CN100513548C - Improved methods for binding AcmA-type protein anchor fusions to cell-wall material of micro-organisms - Google Patents

Abstract

The invention provides a method for improving binding of a proteinaceous substance to cell-wall material of a Gram-positive bacterium, said substance comprising an AcmA cell wall binding domain or homolog or functional derivative thereof, said method comprising treating said cell-wall material with a solution capable of removing a cell-wall component such as a protein, (lipo) teichoic acid or carbohydrate from said cell-wall-material and contacting said substance with said cell-wall material.

Description

AcmA type protein anchor syzygy and microorganism cells wall material are carried out the bonded modification method

In recent years, location that can be by heterologous protein and anchor to host cell such as outside surface of yeast, fungi, Mammals and vegetable cell and bacterium or cell walls, in recombinant microorganism, carry out proteinic heterology surface display (Stahl and Uhlen, TIBTECH May 1997,15,185-192).Displaying at the heterologous protein on the surface of these cells has various ways, and the expression-form of the reactive group that these have nothing in common with each other for example is antigenic determinant, isodynamic enzyme, (strand) antibody, polyhistidyl label, peptide and other compound.The heterology surface display is used as the instrument of application and fundamental research in microbiology, molecular biology, vaccinology and biotechnology.And the application of another bacterium surface displaying is the bacterial vaccine movement system that development is lived.The cell surface display of heterologous antigen determinant is considered to when using the reconstitution cell of living to carry out immunity, and the immune response special to inducing antigen has superiority.Another application is to use bacterium surface displaying to produce whole-cell biological sorbent material or the biofilter that is used for environment purpose, microbial catalyst and diagnostic tool.

In a word, brought into use by the recombinant organisms that uses being had specificity and the chimeric protein formed of grappling or localization part optionally, and this part with comprise above-mentioned reactive group combination.An anchor portion of knowing for example is to comprise so-called LPXTG box, and its covalent attachment aureus surface is promptly with the form of the membrane protein of complete integration.In this method, chimeric protein is by forming by (many) peptides of at least two different genetic origins of normal peptide bond bonded.For example; in the patent application WO 94/18330 that relates to from the mixture of complexity separating compound and the immobilized part of preparation (biological adsorption agent); the method of the such part of claimed acquisition, this method comprise and are anchored in the cell walls of reconstitution cell a kind of conjugated protein or outside surface.Described conjugated protein is a chimeric protein that is produced by described reconstitution cell basically, it consists of: one can the binding specificity compound N-terminal (for example deriving from an antibody) part and with its link coupled C-terminal anchor portion, this anchor portion comes from the anchorin matter of specially selecting that has function in selected specific cell.A method that the protein selectivity only is positioned the aureus cell wall is provided in WO97/08553, as anchorin matter, this method is used the long district amino acid cell walls signal for locating of 80-90 amino acid long at least, and it comes from the proteinic lysostaphin gene or the amidase gene of coding selective binding aureus cell wall constituent.

Just carry out vaccine delivery or immune to express bacteria carrier strain unique antigenic determinant, attenuation now to resist multiple disease at extensive exploitation.In the recent period, carry out mucous membrane (for example nose or mouth) immunity with these carriers and be subjected to very big attention.For example, system and mucoantibody the reaction ((Medaglini etc. of Chinese People's Anti-Japanese Military and Political College wasp venom antigenic determinant have been found in the mouse of oral cavity inoculation human oral symbiosis Gall's chain coccus genetically engineered, the described antigenic determinant of surface expression (Streptococcus gordonii), PNAS 1995,2; 6868-6872)).And protective immunological reaction can be inoculated the recombinant bacteria vaccine by the oral cavity and cause, wherein tetanus toxin fragment C constitutive expression (Robinson etc., Nature Biotechnology 1997,15 in Lactococcus lactis; 653-657).Especially, mucosal immunity is considered to a kind of effective vaccine inoculation approach as the IgG that induces the special pathogenic agent in anti-stick film surface and the method for secretory IgA antibody.The immunogen that bacteria carrier is expressed is with particle form passs immune antigen presenting cell (for example M cell), so can not cause tolerance like soluble antigen.In addition, the existence of common mucomembranous immune system (common mucosal immunesystem) allow a special mucomembranous surface immunity cause antigen-specific IgA secretion and in other immune response in far-end mucous membrane site.The shortcoming of this method is that bacterial strain self may cause inflammation and disease, might cause heating and microbemia.Selectable method be avoid using the attenuated bacteria strain that may self become cause of disease and the symbiotic bacterium of selecting to recombinate as vaccine carrier, as staphylococcus and Lactococcus lactis.

Yet the potential problems that use this recombinant organisms are that they may grow at mucomembranous surface surely, thereby long-term exposure is in the target antigen of these recombinant microorganisms express and release.Such long-term exposure can cause immunological tolerance.In addition, only this organism is that independent fact genetic modification and that comprise recombinant nucleic acid also can run into sizable generally opposition from (layman) public, hinders to come from comprising the low-level overall acceptability of recombinant DNA or RNA product.Also there is similar opposition in protein or its part of using (even attenuation) the natural strain of cause of disease or coming from pathogenic strain.Yet, as above explain, present proteinic heterology surface display technology needs to use to the microorganism specificity of some qualifications and optionally grappling or positioning protein matter generally, is that recombinate or pathogenic on described microorganism is overall, thereby limits their potential application greatly.

The protein anchor of Lactococcus lactis (L.lactis), AcmA (cA), its homologue and functional derivatives (WO 99/25836) are with the non-covalent a lot of gram positive bacteriums of form combination.Also in conjunction with the isolated cells wall material.Binding partner in these cell wallss is not also known at present.Use Gram-positive, food grade bacteria,, provide than using other bacterium, as the obvious favourable vaccine delivery instrument of salmonella as Lactococcus lactis.Lactococcus lactis can not duplicate or invade and report the immunity (Norton etc., 1994) with low internality in tissue.The Lactococcus lactis of expressing tetanus toxin fragment C is presented at the deadly attack of inducing antibody protection mouse not to be subjected to tetanus toxin after mucous membrane is carried, even the carrier bacterium is killed before taking (Robinson etc., 1997).Yet these bacteriums still comprise the recombinant DNA that can propagate in the environment, particularly during oral immunisation plan on a large scale.This uncontrollable recombinant DNA is diffused into and goes to produce other bacterium or other (little) biological danger of taking in gene in the environment.

The invention provides and improve proteinaceous substances and gram positive bacterium cell wall material bonded method, described proteinaceous substances comprises at least one multiple, but be preferably the sequence of two or three multiple AcmA cell wall-bound structural domains or its homologue or its functional deriv, described method comprise with material as described in can from described cell wall material, removing cell wall material as described in the solution-treated of cell-wall component (as protein, (fat) teichoic acid or carbohydrate) and making with as described in the cell wall material of processing contact.The combination that in described method, has obtained to improve, this method is by using the described cell wall material of solution-treated that can remove cell-wall component, the cell wall material that randomly preserve to obtain is until providing required (fusion) protein for it then, and this is by AcmA cell wall-bound structural domain or its homologue or its functional deriv being offered this protein and cell wall material being contacted with this protein.By using method of the present invention, can obtain cell wall material, it has the ability of the conjugated protein metallic substance that has strengthened, and this proteinaceous substances contains AcmA cell wall-bound structural domain or its homologue or its functional deriv.

As state, the invention provides and a kind ofly remove the method for component from bacteria cell wall, it comprises with the full cell of solution-treated that can remove cell-wall component such as protein, (fat) teichoic acid or carbohydrate from described cell wall material.The cell wall material that obtains by the present invention has produced basically has at least 20%, more preferably 30%, best 40% or be preferably 50% empty relatively but the complete cell envelope of forming by the spherical microparticle of inertia substantially, further be called and be bacterium " ghost (ghost) ".Ghost has reflected size and the shape of the bacterium in their sources.

Preferably, the invention provides the method that obtains the gram positive bacterium cell wall material, this bacterium has the proteinaceous substances bonded ability that has strengthened and contain AcmA cell wall-bound structural domain or its homologue or its functional deriv, described method comprises with removing cell-wall component as cell wall material as described in the solution-treated of protein, (fat) teichoic acid or carbohydrate from described cell wall material, and wherein said cell wall material comprises the spherical peptidoglycan microparticle of mentioning to " ghost " basically herein.

The method of extracting the bacterial cell wall material with solution is for example having description among EP 0 545 352A, and Brown etc. has proposed by being exposed to TCA obtains the soluble peptide glycan of purifying from bacterium method.These publications have been described step, cell mechanical lysis at first wherein, thus the gained cell fragment is handled with TCA subsequently extract peptidoglycan from cell walls.Yet the method for quoting provides the preparation method of peptidoglycan and the cracked that has been removed from cell-wall component, the cell walls preparation method of random fragmentation.Very clear described method does not produce " ghost ".And described method does not allow and contains the proteinaceous substances location of AcmA cell wall-bound structural domain or its homologue or its function homologue basically.On the contrary, the preferred purpose of the inventive method is to produce " ghost " that cell-wall component is removed.In any case, carry out proteinaceous substances with " ghost " and show than advantage being arranged with the cracked cell wall material.For example, the combination of proteinaceous substances and bacterium " ghost " causes the higher packed bulk density of combination than the cell wall material of this material and mechanical lysis.In commercial run was used, it was favourable that proteinic high density surface is showed.One preferred embodiment in, the invention provides and not relate to cell wall material cracked method.

Use has the shortcoming of several practical aspects by the cell wall material that relates to the acquisition of mechanical lysis method.Because cell is by cracking fully, all intracellular organic matters all are released, and cell wall fragment must be from protein, separate in the mixture of the complexity of nucleic acid and other cellular component.The nucleic acid that discharges can increase the viscosity of solution and make subsequent step complicated, particularly chromatogram.The cell debris that mechanical lysis produces often is made up of the minicell fragment.These are difficult to remove.This problem has been overcome when using " ghost ".When preparing, ghost provides subsequently purifying and separating step advantageous conditions more about the consistency component of granular size and shape.Preferably, the method that the invention provides by not relating to the lysing cell wall obtains cell wall material, and wherein said cell wall material comprises ghost.

The bacterium of the often preferred use lysing cell of bacterium ghost wall carries out the surface display of immunogenic determinant.Compare with cleavage step, ghost is inactivation during the course, and has kept the natural spherical structure of a lot of bacteriums.Bacterium ghost thereby can better be attached to and/or easierly absorbed by special cell or tissue.The ability of bacterium ghost location scavenger cell or dendritic cell has improved their function and has renderd a service.Therefore, the ghost system of the non-work of non-reorganization provided by the invention is particularly suitable for as the vaccine delivery instrument.The present invention thereby provide and obtain to have the binding ability of enhanced and proteinaceous substances and the method for the immunoreactive ghost of enhanced inducing cell.The invention provides proteinaceous substances and gram positive bacterium cell wall material bonded method, described material comprises AcmA cell wall-bound structural domain or its homologue or its functional deriv, described method comprise with can from described cell wall material, remove cell-wall component as cell wall material as described in the solution-treated of protein, (fat) teichoic acid or carbohydrate and as described in making material with as described in cell wall material contact, wherein said cell wall material comprises the ghost by the method acquisition that does not relate to the cracking bacteria cell wall.

