, contain each segmental two clone and digest with Sac II and Pme I, adopt every kind of plasmid DNA of about 9 μ g.With above-mentioned enzymic digestion pCR4Blunt-TOPOAfcDNA5 ', produce 3, the fragment of 956bp (major part that contains described carrier) and another 1, the fragment of 339bp (containing Aspergillus fumigatus beta-Polyglucosidase cDNA 5 ' fragment).With same enzymic digestion pCR4Blunt-TOPOAfcDNA3 ' carrier, produce 5, the fragment of 227bp fragment (containing most pCR4Blunt-TOPO carrier and Aspergillus fumigatus beta-Polyglucosidase cDNA 3 ' fragment) and another 31bp.The pCR4Blunt-TOPOAfcDNA3 ' of digestion handles with shrimp alkaline phosphotase, be used for DNA product dephosphorylation with digestion, by adding 1 * SAP damping fluid and 1 μ l shrimp alkaline phosphotase (RocheApplied Science, Manheim, Germany) and 37 ℃ with described reaction incubation 10 minutes, be the inactivation that was used for enzyme at 85 ℃ of incubations in 10 minutes then.Two digestion are used the operation of TAE damping fluid on 0.7% sepharose, and use QIAGEN Gel purification kit, carry out purifying according to the operation instruction of manufacturers.

By pCR4Blunt-TOPOAfcDNA5 ' digestion produce 1, the 339bp band and by pCR4Blunt-TOPOAfcDNA3 ' digestion produce 5, the 527bp fragment by application Rapid dna ligation kit, connects according to the operation instruction of manufacturers.With the operation instruction of described ligation, be transformed in XL1-Blue intestinal bacteria subclone-competent cell according to manufacturers.After the conversion, the plasmid DNA of the bacterium colony of self-separation checks order in the future, is connected in series the ground subclone with 5 of checking Aspergillus fumigatus beta-Polyglucosidase cDNA ' and 3 ' fragment, produces 6,566bp pCR4Blunt-TOPOAfcDNA carrier (Figure 24).

Embodiment 27: make up pALFd6 and pALFd7 yeast saccharomyces cerevisiae expression vector

Described Aspergillus fumigatus beta-Polyglucosidase full-length cDNA increases by PCR, uses the primer of following demonstration, and 5 of itself and pCU426 carrier and Aspergillus fumigatus beta-Polyglucosidase cDNA ' and 3 ' sequence have homology:

AfumigatusBGUpper：

5′-CTTCTTGTTAGTGCAATATCATATAGAAGTCATCGACTAGTGGATCTACC

-3′(SEQ ID NO：83)

Has homology with 5 ' end of Aspergillus fumigatus cDNA

AfumigatusBGLower：

5′-GCGTGAATGTAAGCGTGACATAACTAATTACATGACTCGAG

-3′(SEQ ID NO：84)

Has homology with 3 ' end of Aspergillus fumigatus cDNA

Described amplified reaction (100 μ l) is contained pCR4Blunt-TOPOAfcDNA plasmid, 1 * Pfx amplification buffer, dATP, dCTP, dGTP and every kind 50 μ M of dTTP, every kind of 50pmole of above-mentioned primer, the 1.5mM MgSO of Aspergillus fumigatus cDNA sequence by 0.5 μ l ₄Form with the PlatinumPfxDNA polysaccharase of 2.5 units.Describedly be reflected at incubation among the RoboCycler Gradient 40, its program is: a circulation, carried out 5 minutes at 95 ℃; 25 circulations, each 95 ℃ carry out 1 minute, carried out 1 minute and carried out 3 minutes at 50 ℃ at 72 ℃; With final extension circulation, carried out 1O minute at 72 ℃.Described PCR reactive applications QIAquick PCR purification kit carries out purifying.The DNA wash-out is gone into the EB damping fluid of 30 μ l.PCR product with homologous DNA sequence of 37bp mixes with the pCU426 carrier that Spe I and Xho I produce breach with 1 μ l, is used for corotation and dissolves yeast saccharomyces cerevisiae YNG318 competent cell, as described in the embodiment 8.These bacterium colonies and the blueness that becomes not as expecting, this explanation have some order-checking mistakes in Aspergillus fumigatus beta-Polyglucosidase cDNA sequence.The further order-checking of described Aspergillus fumigatus cDNA sequence shows that inserted extra Nucleotide in described cDNA sequence, it has destroyed the open reading frame of described enzyme.

Simultaneously, in order in yeast saccharomyces cerevisiae, to express described Aspergillus fumigatus beta-Polyglucosidase cDNA, with Humicola insolens EGV signal sequence, natural signals sequence with described Aspergillus fumigatus cDNA sequence exchanges, also be used for expressing, relatively to express Aspergillus fumigatus beta-Polyglucosidase with every kind of signal sequence at yeast saccharomyces cerevisiae.Aspergillus fumigatus cDNA sequence is passed through pcr amplification with primer, Humicola insolens EGV signal sequence among described primer and the carrier pALFd1 has homology, and has homology with 5 ' end of ripe Aspergillus fumigatus beta-Polyglucosidase cDNA sequence.The primer of described Aspergillus fumigatus beta-Polyglucosidase cDNA sequence of being used to increase is previously described AfumigatusBGLower primer and the HiEGVAfumigatus primer that describes below:

HiEGVAfumigatus：

5′-CCGCTCCGCCGTTGTGGCCGCCCTGCCGGTGTTGGCCCTTGCC

-3′(SEQ ID NO：85)

Has homology with 5 ' end of Aspergillus fumigatus mature sequence

Described amplified reaction (100 μ l) is by pCR4Blunt-TOPOAfcDNA, 1 * Pfx amplification buffer, dATP, dCTP, dGTP and every kind 50 μ M of dTTP, every kind of 50pmole of above-mentioned primer, the 1.5mM MgSO of 0.5 μ l ₄Form with the Platinum pfx archaeal dna polymerase of 2.5 units.Describedly be reflected at incubation among the RoboCycler Gradient 40, its program is: a circulation, carried out 5 minutes at 95 ℃; 25 circulations, each 95 ℃ carry out 1 minute, carried out 1 minute and carried out 3 minutes at 50 ℃ at 72 ℃; With final extension circulation, carried out 10 minutes at 72 ℃.Described PCR reactive applications QIAquickPCR purification kit carries out purifying.The DNA wash-out is gone into the EB damping fluid of 1O μ l.The PCR product of 3 μ l purifying mixes with the pALFd1 carrier that Eco RI and Xho I produce breach with 1.8 μ l, is used for corotation and dissolves yeast saccharomyces cerevisiae YNG318 competent cell, as described in the embodiment 8.These bacterium colonies become light blue, yet a bacterium colony is obviously very blue.As carrying out the DNA rescue of this bacterium colony as described in the embodiment 10, and described plasmid is transformed into intestinal bacteria SURE electroporation-competent cell, and (Stratagene, La Jolla CA) are used for order-checking.The total length order-checking shows that described Aspergillus fumigatus beta-Polyglucosidase cDNA sequence is correct.This plasmid called after pALFd7 (Figure 25), it comprises described Aspergillus fumigatus beta-Polyglucosidase cDNA sequence and Humicola insolens EGV signal sequence is used for yeast expression.

In order to produce the Yeast expression carrier that contains correct Aspergillus fumigatus cDNA sequence and natural signals sequence thereof, the zone of containing correct nucleotide sequence, from the Yeast expression carrier (pALFd7) that contains described Aspergillus fumigatus beta-Polyglucosidase cDNA sequence and Humicola insolens EGV signal sequence, increase by PCR, use above-mentioned BGLU.5rev primer and following primer: BGL.7for:5 '-CTGGCGTTGGCGCTGTC-3 ' (SEQ ID NO:86)

Described amplified reaction (100 μ l) is by pALFd7,1 * Pfx amplification buffer, dATP, dCTP, dGTP and every kind 50 μ M of dTTP, every kind of 50pmole of above-mentioned primer, the 1.5mM MgSO of 0.5 μ l ₄Form with the Platinum Pfx archaeal dna polymerase of 2.5 units.Describedly be reflected at incubation among the RoboCyclerGradient 40, its program is: a circulation, carried out 5 minutes at 95 ℃; 25 circulations, each 95 ℃ carry out 1 minute, carried out 1 minute and carried out 1 minute at 50 ℃ at 72 ℃; With final extension circulation, carried out 10 minutes at 72 ℃.

The PCR product of described 701bp is used QIAquick PCR purification kit and is carried out purifying.The DNA wash-out is gone into the EB damping fluid of 10 μ l.The PCR product of 3 μ l purifying, mix with the Yeast expression carrier of 3 μ l, contain Aspergillus fumigatus cDNA sequence in the described Yeast expression carrier with natural signals sequence, with the extra Nucleotide that produces breach with Sac II and XmaI carrier, be used for corotation and dissolve yeast saccharomyces cerevisiae YNG318 competent cell, as described in the embodiment 8.These bacterium colonies become blueness.Save plasmid DNA the blue colonies of picking at random from one, as described in example 10 above, and described plasmid is transformed into intestinal bacteria SURE electroporation-competent cell, and (Stratagene, La Jolla CA) are used for order-checking.The total length order-checking shows that described Aspergillus fumigatus beta-Polyglucosidase cDNA sequence is correct.This Yeast expression carrier called after pALFd6 (Figure 26), it comprises described Aspergillus fumigatus cDNA sequence and natural signals sequence thereof.

Embodiment 28: make up the Aspergillus fumigatus beta-Polyglucosidase variant with G142S replacement

With the amino acid whose Nucleotide of G142 zone in the Aspergillus fumigatus encoding sequence of coding pEJG97AfumFAM3A, suddenly change to produce G to the A sudden change, the G142S that described sudden change coding is present among the aspergillus oryzae beta-Polyglucosidase sequence variants BG53 replaces.Use QuickChange rite-directed mutagenesis test kit (Stratagene, La Jolla CA) and following primer (underlined Nucleotide represents to have the codon of the base of change, aminoacid replacement that its coding is new), carry out described sudden change:

SDMG 142SUpper：

5′-GCGGCAGAATCTGGGAA AGCTTCTCTCCTG-3′(SEQIDNO：87)

SDMG 142SLower：

5 '-CAGGAGAGAA GCTTTCCCAGATTCTGCCGC-3 ' (SEQ ID NO:88) G verifies by order-checking to the existence of A sudden change.Described novel vector called after pEJG97AfumFAM3AG142S (Figure 27).Between the 231bp fragment, described 231bp fragment is by obtaining with Eco RI and Bst XI digestion pEJG97AfumFAM3AG142S carrier to the A sudden change for described G.These sites are unique in the pALFd7 carrier.

PEJG97AfumFAM3AG 142S and pALFd7 (every kind of about 6 μ g) are digested with EcoRI and BstXI.The reaction of pALFd7 obtains two fragments, one contain most plasmid (8504bp) and from the 231bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains described wild-type location, wherein produces G and suddenly change to A in the pEJG97AfumFAM3AG142S carrier.The reaction of pEJG97AfumFAM3AG142S obtains three fragments, fragment that contains most plasmid (7351bp), another less 1254bp and from the 231bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains G and suddenlys change to A.The pALFd7 of digestion handles with shrimp alkaline phosphotase, be used for DNA product dephosphorylation with digestion, by adding 1 * SAP damping fluid and 1 μ l SAP (Roche AppliedScience from Roche, Manheim, Germany) and 37 ℃ with described reaction incubation 10 minutes, be the inactivation that was used for enzyme at 85 ℃ of incubations in 10 minutes then.Two digestion are operated on 0.7% sepharose, and use QIAGEN Gel purification kit, carry out purifying according to the operation instruction of manufacturers.

