CN100494370C - Optimized monoclonal antibody - Google Patents
Optimized monoclonal antibody Download PDFInfo
- Publication number
- CN100494370C CN100494370C CNB2006100120013A CN200610012001A CN100494370C CN 100494370 C CN100494370 C CN 100494370C CN B2006100120013 A CNB2006100120013 A CN B2006100120013A CN 200610012001 A CN200610012001 A CN 200610012001A CN 100494370 C CN100494370 C CN 100494370C
- Authority
- CN
- China
- Prior art keywords
- monoclonal antibody
- codon
- expression
- sequence
- antibody
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Active
Links
Images
Landscapes
- Preparation Of Compounds By Using Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention discloses an optimized method of nucleotide codon of eukaryotic expressive protein (including antibody), which also provides a variable area DNA molecule of the anti-CD20 monoclonal antibody of the optimized nucleotide codon. The invention also relates to an optimized mammal expressive carrier, which provides a more effective expressing method of anti-CD20 monoclonal antibody in the CHO cell.
Description
Invention field
The present invention relates to biological technical field, specifically, the carrier that the present invention relates in mammalian cell, efficiently express, a kind of technology of in mammalian cell, expressing by codon optimized raising antibody, codon optimized anti-CD-20 monoclonal antibody sequence, and adopt the expression system of optimizing in mammalian cell, to efficiently express anti-CD-20 monoclonal antibody.
Background of invention
Coding password of expressing protein gene analyzed finds, amino acid whose coding password be not average use [Ikemura T.JMol Biol 1981,151 (3): 389; Grantham R et al., Nucleic Acids Res1981,9 (1): 43].The use of codon can divide three kinds of levels, preferred codon, more preferably codon and not preferred codon [Hooper SD et al., Nucleic Acids Res 2000,28 (18): 3517].In addition, unicellular lower eukaryote and higher organism are also inequality to the preference of coding password, the gene that has proved eukaryotic expression can be stagnated (Robison et al., Nucleic Acids Res.1984 12:6663) because of some codon frequency of utilization in protokaryon seldom makes to express in prokaryotic expression system.Generally believe that rare codon can cause ribosomal termination, and the 3 ' end of mRNA is decomposed by the ribonucleoside enzyme of cell.Therefore, when in eukaryotic expression system, expressing the gene of microorganism or viral source, existing by optimizing report [Yukie Koresawa et al., the JBiochem.2000 127:367 that coding password improves expression level; Lisa H Nucleic Acids Res.198614:3075; David B Mol.Biol.Evol.2002 19:1534].Optimization derives from eukaryotic gene optimization and can improve its expression level in microorganism too.But reasoning intuitively is that to derive from eukaryotic gene be not need codon to the high-efficient expression in eukaryotic cell.Especially for the higher antibody product of expression level in eucaryon, do not have about codon optimized report in the document.
Mammalian cell such as CHO/dhfr-cell generally are used for the stably express of eukaryotic protein.At present, existingly developed multiple business-like mammiferous expression vector.Enhanced promotor such as CMV that they all adopt, SV40 strengthens the startup of destination gene expression.But because it inserts the difference of genomic locus, the expression amount of these expression vector recombinant cell strains can differ hundred times, and the technician needs to screen the cell strain of high expression level from thousands of recombinant clones.Therefore, screen the recombinant cell strain of high expression level, become one of main method of optimizing the cell strain structure thereby reduce the screening operation amount by marker gene.But because the marker gene and not the transcribing with translating of goal gene of cotransfection closely link to each other, clone's ratio of high expression level goal gene is very low when obtaining the high expression level marker gene by screening, and long-term cultivation is under high selective pressure, and the genetic stability of expression product can't guarantee.