One preferred embodiment in, the pH of described solution is lower than the described AcmA cell wall-bound structural domain that calculates or the Pi value of its homologue or its functional deriv, particularly wherein said solution comprises acid.This acid preferably is selected from acetate (HAc), hydrochloric acid (HCl), sulfuric acid (H ₂SO ₄), three chloric acid (trichloric acid, TCA), three fluoric acids (trifluoric acid, TFA) and a chloric acid (monochloric acid, MCA).Concentration in acid described in the described solution depends on the pH value of required arrival, and the pH value is to determine by suitable calculating mostly, for example available computers program such as DNA star or Clone Manager.When the pI that calculates for example is〉8, the pH value of 6-4 is enough to producing suitable combination; When the pI value is lower, for example about 6, preferably select the pH value at 3-4.When structural domain had the pI value of 8-12 scope, it is just enough to 1.2M TCA or suitable acid that described solution for example contains 0.06M.

Preferably further realize that by the described cell wall material of heating in described solution bonded strengthens, although same, the accurate requirement of described heating does not need regulation.Heating for example generally can produce the required cell wall material with further enhanced binding ability in 5-25 minute in boiling temperature (100 ℃).Described material can wash easily and precipitate (for example by centrifugal) from described treatment soln, if desired, can store (for example by freezing) or lyophilize easily and be stored to further use.This cell wall material comprises spherical peptidoglycan microparticle basically, and it reflects size and the shape of the bacterium in its source.

One preferred embodiment in, this cell wall material derives from Lactococcus lactis, Bacterium lacticum, genus bacillus or mycobacterium.The cell walls of gram positive bacterium is by the peptidoglycan layer, protein, and the complex network of (fat) teichoic acid and other (modification) carbohydrate is formed.Generally, the chemical treatment cell wall material is used to remove cell-wall component, as protein, and (fat) teichoic acid and carbohydrate and produce the peptidoglycan (Morata de Ambrosini etc., 1998) of purifying.Sodium laurylsulfonate (SDS) is commonly used to remove deproteinize.Three chloric acid (TCA) known can be from the cell walls isolate special weeding of grease teichoic acid and carbohydrate.Phenol, methane amide and chloroform and methanol mixture are other organic solution that is used for improving the peptidoglycan purifying.

Here we have studied with the effect of the full cell of these and other chemicals pre-treatment gram positive bacterium to combination technology, and this provides the cell wall material of giving the bacterium ghost or the coming from described bacterium possibility with new characteristic, and need not import recombinant DNA.

One preferred embodiment in, the described cell wall material that the invention provides the binding ability with enhanced and AcmA anchor is in the purposes of a kind of composition shape of preparation, pharmaceutical composition for example, it has the proteinaceous substances that contains AcmA type anchor.Reactive group such as antigenic determinant, isodynamic enzyme, (strand) antibody, the polyhistidyl label, peptide, can be easy to be attached to cell wall material provided herein with other compound, this is by providing described group with AcmA type anchor and realizing with contacting of the cell wall material with enhanced binding ability.Other reactive group is fluorescin, luciferase, conjugated protein or peptide, or other material such as microbiotic, hormone, non-peptide antigenic determinant, carbohydrate, lipid acid, aromatoising substance and reporter molecule.

Another preferred embodiment in, the invention provides and use cell wall material provided herein to produce to be used for environment purpose, the biological adsorption agent of microbial catalyst and diagnostic tool or biofilter.For example, food, the use of immobilized biocatalyst in medicine and the chemical industry (enzyme or full microorganism cells) in the past in 10 years always in steady increase.Immobilized biological catalyst is generally more stable than their free form, is easy to handle, and the more important thing is that they can be recycled in the industrial engineering.At present, the immobilization of enzyme often needs conjugate enzyme to arrive the chemical step of insoluble upholder.Yet chemical treatment may have a negative impact to enzyme.Perhaps, enzyme is by joining in the glue and immobilization, and it has a significant disadvantages, and substrate is diffused into the program that slowed down in the glue.

An optional method provided herein is that the protein surface displaying on gram-positive cell or cell wall material provided by the invention is used for the effective immobilization of protein that has enzymic activity on a large scale.In Lactococcus lactis, proved the immobilization of the fused protein that contains the α-Dian Fenmei that is integrated in the AcmA protein anchor structure territory or β-Nei Xiananmei herein.The adding of AcmA anchor fused protein has caused heterologous protein to adhere at Lactococcus lactis and the stable of other gram positive bacterium surface.And then, to describe in the present invention, acid pre-treatment Lactococcus lactis and other gram-positive cell cause the high density surface of heterologous protein to be showed, and this is the prerequisite that commercial run is used.And, carrier, gram-positive cell for example can be obtained by high yield and is non-reorganization.Thereby the production immobilized enzyme that method provided herein can be economic also makes AcmA protein anchor become the useful approach of enzyme surface display on gram-positive cell.

The representative industrial application of another immobilized enzyme is to pass through the enzymatic glucose isomerization of glucose isomerase in high-fructose corn syrup is produced.Can make this process economy feasible by this enzyme of immobilization.As providing, improve the throughput that in the organic solution stability of epoxide hydrolase increases this enzyme to microorganism cells or cell wall material herein by immobilization.Immobilized enzyme also can be used to handle waste water or industrial sewage.For example, handle the industrial sewage that contains the low value chemicals that produces in the process of synthetic commodity chemical thing epoxy chloropropane and propylene oxide.Immobilized haloalkane dehalogenase (haloalkane dehalogenase) is used to these low value products are looped back production process.

The present invention also provides and has been used to prepare the chimeric of composition of the present invention and heterozygosis AcmA type anchor, and it has new binding characteristic.Based on the pI of AcmA type anchor, they can be divided into two groups of heterocomplexs (table 3): pI and be higher than 8 but organize greatly and less one group with relative low pI (＜5) less than 10 one.First-selected heterozygosis AcmA type anchor is to have the AcmA type structural domain of at least one pI that high relatively calculated value is arranged and the AcmA type structural domain of a pI with relatively low calculated value.The ground tackle of gained has the pI of intermediate computations value, and it for example expects when high pH that it is useful discharging the bonded proteinaceous substances, and this for example offers the composition that comprises the cell wall material among the present invention with the chimeric anchor among the present invention.This composition can pass through the stomach of low relatively pH and its anchor binding reactive group of easier release when arriving intestines.

Therefore the present invention provides the proteinaceous substances that comprises AcmA cell wall-bound structural domain or its homologue or its functional derivatives, wherein said structural domain is at least two the different AcmA type cell wall-bound structural domains or the heterozygote of its homologue or its functional derivatives.Preferably, the invention provides the proteinaceous substances that comprises AcmA cell wall-bound structural domain or its homologue or its functional derivatives, wherein said structural domain is the heterozygote of at least two different AcmA tumor-necrosis factor glycoproteinss, and wherein said heterozygote has and is lower than 10 pI calculated value.For example, the invention provides the hybrid protein anchor of forming by the D1 tumor-necrosis factor glycoproteins of the A1 of AcmA and A2 tumor-necrosis factor glycoproteins and AcmD.Preferred this hybrid structure territory comprises at least one an AcmA type structural domain with high relatively calculated value pI and a structural domain that the pI of relative low calculated value is arranged.To the structural domain of high relatively pI is arranged, structural domain or the function equivalent of preferably selecting at least one to derive from the AcmA type structural domain of Lactococcus lactis cytohydrolist AcmA, but known many other structural domains that high pI is arranged, example is as shown in table 3.To the structural domain of relatively low pI is arranged, structural domain or the function equivalent of preferably selecting at least one to derive from the AcmA type structural domain of Lactococcus lactis cytohydrolist AcmD, but known many other structural domains that low relatively pI is arranged, example is as shown in table 3.The invention provides the proteinaceous substances that comprises the hybrid structure territory, near wherein at least two amino acid chains were positioned at mutually, each corresponding structural domain tumor-necrosis factor glycoproteins may be by one or more amino-acid residues separately.Described amino acid chain or repetition may be separated by short range, for example 3-6 to 10-15 amino acid interval, or moderate distance 15-100 amino acid interval, or 100 amino-acid residues of length distance (〉 are at interval).

One preferred embodiment in, the invention provides proteinaceous substances with heterozygosis AcmA structural domain, comprised reactive group more than it.For example, the invention provides the proteinaceous substances that comprises reactive group, group comprises as antigenic determinant, isodynamic enzyme, (strand) antibody or its fragment, polyhistidyl label, fluorescin, luciferase, conjugated protein or peptide, or other material such as microbiotic, hormone, non-peptide antigenic determinant, carbohydrate, lipid acid, aromatoising substance, inorganic particle such as latex, or reporter molecule and AcmA cell wall-bound structural domain or its homologue or its functional deriv, wherein said structural domain is the heterozygote of at least two different AcmA cell wall-bound structural domains or its homologue or its functional deriv, (being also referred to as heterozygosis AcmA structural domain herein) is useful when the heterology surface display, and it reacts with large-scale microbial cell wall fraction widely.

For example, the invention provides a kind of material, proteinic half families of wherein said reactive group right and wrong (moiety) for example are selected from microbiotic, hormone, aromatoising substance, inorganic particle, and reporter molecule.Described material is by for example microbiotic, and as penicillin or tsiklomitsin, but other multiple microbiotic also can use, or hormone, and as the cholesterol hormone, or other any compound is attached to binding domains provided by the invention and makes up.Therefore this can mark or the mark binding domains in conjunction with finishing by the multiple technology of knowing in this area.Preferred embodiment be binding domains in conjunction with a reporter molecule, as fluorescent nano particle, FITC or HRPO can produce the instrument that is used for diagnositc analysis in view of the above and detect the microorganism with peptidoglycan.Similar, having microbiotic bonded binding domains can be used in the body parenteral for example is administered into human or animal's blood flow or externally in conjunction with this microorganism of peptidoglycan is arranged, thereby improve described organism antibiotic concentration on every side, thereby kill this organism by the microbiotic effect.

The invention provides a kind of material, wherein said reactive group is protein half family, for example is selected from antigenic determinant, enzyme, (strand) antibody or its fragment, polyhistidyl label, fluorescin, conjugated protein or peptide.For example, the invention provides a protein, it comprises as the protein of reactive group or (many) peptides.And, the invention provides a nucleic acid molecule, its protein provided by the invention of encoding.This nucleic acid molecule (is list or distrand DNA, RNA or DNA/RNA) comprise the nucleotide sequence of special coding heterozygosis binding domains at least, but also comprise the nucleotide sequence of special encoding reaction group polypeptide, but can also comprise other nucleotide sequence in addition, coded signal peptide for example, or for example comprise promotor and/or regulate nucleotide sequence.The present invention also provides the carrier that comprises nucleic acid molecule, this nucleic acid molecule encoding proteinaceous substances provided by the invention.The present invention also provides the carrier that comprises nucleic acid molecule, this nucleic acid molecule encoding proteinaceous substances provided by the invention.This carrier can for example be a plasmid, phage, or virus, and can use the ordinary method of nucleic acid provided by the invention and this area to make up.The example of this carrier can find at the experimental section of this specification sheets, and other example is a baculovirus vector, or corresponding vector virus, can be in (insect) cell expressing or production by its protein provided by the invention.The present invention also provides the host cell or the expression system of nucleic acid molecule of the present invention or carrier.The host cell of this marking protein provided by the invention self is a proteinic attached microbial provided by the invention.This host cell or expression system can for example be Gram-positive or gram negative bacterium, or yeast cell or insect cell or plant or mammalian cell, or or even acellular expression system such as reticulocyte lysate, but and the nucleic acid that provides of the application of the invention now or carrier and the ordinary skill in the art make up or obtain.The example of this host cell or expression system can find at the experimental section of this specification sheets, but nucleic acid that other example the application of the invention provides or carrier and the ordinary skill in the art obtain.

