CN100497608C - Human cholesteryl ester synthetase-2c and its coding sequence - Google Patents
Human cholesteryl ester synthetase-2c and its coding sequence Download PDFInfo
- Publication number
- CN100497608C CN100497608C CNB2003101087095A CN200310108709A CN100497608C CN 100497608 C CN100497608 C CN 100497608C CN B2003101087095 A CNB2003101087095 A CN B2003101087095A CN 200310108709 A CN200310108709 A CN 200310108709A CN 100497608 C CN100497608 C CN 100497608C
- Authority
- CN
- China
- Prior art keywords
- people
- sequence
- cholesteryl ester
- cell
- acat2c
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
A human cholesterol ester synthetase-2c(ACTT2C), its coding sequence with 1.2 kb of length, the configurator and carrier containing said sequence, and their application in researching and screening the medicines for treating hypercholesterolemia and atherosclerosis are disclosed.
Description
Invention field
The present invention relates to biological chemistry, molecular biology, genetically engineered and DNA recombinant technology field.More specifically, relate to people's cholesteryl ester synthetic enzyme-2c (ACAT2c) and encoding sequence thereof and their application.
Background technology
People's cholesteryl ester synthetic enzyme is a human acyl coenzyme A: cholesterol acyltransferase (ACAT; Acy1-coenzyme A:cholesterol acyltransferase; EC2.3.1.26), be the enzyme that interior unique catalysis longer chain fatty acid of people's cell and free cholesterol form cholesteryl ester.ACAT brings into play the important physical function in vivo, mainly participates in organism cholesterol and processes such as the absorption of ester class, transportation and storage thereof, is one of key enzyme of keeping body inner cholesterol and ester class metabolic balance thereof.Studies show that in a large number that both at home and abroad it is high reactivity ground synthetic cholesterol ester in scavenger cell, cause the excessive accumulation of cell inner cholesterol ester and form foam cell, cause atherosclerosis (AS) early lesion; Its activity cholesterol amount in the cytolemma that can affect the nerves, and directly regulate the generation a, relevant with senile dementia lesion (AD); Its activity change in liver, intestinal cells can directly influence the absorption of synthetic cholesterol ester, cholesterol, the assembling of lipoprotein, and is until blood levels that influences cholesterol and blood transhipment, directly related with hypercholesterolemia ester disease; And the absorption of chronic dietary source cholesterol lacks, and causes serious disease equally, as child, the dementia in old age etc.Therefore, it is epochmaking cholesterol metabolic relative disease drug target protein, in the world the main attack target protein of ACAT as development atherosclerosis pathology medicine.But ACAT is again the extremely low a kind of endoplasmic reticulum membranin of content, even long-term a large amount of people, the material resources etc. of dropping into of many in the world laboratories or company are studied, fails its natural type zymoprotein of purifying so far.So, carry out the work of gene level, to mechanism of action and the structure function of further investigation ACAT and with the relation of relative disease, seem very important, be present unique practicable approach.
In Mammals, find to have two kinds of different ACAT genes of coding ACAT1 and ACAT2 at present.1993, the people ACAT1 cDNA (4011bp) with active function was cloned in U.S. Dartmouth medical college Chang TY laboratory first, 550 aminoacid sequence (Chang TY et al. of its open reading frame coding, 1993, J.Biol.Chem., 268:20747-20755).1996, the experiment of mouse ACAT1 gene knockout was successfully carried out in the R.V.Farese laboratory of Univ California-San Francisco USA, and analyzed and find in liver and small intestine, still had strong ACAT enzymic activity, inferred the ACAT that has another kind of form thus.From Computer Analysis ACAT conserved sequence, 1998, three tame laboratories were cloned cercopithecus aethiops (Anderson RA et al., 1998 respectively, J.Biol.Chem., 273:26747-26754), mouse (Cases S et al., 1998, J.Biol.Chem., 273:26755-26764) and people (0elkers P et al., 1998, J.Biol.Chem., ACAT2 cDNA 273:26765-26771).People ACAT2 cDNA is about 2040bp, 522 amino acid of its open reading frame coding.ACAT1 almost expresses in a organized way in institute, and ACAT2 have high expression level in liver and small intestine.Therefore, assembling and secretion that ACAT2 is considered to mainly to participate in the absorption of diet source cholesterol and contains the ApoB lipophorin, blood levels and blood direct and cholesterol are transported close association.
1999, the structure organization of people ACAT1 genomic dna is cooperated to have delivered with Chang TY laboratory in the contriver laboratory, and finder ACAT1mRNA sequence comes from two different karyomit(e)s (Li Bo-Liang et al., J.Biol.Chem. respectively, 1999,274:11060-11071).Simultaneously, the contriver has carried out researchs such as people ACAT2 genomic dna structure organization again.In liver, intestinal cells, the contriver finds also to have another kind of ACAT2c cDNA form abroad except identical with the ACAT2 cDNA that is about 2040bp (systematic naming method is ACAT2a cDNA) that delivers of going together.The various ways of ACAT2 exists, and shows the importance and the complicacy of this gene function.