The pALFd7 of digestion is connected with described 231bp fragment, described 231bp fragment is from the pEJG97AfumFAM3AG142S digestion that contains the site, described site coding has the amino acid/11 42 of coding mutation, and described coding mutation causes the G142S aminoacid replacement.By using the Rapid dna ligation kit, finish connection according to the operation instruction of manufacturers.

With described ligation,, be transformed into XLl-Blue intestinal bacteria subclone-competent cell according to the operation instruction of manufacturers.After the conversion, the plasmid DNA of the bacterium colony of self-separation checks order in the future, as described in embodiment 10, and verifies the existence of G unique in whole coding regions of described gene to the A sudden change.Subsequently, described plasmid DNA is transformed into the yeast competent cell, as described in example 8 above, it causes containing the separation of the Aspergillus fumigatus beta-Polyglucosidase variant that described G142S replaces.The Yeast expression carrier that will comprise Aspergillus fumigatus beta-Polyglucosidase variant with G142S replacement, called after pALFd7G142S (Figure 28).

Embodiment 29: make up the Aspergillus fumigatus beta-Polyglucosidase variant with H266Q replacement

The amino acid whose Nucleotide of H266 zone in the Aspergillus fumigatus encoding sequence of coding pEJG97AfumFAM3A carrier suddenlys change to produce C to the A sudden change, and the H266Q that described sudden change coding is present among the aspergillus oryzae beta-Polyglucosidase sequence variants BG53 replaces.Use QuickChange rite-directed mutagenesis test kit (Stratagene, La Jolla CA) and following primer (underlined Nucleotide represents to have the codon of the base of change, aminoacid replacement that its coding is new), carry out described sudden change:

SDMH266QUpper：

5’-TGACTGGAGCGCT CAACACAGCGGTGTCG-3’(SEQ ID NO：89)

SDMH266QLower：

5’-CGACACCGCTGTG TTGAGCGCTCCAGTCA-3’(SEQ ID NO：90)

C verifies by order-checking to the existence of A sudden change.Described novel vector called after pEJG97AfumFAM3AH266Q (Figure 29).Between the 270bp fragment, described 270bp fragment is to obtain by isoschizomers Blp I and XmaI digestion pEJG97AfumFAM3AH266Q with Bpu 1102I to described C to the A sudden change.These sites are unique in the pALFd7 carrier.PEJG97AfumFAM3AH266Q and pALFd7 (every kind of about 6 μ g) are digested with BlpI and XmaI.The reaction of pALFd7 obtains two fragments, one contain most plasmid (8465bp) and from the 270bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains described wild-type location, wherein produces C and suddenly change to A in the pEJG97AfumFAM3AH266Q carrier.The reaction of pEJG97AfumFAM3AH266Q obtains three fragments, one contains most plasmid (6,331bp), another less 2, the fragment of 235bp and from the 270bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains C and suddenlys change to A.The pALFd7 of digestion handles with shrimp alkaline phosphotase, be used for DNA product dephosphorylation with digestion, by adding 1 * SAP damping fluid and 2 μ l SAP (Roche AppliedScience from Roche, Manheim, Germany) and 37 ℃ with described reaction incubation 10 minutes, be with enzyme deactivation then 85 ℃ of incubations 10 minutes.Two digestion are operated on 0.7% sepharose, and use QIAGEN Gel purification kit, carry out purifying according to the operation instruction of manufacturers.

The pALFd7 of digestion is connected with described 270bp fragment, and described 270bp fragment is from the pEJG97AfumFAM3AH266Q digestion that contains the site, and its coding has the amino acid/11 42 of coding mutation, and described coding mutation causes the H266Q aminoacid replacement.By using the Rapid dna ligation kit, finish connection according to the operation instruction of manufacturers.

With described ligation,, be transformed into XLl-Blue intestinal bacteria subclone-competent cell according to the operation instruction of manufacturers.After the conversion, the plasmid DNA of the bacterium colony of self-separation checks order in the future, as described in embodiment 10, and verifies the existence of C unique in whole coding regions of described gene to the A sudden change.Subsequently, described plasmid DNA is transformed into the yeast competent cell, as described in example 8 above, it causes containing the separation of the Aspergillus fumigatus beta-Polyglucosidase variant that described H266Q replaces.The Yeast expression carrier that will comprise Aspergillus fumigatus beta-Polyglucosidase variant with G142S replacement, called after pALFd7H266Q.

Embodiment 30: make up the Aspergillus fumigatus beta-Polyglucosidase variant with G142S and H266Q replacement

Plasmid pEJG97AfumFAM3AH266Q contains the C that is arranged in the 270bp fragment and suddenlys change to A, and described 270bp fragment is by obtaining with Blp I and Xma I digestion pEJG97AfumFAM3AH266Q.Described pALFd7G142S carrier contains G to the A sudden change, and described sudden change produces G142S and replaces in Aspergillus fumigatus beta-Polyglucosidase sequence.PEJG97AfumFAM3AH266Q and pALFd7G142S (every kind of about 6 μ g) digest with Blp I and Xma I.The reaction of pALFd7 obtains two fragments, one contains most plasmid (8,465bp) and from the 270bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains described wild-type location, wherein produces C and suddenly change to A in the pEJG97AfumFAM3AH266Q carrier.The reaction of pEJG97AfumFAM3AH266Q obtains three fragments, one contains most plasmid (6,331bp), another less 2, the fragment of 235bp and from the 270bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains C and suddenlys change to A.The pALFd7 of digestion handles with shrimp alkaline phosphotase, be used for DNA product dephosphorylation with digestion, by adding 1 * SAP damping fluid and 2 μ l SAP (Roche Applied Science from Roche, Manheim, Germany) and 37 ℃ with described reaction incubation 10 minutes, be with enzyme deactivation then 85 ℃ of incubations 10 minutes.Two digestion are operated on 0.7% sepharose, and use QIAGEN Gel purification kit, carry out purifying according to the operation instruction of manufacturers.

The pALFd7G142S of digestion is connected with the 270bp fragment that digests from pEJG97AfumFAM3AH266Q, contains the coding mutation that causes the H266Q aminoacid replacement in the described pEJG97AfumFAM3AH266Q digestion.By using the Rapid dna ligation kit, finish connection according to the operation instruction of manufacturers.

With described ligation,, be transformed into XLl-Blue intestinal bacteria subclone-competent cell according to the operation instruction of manufacturers.After the conversion, in the future the plasmid DNA of the bacterium colony of self-separation checks order, and as described in embodiment 10, and verifies the existence that C that coding G142S replaces in whole coding regions of described gene G replaces to A sudden change and coding H266Q suddenlys change to A.Subsequently, described plasmid DNA is transformed into the yeast competent cell, as described in example 8 above, it causes containing separating of Aspergillus fumigatus beta-Polyglucosidase variant that described G142S and H266Q replace.The Yeast expression carrier that will comprise Aspergillus fumigatus beta-Polyglucosidase variant with G142S and H266Q replacement, called after pALFd7G142SH266Q.

Embodiment 31: make up the Aspergillus fumigatus beta-Polyglucosidase variant with H266Q and D705G replacement

The amino acid whose Nucleotide of D705 zone in the Aspergillus fumigatus encoding sequence of coding pEJG97AfumFAM3A carrier, suddenly change to produce A to the G sudden change, the homologous D703G that described sudden change coding is present among the aspergillus oryzae beta-Polyglucosidase sequence variants BG53 replaces.Use QuickChange rite-directed mutagenesis test kit (Stratagene, La Jolla CA) and following primer (underlined Nucleotide represents to have the codon of the base of change, aminoacid replacement that its coding is new), carry out described sudden change:

SDMD705GUpper：

5′-GAGGATTCTTCT GGCGACCCGAACTACGGC-3′(SEQ ID NO：91)

SDMD705GLower：

5′-GCCGTAGTTCGGGTC GCCAGAAGAATCCTC-3′(SEQ ID NO：92)

A verifies by order-checking to the existence of G sudden change.Described novel vector called after pEJG97AfumFAM3AD705G.Described A is arranged in the 711bp fragment to the G sudden change, and described 711bp fragment is to obtain by being used in the Bst EII digestion pEJG97AfumFAM3AD705G carrier that has two sites among the pEJG97AfumFAM3AD705G.In order to clone the 711bp fragment that contains described sudden change in the pALFd7H266Q carrier, pEJG97AfumFAM3AD705G and pALFd7H266Q (every kind of about 6 μ g) are digested with Bst EII.The digestion of pALFd7H266Q obtains two fragments, one contains most plasmid (8,024bp) and from the 711bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains encoding D 705 amino acid whose wild-types location.The digestion of pEJG97AfumFAM3AD705G obtains two fragments, one contains most plasmid (8,125bp) and from the 711bp of described beta-Polyglucosidase encoding sequence than small segment, described beta-Polyglucosidase encoding sequence contains A and suddenlys change to G.The pALFd7H266Q of digestion handles with shrimp alkaline phosphotase, be used for will digestion DNA product dephosphorylation, by adding the SAP of 1 * SAP damping fluid and 2 μ l, and 37 ℃ with described reaction incubation 10 minutes, be with enzyme deactivation then 85 ℃ of incubations 10 minutes.Two digestion are operated on 0.7% sepharose, and use QIAGEN Gel purification kit, carry out purifying according to the operation instruction of manufacturers.

The pALFd7H266Q of digestion is connected with the 711bp fragment that digests from pEJG97AfumFAM3AD705G, contains the coding mutation that causes the D705G aminoacid replacement in the described pEJG97AfumFAM3AD705G digestion.By using the Rapid dna ligation kit, finish connection according to the operation instruction of manufacturers.

With described ligation,, be transformed into XL1-Blue intestinal bacteria subclone-competent cell according to the operation instruction of manufacturers.After the conversion, in the future the plasmid DNA of the bacterium colony of self-separation checks order, as described in embodiment 10, and the existence that suddenlys change to G to A and A of the unique C that verifies encode respectively in whole coding regions of described gene G166S and H266Q aminoacid replacement.Subsequently, described plasmid DNA is transformed into the yeast competent cell, as described in example 8 above, it causes containing separating of Aspergillus fumigatus beta-Polyglucosidase variant that described H266Q and D705G replace.The Yeast expression carrier called after pALFd7H266QD705G that will comprise Aspergillus fumigatus beta-Polyglucosidase variant with H266Q and D705G replacement.

Embodiment 32: the effect of G142S, H266Q, G142S and H266Q and H266Q and D705G sudden change in the test Aspergillus fumigatus beta-Polyglucosidase

Residual activity by the Aspergillus fumigatus beta-Polyglucosidase of following vector encoded is measured, as described in embodiment 9, carry out at 80 ℃ after 10 minutes: pALFd7 contains wild-type Aspergillus fumigatus beta-Polyglucosidase cDNA core sequence and Humicola insolens EGV signal sequence and has the same construct of following sudden change, is labeled as the pALFd7G142S with G142S aminoacid replacement respectively; PALFd7H266Q with H266Q aminoacid replacement; PALFd7G142SH266Q with G142S and H266Q aminoacid replacement; With pALFd7H266QD705G with H266Q and D705G aminoacid replacement.Below table 4 shown that the beta-Polyglucosidase is 80 ℃ relative residual activity.The result shows, described aminoacid replacement has improved Aspergillus fumigatus beta-Polyglucosidase 80 ℃ residual activity.G61S and the combination of H266Q aminoacid replacement have best effect for the thermostability of improving described Aspergillus fumigatus beta-Polyglucosidase.