In a preferred embodiment, the invention provides one and comprise the described pharmaceutical composition that has the enhanced binding ability and combine immunogenic cell wall material, this immunogen is useful to the inoculation purpose, as vaccine.Especially, the invention provides the vaccine that can cause pathogenic agent such as malaria immunity, it is carrying out each stage of life round-robin in cell rather than in blood.

The vaccine that is transported to mucomembranous surface is preferably vaccinate sometimes.They can be easier and safer administration.To mucosal vaccination, Lactococcus lactis deutero-cell wall material can be convenient to use, in view of this bacterium is that expection intestines source property and common does not have tangible unfavorable immune response.Yet, vaccine provided by the invention is used in per injection,, consider to come from the cell wall material of mycobacterium in view of the useful auxiliary property of mycobacterium cell walls preparation, with offered vaccine and carried proteinaceous substances as the essential immunogenic determinant of vaccine, this is useful.

Especially when considering to use method provided by the invention, cell wall material of the present invention be to the removal of small part unnecessary immunogen, this immunogen can cause the immune response of unwanted antibacterium cell-wall component, and the immunoreactive danger that this vaccine carrier produces unwanted anti-cell wall fraction has reduced.

Description of drawings

Fig. 1. coding is reported the synoptic diagram of the plasmid pNG3041 of protein MSA2::cA, is to use the former and sequence former (PrtP.sspro) of protein of Lactococcus lactis PrtP signal after the MSA2::cA secretion: the nisin inductive promotor of Pnis:nisA gene.T: transcription terminator.CmR: chloramphenicol resistance gene.RepC and repA: the gene that relates to plasmid replication.

Fig. 2. combined outside the fluorescent microscope image of bacterial cell of MSA2::cA.A. lactobacillus curvatus (Lb.curvatis), lactobacillus sake (Lb.sake) and Lactococcus lactis cell do not have pre-treatment before combination.B. the Lactococcus lactis cell is being used the TCA pre-treatment in conjunction with preceding.Light colour zone indication report protein MSA2::cA binding site.TCA of no use pretreated (A) and obvious with (B) difference of the pretreated Lactococcus lactis cell of TCA.

Fig. 3. the Lactococcus lactis cell that chemicals are handled, wash cell subsequently, hatch with MSA2::cA again and carry out bonded western trace.Do not have bonded MSA2::cA to be washed off.This figure shows that MSA2::cA combines the pretreated cell of chemicals, uses the specific antibody of MSA2 to detect.Different pre-treatment indicate above swimming lane.MSA2::cA is that the protein of production cell generation is former: proMSA2::cA, some these protein are present in and are used for combination and its also combination (arrow indication) in the substratum.Produce the membrane bound protein enzyme of cell, HtrA cuts sequence and originates in living sophisticated MSA2::cA, and it is in conjunction with pretreated cell (asterisk indication).HtrA also cuts the tumor-necrosis factor glycoproteins of cA anchor.Because three repetitions are arranged, the MSA2 protein of several sizes is present in the producer's the substratum.As long as repeat to exist more than one, just combination can take place.Double asterisk points to one or two MSA2::cA that repeats to be cut off.M: molecular weight standard (molecular weight is indicated at the left side margin).Two traces are different on strength of signal.As a reference, they comprise the same pretreated sample of TCA.Not being both of strength of signal because the dyeing time difference.Can see clearly that TCA and other sour pre-treatment are to the remarkable influence of being combined with of subsequently MSA2::cA.

The pretreated conclusion of all chemicals is summarized in table 1.

Fig. 4. the SDS-PAGE glue of examining Macchiavello's staining of the Lactococcus lactis cell of Chemical Pretreatment.

Pre-treatment:

1, is untreated

2、HCl

3、H ₂SO ₄

4、HAc

5、TFA

6、TCA

Significantly use HCl, H ₂SO ₄, TFA or TCA handle cell and removed a large amount of protein from cells.

Fig. 5. with the western trace of different TCA concentration pre-treatment Lactococcus lactis cells and combined outside MSA2::cA.Arrow and asterisk: see Fig. 3.

Pre-treatment:

1, do not handle with TCA.

2、1％TCA。

3、5％TCA。

4、10％TCA。

5、20％TCA。

The rising of the amount of TCA when showing with pre-treatment among the figure, the combination of MSA2::cA also raises.

Fig. 6 .cA repeats and the contrast of cD repeating sequences.The amino acid consistent with consensus sequence that the figure bottom shows has added underscore.Residue the same in two repetitions pointed out in asterisk.

Fig. 7. combining of when not having the TCA pre-treatment different anchor fused proteins and Lactococcus lactis arranged.Principle is the same with Fig. 3.The different form processings of MSA2 syzygy have produced many bands of a swimming lane.

1, untreated Lactococcus lactis+MSA2::cA

2, untreated Lactococcus lactis+MSA2::cD

3, untreated Lactococcus lactis+MSA2

4, the pretreated Lactococcus lactis+MSA2::cA of TCA

5, the pretreated Lactococcus lactis+MSA2::cD of TCA

6, the pretreated Lactococcus lactis+MSA2 of TCA

Influence is significantly (to compare swimming lane 1 and 4) to the MSA2::cA bonded in the TCA pre-treatment.As if there are some to improve to MSA2::cD, and do not have the MSA2 of anchor not improve.Exist signal instruction MSA2 self to have to the MSA2 that does not have anchor to the faint avidity of bacteria cell wall.Yet, can not detect MSA2::cD or MSA2 in conjunction with pretreated cell (seeing text) with fluorescence and electron microscope.This difference is likely because the difference of these sensitivity.

The fluorescent microscope photo that pretreated Lactococcus lactis cell of Fig. 8 .TCA and MSA2::cA or MSA2::cD are hatched.Light areas indication report fused protein bonded site.Combination takes place in only tangible and MSA2::cA, and discord MSA2::cD.

Fig. 9. the electron micrograph that Lactococcus lactis cell and different MS A2 construct are hatched.The stain representative combines the proteinic position of MSA2 (fusion).

A. unpretreated cell and MSA2::cA are hatched

Pretreated cell of B.TCA and MSA2::cA are hatched

Pretreated cell of C.TCA and MSA2::cD are hatched

Pretreated cell of D.TCA and MSA2 are hatched

Significant in conjunction with (stain) only in pretreated cell of TCA and MSA2::cA (B) as seen.

Figure 10. different anchor fused proteins is with process and do not pass through combining of the pretreated subtilis of TCA.This figure is the western trace similar with 7 with Fig. 3.

1, unpretreated cell+MSA2::cA

2, unpretreated cell+MSA2::cD

3, unpretreated cell+MSA2

4, the pretreated cell+MSA2::cA of TCA

5, the pretreated cell+MSA2::cD of TCA

6, the pretreated cell+MSA2 of TCA

7, pre-treatment subtilis (negative control) not

From this figure, obviously the TCA pre-treatment has improved the combination of MSA2::cA (relatively swimming lane 1 and 4), and is similar with Lactococcus lactis.To MSA2::cD with there is not the MSA2 of anchor, only observe some background combinations.

Figure 11 .MSA2::cA is in conjunction with process and the fluorescent microscope photo that does not pass through the pretreated lactobacterium casei of TCA.The light areas representative combines MSA2::cA.Significantly to lactobacterium casei, the TCA pre-treatment has improved the combination of MSA2::cA.

Figure 12 .MSA2::cA and MSA2::cD are in conjunction with the fluorescent microscope photo of the pretreated M. smegmatics of TCA.The light areas representative combines the MSA2 fused protein.Obviously as seen has only the MSA2::cA combination in this case.

Figure 13. combined outside the Lactococcus lactis of MSA2::cA handle or be stored in western trace under the different condition with LiCl.Band in the different swimming lanes is represented the amount of the MSA2::cA of the cell of handling in conjunction with TCA.Arrow and asterisk such as Fig. 3.

1, standard

2, unpretreated Lactococcus lactis does not have and MSA2::cA is hatched

3, unpretreated Lactococcus lactis and MSA2::cA are hatched

4, pretreated Lactococcus lactis and the MSA2::cA of TCA hatched

5, pretreated Lactococcus lactis and the MSA2::cA of TCA hatched, and washes with 8M LiCl subsequently

6, pretreated Lactococcus lactis and the MSA2::cA of TCA hatched, and 4 ℃ are stored in 3 weeks in the water subsequently

7, pretreated Lactococcus lactis and the MSA2::cA of TCA hatched, and ℃ is stored in 3 weeks in 10% glycerine subsequently-80

8, pretreated Lactococcus lactis and the MSA2::cA of TCA hatched, and ℃ is stored in 3 weeks in the water subsequently-80

This figure shows that once more the TCA pre-treatment is to the favourable influence (relatively swimming lane 3 and 4) of MSA2::cA in conjunction with the Lactococcus lactis cell.Also obviously visible with 8M LiCl wash with 4 ℃ be stored in the water and 3 weeks the MSA2::cA that combines had only minor impact ( comparison swimming lane 4 and 5 and 6).Be stored in-80 ℃ of not influences of MSA2::cA (relatively swimming lane 4 and 7 and 8) to combining.

Figure 14. (A) MSA2::cA and (B) the fluorescent microscope photo of MSA2::cP surface expression in recombinant strain NZ9000 (pNG3041) and NZ9000 (pNG3043) respectively.(C) in conjunction with the MSA2::cA of the pretreated Lactococcus lactis cell of TCA.The position of light areas instruct MS A2 fused protein.The recombinant strain of producing MSA2::cA only has protein (A) in some special site surface.The recombinant strain of producing MSA2::cP has more protein (B) on the organized surface in some zones, the surface of the pretreated non-recombination lactic acid galactococcus of the TCA of the MSA2::cA that combines has obviously been covered (C) fully by protein.

Figure 15. the western trace of Lactococcus lactis holoprotein extract and rabbit immune serum reaction.Serum dilution 1:100.

0: preimmune serum.2 and 3: be respectively the serum after secondary and three immunity.

A1: with NZ9000 Δ acmA[pNG3041] the subcutaneous immunize rabbit of cell (recombinant strain, MSA2::cA surface anchoring)

B1: with the subcutaneous immunize rabbit of NZ9000 Δ acmA (negative control)

C2: with NZ9000 Δ acmA[pNG3043] cell (recombinant strain, MSA2::cP surface anchoring) oral immunisation rabbit

E1: with NZ9000 Δ acmA (non-recombinant strain, MSA2::cA surface anchoring) the oral immunisation rabbit of the pretreated MSA2::cA of combined outside of TCA

Colored zone in the swimming lane means the rabbit anti-serum reaction of those Lactococcus lactis protein and indication.The pretreated bacterial strain that has combined MSA2::cA (E1) of clearly visible nonrecombinant TCA has caused the reaction to Lactococcus lactis protein minimum, means that reaction to carrier has reduced and the reaction of malaria antigen is not had negative impact (seeing Table 2).

Structural domain schematically illustrates among Figure 16 .AcmA and the AcmD.SS: signal sequence.Two enzymes all have the cell wall-bound structural domain, and it repeats to form by 3, is expressed as A1, and 2,3 and D1,2,3 (these repeating sequences comparisons provide in Fig. 6).In addition, provided the example of a hybrid protein anchor of table 5 description.