Change along with Chinese people's growth in the living standard and dietary structure, cardiovascular disorder and neural transformation disease more and more become the important killer who threatens people's life and health, and the research of massive epidemiology and molecular level has proved that these diseases and organism inner cholesterol level are closely related.Because ACAT has played keying action in cholesterol balance and the incidence of atherosclerosis process in vivo, the special inhibitor that therefore screens ACAT becomes the focus that some drugmakers are competitively studied.Because the ACAT albumen of natural form does not also have the purifying success, it is also very difficult therefore to seek the special effective inhibitors of ACAT.Increasing scientist and medical major company have participated in the research in this field both at home and abroad.Especially study the scientific research brainstrust of cardiovascular disorder, special hope can be screened the cardiovascular disease treating medicine of invention at atherosclerosis ACAT.Current paper is thought, the ACAT2 of liver, intestinal cells specifically expressing participates in the absorption of external source cholesterol and the assembling of lipoprotein, directly influence cholesterol levels in the blood, and be the medicine of effect target protein with ACAT2, can in control body's cholesterol level, not destroy intracellular cholesterol balance again, so the research of ACAT2 more and more is subject to people's attention.
The ACAT2c that the contriver finds, molecule mechanism for the critical function of illustrating ACAT and announcement hypercholesterolemia ester disease, atherosclerosis etc. is significant, this basic research breaks through, will very fast its action oriented research of initiation, and promote the invention of medicines such as cholesterol related diseases such as cardiovascular diseases rapidly.Yet, before the application, also do not obtain people's cholesteryl ester synthetic enzyme 2c and encoding sequence thereof.
Therefore, this area presses for exploit person cholesteryl ester synthetic enzyme 2c and encoding sequence thereof.
Summary of the invention
Purpose of the present invention just provides a kind of new people's cholesteryl ester synthetic enzyme 2c and encoding sequence thereof.
Another object of the present invention provides produces these people's cholesteryl ester synthetic enzyme and the method for encoding sequence and their purposes.
A first aspect of the present invention provides a kind of people's cholesteryl ester synthetic enzyme-2c, and described albumen is selected from down group:
(a) have albumen or its conservative property variant protein or its active fragments or its reactive derivative of SEQ ID NO:2 aminoacid sequence.
(b) SEQ ID NO:2 aminoacid sequence is formed through replacement, disappearance or the interpolation of one or more amino-acid residues, and have people's cholesteryl ester synthetic enzyme-2c function by (a) deutero-albumen.
In a preference, described people's cholesteryl ester synthetic enzyme-2c (ACAT2c) has the aminoacid sequence shown in the SEQ ID NO:2.
A second aspect of the present invention provides a kind of isolating polynucleotide, and described polynucleotide comprise one and are selected from down the nucleotide sequence of organizing:
(a) the above-mentioned proteic polynucleotide of coding;
(b) with polynucleotide (a) complementary polynucleotide.
Preferably, described polynucleotide encoding has the albumen of aminoacid sequence shown in the SEQ ID NO:2.
Preferable, the sequence of described polynucleotide comprises and is selected from down a kind of of group:
(a) sequence of 13-1152 position among the SEQ ID NO:1;
(b) sequence of 1-1156 position among the SEQ ID NO:1.
Better, the sequence of described polynucleotide has a kind of of the group of being selected from down:
(a) sequence of 13-1152 position among the SEQ ID NO:1;
(b) sequence of 1-1156 position among the SEQ ID NO:1.
A third aspect of the present invention provides a kind of carrier, and described carrier contains above-mentioned polynucleotide.Preferable, described polynucleotide comprise 13-1152 bit sequence among the SEQ ID NO:1.
A fourth aspect of the present invention provides a kind of host cell, and described host cell comprises above-mentioned carrier.Preferably, described host cell is a mammalian cell.Better, described host cell is mouse, rat or people's a cell.
A fifth aspect of the present invention provides a kind of people's of having cholesteryl ester synthetic enzyme-2c active proteic preparation method, it is characterized in that this method comprises:
(a) under the condition that is fit to expressing human cholesteryl ester synthetic enzyme-2c, cultivate above-mentioned host cell;
(b) from culture, isolate and have the active albumen of people's cholesteryl ester synthetic enzyme-2c.
A sixth aspect of the present invention, provide a kind of can with above-mentioned people's cholesteryl ester synthetic enzyme-2c specificity bonded antibody.
A seventh aspect of the present invention provides a kind of pharmaceutical composition, and described pharmaceutical composition contains the above-mentioned people's cholesteryl ester synthetic enzyme-2c or the above-mentioned polynucleotide of safe and effective amount, and pharmaceutically acceptable carrier.
A eighth aspect of the present invention provides described people's cholesteryl ester synthetic enzyme-2c application in the medicine of screening or preparation treatment cholesterol related diseases.