Bone-marrow-derived lymphocyte is the immune important component part of eukaryote, and in host cell, each bone-marrow-derived lymphocyte is all at the different antibody protein of its cell surface expression.In human body, bone-marrow-derived lymphocyte can express about 10
7To 10
8Individual antibody molecule.After certain heterologous antigen is neutralized, the growth of the bone-marrow-derived lymphocyte of the special neutralizing antibody of generation will be terminated and reduce significantly.But the situation that this specific B lymphocyte still continues a large amount of amplifications takes place sometimes, and the amplification of this cell will cause the generation of cancer, and this cancer is called as B cell lymphoma.
CD20 molecule (the restricted differentiation antigen Bp35 of human B lymphocyte) is the phosphorylated protein of a 33～37kD, marker protein as bone-marrow-derived lymphocyte, it has expression in pre-B lymphocyte, immature B lymphocyte, ripe bone-marrow-derived lymphocyte and activation bone-marrow-derived lymphocyte, and in stem cell and plasmocyte, do not express, exist [Ginaldi L.et al., J Clin Pathol 1998 51:364] that in human serum, also do not have free CD20.The CD20 molecule participates in the reactivation process of cell cycle initial sum differentiation, and almost all express the CD20 molecule at the cell surface of all B cell lymphomas, this makes the antibody of anti-CD20 become the medicine of very promising treatment B cell lymphoma disease [Reff ME et al., Blood 1994 83:435; Golay J.etal., Blood 2000 95:3900].
Studies have shown that, after B lymph tumor cell surface protein CD20 and its antibodies, can cause the collapse and the extinction of B lymph tumor cell.Anti-CD-20 monoclonal antibody is mainly by inducing antibody according to patience cytotoxic effect (ADCC), induce the molten cytosis (CDC) of complement-mediated, induce the cytotoxic effect (CDCC) of complement-mediated and the apoptosis of inducing cell comes killing tumor cell [Gazzano-Santoro H.et al., J Immunol Methods1997 202:163 by activation Tyrosylprotein kinase and L-Cysteine HCL Anhydrous signal transduction pathway; Harjunpaa A.et al., Scand J Immunol 2000 51:634; Flieger D.et al., Cell Immunol 2000 204:55].At present existing anti-CD-20 monoclonal antibodies are used for the treatment of Fei Hejiejinshi B cell lymphoma clinically, as the product of listing the Retuximab[Kai U.et al. of IDEC company, haematologica 2002 87:33 are arranged].But owing to the production cost of antibody is too high medicine can't be used in a large number, therefore reduce the anti-CD-20 monoclonal antibody production cost, improving expressing quantity is very significant work to satisfy clinical application.
Complicated protein structure and glycosylation form can only be expressed just anti-CD-20 monoclonal antibody albumen in mammalian cell expression system can have normal physiologically active.But shortcomings such as mammalian cell is slow owing to its speed of growth, and it is higher to cultivate cost, and protein expression level is low make that antibody drug expression cost is very high.Only be 100-500mg/L as its expression level in the commercially producing of some antibody.Therefore, optimizing the expression of anti-CD-20 monoclonal antibody albumen in mammalian cell is its prerequisite that is used widely.
IRES (the internal ribosomal entry sites) sequence that is positioned at picornavirus and encephalomyocarditis virus (EMCV) 5 ' end untranslated boot section has especially can be in conjunction with the ribosomal secondary structure of eukaryote, thereby causes inner translation initiation.【Belsham?et?al.，Microbiological?Reviews?1996?60：449；Etchison?et?al.，J?Biol?Chem?1982?257：14806；Jackson?et?al.，Curr?TopMicrobiol?Immunol?1990?203：1；Rueckert，Philadelphia，1996pp.609】。The bicistronic mRNA structure that second cistron is marker gene can make goal gene and marker gene express simultaneously, make marker gene become the real selection mode of destination gene expression, nearly all tolerance cell can both be expressed goal gene [Gurtu et al., Biochem Biophys Res Commun 1996 229:295; Rees et al., BioTechniques 1996 20:48].