Figure 17 .western trace shows that the pH supernatant is to MSA2::cD and the influence of the pretreated Lactococcus lactis cell of TCA bonded.As preceding, the western trace has shown the amount of the MSA2::cD that is combined by cell.In addition, in conjunction with after the not combined amount of staying the MSA2::cD in the substratum also shown.The desired location of arrow indication pro-MSA2::cD, the position of sophisticated MSA2::cD indicated in asterisk.

1, in conjunction with the time pH be 6.2, cell

2, in conjunction with the time pH be 6.2, in conjunction with after supernatant

3, in conjunction with the time pH be 3.2, cell

4, in conjunction with the time pH be 3.2, in conjunction with after supernatant

5, positive control: Lactococcus lactis, the pretreated MSA2::cA that when pH6.2, combined of TCA

Clearly visible MSA2::cD when pH3.2 than bonded when the pH6.2 good (relatively swimming lane 1 and 3).

Figure 18. substratum supernatant (S) and have the western trace of the ghost (G) of bonded protein anchor after specified pH is in conjunction with the ghost cell.Swimming lane 1 and 2 is in the pH3 combination; Swimming lane 3 and 4 is in the pH5 combination; Swimming lane 5 and 6 is in the pH7 combination.This figure is presented at pH5 and still has suitable combination.Show almost there is not combination at the natural cD anchor of this pH (D1D2D3).Add A3 and repeat, it has high pI value, has caused when pH5 in conjunction with rising.

Figure 19. immune progress.Mouse is repeated at 14 and 28 days beginning immunity in first day.Giving fatal streptococcus pneumoniae nasal cavity the last time after 14 of oral immunisation days attacks.S.c.: subcutaneous immunity.

Figure 20. serum antibody response.Average resisting-the PpmA serum antibody titer.OV: oral immunisation; IN: the interior immunity of nose; SC: subcutaneous immunity.Fu Shi PpmA: solubility PpmA and the common subcutaneous injection of Fu Shi Freund's complete adjuvant.Obtained high titre with subcutaneous injection ghost-PpmA::cA in the nose.

Figure 21. the survival time.The vaccinated mouse in oral cavity is attacked with the streptococcus pneumoniae of lethal dose.Dead in 72 hours with the mouse of solubility PpmA or ghost vaccine separately.Have 40% after attack, to survive with ghost-PpmA::cA mice immunized, thereby they have been subjected to the inoculation protection.

Figure 22. be table 1.

Figure 23. be table 2.

Figure 24. be table 3.

Figure 25. be table 4.

Figure 26. be table 5.

Embodiment

Embodiment 1

Acid pre-treatment gram positive bacterium strengthens the combination of AcmA protein anchor syzygy

Material and method

Bacterial strain and growth conditions.Use Lactococcus lactis MG1363 strain (Gasson1983) or derivatives thereof such as MG1363 Δ acmA (Buist etc., 1995) or NZ9000 Δ acmA as report fused protein bonded acceptor, yet, use carries the NZ9000 (Kuipers etc., 1997) of a report plasmid as the production strain.The Lactococcus lactis strain in adding M17 meat soup (Oxoid) standard medium of 0.5% glucose, 30 ℃ of cultivations.In the time of suitable, adding final concentration in the M17 substratum is the paraxin of 5 μ g/ml.The substratum supernatant that contains nisin that produces Lactococcus lactis NZ9700 strain is added in the logarithmic growth bacterium in mid-term, and 2 hours abduction deliverings are retouched (1997) as institutes such as Kuipers.Lactobacterium casei ATCC393 strain in MRS meat soup (Oxoid) standard medium, 30 ℃ of growths.M. smegmatics ATCC700084 grows in Middlebrook substratum (Oxoid), and 37 ℃, logical carbon dioxide gas.Subtilis 168 is (every liter: 10g Trypsin matter peptone, 5g yeast extract, 5g sodium-chlor, pH7.4) middle growth, 37 ℃, logical carbon dioxide gas of TY meat soup.

The structure of report plasmid.3 merozoite surface antigen 2 (MSA2) (Ramasamy etc., 1999) conduct report ankyrin matter that repeat the plasmodium 3D7 strain of AcmA (MSA2::cA) sequence have been merged in use.This report protein is encoded by plasmid pNG3041, and this plasmid is based on the derivable expression vector pNZ8048 of nisin (Kuipers etc., 1997) and comprise the multiple clone site of clone's heterozygosis reporter gene of a modification.In the PrtP signal of Lactococcus lactis 5 ' end and 3 ' the terminal syzygy that forms this reporter of forward sequence and AcmA protein anchor sequence.Be included in MSA2 gene order in the construct and correspond to 61 to 708 Nucleotide that are numbered A06129 among the Genbank.Use primer MSA2.1 (5 '-ACCATGGCAAAAAATGAAAGTAAATATAGC) and MSA2.4 (5 ' CGGTCTCTAGCTTATAAGCTTAGAATTCGGGATGTTGCTGCTCCACAG) the MSA2 gene that increases, primer comprises the restriction enzyme enzyme recognition site mark (underscore) that is used to clone.Use primer PrtP.sspro.fw (5 '-CCGTCTCCCATGCAAAGGAAAAAAGAAAGGGC) and PrtPsspro.rev (AAAAAAAGCTTGAATTCCCATGGCAGTCGGATAATAAACTTTCGCC) clone PrtP signal and forward sequence (1206 to 1766 Nucleotide, Kok etc., 1988).Underscore is represented the restriction site that is used to clone.Can obtain AcmA protein anchorage because of fragment (833to1875 Nucleotide) from plasmid pAL01 (Buist etc., 1995) subclone PvuII-HindIII fragment.Specification sheets according to the Roche of provider uses restriction enzyme and the true PCR polysaccharase of expansion de-luxe compartment.Last expression vector called after pNG3041 (Fig. 1).

A terminator codon is incorporated into construct called after pNG304 after the MSA2 sequence in the pNG3041.Therefore, use this construct excretory protein identical with the protein in pNG3041 plasmid source, just it does not contain AcmA ankyrin matter.In the binding analysis experiment, it is as negative control.In addition, make up the carrier of an AcmA protein anchor and another protein anchor exchange.For this reason, use primer pACMB2 (5 ' CGCAAGCTTCTGCAGAGCTCTTAGATTCTAATTGTTTGTCCTGG) and pACMB3 (5 '-CGGAATTCAAGGAGGAGAAATATCAGGAGG) clone the cell wall-bound structural domain (Genbank retrieve sequence number be 1796 to 2371 Nucleotide of AE006288) of the Lactococcus lactis AcmD (Bolotin etc., 2001) that infers.Generate plasmid pNG3042, between MSA2 and AcmD (MSA2::cD) ankyrin matter, comprise a framework endomixis, only different on the gene fragment of the protein anchor of coding plasmid pNG3041.

Pretreatment cell and in conjunction with condition.Following conventional 10%TCA (0.6M) the Chemical Pretreatment Lactococcus lactis NZ9000 that uses

: 0.5ml stable growth phase culture centrifugation cell, wash cell once with the desalination of 2 times of volumes.With 1 times of volume 10%TCA solution re-suspended cell, reaction tubes is put into boiling water hatched 15 minutes.Subsequently, with 2 times of volume PBS (58Mm Na ₂HPO ₄2H ₂O, 17mM NaH ₂PO ₄H ₂O, 68mM NaCl; PH7.2) wash cell once, wash cell three times with the desalination of 2 times of volumes.Zhi Bei cell can be directly used in conjunction with experiment or store standby (section as follows) like this.Use following pharmaceutical chemicals and condition to detect of the influence of different chemical medicine: acetate (HAc), hydrochloric acid (HCl), sulfuric acid (H to the binding ability of Lactococcus lactis cell and the fusion of AcmA-type protein anchor ₂SO ₄), TCA, three fluoric acids (TFA), a chloric acid (MCA), all reagent final concentrations are 0.6M, hatch in boiling water 15 minutes.SDS, the working concentration of dimethyl formamide (DMF) and dimethyl sulfoxide (DMSO) (DMSO) is 10%, and hatches in boiling water after the SDS pre-treatment 15 minutes, DMF and DMSO handle the back incubated at room 15 minutes.With phenol (the Tris damping fluid is saturated) pretreatment cell, hatched 15 minutes for 55 ℃.Other chemical reagent are hatched with the temperature of back: 4M Guanidinium hydrochloride (GnHCl), 37% formaldehyde, chloroform: methyl alcohol (CHCL ₃: CH ₃OH[2:1]) and 0.1% clorox (NaOCl).In addition, analyze with 37 ℃ of 25mM dithiothreitol (DTT) (DTT), hatched in 30 minutes and normal hexane (100%) pretreatment cell.Also detected influence with N,O-Diacetylmuramidase enzymatic pretreatment cell.For this reason, cell is resuspended in the damping fluid of N,O-Diacetylmuramidase (2mg/ml) in (20% sucrose, 10mM TrispH8.1,10m MEDTA, 50mM NaCl), hatches 15 minutes for 55 ℃ then.After chemical reagent and the enzymatic pre-treatment, the step of washing cell is with identical after TCA handles cell.

According to description, with TCA pre-treatment subtilis, lactobacterium casei and M. smegmatics to Lactococcus lactis.Contain MSA2::cA, MSA2::cD or the acellular medium supernatant of MSA2 that do not have an anchor are with 4 times of amounts and (pre-treatment) cell incubated at room 10 minutes (for example 0.5ml culturing cell and 2.0ml culture supernatant are hatched).In conjunction with after, centrifugation cell, resuspended with 2 times of volume desalinations washing cells 2 times with SDS sex change damping fluid, 98 ℃ of heating 5 minutes, and carry out SDS-PAGE electrophoresis and immunoblotting assay thereafter.

Storage requirement: contain MSA2::cA, the acellular supernatant liquor of MSA2::cD or MSA2 before combination ,-20 ℃ of preservations, contains or does not contain 10% glycerine.Before the pretreated Lactococcus lactis cell combination of TCA ,-80 ℃ frozen in 10% glycerine.The pretreated Lactococcus lactis cell that has combined MSA2::cA of TCA, 4 ℃ or-80 ℃ of storages contain or do not contain 10% glycerine.The cell that is stored in 10% glycerine is being washed once in conjunction with 1 times of desalination of preceding usefulness.

With TCA pretreated in conjunction with or not in conjunction with the Lactococcus lactis cell precipitation (in de-mineralized water) of MSA2::cA by putting into tubule and liquid nitrogen contact refrigeration, subsequently with lyophilization removal moisture.Other method, the cell precipitation that does not freeze in conjunction with preceding in 30 ℃ of vacuum-dryings 2 hours.

The western Blot experiment.Detect MSA2 protein, the cell precipitation of 500 μ l cultures is resuspended with 50 μ 1SDS sex change damping fluids.Concentrate (Sauve etc., 1995) acellular substratum supernatants (1ml) with phenol-ether precipitation, vacuum-drying also is resuspended in the 50 μ l SDS sex change damping fluids.Use standard SDS-PAGE technology isolated protein.After the separation, protein is forwarded to (Roche) on the pvdf membrane by electricity.In immunoblot experiment, with 1:10, the anti-rabbit igg-coupling alkaline phosphatase (Roche) of the rabbit MSA2 specific antisera (Ramasamy etc., 1999) of 000 dilution and 1:5000 dilution adopts standard step to detect MSA2 protein.