A ninth aspect of the present invention provides the application of above-mentioned polynucleotide in the medicine of screening or preparation treatment cholesterol related diseases.
A tenth aspect of the present invention provides a kind of method of screening the medicine of treatment cholesterol related diseases, and described method comprises step:
(a) under the condition that is fit to growth, cultivate host cell, described host cell contains above-mentioned expression vector, described expression vector contains above-mentioned polynucleotide and the exogenous promoter that links to each other with this polynucleotide operability, wherein in the substratum of first group of host cell or lysate or preparation albumen, add candidate substances, in the substratum of second group of host cell or lysate or preparation albumen, do not add candidate substances;
(b) measure cholesteryl ester synthetic enzyme-2c activity in first group and second group of host cell or lysate or the preparation albumen, wherein first group of host cell or lysate or prepare proteic this enzymic activity and just represent that above and below second group this candidate substances is the medicine of treatment cholesterol related diseases.
Others of the present invention are because disclosing of the technology of this paper is conspicuous to those skilled in the art.
Description of drawings
Following accompanying drawing is used to illustrate specific embodiments of the present invention, and is not used in qualification by the scope of the invention that claims defined.
Fig. 1: people ACAT2c cDNA sequence is the polynucleotide encoding sequence of people's cholesteryl ester synthetic enzyme 2c.
Fig. 2: the aminoacid sequence of people's cholesteryl ester synthetic enzyme 2c.
Fig. 3: the recombinant expression vector and the western blot analysis that contain people ACAT2c encoding sequence.
A. the structure synoptic diagram of the recombinant expression vector of people ACAT2c encoding sequence;
B. the western blot analysis of people's cholesteryl ester synthetic enzyme 2c.
Fig. 4: the activation analysis of people's cholesteryl ester synthetic enzyme of people ACAT2c genetic expression.
Embodiment
The inventor is through extensive and deep research, separating clone obtains people ACAT2c cDNA first, and it is analyzed, determine a kind of people's cholesteryl ester synthetic enzyme aminoacid sequence of this cDNA coding, make up the recombinant expression vector of people ACAT2c cDNA, transfection mammalian cell is expressed, in order to the enzymic activity of analyst ACAT2c.Finished the present invention on this basis.
As used herein, term " cholesteryl ester synthetic enzyme-2c ", " ACAT2c " are used interchangeably, and refer to have the enzyme of ACAT2c aminoacid sequence (Fig. 2); Term " cholesteryl ester synthetic enzyme-2c cDNA ", " ACAT2c cDNA " " cholesteryl ester synthetic enzyme-2c gene " " ACAT2c gene " are used interchangeably, and refer to have the polymerized nucleoside acid sequence (Fig. 1, SEQ NO:1) of coding ACAT2c.
In the present invention, " cholesteryl ester synthetic enzyme-2c conservative property variation polypeptide " refers to compare with the aminoacid sequence of SEQ ID NO:2, has 10 at the most, preferably at the most 8, more preferably at the most 5,3 amino acid is replaced by similar performance or close amino acid and is formed polypeptide at the most best.
Polynucleotide of the present invention can be dna form or rna form.Dna form comprises the DNA of cDNA, genomic dna or synthetic.DNA can be strand or double-stranded.DNA can be coding strand or noncoding strand.The coding region sequence of encoding mature polypeptide can be identical with the coding region sequence shown in the SEQ ID NO:1 or the varient of degeneracy.As used herein, " varient of degeneracy " is meant that in the present invention coding has the protein of SEQ ID NO:2, but with the differentiated nucleotide sequence of coding region sequence shown in the SEQ ID NO:1.
The polynucleotide of the mature polypeptide of coding SEQ ID NO:2 comprise: the encoding sequence of an encoding mature polypeptide; The encoding sequence of mature polypeptide and various additional code sequence; Encoding sequence of mature polypeptide (with optional additional code sequence) and non-coding sequence.
The invention still further relates to the polynucleotide varient of above-mentioned encoding sequence.The varient that allelic variant that these polynucleotide varients can be natural generations or non-natural take place.These nucleotide diversity bodies comprise and replace varient, deletion mutation body and insert varient.As known in the art, allelic variant is the replacement form of polynucleotide, and it may be one or more Nucleotide replacement, disappearance or insertions of (preferable is less than 10), but can be from not changing the function of this cDNA in fact.
The invention still further relates to nucleic acid fragment with above-mentioned sequence hybridization.As used herein, the length of " nucleic acid fragment " contains 50 Nucleotide at least, better is at least 100 Nucleotide, is more preferably at least 150 Nucleotide, preferably at least 200 above total lengths to people's cholesteryl ester synthetic enzyme-2c encoding sequence of Nucleotide.Nucleic acid fragment can be used for the nucleotide sequence of amplification technique (as PCR) to determine and/or to clone cDNA of the present invention of nucleic acid.