The relative residual activity of table 4. Aspergillus fumigatus Beta-Polyglucosidase variant

Aminoacid replacement

80 ℃ relative residual activity

Aspergillus fumigatus WT	1.00
		Aspergillus fumigatus G142S	1.37
Aspergillus fumigatus H266Q	1.08
		Aspergillus fumigatus G142S; H266Q	1.73
Aspergillus fumigatus H266Q; D705G	1.57

The biomaterial preservation

Clause according to budapest treaty, following biomaterial has been preserved in farming research service patent culture collection center, north district research centre (Agricultural Research Service PatentCulture Collection, Northern Regional Research Center), 1815 University Street, Peoria, Illinois, 61604, provided following preserving number:

Preservation thing (Deposit) preservation registration number preservation date

Intestinal bacteria TOP10 (pEJG113) NRRLB-30695 October 17,2003

Intestinal bacteria (pSATe111BG53) NRRL B-30652 May 2,2003

This bacterial strain preservation under following condition: guarantee during present patent application is unsettled, can obtain this culture according to the people that 37C.F.R. § 1.14 and 35U.S.C. § 122 authorize by the Patent ﹠ Trademark committee member.This preservation thing is the pure basically culture of institute's preservation strain.At the copy of having submitted this application to, or the country of its follow-up text, according to the requirement of this foreign patent law, can obtain this preservation thing.Yet, should be appreciated that the acquisition of preservation thing does not constitute implementing permission of the present invention, implementing the present invention is the infringement of patent right that action by government is authorized.

The present invention in this description and requirement is not limited in the scope of specific embodiments disclosed herein, because these embodiments are intended to the explanation as some aspect of the present invention.Any equal embodiment definitely within the scope of the present invention.In fact, remove here show and describe outside, to the various changes of the aforesaid specification sheets of the present invention, be conspicuous for those skilled in the art.Such change also drops in the scope of additional claim definitely.Having under the situation of conflict, be as the criterion with this specification sheets that comprises definition.

Quote various reference at this, it openly integrally is incorporated herein by reference.

Sequence table

＜110〉Novozymes Biotech Inc. (NOVOZYMES BIOTECH, INC.)

＜120〉variant of beta-glucosidase enzyme

<130>10371.204-WO

<150>60/467,767

<151>2003-05-02

<150>60/528,342

<151>2003-12-09

<160>92

<170>Patentln version 3.2

<210>1

<211>2586

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<220>

<221>CDS

<222>(1)..(2583)