Fluorescence microscopy.100ttl cell suspension and MSA2::cA, MSA2::cD or MSA2 fused protein are hatched, and be with desalination washing 2 times, resuspended with the PBS of the MSA2-specificity rabbit anti-serum that contains 1%BSA and 1:200 dilution of equal volume.Incubated at room 20 minutes is washed cell 3 times with 2 times of volume PBS.Subsequently, cell was hatched 20 minutes with the PBS of the goat anti-rabbit immunoglobulin matter G (molecular probe) that contains 1%BSA and 1:100 dilution Oregon Green Marker of 1 times of volume.Wash cell 1 time and 2 times of volume desalinations washing cell 2 times with 2 times of volume PBS, with 100 μ l de-mineralized water re-suspended cells.The cell suspension of getting 10 μ l titres is added drop-wise on the Polysin microslide (Menzel-Glaser), and is air-dry, and fluorescent microscope (Zeiss) detects down.

The electron microscope method.Press as above method, with pretreated Lactococcus lactis cell of TCA and MSA2::cA, MSA2::cD or MSA2 are hatched, and collect and wash cell.With a large amount of cells of the fixing preparation of glutaraldehyde, finish immune-gold labeled experiment on the net at polyethylene-carbon tweezer, use the 15nm goat anti-rabbit igg gold standard molecular weight (Amersham) of Auroprobe.Dilute the primary antibody of anti-MSA2 with PBS-glycine buffer 1:1000.Subsequently, the sample of mark dyes (the W/V aqueous solution) with 0.1% uranyl acetate, detects at 100kV with Philip CM10 photo-emission electron microscopy.

Use different chemical reagent pre-treatment Lactococcus lactis cell.Use the fused protein of the cA protein anchor of Lactococcus lactis AcmA in conjunction with extensively various gram positive bacterium.But in this bacterioid, existing in conjunction with quantity of fused protein is different greatly.We observe, and the combination of MSA2::cA has covered some lactic-acid bacteria cells surfaces fully, yet other bacterium such as Lactococcus lactis show it only is that limited position is in conjunction with (figure .2A).A kind of explanation of this phenomenon may be, though other explanation is also possible, the cell walls of some bacterial species comprises interference cA anchor bonded composition.Chemical reagent such as SDS, TCA, chloroform/methanol and other reagent can be removed these compositions (Morata de Ambrosini etc., 1998) from the isolated bacterial cell walls.Therefore, we studied after the cell walls cell wall constituent of removing the full cell of Lactococcus lactis to the influence of report fused protein MSA2::cA bonded.According to the description in the materials and methods, use different chemical reagent or N,O-Diacetylmuramidase pre-treatment Lactococcus lactis cell.Fig. 3 shows that pre-treatment is in conjunction with the typical immunoblot experiment result behind the full cell of MSA2::cA.Sophisticated MSA2::cA swimming is to the position (asterisk is pointed out) of 75kDa protein size.Arrow represents still to have the MSA2::cA of PrtP forward sequence.Double asterisk represents to remove the MSA2::cA of 1-2 tumor-necrosis factor glycoproteins.The protein enzyme HtrA of a cytolemma grappling shows and relates to processing precursor protein matter and remove tumor-necrosis factor glycoproteins from AcmA (Poquet etc., 2000).Can reach a conclusion from Fig. 3, use TCA (swimming lane 8 and 16 is same sample, makes the strength of signal difference because the dyeing development time is different), HCl, H ₂SO ₄With the HAc pretreatment cell, can substantially improve the combination (comparing) of MSA2::cA subsequently with the negative control of swimming lane 15.Other acid are experimentized, and TFA has identical (not shown) as a result with MCA.Phenol, Guanidinium hydrochloride shows after methane amide and the chloroform/methanol pre-treatment in conjunction with improving and relaxes (being respectively swimming lane 4,5,6,7).Use SDS, DMF after DMSO and the DTT pre-treatment, can be observed in conjunction with improving a little.All results have been summed up for 1 li at form.We reach a conclusion, sour TCA, TFA, MCA, HCl, H ₂SO ₄With Hac pre-treatment Lactococcus lactis cell, can the most effective cA of improvement anchor fused protein and the combining of lactic-acid bacteria cells.Known acid such as TCA can remove (fat) teichoic acid from cell walls.We analyze also whether protein is removed in these acid treatment meetings from cell walls.Fig. 4 show cracking pretreatment cell gel examine Macchiavello's staining.Except most of acid treatment of HAc can be removed amounts of protein from the Lactococcus lactis cell.(known it cell wall protein can be removed) shows that the MSA2::cA combination only has a small amount of (Fig. 3 that improves because HAc can only remove the protein (relatively swimming lane 1 and 4) of trace and SDS pre-treatment, swimming lane 1), we reach a conclusion, and the protein of removing in the cell walls is not important to the combination that improves cA anchor syzygy.Be likely that lipoteichoicacid or carbohydrate have occupied the site on the Lactococcus lactis cell walls and disturbed effective combination.Perhaps, sour pre-treatment causes peptidoglycan chain compactness to change, thereby makes the easier acquisition of cA binding site.

In other all experiments, use the TCA pre-treatment.Then, the best TCA concentration of our decisions when the boiling step.To 1%, 5%, 10% and 20%TCA experimentize.Though the pre-treatment of 1%TCA shows that the combination of MSA2::cA has had the further improvement of pre-treatment demonstration of significant improvement and 5%TCA, does not observe further and improves when concentration is higher than 10% (Fig. 5).Therefore in the boiling step, we select 10%TCA as all standard step of further testing.

Subsequently, we analyze the binding characteristic of homologue cD when the standard of use TCA pre-treatment step of the Lactococcus lactis cA in the MSA2 syzygy.2/3 AcmD tumor-necrosis factor glycoproteins and the height homology of AcmA, Fig. 6 provides sequence relatively.In these experiments, comprise a negative control, the secretion MSA2 in no anchor structure territory.In the western Blot experiment, influence is significant (Fig. 7, relatively swimming lane 1 and 4) to the MSA2::cA bonded in the TCA pre-treatment.This same fluorescent microscope (Fig. 2, relatively Lactococcus lactis of A and B of using; Fig. 8) and electron microscope (Fig. 9, relatively A and B) study.Do not rely on the technology of use, can clearly detect the TCA pre-treatment influences the MSA2::cA bonded.In immunoblot experiment, MSA2::cD with without combining of the pretreated Lactococcus lactis cell of TCA very low (Fig. 7, swimming lane 2), and do not detect (Fig. 9 A) during with fluorescent microscope and electron microscope.In immunoblot experiment, the TCA pre-treatment only has slight influence (Fig. 7, swimming lane 5) for the MSA2::cD strength of signal.Simultaneously, fluorescent microscope is not observed the MSA2::cD specific signals (Fig. 8) relevant with pretreatment cell and electron microscope is only observed low-level mark rate (Fig. 9 C).Surprisingly, in without TCA pre-treatment and the pretreated Lactococcus lactis cell of TCA, observe some cell coherent signals (Fig. 7 is respectively a swimming lane 3 and 6) for the MSA2 in no anchor structure territory.But as for MSA2::cD, fluorescent microscope is not seen, and electron microscope is only found a spot of marking signal (Fig. 9 D).In a word, we reach a conclusion: (i) in immunoblot experiment, can detected report protein MSA2 and bacteria cell wall have low avidity; (ii) cA anchor structure territory differential stimulus report syzygy and non-pretreatment cell combines; (iii) Chemical Pretreatment is particularly sour, has strengthened this combination; (iv) under the condition of using, cD anchor structure territory does not promote the combination of fused protein.

The fluorescence of TCA pre-treatment Lactococcus lactis cell and electronic microscope image (figure .2,8 and 9) show that clearly pre-treatment can keep the cell integrity.Therefore but cell is no longer survived (adherent rate is 0) and is considered to the spherical peptidoglycan microsome (ghost cell) of inertia of the about 1 μ m of diameter.

In conjunction with other gram-positive microorganisms.Analyzed MSA2::cA, the MSA2 and the gram positive bacterium subtilis in MSA2::cD and no anchor structure territory, the combination of lactobacterium casei and M. smegmatics.Figure 10 has shown no TCA of summary and the pretreated bacillus subtilis mycetocyte of TCA bonded immunoblot experiment.As for Lactococcus lactis, can be observed the significantly increase that is combined with to MSA2::cA.Under the fluorescent microscope in unpretreated bacillus subtilis mycetocyte the visible specific signal of MSA::cA, but the pretreated cell of TCA has a signal (not shown) of improving greatly.By fluorescence microscope, can not prove the (not shown) that combines of MSA2::cD and MSA2 and not pre-treatment or TCA pretreatment cell.

In lactobacterium casei and M. smegmatics, obtain similar result.Figure 11 shows that MSA2::cA and the pretreated lactobacterium casei cell of TCA bonded improve.Do not detect the fluorescent signal (not shown) for MSA2::cD and MSA2.The TCA pre-treatment of M. smegmatics also has favourable influence to the combination of MSA2::cA, yet does not observe the combination (Figure 12) of MSA2::cD or MSA2.

In a word, we reach a conclusion, and sour pre-treatment as TCA, can improve combining of cA ankyrin matter syzygy and gram positive bacterium cell surface.

Bonding force and storage requirement.Analyze the bonding force of MSA2::cA and the pretreated Lactococcus lactis cell of TCA, handle with LiCl in conjunction with the back.LiCl is commonly used to remove the protein of bacteria cell wall.From Figure 13 immunoblot experiment, can reach a conclusion, 8M LiCl only partly removes the MSA2::cA (relatively swimming lane 4 and 5) of Lactococcus lactis cell.Therefore, though MSA2::cA combines with cell walls is non-covalent, it is very strong that bonded interacts.

Contain the acellular culture supernatant-20 ℃ storage of MSA2::cA, contain or do not contain 10% glycerine.In this way store several weeks of MSA2::cA, still have same and the pretreated Lactococcus lactis cell of TCA bonded ability (not shown).

In conjunction with the pretreated Lactococcus lactis cell of the TCA of MSA2::cA, can store 3 week or-80 ℃ in 40 ℃ of de-mineralized waters and be stored in and contain or do not contain in the de-mineralized water of 10% glycerine.Sample all adopts the western blotting method analysis.In conjunction with storing for 3 week in 40 ℃ of water of pretreatment cell of MSA2::cA, the result only loses about 50% signal (Figure 13, relatively swimming lane 4 and 6).Can not determine that losing of this signal whether is because protein degradation or be discharged in the water.Contain or do not contain 10% glycerine-80 ℃ storage for not influence of combination (Figure 13, relatively swimming lane 4,7 and 8).

In addition, we study oven dry and lyophilization influences MSA2::cA and the pretreated Lactococcus lactis cell of TCA bonded.The oven dry pretreatment cell does not have negative impact for the combination of MSA2::cA thereafter.Oven dry can the resuspended bonded fused protein of can not losing of water in conjunction with the pretreatment cell of MSA2::cA.Also produce same result during in conjunction with the cell of MSA2::cA in freeze-drying.Freeze-drying will cause the (not shown) of losing with the MSA2::cA binding ability in conjunction with preceding TCA pretreatment cell.We reach a conclusion from these data: although (i) cA anchor and cell wall-bound have non-covalent characteristic, this bonding force is very strong.But (ii) acellular substratum supernatant-20 ℃ of safe storages and, (iii) dry the TCA pretreatment cell for this combination or do not provide an effective and easy method in conjunction with the storage of the cell of cA anchor syzygy.