The Nucleotide full length sequence of ACAT2c cDNA of the present invention or its fragment can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention relevant nucleotide sequence design primer, and the cDNA library in personnel selection cell source or the cDNA library that contains the human chromosome cell be as template, amplification and must relevant sequence.
In case obtained relevant sequence, just can obtain relevant sequence in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.
In addition, also the method for available synthetic is synthesized relevant sequence, especially fragment length more in short-term.Usually, by first synthetic a plurality of small segments, and then connect and to obtain the very long fragment of sequence.At present, can be fully obtain the dna sequence dna of gene of the present invention (or its fragment, or derivatives thereof) by chemosynthesis.This dna sequence dna can be introduced in various existing dna moleculars as known in the art (or as carrier) and the cell then.
The method of application round pcr DNA amplification/RNA (Saiki RK et al., Sci ence, 1985,230:1350-1354) be optimized for acquisition encoding sequence of the present invention.
The present invention also relates to comprise the construction or the carrier of gene of the present invention, and transform or the host cell of transduction with described construction or carrier, and the method that produces ACAT2c through recombinant technology.
Term " carrier " refers to that bacterial plasmid well known in the art, phage, yeast plasmid, vegetable cell virus, mammalian cell virus are as adenovirus, retrovirus or other carriers.The carrier of Shi Yonging includes but not limited in the present invention: expression vector, cloning vector for example are applicable to the carrier in protokaryon (as bacteriums such as intestinal bacteria), eucaryon (as yeast), insect cell, vegetable cell, the mammalian cell.In a word, as long as can duplicate in host and stablize, any plasmid and carrier can be used.In expression vector, except containing replication orgin, cholesteryl ester synthetic enzyme-2ccDNA, also can contain controlling elementss such as exogenous promoter is transcribed with other, translation.
Method well-known to those having ordinary skill in the art can be used to make up and contains cholesteryl ester synthetic enzyme-2c cDNA and suitable transcribing/the translate expression vector of control signal.These methods comprise (Sambroook, et al.Molecular Cloning, a Laboratory Manual, Cold SpringHarbor Laboratory.New York, 1989) such as extracorporeal recombinant DNA technology, DNA synthetic technology, the interior recombinant technologys of body.Described encoding sequence can be connected with exogenous promoter effectively, to express ACAT2c.
In addition, expression vector preferably comprises one or more selected markers, to be provided for selecting the phenotypic character of transformed host cells, cultivate Tetrahydrofolate dehydrogenase, neomycin resistance and the green fluorescent protein (GFP) of usefulness as eukaryotic cell, or be used for colibacillary tsiklomitsin or amicillin resistance.
Comprise the nucleotide sequence of people's cholesteryl ester synthetic enzyme-2c cDNA and the carrier of suitable promotor or control sequence, can be used to transform appropriate host cell, so that it can expressing human cholesteryl ester synthetic enzyme-2c.
Be applicable to that exogenous promoter of the present invention is not particularly limited, nearly all exogenous promoter all can be used for the present invention.The example of representational exogenous promoter comprises (but being not limited to): various recombinant clone promotors, and as promotor of SV40 promotor, CMV promotor etc. and various synthetic etc.It should be noted that exogenous promoter also comprises the promotor from host itself.For example,, can separate obtaining relevant promotor, then with itself and cholesteryl ester synthetic enzyme-2c of the present invention from patient itself for some inherited disease the disease that high reactivity or low activity caused of certain promotor (for example because of)
The cDNA sequence links to each other, and forms the construction that contains exogenous promoter, then described construction is used to screen the medicine of treatment cholesterol related diseases or be used for gene therapy.
The exogenous promoter that a kind of example of construction is exactly with the cholesteryl ester synthetic enzyme-2c cDNA links to each other.As for the position relation of cholesteryl ester synthetic enzyme-2c cDNA and exogenous promoter, the cDNA sequence should be positioned at the downstream of exogenous promoter.
Host cell can be a prokaryotic cell prokaryocyte, as bacterial cell; Or eukaryotic cell such as low, as yeast cell; Or higher eucaryotic cells, as mammalian cell.Representative example has: intestinal bacteria, streptomyces; The bacterial cell of Salmonella typhimurium; Fungal cell such as yeast; Vegetable cell; The insect cell of fruit bat S2 or Sf9; The zooblast of CHO, COS, 293 cells or Bowes melanoma cells etc.The preferred mammal cell, as mouse, rat and people's cell.
Can carry out with routine techniques well known to those skilled in the art with the recombinant DNA transformed host cell.The method for transformation of some employings includes, but are not limited to: coprecipitation of calcium phosphate method, conventional mechanical method such as microinjection, electroporation, liposome packing etc.
The transformant that obtains can be cultivated with ordinary method, to express ACAT2c.According to used host cell, used substratum can be selected from various conventional substratum in the cultivation.Under the condition that is suitable for the host cell growth and expresses, cultivate.The extracellular can be expressed or be secreted into to above-mentioned recombinant polypeptide in cell or on cytolemma.