<400>1

atg aag ctt ggt tgg atc gag gtg gcc gca ttg gcg gct gcc tca gta 48

Met Lys Leu Gly Trp Ile Glu Val Ala Ala Leu Ala Ala Ala Ser Val

1 5 10 15

gtc agt gcc aag gat gat ctc gcg tac tcc cct cct ttc tac cct tcc 96

Val Ser Ala Lys Asp Asp Leu Ala Tyr Ser Pro Pro Phe Tyr Pro Ser

20 25 30

cca tgg gca gat ggt cag ggt gaa tgg gcg gaa gta tac aaa cgc gct 144

Pro Trp Ala Asp Gly Gln Gly Glu Trp Ala Glu Val Tyr Lys Arg Ala

35 40 45

gta gac ata gtt tcc cag atg acg ttg aca gag aaa gtc aac tta acg 192

Val Asp Ile Val Ser Gln Met Thr Leu Thr Glu Lys Val Asn Leu Thr

50 55 60

act gga aca gga tgg caa cta gag agg tgt gtt gga caa act ggc agt 240

Thr Gly Thr Gly Trp Gln Leu Glu Arg Cys Val Gly Gln Thr Gly Ser

65 70 75 80

gtt ccc aga ctc aac atc ccc agc ttg tgt ttg cag gat agt cct ctt 288

Val Pro Arg Leu Asn Ile Pro Ser Leu Cys Leu Gln Asp Ser Pro Leu

85 90 95

ggt att cgt ttc tcg gac tac aat tca gct ttc cct gcg ggt gtt aat 336

Gly Ile Arg Phe Ser Asp Tyr Asn Ser Ala Phe Pro Ala Gly Val Asn

100 105 110

gtc gct gcc acc tgg gac aag acg ctc gcc tac ctt cgt ggt cag gca 384

Val Ala Ala Thr Trp Asp Lys Thr Leu Ala Tyr Leu Arg Gly Gln Ala

115 120 125

atg ggt gag gag ttc agt gat aag ggt att gac gtt cag ctg ggt cct 432

Met Gly Glu Glu Phe Ser Asp Lys Gly Ile Asp Val Gln Leu Gly Pro

130 135 140

gct gct ggc cct ctc ggt gct cat ccg gat ggc ggt aga aac tgg gaa 480

Ala Ala Gly Pro Leu Gly Ala His Pro Asp Gly Gly Arg Asn Trp Glu

145 150 155 160

ggt ttc tca cca gat cca gcc ctc acc ggt gta ctt ttt gcg gag acg 528

Gly Phe Ser Pro Asp Pro Ala Leu Thr Gly Val Leu Phe Ala Glu Thr

165 170 175

att aag ggt att caa gat gct ggt gtc att gcg aca gct aag cat tat 576

Ile Lys Gly Ile Gln Asp Ala Gly Val Ile Ala Thr Ala Lys His Tyr

180 185 190

atc atg aac gaa caa gag cat ttc cgc caa caa ccc gag gct gcg ggt 624

Ile Met Asn Glu Gln Glu His Phe Arg Gln Gln Pro Glu Ala Ala Gly

195 200 205

tac gga ttc aac gta agc gac agt ttg agt tcc aac gtt gat gac aag 672

Tyr Gly Phe Asn Val Ser Asp Ser Leu Ser Ser Asn Val Asp Asp Lys

210 215 220

act atg cat gaa ttg tac ctc tgg ccc ttc gcg gat gca gta cgc gct 720

Thr Met His Glu Leu Tyr Leu Trp Pro Phe Ala Asp Ala Val Arg Ala

225 230 235 240

gga gtc ggt gct gtc atg tgc tct tac aac caa atc aac aac agc tac 768

Gly Val Gly Ala Val Met Cys Ser Tyr Asn Gln Ile Asn Asn Ser Tyr

245 250 255

ggt tgc gag aat agc gaa act ctg aac aag ctt ttg aag gcg gag ctt 816

Gly Cys Glu Asn Ser Glu Thr Leu Asn Lys Leu Leu Lys Ala Glu Leu

260 265 270

ggt ttc caa ggc ttc gtc atg agt gat tgg acc gct cat cac agc ggc 864

Gly Phe Gln Gly Phe Val Met Ser Asp Trp Thr Ala His His Ser Gly

275 280 285

gta ggc gct gct tta gca ggt ctg gat atg tcg atg ccc ggt gat gtt 912

Val Gly Ala Ala Leu Ala Gly Leu Asp Met Ser Met Pro Gly Asp Val

290 295 300

acc ttc gat agt ggt acg tct ttc tgg ggt gca aac ttg acg gtc ggt 960

Thr Phe Asp Ser Gly Thr Ser Phe Trp Gly Ala Asn Leu Thr Val Gly

305 310 315 320

gtc ctt aac ggt aca atc ccc caa tgg cgt gtt gat gac atg gct gtc 1008

Val Leu Asn Gly Thr Ile Pro Gln Trp Arg Val Asp Asp Met Ala Val

325 330 335

cgt atc atg gcc gct tat tac aag gtt ggc cgc gac acc aaa tac acc 1056

Arg Ile Met Ala Ala Tyr Tyr Lys Val Gly Arg Asp Thr Lys Tyr Thr

340 345 350

cct ccc aac ttc agc tcg tgg acc agg gac gaa tat ggt ttc gcg cat 1104

Pro Pro Asn Phe Ser Ser Trp Thr Arg Asp Glu Tyr Gly Phe Ala His

355 360 365

aac cat gtt tcg gaa ggt gct tac gag agg gtc aac gaa ttc gtg gac 1152

Asn His Val Ser Glu Gly Ala Tyr Glu Arg Val Asn Glu Phe Val Asp

370 375 380

gtg caa cgc gat cat gcc gac cta atc cgt cgc atc ggc gcg cag agc 1200

Val Gln Arg Asp His Ala Asp Leu Ile Arg Arg Ile Gly Ala Gln Ser

385 390 395 400

act gtt ctg ctg aag aac aag ggt gcc ttg ccc ttg agc cgc aag gaa 1248

Thr Val Leu Leu Lys Asn Lys Gly Ala Leu Pro Leu Ser Arg Lys Glu

405 410 415

aag ctg gtc gcc ctt ctg gga gag gat gcg ggt tcc aac tcg tgg ggc 1296

Lys Leu Val Ala Leu Leu Gly Glu Asp Ala Gly Ser Asn Ser Trp Gly

420 425 430

gct aac ggc tgt gat gac cgt ggt tgc gat aac ggt acc ctt gcc atg 1344

Ala Asn Gly Cys Asp Asp Arg Gly Cys Asp Asn Gly Thr Leu Ala Met

435 440 445

gcc tgg ggt agc ggt act gcg aat ttc cca tac ctc gtg aca cca gag 1392

Ala Trp Gly Ser Gly Thr Ala Asn Phe Pro Tyr Leu Val Thr Pro Glu

450 455 460

cag gcg att cag aac gaa gtt ctt cag ggc cgt ggt aat gtc ttc gcc 1440

Gln Ala Ile Gln Asn Glu Val Leu Gln Gly Arg Gly Asn Val Phe Ala

465 470 475 480

gtg acc gac agt tgg gcg ctc gac aag atc gct gcg gct gcc cgc cag 1488

Val Thr Asp Ser Trp Ala Leu Asp Lys Ile Ala Ala Ala Ala Arg Gln

485 490 495

gcc agc gta tct ctc gtg ttc gtc aac tcc gac tca gga gaa ggc tat 1536

Ala Ser Val Ser Leu Val Phe Val Asn Ser Asp Ser Gly Glu Gly Tyr

500 505 510

ctt agt gtg gat gga aat gag ggc gat cgt aac aac atc act ctg tgg 1584

Leu Ser Val Asp Gly Asn Glu Gly Asp Arg Asn Asn Ile Thr Leu Trp

515 520 525

aag aac ggc gac aat gtg gtc aag acc gca gcg aat aac tgt aac aac 1632

Lys Asn Gly Asp Asn Val Val Lys Thr Ala Ala Asn A sn Cys Asn Asn

530 535 540

acc gtt gtc atc atc cac tcc gtc gga cca gtt ttg atc gat gaa tgg 1680

Thr Val Val Ile Ile His Ser Val Gly Pro Val Leu Ile Asp Glu Trp

545 550 555 560

tat gac cac ccc aat gtc act ggt att ctc tgg gct ggt ctg cca ggc 1728

Tyr Asp Hi s Pro Asn Val Thr Gly Ile Leu Trp Ala Gly Leu Pro Gly

565 570 575

cag gag tct ggt aac tcc att gcc gat gtg ctg tac ggt cgt gtc aac 1776

Gln Glu Ser Gly Asn Ser Ile Ala Asp Val Leu Tyr Gly Arg Val Asn

580 585 590

cct ggc gcc aag tct cct ttc act tgg ggc aag acc cgg gag tcg tat 1824

Pro Gly Ala Lys Ser Pro Phe Thr Trp Gly Lys Thr Arg Glu Ser Tyr

595 600 605

ggt tct ccc ttg gtc aag gat gcc aac aat ggc aac gga gcg ccc cag 1872

Gly Ser Pro Leu Val Lys Asp Ala Asn Asn Gly Asn Gly Ala Pro Gln

610 615 620

tct gat ttc acc cag ggt gtt ttc atc gat tac cgc cat ttc gat aag 1920

Ser Asp Phe Thr Gln Gly Val Phe Ile Asp Tyr Arg His Phe Asp Lys

625 630 635 640

ttc aat gag acc cct atc tac gag ttt ggc tac ggc ttg agc tac acc 1968

Phe Asn Glu Thr Pro Ile Tyr Glu Phe Gly Tyr Gly Leu Ser Tyr Thr

645 650 655

acc ttc gag ctc tcc gac ctc cat gtt cag ccc ctg aac gcg tcc cga 2016

Thr Phe Glu Leu Ser Asp Leu His Val Gln Pro Leu Asn Ala Ser Arg

660 665 670

tac act ccc acc agt ggc atg act gaa gct gca aag aac ttt ggt gaa 2064

Tyr Thr Pro Thr Ser Gly Met Thr Glu Ala Ala Lys Asn Phe Gly Glu

675 680 685

att ggc gat gcg tcg gag tac gtg tat ccg gag ggg ctg gaa agg atc 2112

Ile Gly Asp Ala Ser Glu Tyr Val Tyr Pro Glu Gly Leu Glu Arg Ile

690 695 700

cat gag ttt atc tat ccc tgg atc aac tct acc gac ctg aag gca tcg 2160

His Glu Phe Ile Tyr Pro Trp Ile Asn Ser Thr Asp Leu Lys Ala Ser

705 710 715 720

tct gac gat tct aac tac ggc tgg gaa gac tcc aag tat att ccc gaa 2208

Ser Asp Asp Ser Asn Tyr Gly Trp Glu Asp Ser Lys Tyr Ile Pro Glu

725 730 735

ggc gcc acg gat ggg tct gcc cag ccc cgt ttg ccc gct agt ggt ggt 2256

Gly Ala Thr Asp Gly Ser Ala Gln Pro Arg Leu Pro Ala Ser Gly Gly

740 745 750

gcc gga gga aac ccc ggt ctg tac gag gat ctt ttc cgc gtc tct gtg 2304

Ala Gly Gly Asn Pro Gly Leu Tyr Glu Asp Leu Phe Arg Val Ser Val

755 760 765

aag gtc aag aac acg ggc aat gtc gcc ggt gat gaa gtt cct cag ctg 2352

Lys Val Lys Asn Thr Gly Asn Val Ala Gly Asp Glu Val Pro Gln Leu

770 775 780

tac gtt tcc cta ggc ggc ccg aat gag ccc aag gtg gta ctg cgc aag 2400

Tyr Val Ser Leu Gly Gly Pro Asn Glu Pro Lys Val Val Leu Arg Lys

785 790 795 800

ttt gag cgt att cac ttg gcc cct tcg cag gag gcc gtg tgg aca acg 2448

Phe Glu Arg Ile His Leu Ala Pro Ser Gln Glu Ala Val Trp Thr Thr

805 810 815

acc ctt acc cgt cgt gac ctt gca aac tgg gac gtt tcg gct cag gac 2496

Thr Leu Thr Arg Arg Asp Leu Ala Asn Trp Asp Val Ser Ala Gln Asp

820 825 830

tgg acc gtc act cct tac ccc aag acg atc tac gtt gga aac tcc tca 2544

Trp Thr Val Thr Pro Tyr Pro Lys Thr Ile Tyr Val Gly Asn Ser Ser

835 840 845

cgg aaa ctg ccg ctc cag gcc tcg ctg cct aag gcc cag taa 2586

Arg Lys Leu Pro Leu Gln Ala Ser Leu Pro Lys Ala Gln

850 855 860

<210>2

<211>861

<212>PRT

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>2

Met Lys Leu Gly Trp Ile Glu Val Ala Ala Leu Ala Ala Ala Ser Val

1 5 10 15

Val Ser Ala Lys Asp Asp Leu Ala Tyr Ser Pro Pro Phe Tyr Pro Ser

20 25 30

Pro Trp Ala Asp Gly Gln Gly Glu Trp Ala Glu Val Tyr Lys Arg Ala

35 40 45

Val Asp Ile Val Ser Gln Met Thr Leu Thr Glu Lys Val Asn Leu Thr

50 55 60

Thr Gly Thr Gly Trp Gln Leu Glu Arg Cys Val Gly Gln Thr Gly Ser

65 70 75 80

Val Pro Arg Leu Asn Ile Pro Ser Leu Cys Leu Gln Asp Ser Pro Leu

85 90 95

Gly Ile Arg Phe Ser Asp Tyr Asn Ser Ala Phe Pro Ala Gly Val Asn

100 105 110

Val Ala Ala Thr Trp Asp Lys Thr Leu Ala Tyr Leu Arg Gly Gln Ala

115 120 125

Met Gly Glu Glu Phe Ser Asp Lys Gly Ile Asp Val Gln Leu Gly Pro

130 135 140

Ala Ala Gly Pro Leu Gly Ala His Pro Asp Gly Gly Arg Asn Trp Glu

145 150 155 160

Gly Phe Ser Pro Asp Pro Ala Leu Thr Gly Val Leu Phe Ala Glu Thr

165 170 175

Ile Lys Gly Ile Gln Asp Ala Gly Val Ile Ala Thr Ala Lys His Tyr

180 185 190

Ile Met Asn Glu Gln Glu His Phe Arg Gln Gln Pro Glu Ala Ala Gly

195 200 205

Tyr Gly Phe Asn Val Ser Asp Ser Leu Ser Ser Asn Val Asp Asp Lys

210 215 220

Thr Met His Glu Leu Tyr Leu Trp Pro Phe Ala Asp Ala Val Arg Ala

225 230 235 240

Gly Val Gly Ala Val Met Cys Ser Tyr Asn Gln Ile Asn Asn Ser Tyr

245 250 255

Gly Cys Glu Asn Ser Glu Thr Leu Asn Lys Leu Leu Lys Ala Glu Leu

260 265 270

Gly Phe Gln Gly Phe Val Met Ser Asp Trp Thr Ala His His Ser Gly

275 280 285

Val Gly Ala Ala Leu Ala Gly Leu Asp Met Ser Met Pro Gly Asp Val

290 295 300

Thr Phe Asp Ser Gly Thr Ser Phe Trp Gly Ala Asn Leu Thr Val Gly

305 310 315 320

Val Leu Asn Gly Thr Ile Pro Gln Trp Arg Val Asp Asp Met Ala Val

325 330 335

Arg Ile Met Ala Ala Tyr Tyr Lys Val Gly Arg Asp Thr Lys Tyr Thr

340 345 350

Pro Pro Asn Phe Ser Ser Trp Thr Arg Asp Glu Tyr Gly Phe Ala His

355 360 365

Asn His Val Ser Glu Gly Ala Tyr Glu Arg Val Asn Glu Phe Val Asp

370 375 380

Val Gln Arg Asp His Ala Asp Leu Ile Arg Arg Ile Gly Ala Gln Ser

385 390 395 400

Thr Val Leu Leu Lys Asn Lys Gly Ala Leu Pro Leu Ser Arg Lys Glu

405 410 415

Lys Leu Val Ala Leu Leu Gly Glu Asp Ala Gly Ser Asn Ser Trp Gly

420 425 430

Ala Asn Gly Cys Asp Asp Arg Gly Cys Asp Asn Gly Thr Leu Ala Met

435 440 445

Ala Trp Gly Ser Gly Thr Ala Asn Phe Pro Tyr Leu Val Thr Pro Glu

450 455 460

Gln Ala Ile Gln Asn Glu Val Leu Gln Gly Arg Gly Asn Val Phe Ala

465 470 475 480

Val Thr Asp Ser Trp Ala Leu Asp Lys Ile Ala Ala Ala Ala Arg Gln

485 490 495

Ala Ser Val Ser Leu Val Phe Val Asn Ser Asp Ser Gly Glu Gly Tyr

500 505 510

Leu Ser Val Asp Gly Asn Glu Gly Asp Arg Asn Asn Ile Thr Leu Trp

515 520 525

Lys Asn Gly Asp Asn Val Val Lys Thr Ala Ala Asn Asn Cys Asn Asn

530 535 540

Thr Val Val Ile Ile His Ser Val Gly Pro Val Leu Ile Asp Glu Trp

545 550 555 560

Tyr Asp His Pro Asn Val Thr Gly Ile Leu Trp Ala Gly Leu Pro Gly

565 570 575

Gln Glu Ser Gly Asn Ser Ile Ala Asp Val Leu Tyr Gly Arg Val Asn

580 585 590

Pro Gly Ala Lys Ser Pro Phe Thr Trp Gly Lys Thr Arg Gl uSer Tyr

595 600 605

Gly Ser Pro Leu Val Lys Asp Ala Asn Asn Gly Asn Gly Ala Pro Gln

610 615 620

Ser Asp Phe Thr Gln Gly Val Phe Ile Asp Tyr Arg His Phe Asp Lys

625 630 635 640

Phe Asn Glu Thr Pro Ile Tyr Glu Phe Gly Tyr Gly Leu Ser Tyr Thr

645 650 655

Thr Phe Glu Leu Ser Asp Leu His Val Gln Pro Leu Asn Ala Ser Arg

660 665 670

Tyr Thr Pro Thr Ser Gly Met Thr Glu Ala Ala Lys Asn Phe Gly Glu

675 680 685

Ile Gly Asp Ala Ser Glu Tyr Val Tyr Pro Glu Gly Leu Glu Arg Ile

690 695 700

His Glu Phe Ile Tyr Pro Trp Ile Asn Ser Thr Asp Leu Lys Ala Ser

705 710 715 720

Ser Asp Asp Ser Asn Tyr Gly Trp Glu Asp Ser Lys Tyr Ile Pro Glu

725 730 735

Gly Ala Thr Asp Gly Ser Ala Gln Pro Arg Leu Pro Ala Ser Gly Gly

740 745 750

Ala Gly Gly Asn Pro Gly Leu Tyr Glu Asp Leu Phe Arg Val Ser Val

755 760 765

Lys Val Lys Asn Thr Gly Asn Val Ala Gly Asp Glu Val Pro Gln Leu

770 775 780

Tyr Val Ser Leu Gly Gl y Pro Asn Glu Pro Lys Val Val Leu Arg Lys

785 790 795 800

Phe Glu Arg Ile His Leu Ala Pro Ser Gln Glu Ala Val Trp Thr Thr

805 810 815

Thr Leu Thr Arg Arg Asp Leu Ala Asn Trp Asp Val Ser Ala Gln Asp

820 825 830

Trp Thr Val Thr Pro Tyr Pro Lys Thr Ile Tyr Val Gly Asn Ser Ser

835 840 845

Arg Lys Leu Pro Leu Gln Al a Ser Leu Pro Lys Ala Gln

850 855 860

<210>3

<211>32

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>3

gcagatctac catgaagctt ggttggatcg ag 32

<210>4

<211>30

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>4

gcctcgagtt act gggcctt aggcagcgag 30

<210>5

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>5

aacgttaatt aaggaatcgt tttgtgttt 29

<210>6

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>6

agtactagta gctccgtggc gaaagcctg 29

<210>7

<211>31

<212>DNA

＜213〉intestinal bacteria (Escherichia coli)

<400>7

ttgaattgaa aatagattga tttaaaactt c 31

<210>8

<211>25

<212>DNA

＜213〉intestinal bacteria (Escherichia coli)

<400>8

ttgcatgcgt aatcatggtc atagc 25

<210>9

<211>26

<212>DNA

＜213〉yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400>9

ttgaattcat gggtaataac tgatat 26

<210>10

<211>32

<212>DNA

＜213〉yeast saccharomyces cerevisiae (Saccharomyces cerevisiae)