Embodiment 2

Be fused to the non-recombination lactic acid galactococcus oral immunisation rabbit of the plasmodium malaria antigen MSA2 of Lactococcus lactis AcmA ankyrin matter with preload

The technology that embodiment 1 describes, by AcmA-type protein anchor, when the outer added-time, effectively the conjugated protein heterozygote is to the cell surface of non-reorganization gram positive bacterium.Therefore, this technology need not introduced recombinant DNA for bacterium and bacteria cell wall and has new characteristic possibility is provided.At this, we have studied plasmodium merozoite surface protein matter in rabbit, the immunogenicity of 3D7 strain MSA2 (Ramasamy et al.1999), and it presents at the Lactococcus lactis cell surface of nonrecombinant non-work as an AcmA anchor fused protein.

Material and method

Bacterial strain and growth conditions.Generate the Lactococcus lactis of MSA2::cA, its growth conditions, induced expression, the combining method of TCA pre-treatment Lactococcus lactis recipient cell and MSA2::cA and these cells is described in embodiment 1, and following modification is arranged: in 1 (TCA-pretreatment cell) than 5 (the acellular medium supernatant that contains MSA2::cA) ratio combination.In the immunization experiment, the Lactococcus lactis NZ9000 strain that has plasmid pNG3043 is as positive control (being positive in the experiment of formerly not delivering).This plasmid-encoded MSA2 hybrid protein, it comprises Lactococcus lactis PrtP cell walls anchor structure territory (MSA2::cP) rather than AcmA protein anchor at C ' end.PrtP cell walls anchor structure territory comprises the LPXTG promotor, and it can act on a symphysis and connect the sorting enzyme protein is connected to cell walls (Navarre and Schneewind1994) with covalent linkage.Be used for 6539 to 6914 Nucleotide of the cP structural domain of pNG3043 construct corresponding to (1988) such as Kok.Use primer PrtP.cwa.fw3 (5ATATAAAGCTTGCAAAGTCTGAAAACGAAGG) and primer PrtPcwa.rev (5 ' CCGTCTCAAGCTCACTATTCTTCACGTTGTTTCCG) this fragments that increase.Underscore is represented the restriction enzyme enzyme recognition site that is used to clone.The different cell wall-bound structural domains that only exist only in of plasmid pNG3043 and plasmid pNG3041.The growth conditions of NZ9000 Δ acmA strain [pNG3043] is identical with NZ9000 Δ acmA strain [pNG3041] with induced expression.

The rabbit immunity.Obtain 10 New Zealand white rabbit of having set up barrier from the Harlan laboratory, New Zealand white rabbit is divided into 2 groups carries out immunity test.According to WHO guidance management and use animal (WHO/LAB/88.1).Before the immunity, rabbit from ear's bloodletting to obtain preimmune serum.Rabbit and immunogenic detail file are as follows:

Rabbit A1 and A2, subcutaneous immune NZ9000 Δ acmA[pNG3041] cell (recombinant chou, the MSA2::cA of part surface grappling)

Rabbit B1 and B2, subcutaneous immune NZ9000 Δ acmA (negative control).

Rabbit C1 and C2, oral immunisation NZ9000 Δ acmA[pNG3043] cell (recombinant chou, the MSA2::cP of surface anchoring).

Rabbit D1 and D2, oral immunisation NZ9000 Δ acmA[pNG3041] cell (recombinant chou, the MSA2::cA of surface anchoring).

Rabbit E1 and E2, oral immunisation NZ9000 Δ acmA[pNG3041] the pretreated NZ9000 Δ acmA (non-recombinant chou, the MSA2::cA of surface anchoring) that combines MSA2::cA of TCA of medium supernatant.

The NZ9000 Δ acmA[pNG3043 of surface expression MSA2::cP] be stored in-80 ℃ of growth mediums that contain 10% glycerine, 10 ¹¹The integral multiple cell density.With this understanding, the MSA2 (not shown) that cell can be survived and immunofluorescence technique proof can keep the surface.Bacterium with fresh generation carries out first immunisation.Fresh bacterium of thawing is used in immunity subsequently, washes cell and re-suspended cell in damping fluid, with the proper concn immunity.On the other hand, from the fresh culture bacterium, the prepared combined outside every day unpretreated NZ9000 Δ acmA (negative control) of MSA2::cA, unpretreated NZ9000 Δ acmA[pNG3041] and the pretreated NZ9000 Δ of TCA acmA.

Vertebrae two is surveyed any one surveys that total amount is 5 x 10 among the 100 μ l PBS that subcutaneous injection is resuspended in no any adjuvant ⁹Cell.At interval 3 week, repeat 2 subcutaneous injections again.Before the oral immunisation, rabbit fasting water and food 2-4 hour.Then, their feeds are resuspended in 5 x 10 in 1ml 0.5% sucrose ¹⁰Cell, each dosage repeat 3 days continuously to obtain reproducible oral immunisation.At interval 3 week, give 3 successive oral immunisations altogether.Do not observe immunity is produced disadvantageous influence subsequently, comprise the granuloma at subcutaneous injection position etc., show that animal has good tolerance to Lactococcus lactis.

Serum antibody response.After each immune 2 weeks, rabbit carries out antibody analysis from ear's bloodletting to obtain serum.Serum is stored in-20 ℃ to using.Serum with 10 times of serial dilutions, is used for the titre of immunofluorescence analysis (IFA) with the surperficial MSA2 of decision antibody antimalarial protozoon merozoite 3D7 in containing the PBS of 2%BSA.IFA carries out (Ramasamy 1987) as previously mentioned as previously mentioned having fixed late period on the plasmodial acetone-methyl alcohol of 3D7.In order to detect all antibody isomer, the green link coupled goat antirabbit Ig of Oregon (molecular probe) is anti-as two.To only detecting IgG antibody, use the fluorescein link coupled, affinity purification, the mouse monoclonal antibody of special anti-rabbit chain.

Result and discussion

The surface expression of the MSA2 of different Lactococcus lactis strains.With examining the semiquantitative decision recombination lactic acid of Macchiavello's staining SDS-PAGE gel and fluorescence microscopy milk-globule bacterial strain and the pretreated MSA2::cA of nonrecombinant TCA from the MSA2 molecule of the Lactococcus lactis cell expressing of combined outside and the quantity of exposed surface, wherein recombination lactic acid milk-globule bacterial strain carries plasmid pNG3041 or the pNG3043 that produces MSA2::cA or MSA2::cP respectively.We estimate that recombinant strain produces about 1.4 x 10 ⁵The MSA2::cA of molecule or MSA2::cP.The fluorescent microscope that the surface of MSA2::cA and MSA2::cP exposes as Figure 14 shows that difference is very big.Have the pretreated Lactococcus lactis cell of the non-reorganization of MSA2::cA bonded TCA and be presented at the dyeing of whole cell surface homogeneous.Yet this representative of sxemiquantitative SDS-PAGE analysis revealed approximately each cell has 1 x 10 ⁴The MSA2::cA of molecule.Thereby we reach a conclusion, and MSA2::cA that the surface of recombination lactic acid milk-globule bacterial strain exposes and the quantity of MSA2::cP are less than 10% of molecule sum that these strains produce.Other molecule is limited in film or the cell walls probably.The expression that Norton etc. also observe the TTFC that is fused to cP cell walls anchor structure territory has similar phenomena (1996).In that research, have only TTFC::cP that film or cell walls are correlated with but that do not have the surface to expose to be proved to be.Thereby may expose protein to the surface on the Lactococcus lactis cell, be more efficient methods from the pretreated cell of combined outside TCA.

The anti-MSA2 antibody response of oral immunisation rabbit.The immunoreactive characteristic of anti-MSA2 antibody is summarized in table 2.The recombination lactic acid galactococcus that oral immunisation produces MSA2::cP (rabbit C1 and C2) did in the past (not delivering the result) at this as over against photograph.In the experiment in the past, the similar antibody response of discovery.Present experiment shows A, after D and twice immunity of E group rabbit, can be observed the specific antibody reaction of anti-nearly natural MSA2, and immunity back antibody titers raises for the third time, in all situations, and after three immunity, subcutaneous or oral cavity route no matter, IgG antibody all is main.After contrasting subcutaneous immunity three times with the Lactococcus lactis cell is independent, observe the surperficial IFA of weak relatively anti--MSA2, this is owing to producing antibody cross reaction (as follows).

Sum up these results, we reach a conclusion: (i) MSA2 of Lactococcus lactis cell generation has caused the serum antibody of discerning natural plasmodium MSA2, (ii) in mucosal immunity, because existence that can upborne system IgG antibody (table 2), the special Th cell of MSA2 is activated, (iii) the oral immunisation MSA2::cA that combines the pretreated Lactococcus lactis cell of TCA of the non-work of non-reorganization produces the recombinant strain of the work of MSA2::cA causing on the special serum antibody response to render a service with subcutaneous or oral administration, or the recombinant strain of the work of the generation MSA2::cP of its cell walls of oral cavity inoculation MSA2 covalent attachment is the same.

Anti-Lactococcus lactis antibody response.Immunoblotting (Figure 15) proves after rabbit secondary and three immunity the antigenic antibody response of significant anti-Lactococcus lactis.This reacts subcutaneous immunity (A and B group rabbit) than oral immunisation (C organizes rabbit) the obvious grow of Lactococcus lactis.Compare with the Lactococcus lactis cell that oral immunisation is lived, the pretreated Lactococcus lactis cell of oral immunisation TCA (E organizes rabbit) has caused the antibody that can react with Lactococcus lactis antigen still less under lower intensity.Probably, this is because the TCA pre-treatment has been removed the proteinic fact (seeing embodiment 1) from the Lactococcus lactis cell.Cell observation to TCA pre-treatment (non-reorganization) makes such means of delivery be more suitable for immunization strategy repeatedly than its homologue (recombinant chou) to lower anti-carrier reaction.

Embodiment 3

AcmA protein anchor homologue and heterozygote pH dependency are in conjunction with cell walls

The cell wall-bound structural domain of Lactococcus lactis cytohydrolist AcmA or anchor are made up of 45 with high homology amino acid whose three tumor-necrosis factor glycoproteinss.(Buist etc. 1995).These tumor-necrosis factor glycoproteinss belong in the protein of structural domain family that the consensus sequence with patent application WO 99/25836 definition coincide and many surface alignment that can be in biology widely to be found.Another total feature of most of these structural domains is the pI value height of their calculating: about 8 or higher (table 3).Our former pH value in conjunction with using in the experiment (embodiment 1 and 2) with MSA2::cA is about 6, means the binding domains positively charged.Lactococcus lactis cytohydrolist AcmD[cD] the AcmA protein anchor homologue of (Bolotin etc. 2001) also forms (Figure 16) by three tumor-necrosis factor glycoproteinss, and the pI value of its calculating (approximately pI3.8) is than much lower (table 4) of cA structural domain.Thereby, in embodiment 1, use in conjunction with under the condition, the cD anchor is electronegative.We the verified under these conditions MSA2::cD that do not take place reports combination of proteins.Therefore, studied the influence of pH in the cohesive process of cD fused protein (MSA2::cD) here.And then, we have made up three cD tumor-necrosis factor glycoproteinss and the hybrid protein anchor that the cA tumor-necrosis factor glycoproteins is formed, wherein the pI value of the calculating of cA shows that than the height of the tumor-necrosis factor glycoproteins of independent cD the pH incorporation range of AcmA type protein anchor can be handled by the pI value of using single tumor-necrosis factor glycoproteins in the heterozygote.