The present invention also comprises ACAT2c DNA or the polypeptide of its fragment coding has specific polyclonal antibody and monoclonal antibody, especially monoclonal antibody.Here, " specificity " is meant that antibody capable is incorporated into ACAT2c gene product or fragment.The present invention also comprises having immunocompetent antibody fragment, as Fab ' or (Fab)
2Fragment; Heavy chain of antibody; Light chain of antibody; Or chimeric antibody, as have the murine antibody binding specificity but still keep antibody from people's antibody moiety.Antibody of the present invention can be prepared by the known various technology of those skilled in that art.
The proteic antibody of anti-ACAT2c can be used in the immunohistochemistry technology, detects the ACAT2c albumen in the biopsy specimen.Utilize albumen of the present invention,, can filter out with ACAT2c albumen interactional material takes place, as inhibitor, agonist or antagonist etc. by various conventional screening methods.
The present invention also provides a kind of pharmaceutical composition, and it contains ACAT2c albumen of the present invention, its coding nucleic acid and/or the antisense nucleic acid of safe and effective amount, and pharmaceutically acceptable carrier or vehicle.This class carrier comprises (but being not limited to): salt solution, damping fluid, glucose, water, glycerine, ethanol and combination thereof.Pharmaceutical preparation should be complementary with administering mode.Pharmaceutical composition of the present invention can be made into the injection form, for example is prepared by ordinary method with the physiological saline or the aqueous solution that contains glucose and other assistant agents.Pharmaceutical composition such as tablet and capsule can be prepared by ordinary method.Pharmaceutical composition such as injection, solution, tablet and capsule should be made under aseptic condition.The dosage of activeconstituents is the treatment significant quantity, for example every day about 0.01 microgram/kg body weight-Yue 5 mg/kg body weight.In addition, polypeptide of the present invention also can use with the other treatment agent.
When making pharmaceutical composition, be that the ACAT2c albumen of safe and effective amount or its antagonist, agonist are applied to Mammals, wherein this safe and effective amount is usually at least about 0.01 microgram/kg body weight, and in most of the cases be no more than about 10 mg/kg body weight, preferably this dosage is about 0.01 microgram/kg body weight-Yue 100 micrograms/kg body weight.Certainly, concrete dosage also should be considered factors such as route of administration, patient health situation, and these all are within the skilled practitioners skill.
The invention still further relates to the diagnostic testing process of quantitative and detection and localization ACAT2c level.These tests are known in the art, and comprise that FISH measures and radioimmunoassay.The ACAT2c level that is detected in the test can be with laying down a definition the importance of ACAT2c in various diseases and be used to diagnose ACAT2c to lack as or increase caused disease.
The method that whether has ACAT2c in a kind of test sample is to utilize the specific antibody of ACAT2c to detect, and it comprises: sample is contacted with the ACAT2c specific antibody; Observe whether form antibody complex, formed antibody complex and just represented to exist in the sample ACAT2c.
In one embodiment of the invention, obtained people ACAT2c cDNA sequence by pcr amplification, analyze simultaneously and find that this cDNA sequence 5 '-zone has the ATG translation initiation codon, 3 '-zone has TAG translation stop codon, illustrate that this is to have the gene cDNA sequence that frame is read in typical case's translation, a kind of people's cholesteryl ester synthetic enzyme of 379 aminoacid sequences of its coding is ACAT2c.
In another embodiment, the present invention is with the expression vector of people ACAT2c cDNA, transfection mammalian cell is expressed, analyzed the cholesteryl ester synthetase albumen that people ACAT2c cDNA expresses, utilize two kinds of systems approaches of Cell-free and Intact cell to measure the cholesteryl ester synthase activity simultaneously, show that transfectional cell expressing human ACAT2c has the cholesteryl ester synthase activity, but far below the positive control activity, show its diagnosis and treatment, drug research, have extremely important value cholesterol metabolic relative diseases such as hypercholesterolemia ester diseases.
Cholesteryl ester synthetic enzyme of the present invention-2c cDNA has broad application prospects.ACAT-2c is still significant to diagnosis, treatment and the drug screening of cholesterol related diseases (comprising atherosclerosis, Alzheimer's disease etc.) to fundamental research.The present invention makes may be by changing the expression activity of ACAT in specific period, particular organization, for treatment cholesterol metabolic relative disease (as atherosclerosis etc.) provides another possible approach, and can utilize the present invention in mammalian cell, to express ACAT2c.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring HarborLaboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.
Clone, the evaluation of embodiment 1 people ACAT2c cDNA
For obtaining to contain people ACAT2c cDNA sequence, design synthetic primer, sequence is as follows:
C41:5’GGAGACCGCACCATGGAG3’
C42:5’TGTCTAGACCTCTAGGTATGGCAGGAC3’
C21:5’GGAAGAGTATCAGCATGACG3’
Use C41 and C42, C41 and two pairs of primers of C21 respectively, utilize the cDNA product of RT-PCR amplification HepG2 and Caco-2 cell, the PCR product cloning is arrived T-Easy Vector (available from Promega), order-checking and analytical sequence, discovery has 379 a kind of cDNA sequences of amino acid whose people's cholesteryl ester synthetic enzyme of coding, called after ACAT2c gene order.