<400>10

aaatcaatct attttcaatt caattcatca tt 32

<210>11

<211>45

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

<400>11

ggatgctgtt gactccggaa atttaacggt ttggtcttgc atccc 45

<210>12

<211>44

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

<400>12

ggtattgtcc tgcagacggc aatttaacgg cttctgcgaa tcgc 44

<210>13

<211>29

<212>DNA

<213>Humicola insolens

<400>13

aagcttaagc atgcgttcct cccccctcc 29

<210>14

<211>32

<212>DNA

<213>Humicola insolens

<400>14

ctgcagaatt ctacaggcac tgatggtacc ag 32

<210>15

<211>32

<212>DNA

<213>Humicola insolens

<400>15

ctgcagaatt ctacaggcac tgatggtacc ag 32

<210>16

<211>36

<212>DNA

<213>Humicola insolens

<400>16

accgcggact gcgcatcatg cgttcctccc ccctcc 36

<210>17

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>17

aaacgtcgac cgaatgtagg attgttatc 29

<210>18

<211>17

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>18

gatgcgcagt ccgcggt 17

<210>19

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>19

aaacgtcgac cgaatgtagg attgttatc 29

<210>20

<211>36

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>20

ggagggggga ggaacgcatg atgcgcagtc cgcggt 36

<210>21

<211>29

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>21

aaacgtcgac cgaatgtagg attgttatc 29

<210>22

<211>32

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>22

ctgcagaatt ctacaggcac tgatggtacc ag 32

<210>23

<211>46

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>23

atagtcaacc gcggactgcg catcatgaag cttggttgga tcgagg 46

<210>24

<211>26

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>24

actagtttac tgggccttag gcagcg 26

<210>25

<211>26

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>25

gtcgactcga agcccgaatg taggat 26

<210>26

<211>45

<212>DNA

＜213〉Trichodermareesei (Trichoderma reesei)

<400>26

cctcgatcca accaagcttc atgatgcgca gtccgcggtt gacta 45

<210>27

<211>42

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>27

tgccggtgtt ggcccttgcc aaggatgatc tcgcgtactc cc 42

<210>28

<211>28

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>28

gactagtctt actgggcctt aggcagcg 28

<210>29

<211>63

<212>DNA

<213>Humicola insolens

<400>29

atgcgttcct cccccctcct ccgctccgcc gttgtggccg ccctgccggt gttggccctt 60

gcc 63

<210>30

<211>30

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>30

acgcgtcgac cgaatgtagg attgttatcc 30

<210>31

<211>42

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>31

gggagtacgc gagatcatcc ttggcaaggg ccaacaccgg ca 42

<210>32

<211>40

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>32

aatccgacta gtggatctac catgcgttcc tcccccctcc 40

<210>33

<211>32

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>33

gcgggcctcg agttactggg ccttaggcag cg 32

<210>34

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>34

agggtgaatg ggcggaa 17

<210>35

<211>20

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>35

gacatttttg ctgtcagtca 20

<210>36

<211>20

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>36

aatgttacat gcgtacacgc 20

<210>37

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>37

gtttcggctc aggactg 17

<210>38

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>38

acttccgccc attcacc 17

<210>39

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>39

agggtgaatg ggcggaa 17

<210>40

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>40

ggcggaaatg ctcttgt 17

<210>41

<211>18

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>41

sggatggcgg tagaaact 18

<210>42

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>42

gcggtccaat cactcat 17

<210>43

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>43

gctacggttg cgagaat 17

<210>44

<211>17

<212>DNA

＜211〉aspergillus oryzae (Aspergillus oryzae)

<400>44

ctcaagggca aggcacc 17

<210>45

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>45

ggtgccttgc ccttgag 17

<210>46

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>46

ttcgctgcgg tcttgac 17

<210>47

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>47

gtggaagaac ggcgaca 17

<210>48

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>48

cccagccgta gttagaa 17

<210>49

<211>17

<212>DNA

＜213〉aspergillus oryzae (A spergillus oryzae)

<400>49

cgtcccgata cactccc 17

<210>50

<211>17

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>50

cctggagcgg cagtttc 17

<210>51

<211>18

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>51

ggtcggtgtc cttaacgg 18

<210>52

<211>20

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>52

actatcctgc aaacacaagc 20

<210>53

<211>16

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>53

cctttcactt ggggca 16

<210>54

<211>20

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>54

ggagttacca gactcctggc 20

<210>55

<211>20

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>55

accttccgaa acatggttat 20

<210>56

<211>39

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<220>

<221>misc_feature

<222>(16)..(17)

＜223〉n represents a, c, g, or t

<400>56

ggtagaaact gggaannstt ctcaccagat ccagccctc 39

<210>57

<211>33

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<220>

<221>misc_feature

<222>(16)..(17)

＜223〉n represents a, c, g, or t

<400>57

gcctacgccg ctgtgnnsag cggtccaatc act 33

<210>58

<211>22

<212>DNA

<213>Aspergillus nidulens

<400>58

gtgccccatg atacgcctcc gg 22

<210>59

<211>26

<212>DNA

<213>Aspergillus nidulens

<400>59

gagtcgtatt tccaaggctc ctgacc 26

<210>60

<211>23

<212>DNA

<213>Aspergillus nidulens

<400>60

ggaggccatg aagtggacca acg 23

<210>61

<211>45

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

<400>61

caccgtgaaa gccatgctct ttccttcgtg tagaagacca gacag 45

<210>62

<211>45

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

<400>62

ctggtcttct acacgaagga aagagcatgg ctttcacggt gtctg 45

<210>63

<211>44

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

<400>63

ctatatacac aactggattt accatgggcc cgcggccgca gatc 44

<210>64

<211>44

<212>DNA

＜213〉aspergillus niger (Aspergillus niger)

<400>64

gatctgcggc cgcgggccca tggtaaatcc agttgtgtat atag 44

<210>65

<211>30

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>65

actggattta ccatgaagct tggttggatc 30

<210>66

<211>30

<212>DNA

＜213〉aspergillus oryzae (Aspergillus oryzae)

<400>66

agtcacctct agttattact gggccttagg 30

<210>67

<211>31

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>67

actggattta ccatgagatt cggttggctc g 31

<210>68

<211>31

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>68

agtcacct ctagttactagt agacacgggg c 31

<210>69

<211>3060

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>69

atgagattcg gttggctcga ggtggccgct ctgacggccg cttctgtagc caatgcccag 60

gtttgtgatg ctttcccgtc attgtttcgg atatagttga caatagtcat ggaaataatc 120

aggaattggc tttctctcca ccattctacc cttcgccttg ggctgatggc cagggagagt 180

gggcagatgc ccatcgacgc gccgtcgaga tcgtttctca gatgacactg gcggagaagg 240

ttaaccttac aacgggtact gggtgggttg cgactttttt gttgacagtg agctttcttc 300

actgaccatc tacacagatg ggaaatggac cgatgcgtcg gtcaaaccgg cagcgttccc 360

aggtaagctt gcaattctgc aacaacgtgc aagtgtagtt gctaaaacgc ggtggtgcag 420

acttggtatc aactggggtc tttgtggcca ggattcccct ttgggtatcc gtttctgtga 480

gctatacccg cggagtcttt cagtccttgt attatgtgct gatgattgtc tctgtatagc 540

tgacctcaac tccgccttcc ctgctggtac taatgtcgcc gcgacatggg acaagacact 600

cgcctacctt cgtggcaagg ccatgggtga ggaattcaac gacaagggcg tggacatttt 660

gctggggcct gctgctggtc ctctcggcaa atacccggac ggcggcagaa tctgggaagg 720

cttctctcct gatccggttc tcactggtgt acttttcgcc gaaactatca agggtatcca 780

agacgcgggt gtgattgcta ctgccaagca ttacattctg aatgaacagg agcatttccg 840

acaggttggc gaggcccagg gatatggtta caacatcacg gagacgatca gctccaacgt 900

ggatgacaag accatgcacg agttgtacct ttggtgagta gttgacactg caaatgagga 960

ccttgattga tttgactgac ctggaatgca ggccctttgc agatgctgtg cgcggtaaga 1020

ttttccgtag acttgacctc gcgacgaaga aatcgctgac gaaccatcgt agctggcgtt 1080

ggcgctgtca tgtgttccta caatcaaatc aacaacagct acggttgtca aaacagtcaa 1140

actctcaaca agctcctcaa ggctgagctg ggcttccaag gcttcgtcat gagtgact gg 1200

agcgctcacc acagcggtgt cggcgctgcc ctcgctgggt tggatatgtc gatgcctgga 1260

gacatttcct tcgacgacgg actctccttc tggggcacga acctaactgt cagtgttctt 1320

aacggcaccg ttccagcctg gcgtgtcgat gacatggctg ttcgtatcat gaccgcgtac 1380

tacaaggttg gtcgtgaccg tcttcgtatt ccccctaact tcagctcctg gacccgggat 1440

gagtacggct gggagcattc tgctgtctcc gagggagcct ggaccaaggt gaacgacttc 1500

gtcaatgtgc agcgcagtca ctctcagatc atccgtgaga ttggtgccgc tagtacagtg 1560

ctcttgaaga acacgggtgc tcttcctttg accggcaagg aggttaaagt gggtgttctc 1620

ggtgaagacg ctggttccaa cccgtggggt gctaacggct gccccgaccg cggctgtgat 1680

aacggcactc tgtctatggc ctggggtagt ggtactgcca acttccctta ccttgtcacc 1740

cccgagcagg ctatccagcg agaggtcatc agcaacggcg gcaatgtctt tgctgtgact 1800

gataacgggg ctctcagcca gatggcagat gttgcatctc aatccaggtg agtgcgggct 1860

cttagaaaaa gaacgttctc tgaatgaagt tttttaacca ttgcgaacag cgtgtctttg 1920

gtgtttgtca acgccgactc tggagagggt ttcatcagtg tcgacggcaa cgagggtgac 1980

cgcaaaaatc tcactctgtg gaagaacggc gaggccgtca ttgacactgt tgtcagccac 2040

tgcaacaaca cgattgtggt tattcacagt gttgggcccg tcttgatcga ccggtggtat 2100

gataacccca acgtcactgc catcatctgg gccggcttgc ccggtcagga gagtggcaac 2160

tccctggtcg acgtgctcta tggccgcgtc aaccccagcg ccaagacccc gttcacctgg 2220

ggcaagactc gggagtctta cggggctccc ttgctcaccg agcctaacaa tggcaatggt 2280

gctccccagg atgatttcaa cgagggcgtc ttcattgact accgtcactt tgacaagcgc 2340

aatgagaccc ccatttatga gtttggccat ggcttgagct acaccacctt tggttactct 2400

caccttcggg ttcaggccct caatagttcg agttcggcat atgtcccgac tagcggagag 2460

accaagcctg cgccaaccta tggtgagatc ggtagtgccg ccgactacct gtatcccgag 2520

ggtctcaaaa gaattaccaa gtttatttac ccttggctca actcgaccga cctcgaggat 2580

tcttctgacg acccgaacta cggctgggag gactcggagt acattcccga aggcgctagg 2640

gatgggtctc ctcaacccct cctgaaggct ggcggcgctc ctggtggtaa ccctaccctt 2700

tatcaggatc ttgttagggt gtcggccacc ataaccaaca ctggtaacgt cgccggttat 2760

gaagtccctc aattggtgag tgacccgcat gttccttgcg ttgcaatttg gctaactcgc 2820

ttctagtatg tttcactggg cggaccgaac gagcctcggg tcgttctgcg caagttcgac 2880

cgaatcttcc tggctcctgg ggagcaaaag gtttggacca cgactcttaa ccgtcgtgat 2940

ctcgccaatt gggatgtgga ggctcaggac tgggtcatca caaagtaccc caagaaagtg 3000

cacgtcggca gctcctcgcg taagctgcct ctgagagcgc ctctgccccg tgtctactag 3060

<210>70

<211>863

<212>PRT

＜213〉Aspergillus fumigatus (As pergillus fumigatus)