Material and method

Bacterial isolates, growth and inductive condition, the TCA pre-treatment of Lactococcus lactis cell, to inducing of the MSA2 protein anchor fused protein of TCA pretreatment cell, wash conditions, description is identical in the protein electrophorese, immunoblotting and immunodetection and embodiment 1.Under the condition of using, contain MSA2::cA, the acellular culture supernatant pH about 6.2 of MSA2::cD or A3D1D2D3.Detect the influence of pH, the pH of substratum regulates with HCl or NaOH and obtains required pH.

Plasmid construction.Expressing the plasmid of MSA2::cD syzygy describes in embodiment 1.Plasmid pPA43 is based on the same expression plasmid and comprised the Lactococcus lactis signal sequence (ssUsp of the Usp45 of framework endomixis; Van Asseldonk etc. 1990, Gene 95:155-160), be the c-myc epi-position of testing goal, the tumor-necrosis factor glycoproteins D1 of A3 cA tumor-necrosis factor glycoproteins and cD, D2 and D3.The primer that is used for cloning A3 is cArepeat3.fw (CCG TCT CCA ATT CAA TCTGCT GCT GCT TCA AAT CC) and cArepeat3.rev (TAA TAA GCT TAAAGG TCT CCA ATT CCT TTT ATT CGT AGA TAC TGA CCA ATTAAA ATA G) [black matrix is the A3 distinguished sequence].The primer that is used to clone three cD tumor-necrosis factor glycoproteinss is cDrepeatl.fw (CCGTCTCCAATTTCAGGAGGAACTGCTGTTACAACTAG) and repeat3.rev

(TAATAAGCTTAAAGGTCTCCAATTCCAGCAACTTGCAAAACTTCTCCTAC) [black matrix is the cD distinguished sequence].

Result and discussion.

The combination of MSA2::cD when hanging down pH.Because than the combination of not observing MSA2::cD under the high pH of the pI (pI3.85) of the calculating of cD structural domain (grow and induce the pH about 6.2 of back substratum), we have studied the combination when medium pH is adjusted to pH3.2.The pretreated Lactococcus lactis cell of TCA be used for bound substrates and with immunoblotting assay the relative quantity of bonded MSA2::cD.Be retained in the proteinic amount of unconjugated report in the culture supernatant after also having analyzed combination.Figure 17 be presented at pH3.2 carry out in conjunction with the time bonded MSA2::cD tangible rising (relatively swimming lane 1 and 3) is arranged.Less unconjugated report protein is retained in (relatively swimming lane 2 and 4) in the supernatant simultaneously.Table positive electricity is very important to the combination in cA type anchor structure territory as a result for this.

The combination of cAcD heterozygosis anchor.The analysis revealed two class tumor-necrosis factor glycoproteinss of the pI value of cA homologue can be distinguished in the table 3: have high pI value (〉 8) the major portion (having 99 in 148) of homologue and another group pI value be lower than 6 (having 33 in 148), wherein cD represents.Based on our experimental result, be presented under the pH that is lower than its pI, the anchor structure territory of these types is only in conjunction with bacteria cell wall.Significantly, most cell wall-bound structural domain homologues only are made up of tumor-necrosis factor glycoproteins, and this tumor-necrosis factor glycoproteins has represents one of two groups pI value, promptly has the tumor-necrosis factor glycoproteins of high or low pI.Ironically, have some protein of cell wall-bound structural domain, as the DniR of Trepanoma pallidum and the Ntn hydrolase of Borrelia burgdorferi, by forming by the tumor-necrosis factor glycoproteins of high and low pI.Because these " natural crossing zoarium " cell wall-bound structural domains be lower than in the structural domain the middle pI value of total tumor-necrosis factor glycoproteins in conjunction with pH, we have made up the hybrid cell wall-held protein matter anchor with middle pI value with our obtainable cA and cD tumor-necrosis factor glycoproteins.Table 5 has been listed the AcmD anchor of natural A cmA and number of C a/cD heterozygote.The hybrid protein anchor (A3D1D2D3) that makes up has about 5.1 pI calculated value.The protein anchor that has only D1D2D3 to form is presented at and is higher than the combination that it calculates under the pH of pI and does not almost have (on seeing).A3 (pI10) structural domain shows similar combination at pH5 with pH7.

Detected heterozygosis anchor A3D1D2D3 at pH3, the combination under pH5 and the pH7.At the nearly all protein of pH3 all in conjunction with ghost cell (Figure 18).Still there is the combination (+/-40%) of a great deal of at pH5, yet has only a spot of combination (+/-20%) at pH7.This result shows, caused that by adding a cA tumor-necrosis factor glycoproteins (A3) the pI calculated value moves on to 5.1 from 3.8, and this makes cD tumor-necrosis factor glycoproteins bonded pH scope is moved on to higher pH value.Can not be owing to the just combination of A3 tumor-necrosis factor glycoproteins at pH5 to the combination rising of A3D1D2D3 heterozygote.If like this, pH7 take place should be the same in conjunction with level because the A tumor-necrosis factor glycoproteins shows same combination under these pH.In addition, not to add and the result at pH5 in conjunction with raising, mean that promptly extra binding domains has caused in conjunction with raising.Before a tumor-necrosis factor glycoproteins adds the cA anchor, show and do not produce in conjunction with raising.With the binding ratio of independent D1D2D3 tumor-necrosis factor glycoproteins, the combination of A3D1D2D3 tumor-necrosis factor glycoproteins is because the rising of the calculating pI value of heterozygosis cA/cD anchor under high pH value.

This clear pH binding characteristic of these type protein anchors that proved can be handled based on the pI value of the independent tumor-necrosis factor glycoproteins that is present in heterozygote.

Embodiment 4

After oral immunisation showed the Lactococcus lactis ghost of the plasmodium antigens MSA2 that is fused to Lactococcus lactis AcmA protein anchor, cell immune response induced in mouse

Preload be fused to the plasmodium MSA2 antigen (MSA2::cA) of AcmA protein anchor the Lactococcus lactis cell (ghost) of non-work of non-genetic modification be used for the oral immunisation mouse, similar to embodiment 2 methods.In this experiment, the ghost whether we are special proposes to carry on the surface by the oral cavity route immunity the non-work of non-reorganization of MSA2::cA can cause the immune response of typical Th1-type, produces the T cell as IgG2 antibody in spleen and gamma-interferon (γ IFN).The reaction of these types is relevant to antigenic immunity with acquisition especially, and as malaria, it is hidden in the cell rather than carries out each stage of life round-robin in the blood.

Material and method

Every group of 5 mouse of system of the same race are not used for immunity.The kind system that uses is that Balb/c[has the main histocompatibility locus of H2d allotype], C57Black[H2b], C3H[H2k] and ICR[outbreed, promptly multiple H2 type].Oral immunisation is three weeks at interval.Be adsorbed on the pretreated Lactococcus lactis cell of the TCA (ghost-MSA2::cA) or as embodiment 2 describe on surface with showing on the surface that by the cell walls anchor that uses covalent coupling the recombination lactic acid galactococcus (Lactococcus lactis [MSA2::cP]) of MSA2 carries out immunity with MSA2::cA.For the second time, for the third time with the 4th two week of immunity after, mouse carries out the anti-blood of afterbody and obtains serum sample.Collect and extract movement to check intestines IgA production of antibodies.Mouse is put to death in each experiment, takes out spleen and detects t cell responses with ELISPOT.The MSA2-his label that E.coli produces is used as antigen in ELISA and ELISPOT analysis.

The growth of bacterial strain, the preparation of ghost cell as described in Example 2.

Result and discussion

The kinetics and the heterogeneous of the serum IgG antibody that oral immunisation produces.

In different mouse kind systems, observe the different of antibody response kinetics and heterogeneous distribution.Importantly, when doing immunogen with the recombination lactic acid galactococcus [MSA2::cP] that lives or ghost-MSA2::cA, antibody response also is different.To ghost-MSA2::cA, after twice immunity, in C3H mouse, detect high serum antibody level.In all 4 mouse kinds systems, all observe IgG antibody after three times and four immunity.Antibody titers is the highest in C3H mouse.Use the IgG antibody that fluorescent microscope (IFA) has detected in the immune serum and the natural MSA2 of parasite reacts, confirm that proteinic insensitive processing form has caused the biology associated antibodies.The contrast immunity is only carried out with ghost.Do not cause the MSA2 specific antibody in this case.MSA2cP as immunogenic parallel laboratory test in, behind the second immunisation, only in the Balb/c mouse, see high serum IgG antibody level.After three times and four immunity, in C3H mouse, also caused useful antibody response.Antibody titers is the highest in the Balb/c mouse.

The heterogeneous of the serum IgG antibody that immunity causes corresponding to ghost MSA2::cA exists significantly different between kind of system.The Balb/c mouse shows high-caliber IgG2a and IgG2b antibody, some IgG3 antibody and insignificant IgG1.The Th1 proneness that this proof is possible.On the other hand, C57Black and C3H mouse have high IgG1 to MSA2, IgG2a and IgG2b and lower IgG3 antibody.This is more typical mixing Th1 and Th2 reaction.The ICR mouse as expection, has shown series reaction.Some ICR mouse have Balb/c and other has the pattern of the IgG heterogeneous of C3H/C57Black.

The formation of mucoantibody.Carry out immunity with the recombination lactic acid galactococcus (MSA2::cP) or the ghost-MSA2::cA that live, use ELISA, in the movement of ICR and Balb/c mouse, detect IgA antibody, but do not have in C3H or the C57Black mouse.

T cell responses.The intensity of seeing the IgGELISA reaction in each immunity in ghost-MSA2::cA mice immunized increases the antibody response that the Th dependence has taken place to strengthen and exist proof in these animals.The distribution of IgG heterogeneous has further confirmed this conclusion.Therefore, at ICR, Balb/c has produced the Th cell in C57Black and the C3H mouse.

Detect the celliferous ELISPOT analysis of IFN-(γ IFN) and mainly detect the CD8+Tc cell.This cell is the immunoreactive important component to many cause of diseases, comprises plasmodium.The His-label MSA2 that E.coli produces is used as antigen in analysis.The special γ IFN of MSA2 produce cell with ghost-MSA2::cA immunity Balb/c, can be proved to be in the spleen of C57Black and C3H.The special γ IFN of MSA2 produces cell and is not observing separately or in the spleen with the immune control mice of the recombination lactic acid galactococcus (MSA2-cP) that lives with ghost.The back has shown that high-caliber non-specific γ IFN produces cell for one group.The reason of high background may be occurent inflammation.

The susceptibility of carrying the special Tc cell of MSA2 in the spleen behind the Lactococcus lactis ghost-systemic immunity of nonrecombinant non-work of exogenous protein is a new discovery.It can be applicable to malaria because the γ IFN that produces in the protection that anti-sporophyte infects and the spleen to produce cell relevant.

In a word, the ghost system of the non-work of non-reorganization can be with oral immunisation to cause the immune response of typical Th1 type.These type reaction with obtain to be hidden in the cell rather than to carry out the immunity of cause of disease in each stage of life round-robin in blood relevant especially to those.The recombination system that this reaction pair ghost system comparison is lived is more remarkable and special.The ghost system has and has exempted diffusion recombinant DNA dangerous additional advantage in the environment.

Embodiment 5

With after preload has been arranged being fused to the antigenic Lactococcus lactis ghost of the PpmA oral immunisation of Lactococcus lactis AcmA protein anchor, the protection mouse is attacked by fatal streptococcus pneumoniae

Streptococcus pneumoniae is the topmost cause of disease material of severe infections, as septicemia, and meningitis, pneumonia, and otitis media.In the recent period molecule loimology and the Study on etiology of streptococcus pneumoniae have been identified immunocompetent pneumoprotein matter.One of these protein, protein enzyme mature protein PpmA is presented in the mouse pneumonia model and can causes the immunoprotection potentiality.