The nucleotide sequence of the people ACAT2c cDNA that records is shown in Fig. 1 and SEQ ID NO:1.
Embodiment 2 people ACAT2c cDNA read frame and encoding amino acid sequence analysis thereof
The ACAT2c cDNA sequence that obtains according to order-checking, analyze and find that this cDNA sequence 5 '-zone has the ATG translation initiation codon, 3 '-zone has TAG translation stop codon, illustrate that this is to have the gene cDNA sequence that frame is read in typical case's translation, people's cholesteryl ester synthetic enzyme of 379 aminoacid sequences of its coding is ACAT2c (Fig. 2), and the people ACAT2a that reports than external colleague lacks 143 amino acid residue sequences.
Embodiment 3 people ACAT2c cDNA Construction of eukaryotic
For determining protein expression and the enzyme activity assay of people ACAT2c cDNA, utilize total RNA earlier from people's intestinal cells strain Caco-2 preparation, obtain document by the RT-PCR amplification and deliver the coding region of ACAT2 cDNA sequence as positive control (Positive); Then positive control and the sample cDNA that obtains inserted respectively between the EcoRV and XbaI of pcDNA3 (available from Invitrogene company), be positioned at the downstream of CMV promotor, obtain corresponding carrier for expression of eukaryon: pcDNA3-A2 and pcDNA3-A2c (referring to Fig. 3 A).
Embodiment 4 cell cultures, DNA transfection and people ACAT2c cDNA expressed protein are analyzed
Utilize the Chinese hamster ovary celI strain AC29 of a strain ACAT defective type, in F12 substratum (containing 10%FBS, 100 μ g/mlstreptomycin, 100 μ g/ml penicillin), in humidity 95%, 5% CO
2, 37 ℃ cultivate down.The expression analysis of people ACAT2c cDNA proteins encoded determines that by transfection experiment the method for selecting for use is coprecipitation of calcium phosphate method (Calcium-phosphate transfection, Liu J et al.1997).With carrier pcDNA3 (negative control), pcDNA3-A2 (positive control) and three kinds of plasmid DNA of pcDNA3-A2c, AC29 carries out expression study with the strain of calcium phosphate method transfection ACAT defective type Chinese hamster ovary celI respectively.
Concrete experimentation is as follows: transfection seeds cells in the 60mm culture dish (di sh) the day before yesterday, and every di sh cell count is 500,000/5ml, and the cell abundance reaches 30-50% during transfection.Transfection renewed bright substratum in preceding 3 hours.Preparation calcium phosphate precipitation plasmid DNA comprises 12 μ g sample plasmid DNA (each dish), dropwise DNA/ calcium phosphate precipitation liquid is added in the training liquid 37 ℃ of transfection AC29 cells then.After 10 hours, PBS washes cell 2 times, recovers growth in fresh culture.Collect cells transfected after 48 hours.
It is as follows that collecting cell is measured protein expression: the transfectional cell of cultivation washes twice with cold PBS, adds 100ul cell pyrolysis liquid (10%SDS, 50mM Tris-HCl pH 6.8,1mM EDTA, 25mM DTT) dissolved cell protein.The lysis protein solution is sheared for several times with No. 18 syringe needles, with fracture heavy-gravity chromosomal DNA.Determining the protein quantity carries out according to Lowry method slightly modified.SDS-PAGE analyzes and carries out according to the Laemmli method, and gum concentration is 12%.After electrophoresis finished, polyacrylamide gel-4 a layer electricity that shifts filter paper-nitrocellulose filter-electricity commentaries on classics damping fluid rinsing of spreading 4 layers of electrotransfer liquid on the instrument from bottom to up respectively and soaking at running gel changeed the filter paper that liquid soaks, and sets electric current 1mA/cm
2Shifted 30 minutes.Nitrocellulose filter that transfer finishes after 30 minutes, adds the DM54 ACAT2 antibody mulch film of dilution with the TBST damping fluid sealing that contains 5% skim-milk, and 4 ℃ are shaken and spend the night or room temperature 2 hours.The TBST damping fluid is washed film 3 times.The goat anti-rabbit igg mulch film that adds the horseradish peroxidase-labeled of dilution then, room temperature 1 hour, the TBST damping fluid is washed film 3 times, and the TBS damping fluid is washed film 2 times.Carry out fluorography by the method that ECL Western blot detection kit (Santa CruzBiotechnology Inc. company) provides, the result is referring to Fig. 3 B.
The enzyme activity assay of embodiment 5 cell cultures, DNA transfection and people ACAT2c cDNA expressing protein
Cell cultures, DNA transfection experiment carry out two kinds of systems approaches of Cell-free and IntactCell then respectively and measure the cholesteryl ester synthase activity substantially with above-mentioned embodiment 4.