<400>70

Met Arg Phe Gly Trp Leu Glu Val Ala Ala Leu Thr Ala Ala Ser Val

1 5 10 15

Ala Asn Ala Gln Glu Leu Ala Phe Ser Pro Pro Phe Tyr Pro Ser Pro

20 25 30

Trp Ala Asp Gly Gln Gly Glu Trp Ala Asp Ala His Arg Arg Ala Val

35 40 45

Glu Ile Val Ser Gln Met Thr Leu Ala Glu Lys Val Asn Leu Thr Thr

50 55 60

Gly Thr Gly Trp Glu Met Asp Arg Cys Val Gly Gln Thr Gly Ser Val

65 70 75 80

Pro Arg Leu Gly Ile Asn Trp Gly Leu Cys Gly Gln Asp Ser Pro Leu

85 90 95

Gly Ile Arg Phe Ser Asp Leu Asn Ser Ala Phe Pro Ala Gly Thr Asn

100 105 110

Val Ala Ala Thr Trp Asp Lys Thr Leu Ala Tyr Leu Arg Gly Lys Ala

115 120 125

Met Gly Glu Glu Phe Asn Asp Lys Gly Val Asp Ile Leu Leu Gly Pro

130 135 140

Ala Ala Gly Pro Leu Gly Lys Tyr Pro Asp Gly Gly Arg Ile Trp Glu

145 150 155 160

Gly Phe Ser Pro Asp Pro Val Leu Thr Gly Val Leu Phe Ala Glu Thr

165 170 175

Ile Lys Gly Ile Gln Asp Ala Gly Val Ile Ala Thr Ala Lys His Tyr

180 185 190

Ile Leu Asn Glu Gln Glu His Phe Arg Gln Val Gly Glu Ala Gln Gly

195 200 205

Tyr Gly Tyr Asn Ile Thr Glu Thr Ile Ser Ser Asn Val Asp Asp Lys

210 215 220

Thr Met His Glu Leu Tyr Leu Trp Pro Phe Ala Asp Ala Val Arg Ala

225 230 235 240

Gly Val Gly Ala Val Met Cys Ser Tyr Asn Gln Ile Asn Asn Ser Tyr

245 250 255

Gly Cys Gln Asn Ser Gln Thr Leu Asn Lys Leu Leu Lys Ala Glu Leu

260 265 270

Gly Phe Gln Gly Phe Val Met Ser Asp Trp Ser Ala His His Ser Gly

275 280 285

Val Gly Ala Ala Leu Ala Gly Leu Asp Met Ser Met Pro Gly Asp Ile

290 295 300

Ser Phe Asp Asp Gly Leu Ser Phe Trp Gly Thr Asn Leu Thr Val Ser

305 310 315 320

Val Leu Asn Gly Thr Val Pro Ala Trp Arg Val Asp Asp Met Ala Val

325 330 335

Arg Ile Met Thr Ala Tyr Tyr Lys Val Gly Arg Asp Arg Leu Arg Ile

340 345 350

Pro Pro Asn Phe Ser Ser Trp Thr Arg Asp Glu Tyr Gly Trp Glu His

355 360 365

Ser Ala Val Ser Glu Gly Ala Trp Thr Lys Val Asn Asp Phe Val Asn

370 375 380

Val Gln Arg Ser His Ser Gln Ile Ile Arg Glu Ile Gly Ala Ala Ser

385 390 395 400

Thr Val Leu Leu Lys Asn Thr Gly Ala Leu Pro Leu Thr Gly Lys Glu

405 410 415

Val Lys Val Gly Val Leu Gly Glu Asp Ala Gly Ser Asn Pro Trp Gly

420 425 430

Ala Asn Gly Cys Pro Asp Arg Gly Cys Asp Asn Gly Thr Leu Ala Met

435 440 445

Ala Trp Gly Ser Gly Thr Ala Asn Phe Pro Tyr Leu Val Thr Pro Glu

450 455 460

Gln Ala Ile Gln Arg Glu Val Ile Ser Asn Gly Gly Asn Val Phe Ala

465 470 475 480

Val Thr Asp Asn Gly Ala Leu Ser Gln Met Ala Asp Val Ala Ser Gln

485 490 495

Ser Ser Val Ser Leu Val Phe Val Asn Ala Asp Ser Gly Glu Gly Phe

500 505 510

Ile Ser Val Asp Gly Asn Glu Gly Asp Arg Lys Asn Leu Thr Leu Trp

515 520 525

Lys Asn Gly G1u Ala Val Ile Asp Thr Val Val Ser His Cys Asn Asn

530 535 540

Thr Ile Val Val Ile His Ser Val Gly Pro Val Leu Ile Asp Arg Trp

545 550 555 560

Tyr Asp Asn Pro Asn Val Thr Ala Ile lle Trp A1a Gly Leu Pro Gly

565 570 575

Gln Glu Ser Gly Asn Ser Leu Val Asp Val Leu Tyr Gly Arg Val Asn

580 585 590

Pro Ser Ala Lys Thr Pro Phe Thr Trp Gly Lys Thr Arg Glu Ser Tyr

595 600 605

Gly Ala Pro Leu Leu Thr Glu Pro Asn Asn Gly Asn Gly Ala Pro Gln

610 615 620

Asp Asp Phe Asn Glu Gly Val Phe Ile Asp Tyr Arg His Phe Asp Lys

625 630 635 640

Arg Asn Glu Thr Pro Ile Tyr Glu Phe Gly His Gly Leu Ser Tyr Thr

645 650 655

Thr Phe Gly Tyr Ser His Leu Arg Val Gln Ala Leu Asn Ser Ser Ser

660 665 670

Ser Ala Tyr Val Pro Thr Ser Gly Glu Thr Lys Pro Ala Pro Thr Tyr

675 680 685

Gly Glu Ile Gly Ser Ala Ala Asp Tyr Leu Tyr Pro Glu Gly Leu Lys

690 695 700

Arg Ile Thr Lys Phe Ile Tyr Pro Trp Leu Asn Ser Thr Asp Leu Glu

705 710 715 720

Asp Ser Ser Asp Asp Pro Asn Tyr Gly Trp Glu Asp Ser Glu Tyr Ile

725 730 735

Pro Glu Gly Ala Arg Asp Gly Ser Pro Gln Pro Leu Leu Lys Ala Gly

740 745 750

Gly Ala Pro Gly Gly Asn Pro Thr Leu Tyr Gln Asp Leu Val Arg Val

755 760 765

Ser Ala Thr Ile Thr Asn Thr Gly Asn Val Ala Gly Tyr Glu Val Pro

770 775 780

Gln Leu Tyr Val Ser Leu Gly Gly Pro Asn Glu Pro Arg Val Val Leu

785 790 795 800

Arg Lys Phe Asp Arg Ile Phe Leu Ala Pro Gly Glu Gln Lys Val Trp

805 810 815

Thr Thr Thr Leu Asn Arg Arg Asp Leu Ala Asn Trp Asp Val Glu Ala

820 825 830

Gln Asp Trp Val Ile Thr Lys Tyr Pro Lys Lys Val His Val Gly Ser

835 840 845

Ser Ser Arg Lys Leu Pro Leu Arg Ala Pro Leu Pro Arg Val Tyr

850 855 860

<210>71

<211>2589

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>71

atgagattcg gttggctcga ggtggccgct ctgacggccg cttctgtagc caatgcccag 60

gaattggctt tctctccacc attctaccct tcgccttggg ctgatggcca gggagagtgg 120

gcagatgccc atcgacgcgc cgtcgagatc gtttctcaga tgacactggc ggagaaggtt 180

aaccttacaa cgggtactgg atgggaaatg gaccgatgcg tcggtcaaac cggcagcgtt 240

cccagacttg gtatcaactg gggtctttgt ggccaggatt cccctttggg tatccgtttc 300

tctgacctca actccgcctt ccctgctggt actaatgtcg ccgcgacatg ggacaagaca 360

ctcgcctacc ttcgtggcaa ggccatgggt gaggaattca acgacaaggg cgtggacatt 420

ttgctggggc ctgctgctgg tcctctcggc aaatacccgg acggcggcag aatctgggaa 480

ggcttctctc ctgatccggc tctcactggt gtacttttcg ccgaaactat caagggtatc 540

caagacgcgg gtgtgattgc tactgccaag cattacattc tgaatgaaca ggagcatttc 600

cgacaggttg gcgaggccca gggatatggt tacaacatca cggagacgat cagctccaac 660

gtggatgaca agaccatgca cgagttgtac ctttggccct ttgcagatgc tgtgcgcgct 720

ggcgttggcg ctgtcatgtg ttcctacaat caaatcaaca acagctacgg ttgtcaaaac 780

agtcaaactc tcaacaagct cctcaaggct gagctgggct tccaaggctt cgtcatgagt 840

gactggagcg ctcaccacag cggtgtcggc gctgccctcg ctgggttgga tatgtcgatg 900

cccggagaca tttccttcga cgacggactc tccttctggg gcacgaacct aactgtcagt 960

gttcttaacg gcaccgttcc agcctggcgt gtcgatgaca tggctgttcg tatcatgacc 1020

gcgtactaca aggttggtcg tgaccgtctt cgtattcccc ctaacttcag ctcctggacc 1080

cgggatgagt acggctggga gcattctgct gtctccgagg gagcctggac caaggtgaac 1140

gacttcgtca atgtgcagcg cagtcactct cagatcatcc gtgagattgg tgccgctagt 1200

acagtgctct tgaagaacac gggtgctctt cctttgaccg gcaaggaggt taaagtgggt 1260

gttctcggtg aagacgctgg ttccaacccg tggggtgcta acggctgccc cgaccgcggc 1320

tgtgataacg gcactcttgc tatggcctgg ggtagtggta ctgccaactt cccttacctt 1380

gtcacccccg agcaggctat ccagcgagag gtcatcagca acggcggcaa tgtctttgct 1440

gtgactgata acggggctct cagccagatg gcagatgttg catctcaatc cagcgtgtct 1500

ttggtgtttg tcaacgccga ctctggagag ggtttcatca gtgtcgacgg caacgagggt 1560

gaccgcaaaa atctcactct gtggaagaac ggcgaggccg tcattgacac tgttgtcagc 1620

cactgcaaca acacgattgt ggttattcac agtgttgggc ccgtcttgat cgaccggtgg 1680

tatgataacc ccaacgtcac tgccatcatc tgggccggct tgcccggtca ggagagtggc 1740

aactccctgg tcgacgtgct ctatggccgc gtcaacccca gcgccaagac cccgttcacc 1800

tggggcaaga ctcgggagtc ttacggggct cccttgctca ccgagcctaa caatggcaat 1860

ggtgctcccc aggatgattt caacgagggc gtcttcattg actaccgtca ctttgacaag 1920

cgcaatgaga cccccattta tgagtttggc catggcttga gctacaccac ctttggttac 1980

tctcaccttc gggttcaggc cctcaatagt tcgagttcgg catatgtccc gactagcgga 2040

gagaccaagc ctgcgccaac ctatggtgag atcggtagtg ccgccgacta cctgtatccc 2100

gagggtctca aaagaattac caagtttatt tacccttggc tcaactcgac cgacctcgag 2160

gattcttctg acgacccgaa ctacggctgg caggactcgg agtacattcc cgaaggcgct 2220

agggatgggt ctcctcaacc cctcctgaag gctggcggcg ctcctggtgg taaccctacc 2280

ctttatcagg atcttgttag ggtgtcggcc accataacca acactggtaa cgtcgccggt 2340

tatgaagtcc ctcaattgta tgtttcattg ggcggaccga acgagcctcg ggtcgttctg 2400

cgcaagttcg accgaatctt cctggctcct ggggagcaaa aggtttggac cacgactctt 2460

aaccgtcgtg atctcgccaa ttgggatgtg gaggctcagg actgggtcat cacaaagtac 2520

cccaagaaag tgcacgtcgg cagctcctcg cgtaagctgc ctctgagagc gcctctgccc 2580

cgtgtctac 2589

<210>72

<211>29

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>72

ggctcatgag attcggttgg ctcgaggtc 29

<210>73

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>73

gccgttatca cagccgcggt cggggcagcc 30

<210>74

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>74

ggctgccccg accgcggctg tgataacggc 30

<210>75

<211>35

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>75

gcttaattaa tctagtagac acggggcaga ggcgc 35

<210>76

<211>16

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>76

acactggcgg agaagg 16

<210>77

<211>18

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>77

gcccagggat atggttac 18

<210>78

<211>19

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>78

cgactctgga gagggtttc 19

<210>79

<211>19

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>79

ggactgggtc atcacaaag 19

<210>80

<211>17

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>80

gcgagaggtc atcagca 17

<210>81

<211>17

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>81

gtaaaacgac ggccagt 17

<210>82

<211>16

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>82

caggaaacag ctatga 16

<210>83

<211>69

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>83

cttcttgtta gtgcaatatc atatagaagt catcgactag tggatctacc atgagattcg 60

gttggctcg 69

<210>84

<211>61

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>84

gcgtgaatgt aagcgtgaca taactaatta catgactcga gctagtagac acggggcaga 60

g 61

<210>85

<211>60

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>85

ccgctccgcc gttgtggccg ccctgccggt gttggccctt gccgaattgg ctttctctcc 60

<210>86

<211>17

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>86

ctggcgttgg cgctgtc 17

<210>87

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>87

gcggcagaat ctgggaaagc ttctctcctg 30

<210>88

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>88

caggagagaa gctttcccag attctgccgc 30

<210>89

<211>29

<212>DNA

＜213〉Aspergillus fumigatus (Aspergill us fumigatus)