It is an effective carrier in the oral immunisation of rabbit and mouse that the Lactococcus lactis ghost of non-genetic modification has been shown, can cause strong anti-malarial immune response.The ability that structure that has shown the Lactococcus lactis ghost that is fused to Lactococcus lactis AcmA cell wall-bound structural domain on the surface and the mouse that we have studied these ghost protection oral immunisations are avoided the streptococcus pneumoniae attack of fatal nasal cavity dosage has been described here.

Material and method

Bacterial strain and growth conditions.As embodiment 1 growth Lactococcus lactis and preparation ghost cell are described.Streptococcus pneumoniae (2001.Infect Immun69:426-434 such as Gingles) as described before grows.

Make up ppmA protein anchor syzygy expression plasmid.The MSA2 protein anchor syzygy expression plasmid of describing among the expression plasmid of ppmA protein anchor syzygy (PpmA::cA) and the embodiment 2 is similar substantially.In order to secrete PpmA::cA, used the secretory signal sequence (1990Gene95:155-160 such as van Assseldonk) of the Usp45 protein (ssUsp) of Lactococcus lactis.Use primer ppmA.1 (C GGTCTCACATGTCGAAAGGGTCAGAAGGTGCAGACC) and ppmA.2 (C GGTCTCGAATTGCTTCGTTTGATGTACTACTGCTTGAG) by PCR clone PpmA gene, produced the pPA32 plasmid that comprises as ssUsP45 and protein anchor framework endomixis body (ssUsp::ppmA::cA) ppmA.The expression of fusion gene has produced secretion product P pmA::cA.The sequence of underscore shows and is used to digest the segmental Eco31I Restriction Enzyme of PCR recognition site in the primer.This limited reactions has produced NcoI and EcoRI sticky end, can be used for the clone.Black matrix is the ppmA sequence.The chromosomal DNA of streptococcus pneumoniae strain D39 is used as template.

The preparation vaccine.Behind Lactococcus lactis [pPA32] growth and the abduction delivering, 3 liters of M17 substratum that PpmA::cA is arranged of acquisition are centrifugal, and sterile filtration (0.2um) is removed all and produced cell.With 0.5 liter of Lactococcus lactis NZ9000 (Δ acmA) preparation ghost cell.(ghost-PpmA::cA), centrifugation is washed with PBS in conjunction with the back for ghost cell and PpmA::cA.At last at-80 ℃, with 2.5 x 10 ¹⁰Ghost/ml is kept among the PBS.Two control groups comprise: (i) not in conjunction with the ghost of PpmA::cA.To specimen preparation,, but there is not integrating step with the ghost cell of same amount and the step of carrying out same centrifugal and washing; (ii) soluble PpmA, it is separated into his-label syzygy.

Mouse immune.Every group of 10 mouse are used for immunity.The oral cavity dosage of inoculation is for the 5x109 ghost that is with or without PpmA::cA (50, μ g) or be dissolved in the solvable PpmA of 50 μ g among the PBS.Nasal cavity dosage is for containing or do not contain 5 x, 108 ghosts or the solvable PpmA of 5 μ g of PpmA::cA (5 μ g).Subcutaneous injection 10 ⁸Ghost-PpmA::cA (1 μ g).To immunity in the nose, mouse is slightly anaesthetized with isoflurane.

Attack in the nose.Oral immunisation group mouse carries out after 14 days attacking (2000 Infect Immun 68:492-501 such as Kadioglu) as previously mentioned in the nose with the last booster immunization of the streptococcus pneumoniae D39 of 106 colony forming units (CFU).After the attack, the visible clinical symptom of supervision mouse 7 days, experiment finishes then.At this moment also the mouse of survival is thought and survives under streptococcus pneumoniae is attacked; Dying mouse is judged to be the terminal point that reaches analysis in 7 days, and the disconnected neck of animal is put to death.

Elisa assay.Attack the mouse that survives from each streptococcus pneumoniae and extract serum sample, with before being stored in-20 ℃.The enzyme plate 0.05 carbonate buffer solution bag quilt that contains 100 μ gPpmA/ml.Every group total serum is hatched with 10 times of gradient dilutions and plate, as previously mentioned (2001Infect Immun 69:426-434 such as Gingles).Anti--mouse immuning ball protein matter-Ma-horseradish peroxidase thing is used for detecting and measuring absorption at 492nm.

Result and discussion

Serum antibody response.The synoptic diagram of mouse such as Figure 19 carries out the oral cavity, nasal cavity and subcutaneous immunity.Determine the titre of anti-PpmA antibody in every group of blood serum with elisa assay.The result provides in Figure 20.Independent oral cavity or nasal cavity injection ghost (OV ghost and IN ghost) not expectability cause anti-PpmA antibody.The solvable PpmA that nasal is given has only produced low anti-PpmA antibody titers, and it is not that the discovery of very immunogenicity is consistent when mucosal route gives with soluble antigen.The ghost PpmA::cA that oral cavity route provides (OV PpmA+ ghost) has also only caused low-level anti-PpmA serum antibody.This is opposite with the result with the MSA2::cA oral immunisation of description among the embodiment 2.Yet this may be that antigenic type is relevant.Intranasal administration ghost PpmA::cA produces the anti-PpmA antibody (IN PpmA+ ghost) of high titre.And subcutaneous administration ghost-PpmA::cA has obtained high titre.With with the solvable PpmA of the strong common subcutaneous administration of Fu Shi Freund's complete adjuvant relatively, only low 5 to 10 factors (Holland does not deliver the result for Peter Adrian, Erasmusuniversity Rotterdam) of these titres.In addition, the every dosage of Fu Shi PpmA vaccine contains 50PpmA, yet the ghost-PpmA:cA of intranasal administration only contains 5 μ g/ dosage and subcutaneous ghost-PpmA::cA vaccine has only 1 μ g PpmA/ dosage.The clear adjuvant effect that has proved the ghost cell of this result.Do not observe the oral cavity, the side effect of nasal cavity or subcutaneous administration ghost, this is common opposite to severe side effect with the use freund adjuvant.

This result's proof can be used by mucosal route and obtain high titre serum antibody.And these data presentation ghost cells can cause high titre serum antibody with traditional adjuvant safe handling, are free from side effects.

Anti-attack protection.With independent solvable PpmA, the mouse of ghost or ghost-PpmA::cA oral immunisation is in immunity streptococcus pneumoniae attack with fatal intranasal dose after 14 days.Attack in back 72 hours dead with solvable PpmA or ghost mice immunized separately.Show 40% survival rate (Figure 21) with the group of ghost-PpmA::cA immunity.This result shows with ghost-PpmA mucosal immunity mouse can cause the protective immunity that fatal streptococcus pneumoniae is attacked.In a word, the ghost system of the non-work of non-reorganization can be used to cause that high titre serum antibody and mucosal administration approach can be used to obtain the protective immunity of the cause of disease that anti-stick film obtains.

Reference:

Bolotin?et?al.(2001)Genome?Res.11：731-753.

Buist?et?al.(1995)J.Bacteriol.177：1554-1563.

Gasson(1983)J.Bacteriol.154：1-9.

Kok?et?al.(1988)Appl.Environ.Microbiol.54：231-238.

Kuipers?et?al.(1997)Tibtech.15：135-140.

Morata?de?Ambrosini?et?al.(1998)J.Food?Prot.61：557-562.

Navarre?and?Schneewind(1994)Mol.Microbiol.14：115-121.

Norton?et?al.(1994)FEMS?Microbiol.Lett.120：249-256.

Norton?et?al.(1996)FEMS?Immunol.Med.Microbiol.14：167-177.

Poquet?et?al.(2000)Mol.Microbiol.35：1042-1051.

Ramasamy(1987)Immunol.Cell?Biol.65：419-424.

Ramasamy?et?al.(1999)Parasite?Immunol.21：397-407.

Robinson?et?al.(1997)Nature?Biotechnol.15：653-657.

Sauve?et?al.(1995)Anal.Biochem.226：382-283.

Claims (20)

1, obtains to have the method for cell wall material of gram positive bacterium of the binding ability of enhanced and proteinaceous substances, described proteinaceous substances comprises and described cell wall material bonded AcmA cell wall-bound structural domain or its homologue or its functional derivatives, described method comprises with a kind of acid solution handles full cell material, from described cell wall material, to remove cell-wall component, described component is protein, teichoic acid, lipoteichoicacid or carbohydrate, thereby generates spherical peptidoglycan microsome.

2, the process of claim 1 wherein that described acid solution contains a kind of acid that is selected from next group: acetate (HAc), hydrochloric acid (HC1), sulfuric acid (H ₂SO ₄), trichoroacetic acid(TCA) (TCA), trifluoroacetic acid (TFA) and Monochloro Acetic Acid (MCA).

3, claim 1 or 2 method, wherein said cell wall material derives from galactococcus, Bacterium lacticum, genus bacillus or mycobacterium.

4, claim 1 or 2 method further comprise the described cell wall material in the described solution of heating.

5, the cell wall material of the gram positive bacterium that obtains by each method in the claim 1 to 4.

6, the cell wall material of claim 5, further comprise a kind of proteinaceous substances that is attached on the described cell wall material, described proteinaceous substances comprises and described cell wall material bonded AcmA cell wall-bound structural domain or its homologue or its functional derivatives.

7, the cell wall material of claim 6, wherein said proteinaceous substances also comprises a reactive group.

8, the cell wall material of claim 7, wherein said reactive group are immunogenic determinant, enzyme or antibody, microbiotic, hormone, aromatoising substance, inorganic particle or reporter molecule.

9, the cell wall material of claim 8, wherein said immunogenic determinant are the pathogenic agent sources.

10, the cell wall material of claim 9, wherein said pathogenic agent is a plasmodium falciparum.

11, the cell wall material of claim 10, wherein said immunogenic determinant are malaria antigen MSA2.

12, the cell wall material of claim 9, wherein said pathogenic agent is a streptococcus pneumoniae.

13, the cell wall material of claim 12, wherein said immunogenic determinant are suis PpmA antigen.

14, a kind of pharmaceutical composition, its composition that comprises among the claim 6-13 each is as activeconstituents.

15, the pharmaceutical composition of claim 14, wherein said composition are a kind of vaccines.

16, the pharmaceutical composition of claim 15, wherein said vaccine are the vaccines that is used for mucosal immunity.

17, the pharmaceutical composition of claim 16, wherein said vaccine are the vaccines that is used for immunity in oral cavity or the nose.

18, the purposes of each composition in the preparation biological catalyst among the claim 5-13.

19, proteinaceous substances and gram positive bacterium cell wall material are carried out the bonded method, described method comprises:

Handle described cell wall material to remove cell-wall component from described cell wall material with a kind of acid solution, described component is protein, teichoic acid, lipoteichoicacid or carbohydrate, thereby generates spherical peptidoglycan microsome; With

Described spherical peptidoglycan microsome is contacted with a kind of proteinaceous substances, and wherein said proteinaceous substances comprises and described treated cell wall material bonded AcmA cell wall-bound structural domain or its homologue or its functional derivatives.

20, the method for claim 19, wherein said proteinaceous substances contact with described treated cell wall material under a pH value, and this pH value is lower than the pI calculated value of described AcmA cell wall-bound structural domain or its homologue or its functional derivatives.

Images