The analysis reference literature reported method of Cell free systems measurement cholesteryl ester synthase activity (Chang CCYet al., 1995, J.Biol.Chem.270:29532-29540), the cracking transfectional cell, add cholesterol and
3The oleoyl CoA substrate of H mark, the enzymic activity of ACAT in the mensuration microsome.Specific practice is, the transfection AC29 cell that cold PBS washes after twice adds the 1mM Tris (pH7.8) that 100 μ l contain 1mM EDTA, place collecting cell lysate after 5 minutes on ice, get 15 μ l 2M KCl, 7.5 μ l 10%CHAPS, 37 ℃ of effects of 15 μ l cell lysates and reaction substrate 10 minutes add 4ml CHC13:MeOH (2:1) mixing termination reaction then, add 10 μ l oleoyl cholesterol again, mixing, add 1ml water, centrifugal, abandon water, dry up, add 60 μ l ethyl acetates, thin-layer chromatography is collected cholesterol ester, isotropic substance is counted, and proofreaies and correct the expression amount of ACAT2c with Western blot.This method records ACAT2c and has the cholesteryl ester synthase activity, but far below positive control (referring to Fig. 4 A).
Analysis reference literature reported method (Chang CCYet al., 1986, Biochemistry, the 25:1700-1705 of Intact Cell systems measurement cholesteryl ester synthase activity; Cadigan KM et al., 1988, J.Biol.Chem. 263:274-82) carries out.Concise and to the point way is that the AC29 cell after the transfection adds
3The oleic acid of H mark was cultivated 3-4 hour, regathered cell and cracking, measured cell inner cholesterol fat synthetic (CE is synthetic) at last, and proofreaied and correct the expression amount of ACAT2c with Westernblot.This method records ACAT2c and has the cholesteryl ester synthase activity, also far below positive control (referring to Fig. 4 B).
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Sequence table
<110〉Shanghai Inst. of Life Science, CAS
<120〉people's cholesteryl ester synthetic enzyme-2c and encoding sequence thereof
<130>031115c
<160>5
<170>PatentIn?version3.1
<210>1
<211>1156
<212>DNA
<213〉homo sapiens
<220>
<221>CDS
<222>(13)..(1152)
<223>
<400>1
<210>2
<211>379
<212>PRT
<213〉homo sapiens
<400>2
<210>3
<211>18
<212>DNA
<213〉synthetic
<220>
<221>misc_feature
<222>(1)..(18)
<223〉primer C41
<400>3
<210>4
<211>27
<212>DNA
<213〉synthetic
<220>
<221>misc_feature
<222>(1)..(27)
<223〉primer C42
<400>4
<210>5
<211>20
<212>DNA
<213〉synthetic
<220>
<221>misc_feature
<222>(1)..(20)
<223〉primer C21
<400>5
Claims (9)
1. isolating people's cholesteryl ester synthetic enzyme-2c is characterized in that, this albumen is the albumen of aminoacid sequence shown in the SEQ ID NO:2.
2. isolating polynucleotide is characterized in that, the described isolating people's cholesteryl ester synthetic enzyme-2c of its coding claim 1.
3. polynucleotide as claimed in claim 2 is characterized in that, the sequence of these polynucleotide is selected from down a kind of of group:
(a) sequence of 13-1152 position among the SEQ ID NO:1;
(b) sequence of 1-1156 position among the SEQ ID NO:1.
4. a carrier is characterized in that, it contains the described polynucleotide of claim 2.
5. a host cell is characterized in that, it contains the described carrier of claim 4.
6. host cell as claimed in claim 5 is characterized in that described host cell is a mammalian cell.
7. host cell as claimed in claim 6 is characterized in that, described host cell is mouse, rat or people's a cell.
8. the preparation method of the described isolating people's cholesteryl ester synthetic enzyme-2c of claim 1 is characterized in that this method comprises:
(a) under the condition that is fit to expressing human cholesteryl ester synthetic enzyme-2c, cultivate the described host cell of claim 5;
(b) from culture, isolate and have the active albumen of people's cholesteryl ester synthetic enzyme-2c.
9. an energy and the described people's cholesteryl ester synthetic enzyme of claim 1-2c specificity bonded antibody.