<400>89

tgactggagc gctcaacaca gcggtgtcg 29

<210>90

<211>29

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>90

cgacaccgct gtgttgagcg ctccagtca 29

<210>91

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>91

gaggattctt ctggcgaccc gaactacggc 30

<210>92

<211>30

<212>DNA

＜213〉Aspergillus fumigatus (Aspergillus fumigatus)

<400>92

gccgtagttc gggtcgccag aagaatcctc 30

Claims (115)

1. the variant of isolating parental generation beta-Polyglucosidase, be included in the replacement on one or more sites, described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 142,183,266 and 705, wherein said variant has the beta-glucosidase activity.

2. the variant of claim 1, wherein said parental generation beta-Polyglucosidase is the polypeptide that (a) comprises aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ IDNO:70 have at least 70% identity; Or (b) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the low stringency condition and the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or the hybridization of their complementary strand.

3. the variant of claim 2, wherein (a) comprises the polypeptide of aminoacid sequence, the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 75% identity.

4. the variant of claim 3, wherein (a) comprises the polypeptide of aminoacid sequence, the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 80% identity.

5. the variant of claim 4, wherein (a) comprises the polypeptide of aminoacid sequence, the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 85% identity.

6. the variant of claim 5, wherein (a) comprises the polypeptide of aminoacid sequence, the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 90% identity.

7. the variant of claim 6, wherein (a) comprises the polypeptide of aminoacid sequence, the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 95% identity.

8. the variant of claim 2, wherein (b) is by nucleotide sequence coded polypeptide, during described nucleotides sequence is listed under the stringency condition with the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or their complementary strand hybridization.

9. the variant of claim 8, wherein (b) is by nucleotide sequence coded polypeptide, during described nucleotides sequence is listed in-Gao stringency condition under with the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or their complementary strand hybridization.

10. the variant of claim 9, wherein (b) is by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the high stringency condition and the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or the hybridization of their complementary strand.

11. the variant of claim 1, wherein said parental generation beta-Polyglucosidase comprise the aminoacid sequence of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.

12. the variant of claim 1, wherein said parental generation beta-Polyglucosidase is made up of the aminoacid sequence of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.

13. the variant of claim 1, wherein said parental generation beta-Polyglucosidase are wild-type beta-Polyglucosidases.

14. the variant of claim 1, wherein said parental generation beta-Polyglucosidase are mould genus of top spore, Agaricus, Alternaria, Aspergillus, grape seat chamber Pseudomonas, Chaetomidium, Claviceps, cochliobolus belongs to, Coprinopsis, Coptotermes, Cryphonectria, Exidia, fusarium, Gibberella, Holomastigotoides, Humicola, the rake Pseudomonas, Lentinula, Leptospaeria, Melanocarpus, Neurospora, Penicillium, Phanerochaete, Poitrasia, Pseudotrichonympha, the capital spore belongs to, Talaromyces, thermophilic ascomycete belongs to, Thielavia, Trichoderma, Peziza becomes mildewed, Verticillium, Volvariella or Xylaria beta-Polyglucosidase.

15. the variant of claim 14, wherein said Trichoderma beta-Polyglucosidase are Trichodermareesei beta-Polyglucosidases.

16. the variant of claim 1, it is included in the site 142 corresponding to SEQ ID NO:2 or SEQ ID NO:70; The site 183 of SEQ ID NO:2 or SEQ ID NO:70; The site 266 of SEQ ID NO:2 or SEQ ID NO:70; Or the replacement on the site in the site 705 of SEQ ID NO:2 site 703 or SEQ ID NO:70.

17. the variant of claim 16 is being Ser corresponding to the replacement on the site in site 142 wherein; Be Arg corresponding to the replacement on the site in site 183; Be Gln corresponding to the replacement on the site in site 266; Be Gly corresponding to the replacement on the site in site 703 or site 705.

18. the variant of claim 1, it is included in the site 142 and 183 corresponding to the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 142 and 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 142 and 703 of the amino acid/11 to 842 of SEQ IDNO:2; The site 142 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 183 and 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 183 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 183 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 266 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; Or the replacement on the site of the site 266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

19. the variant of claim 1, it comprises the site 142,183 and 266 corresponding to the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 142,266 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 142,266 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 183,266 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 183,266 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 142,183 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; Or the replacement on the site of the site 142,183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

20. the variant of claim 1, it is included in the site 142,183,266 and 703 corresponding to the amino acid/11 to 842 of SEQ ID NO:2; Or the replacement on the site of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

21. the variant of claim 1, it comprises the replacement of one or more G142S of being selected from, Q183R, H266Q or D703G or D705G.

22. the variant of claim 1, it comprises replacement G142S+Q183R+H266Q+D703G or D705G; G142S+Q183R+H266Q; G142S+H266Q+D703G or D705G; Q183R+H266Q+D703G or D705G; G142S+Q183R+D703G or D705G; G142S+Q183R; G142S+H266Q; G142S+D703G or D705G; Q183R+H266Q; Q183R+D703G or D705G; Or H266Q+D703G or D705G.

23. the variant of claim 1, wherein the number of Qu Daiing is 4,3,2 or 1.

24. the variant of claim 1, it comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 70% identity.

25. the variant of claim 24, it comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 75% identity.

26. the variant of claim 25, it comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 80% identity.

27. the variant of claim 26, it comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 85% identity.

28. the variant of claim 27, it comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 90% identity.

29. the variant of claim 28, it comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 95% identity.

30. the variant of claim 1, it is compared with described parental generation beta-Polyglucosidase, have one or more improved character, wherein said improved character is selected from heat activity, thermostability, pH activity, pH stability, substrate specificity, product specificity or chemical stability.

31. the variant of claim 30, the heat of wherein said variant beta-Polyglucosidase is active, and 1.5-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

32. the variant of claim 31, the heat of wherein said variant beta-Polyglucosidase is active, and 2-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

33. the variant of claim 32, the heat of wherein said variant beta-Polyglucosidase is active, and 5-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

34. the variant of claim 33, the heat of wherein said variant beta-Polyglucosidase is active, and 7-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

35. the variant of claim 34, the heat of wherein said variant beta-Polyglucosidase is active, and 20-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

36. the variant of claim 1, wherein said variant is made up of 741 to 750,751 to 760,761 to 770,771 to 780,781 to 790,791 to 800,801 to 810,811 to 820,821 to 830,831 to 840,841 to 850,851 to 860,861 to 870,871 to 880,881 to 890,891 to 900,901 to 910,911 to 920,921 to 930,931 to 940 or 941 to 950 amino acid.

37. the variant of claim 1, it is by being included in nucleotide sequence coded among the E.coli NRRL B-30652.

38. isolating nucleotide sequence, each variant among its coding claim 1-37.

39. nucleic acid construct, it comprises the nucleotide sequence of claim 38.

40. expression vector, it comprises the nucleic acid construct of claim 39.

41. host cell, it comprises the nucleic acid construct of claim 39.

42. produce the method for the variant of parental generation beta-Polyglucosidase, comprising:

(a) be suitable for expressing under the condition of described variant, cultivating the host cell of claim 41; With

(b) from this substratum, reclaim described variant.

43. detergent composition comprises among the claim 1-37 each beta-Polyglucosidase variant and tensio-active agent.

44. degraded or conversion contain the method for the biomass of Mierocrystalline cellulose and hemicellulose, comprise with each beta-Polyglucosidase variant among the claim 1-37 of significant quantity handling described biomass and reclaiming the biomass of degraded.

45. the method for claim 44 further comprises interior-1 with significant quantity, 4-beta-dextranase and outer-1, and the 4-beta-D-dextranase is handled described biomass.

46. degraded or conversion contain the method for the biomass of Mierocrystalline cellulose and hemicellulose, comprise with the host cell of claim 41 handling described biomass and reclaiming the biomass of degraded.

47. the method for claim 46 further comprises interior-1 with significant quantity, 4-beta-dextranase and outer-1, and the 4-beta-D-dextranase is handled described biomass.

48. a kind of plant, it comprises the nucleotide sequence of claim 38.

49. obtain the method for the variant of parental generation beta-Polyglucosidase, it comprises:

(a) corresponding to the site 142,183,266 of the amino acid/11 to 842 of SEQ ID NO:2 and 703 or import corresponding to one or more sites of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705 and to replace, wherein said variant has the beta-glucosidase activity; With

(b) reclaim described variant.

50. the method for claim 49, wherein said parental generation beta-Polyglucosidase is the polypeptide that (i) comprises aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQID NO:70 have at least 70% identity; Or (ii) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the low stringency condition, with the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or the hybridization of their complementary strand.

51. the method for claim 50, wherein (i) comprises the polypeptide of aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 75% identity.

52. the method for claim 51, wherein (i) comprises the polypeptide of aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 80% identity.

53. the method for claim 52, wherein (i) comprises the polypeptide of aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 85% identity.

54. the method for claim 53, wherein (i) comprises the polypeptide of aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 90% identity.

55. the method for claim 54, wherein (i) comprises the polypeptide of aminoacid sequence, and the amino acid/11 to 842 of described aminoacid sequence and SEQ ID NO:2 or the amino acid/11 to 844 of SEQ ID NO:70 have at least 95% identity.

56. the method for claim 50, wherein (ii) by nucleotide sequence coded polypeptide, under the stringency condition, with the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or their complementary strand was hybridized during described nucleotides sequence was listed in.

57. the method for claim 56, wherein (ii) by nucleotide sequence coded polypeptide, during described nucleotides sequence is listed in-Gao stringency condition under, with the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ IDNO:71, or their complementary strand hybridization.

58. the method for claim 57, wherein (ii) by nucleotide sequence coded polypeptide, described nucleotides sequence is listed under the high stringency condition, with the Nucleotide 58 to 2583 of SEQ ID NO:1 or the Nucleotide 58 to 2589 of SEQ ID NO:71, or the hybridization of their complementary strand.

59. the method for claim 49, wherein said parental generation beta-Polyglucosidase comprise the aminoacid sequence of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.

60. the method for claim 49, wherein said parental generation beta-Polyglucosidase is made up of the aminoacid sequence of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70.

61. the method for claim 49, wherein said parental generation beta-Polyglucosidase are wild-type beta-Polyglucosidases.