Priority Applications (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2003101087095A CN100497608C (en) | 2003-11-19 | 2003-11-19 | Human cholesteryl ester synthetase-2c and its coding sequence |
Applications Claiming Priority (1)
Application Number | Priority Date | Filing Date | Title |
---|---|---|---|
CNB2003101087095A CN100497608C (en) | 2003-11-19 | 2003-11-19 | Human cholesteryl ester synthetase-2c and its coding sequence |
Publications (2)
Publication Number | Publication Date |
---|---|
CN1618958A CN1618958A (en) | 2005-05-25 |
CN100497608C true CN100497608C (en) | 2009-06-10 |
Family
ID=34758691
Family Applications (1)
Application Number | Title | Priority Date | Filing Date |
---|---|---|---|
CNB2003101087095A Expired - Fee Related CN100497608C (en) | 2003-11-19 | 2003-11-19 | Human cholesteryl ester synthetase-2c and its coding sequence |
Country Status (1)
Country | Link |
---|---|
CN (1) | CN100497608C (en) |
Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6579974B1 (en) * | 1998-06-23 | 2003-06-17 | The Regents Of The University Of California | Acyl CoA:cholesterol acyltransferase (ACAT-2) |
-
2003
- 2003-11-19 CN CNB2003101087095A patent/CN100497608C/en not_active Expired - Fee Related
Patent Citations (1)
Publication number | Priority date | Publication date | Assignee | Title |
---|---|---|---|---|
US6579974B1 (en) * | 1998-06-23 | 2003-06-17 | The Regents Of The University Of California | Acyl CoA:cholesterol acyltransferase (ACAT-2) |
Non-Patent Citations (2)
Title |
---|
Characterization of two human genes encoding acylcoenzyme A:cholesterol acyltransferase-related enzymes. Oelkers-Peter,等人.Journal-of-Biological-Chemistry,Vol.273 No.41. 1998 * |
Molecular cloning and functional expression of humanacyl-coenzyme A:Cholesterol acyltransferase cDNA in mutantChinese hamster ovary cells. Chang-C-C-Y,等人.Journal of Biological Chemistry,Vol.268 No.28. 1993 * |
Also Published As
Publication number | Publication date |
---|---|
CN1618958A (en) | 2005-05-25 |
Similar Documents
Publication | Publication Date | Title |
---|---|---|
CN106032540B (en) | Gland relevant viral vector building of CRISPR/Cas9 endonuclease enzyme system and application thereof | |
Herasse et al. | Expression and functional characteristics of calpain 3 isoforms generated through tissue-specific transcriptional and posttranscriptional events | |
KR102619197B1 (en) | HSD17B13 variant and its uses | |
CN105960413A (en) | Artificial dna-binding proteins and uses thereof | |
JPH11253186A (en) | Novel ornithinecarbamoyl transferase | |
CN109511259A (en) | By aptamer regulated polyadenylation come controlling gene expression | |
CN100497608C (en) | Human cholesteryl ester synthetase-2c and its coding sequence | |
CA2377931A1 (en) | Novel mammalian calcium channels and related probes, cell lines and methods | |
JPH11123086A (en) | Serine-threonine protein kinase | |
CN102002493A (en) | Application of small RNA-326 in preparation of medicament | |
CN101173003A (en) | Hundred-paced pit viper toxin thrombinogen excitor, coded sequence and uses thereof | |
JP3372267B2 (en) | Chimeric gene | |
AU763574B2 (en) | Human vault RNA | |
WO1999065450A2 (en) | Immunosuppressive agents that inhibit calcineurin function and uses thereof | |
JP2001515363A (en) | Staphylococcus aureus UDP-N-acetylmuramoyl-L-alanine: D-glutamme Triggerase (murD) | |
JPWO2004061101A1 (en) | Methods for selecting new immunosuppressants | |
CN1952134A (en) | Polynucleotide promoting activity of human transcription factor NF-kappa B and its encoded polypeptide and application | |
RU2723187C1 (en) | Genetic cassette containing codon-optimized nucleotide sequences of genes hexa and hexv, and pharmaceutical composition for treating tay-sachs disease | |
CN1657618B (en) | Hepatic correlative oncogene inhibitory and use | |
CN100478355C (en) | New human protein with mouse NIH/3T3 cell transformation improving function and its code sequence | |
CN111808938A (en) | ATP6V0D2 for early diagnosis or curative effect monitoring of atherosclerosis | |
CN100478354C (en) | Novel human protein with cancer inhibiting function and its code sequence | |
JP2003520577A (en) | EPO primary response gene 1, EPRG1 | |
JP2002524066A (en) | gcp | |
JP2002540758A (en) | AMA |
Legal Events
Date | Code | Title | Description |
---|---|---|---|
C06 | Publication | ||
PB01 | Publication | ||
C10 | Entry into substantive examination | ||
SE01 | Entry into force of request for substantive examination | ||
C14 | Grant of patent or utility model | ||
GR01 | Patent grant | ||
TR01 | Transfer of patent right | ||
TR01 | Transfer of patent right |
Effective date of registration: 20200717 Address after: 200031 building 35, No. 320, Yueyang Road, Xuhui District, Shanghai Patentee after: Center for excellence and innovation of molecular cell science, Chinese Academy of Sciences Address before: 200031 No. 320, Yueyang Road, Shanghai Patentee before: SHANGHAI INSTITUTES FOR BIOLOGICAL SCIENCES, CHINESE ACADEMY OF SCIENCES |
|
CF01 | Termination of patent right due to non-payment of annual fee | ||
CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090610 Termination date: 20211119 |