62. the method for claim 49, wherein said parental generation beta-Polyglucosidase are mould genus of top spore, Agaricus, Alternaria, Aspergillus, grape seat chamber Pseudomonas, Chaetomidium, Claviceps, cochliobolus belongs to, Coprinopsis, Coptotermes, Cryphonectria, Exidia, fusarium, Gibberella, Holomastigotoides, Humicola, the rake Pseudomonas, Lentinula, Leptospaeria, Melanocarpus, Neurospora, Penicillium, Phanerochaete, Poitrasia, Pseudotrichonympha, the capital spore belongs to, Talaromyces, thermophilic ascomycete belongs to, Thielavia, Trichoderma, Peziza becomes mildewed, Verticillium, Volvariella or Xylaria beta-Polyglucosidase.

63. the method for claim 62, wherein said Trichoderma beta-Polyglucosidase are Trichodermareesei beta-Polyglucosidases.

64. the method for claim 49, wherein said variant are included in the site 142 corresponding to SEQ ID NO:2 or SEQ ID NO:70; The site 183 of SEQ ID NO:2 or SEQ ID NO:70; The site 266 of SEQ ID NO:2 or SEQ ID NO:70; Or the replacement on the site in the site 705 of the site 703 of SEQ ID NO:2 or SEQ ID NO:70.

65. the method for claim 64 is being Ser corresponding to the replacement on the site in site 142 wherein; Be Arg corresponding to the replacement on the site in site 183; Be Gln corresponding to the replacement on the site in site 266; Be Gly corresponding to the replacement on the site in site 703 or site 705.

66. the method for claim 49, wherein said variant are included in the site 142 and 183 corresponding to the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 142 and 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 142 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 142 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 183 and 266 of the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 183 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 183 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 266 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; Or the replacement on the site of the site 266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

67. the method for claim 49, wherein said variant are included in the site 142,183 and 266 corresponding to the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; The site 142,266 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 142,266 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 183,266 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; The site 183,266 and 705 of the amino acid/11 to 844 of SEQ ID NO:70; The site 142,183 and 703 of the amino acid/11 to 842 of SEQ ID NO:2; Or the replacement on the site of the site 142,183 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

68. the method for claim 49, wherein said variant are included in the site 142,183,266 and 703 corresponding to the amino acid/11 to 842 of SEQ ID NO:2; Or the replacement on the site of the site 142,183,266 of the amino acid/11 to 844 of SEQ ID NO:70 and 705.

69. the method for claim 49, wherein said variant comprises the replacement of one or more G142S of being selected from, Q183R, H266Q or D703G or D705G.

70. comprising, the method for claim 49, wherein said variant replace G142S+Q183R+H266Q+D703G or D705G; G142S+Q183R+H266Q; G142S+H266Q+D703G or D705G; Q183R+H266Q+D703G or D705G; G142S+Q183R+D703G or D705G; G142S+Q183R; G142S+H266Q; G142S+D703G or D705G; Q183R+H266Q; Q183R+D703G or D705G; Or H266Q+D703G or D705G.

71. the method for claim 49, wherein the number of Qu Daiing is 4,3,2 or 1.

72. the method for claim 49, wherein said variant comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 70% identity.

73. the method for claim 72, wherein said variant comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 75% identity.

74. the method for claim 73, wherein said variant comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 80% identity.

75. the method for claim 74, wherein said variant comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 85% identity.

76. the method for claim 75, wherein said variant comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 90% identity.

77. the method for claim 76, wherein said variant comprises aminoacid sequence, and the aminoacid sequence of this aminoacid sequence and described parental generation beta-Polyglucosidase has at least 95% identity.

78. the method for claim 49, wherein said variant is compared with parental generation beta-Polyglucosidase, have one or more improved character, wherein said improved character is selected from heat activity, thermostability, pH activity, pH stability, substrate specificity, product specificity or chemical stability.

79. the method for claim 78, the heat of wherein said variant is active, and 1.5-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

80. the method for claim 79, the heat of wherein said variant is active, and 2-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

81. the method for claim 80, the heat of wherein said variant is active, and 5-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

82. the method for claim 81, the heat of wherein said variant is active, and 7-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

83. the method for claim 82, the heat of wherein said variant is active, and 20-is doubly at least than the hot active height of the parental generation beta-Polyglucosidase of described variant.

84. the method for claim 49, wherein said variant is made up of 741 to 750,751 to 760,761 to 770,771 to 780,781 to 790,791 to 800,801 to 810,811 to 820,821 to 830,831 to 840,841 to 850,851 to 860,861 to 870,871 to 880,881 to 890,891 to 900,901 to 910,911 to 920,921 to 930,931 to 940 or 941 to 950 amino acid.

85. have the isolated polypeptide of beta-glucosidase activity, wherein said amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are different in one or more sites, and described site is corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703 or corresponding to the site in the amino acid/11 to 844 of SEQ ID NO:70 142,183,266 and 705.

86. the polypeptide of claim 85, wherein said amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are in the site 142 corresponding to SEQ ID NO:2 or SEQ ID NO:70; The site 183 of SEQID NO:2 or SEQ ID NO:70; The site 266 of SEQ ID NO:2 or SEQ ID NO:70; Or the site in the site 705 of the site 703 of SEQ ID NO:2 or SEQ ID NO:70 is different.

87. the polypeptide of claim 86 wherein is not both Ser corresponding to the site 142 of SEQ ID NO:2 or SEQ ID NO:70; Be not both Arg corresponding to the site 183 of SEQ ID NO:2 or SEQ ID NO:70; Be not both Gln corresponding to the site 266 of SEQ ID NO:2 or SEQ ID NO:70; Or be not both Gly corresponding to the site 705 of the site 703 of SEQ ID NO:2 or SEQ ID NO:70.

88. the polypeptide of claim 85, wherein said amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are corresponding to the site 142 and 183 in the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; Site 142 and 266 in the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; Site 142 and 703 in the amino acid/11 to 842 of SEQ ID NO:2; Site 142 and 705 in the amino acid/11 to 844 of SEQ ID NO:70; Site 183 and 266 in the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; Site 183 and 703 in the amino acid/11 to 842 of SEQ ID NO:2; Site 183 and 705 in the amino acid/11 to 844 of SEQ ID NO:70; Site 266 and 703 in the amino acid/11 to 842 of SEQ ID NO:2; Or the site of the site 266 in the amino acid/11 to 844 of SEQ ID NO:70 and 705 is different.

89. the polypeptide of claim 85, wherein said amino acid sequence of polypeptide and SEQ ID NO:2 or SEQ ID NO:70 are corresponding to the site 142,183 and 266 in the amino acid/11 to 844 of the amino acid/11 to 842 of SEQ ID NO:2 or SEQ ID NO:70; Site 142,266 and 703 in the amino acid/11 to 842 of SEQ ID NO:2; Site 142,266 and 705 in the amino acid/11 to 844 of SEQ ID NO:70; Site 183,266 and 703 in the amino acid/11 to 842 of SEQ ID NO:2; Site 183,266 and 705 in the amino acid/11 to 844 of SEQID NO:70; Site 142,183 and 703 in the amino acid/11 to 842 of SEQ ID NO:2; Or the site of the site in the amino acid/11 to 844 of SEQ ID NO:70 142,183 and 705 is different.

90. the polypeptide of claim 85, wherein said amino acid sequence of polypeptide and SEQ ID NO:2 are corresponding to the site in the amino acid/11 to 842 of SEQ ID NO:2 142,183,266 and 703; Or the site of the site in the amino acid/11 to 844 of SEQ ID NO:70 142,183,266 and 705 is different.

91. the polypeptide of claim 85, wherein said amino acid sequence of polypeptide has 4,3,2 or 1 amino acid different with SEQ ID NO:2 or SEQ ID NO:70.

92. the polypeptide of claim 85, described polypeptide is compared with the polypeptide of SEQ ID NO:2 or SEQ ID NO:70 has one or more improved character, and wherein said improved character is selected from heat activity, thermostability, pH activity, pH stability, substrate specificity, product specificity or chemical stability.

93. the polypeptide of claim 92, the heat of wherein said polypeptide is active, and 1.5-is doubly at least than the hot active height of the polypeptide of SEQ ID NO:2 or SEQ ID NO:70.

94. the polypeptide of claim 93, the heat of wherein said polypeptide is active, and 2-is doubly at least than the hot active height of the polypeptide of SEQ ID NO:2 or SEQ ID NO:70.

95. the polypeptide of claim 94, the heat of wherein said polypeptide is active, and 5-is doubly at least than the hot active height of the polypeptide of SEQ ID NO:2 or SEQ ID NO:70.

96. the polypeptide of claim 95, the heat of wherein said polypeptide is active, and 7-is doubly at least than the hot active height of the polypeptide of SEQ ID NO:2 or SEQ ID NO:70.

97. the polypeptide of claim 96, the heat of wherein said polypeptide is active, and 20-is doubly at least than the hot active height of the polypeptide of SEQ ID NO:2 or SEQ ID NO:70.

98. the polypeptide of claim 85, wherein said polypeptide is made up of 741 to 750,751 to 760,761 to 770,771 to 780,781 to 790,791 to 800,801 to 810,811 to 820,821 to 830,831 to 840,841 to 850,851 to 860,861 to 870,871 to 880,881 to 890,891 to 900,901 to 910,911 to 920,921 to 930,931 to 940 or 941 to 950 amino acid.

99. isolating nucleotide sequence, each polypeptide among its coding claim 85-98.

100. nucleic acid construct, it comprises the nucleotide sequence of claim 99.

101. expression vector, it comprises the nucleic acid construct of claim 100.

102. host cell, it comprises the nucleic acid construct of claim 100.

103. produce the method for polypeptide, comprising with beta-glucosidase activity:

(a) be suitable for expressing under the condition of described polypeptide, cultivating the host cell of claim 102; With

(b) from this substratum, reclaim described polypeptide.

104. detergent composition comprises among the claim 85-98 each polypeptide with beta-glucosidase activity and tensio-active agent.

105. degraded or conversion contain the method for the biomass of Mierocrystalline cellulose and hemicellulose, comprise with each the polypeptide with beta-glucosidase activity among the claim 85-98 of significant quantity handling described biomass and reclaiming the biomass of degraded.

106. the method for claim 105 further comprises interior-1 with significant quantity, 4-beta-dextranase and outer-1, and the 4-beta-D-dextranase is handled described biomass.

107. degraded or conversion contain the method for the biomass of Mierocrystalline cellulose and hemicellulose, comprise with the host cell of claim 102 handling described biomass and reclaiming the biomass of degraded.

108. the method for claim 107 further comprises interior-1 with significant quantity, 4-beta-dextranase and outer-1, and the 4-beta-D-dextranase is handled described biomass.

109. a kind of plant, it comprises the nucleotide sequence of claim 99.

110. the variant of claim 12, wherein the parental generation beta-Polyglucosidase of being made up of the aminoacid sequence of the amino acid/11 to 842 of SEQ ID NO:2 is by being included in nucleotide sequence coded among the intestinal bacteria DSM 14240.

111. the variant of claim 12, wherein the parental generation beta-Polyglucosidase of being made up of the aminoacid sequence of the amino acid/11 to 844 of SEQ ID NO:70 is by being included in nucleotide sequence coded among the plasmid pEJG113, and described plasmid pEJG113 is included among the intestinal bacteria NRRL B-30695.

112. the method for claim 60, wherein said parental generation beta-Polyglucosidase is by being included in nucleotide sequence coded among the intestinal bacteria DSM 14240.

113. the method for claim 60, wherein said parental generation beta-Polyglucosidase is by being included in nucleotide sequence coded among the plasmid pEJG113, and described plasmid pEJG113 is included among the intestinal bacteria NRRLB-30695.

114. the method for claim 49, wherein said variant beta-Polyglucosidase is by being included in nucleotide sequence coded among the pSATe111BG53, and described pSATe111BG53 is included among the intestinal bacteria NRRL B-30652.

115. the polypeptide of claim 85, it is by being included in nucleotide sequence coded among the pSATe111BG53, and described pSATe111BG53 is included among the intestinal bacteria NRRL B-30652.

Images