Summary of the invention
The object of the present invention is to provide a kind of optimization to derive from the technology and the method for the Nucleotide codon in eukaryotic albumen (the comprising antibody) gene order, codon optimized gene order of anti-CD-20 monoclonal antibody and mammalian cell gene engineering expression system efficiently are provided, and the method that adopts these expression vectors that the anti-CD-20 monoclonal antibody gene order is efficiently expressed in mammalian cell.
The object of the present invention is to provide a kind of technology and method of optimizing the Nucleotide codon in the antibody gene sequence, and the codon optimized CD20 chimeric antibody variable region gene sequence of Nucleotide.
In a preferred embodiment, the chain variable region gene sequence of antibody is SEQ ID NO:1, SEQ IDNO:2, and the sequence shown in SEQ ID NO:3 and the SEQ ID NO:4, preferred chain variable region gene sequence is SEQ ID NO:3; The heavy chain variable region gene sequence is SEQ ID NO:5, SEQ ID NO:6, and the sequence shown in SEQ ID NO:7 and the SEQ ID NO:8, preferred heavy chain variable region gene sequence is SEQID NO:7.
In this example, the optimization of Nucleotide codon has been carried out in the variable region of this anti-CD-20 monoclonal antibody heavy chain and light chain, employing is more preferably codon and not preferred codon of preferred codon instead of part in mouse, with preferred codon or the not preferred codon of codon instead of part more preferably, thereby avoided improving the expression amount of anti-CD-20 monoclonal antibody albumen in mammalian cell because of the synthetic not enough protein expression obstacle that causes of codon in the cell.
Preferred codon comprises: Ala (gcc); Arg (cgc); Asn (aac); Asp (gac); Cys (tgc); Gln (cag); Glu (gag); Gly (ggc); His (cac); Ile (atc); Leu (ctg); Lys (aag); Pro (ccc); Phe (ttc); Ser (agc); Thr (acc); Tyr (tac) and Val (ctc).More preferably password comprises Gly (ggg); Ile (att); Leu (ctc); Ser (tcc); Val (gtc) and Arg (agg); Pro (cct); Thr (aca); Ala (gct).
In a preferred embodiment, the not preferred codon substitution rate in light chain and the heavy chain variable region gene is 10%-20%, 20%-50%, 50%-70%, 70%-100% and 100%.
In a preferred embodiment, on the basis that guarantees not preferred codon replacement rate, the light chain of optimization and the CG sequence number in the heavy chain variable region gene reduce or not obvious increase.
In a preferred embodiment, the anti-CD-20 monoclonal antibody of synthetic gene is at mammalian cell, as the expression amount in the HEK-293 cell be natural gene anti-CD-20 monoclonal antibody at least 120%, 150% even 190%.
In a preferred embodiment, this anti-CD-20 monoclonal antibody is a chimeric antibody, and the constant region of its light chain can be people κ and λ type sequence, preferred κ type sequence, and the constant region of heavy chain is the human IgG1, IgG2, IgG3, IgG4 and IgM type sequence, preferred IgG1 type sequence.
The mammalian cell expression vector that the object of the present invention is to provide a cover to efficiently express.
In a preferred embodiment, the heavy chain gene of neo gene and anti-CD-20 monoclonal antibody is structured in the same operon, be positioned at the back of IRES sequence behind the heavy chain gene of anti-CD-20 monoclonal antibody, thereby the weakened expression of selected marker neo of this carrier, make heavy chain gene that screening by G418 obtains neo gene and the anti-CD-20 monoclonal antibody recombinaant CHO cell clone of high expression level simultaneously.
In a preferred embodiment, the heavy chain gene of neo gene and anti-CD-20 monoclonal antibody is structured in the same operon, be positioned at the back of IRES sequence behind the heavy chain gene of anti-CD-20 monoclonal antibody, the light chain gene of hyg gene and anti-CD-20 monoclonal antibody is structured in the same operon, be positioned at the back of IRES sequence behind the light chain gene of anti-CD-20 monoclonal antibody, thereby the weakened expression of selective marker gene neo and hyg of this carrier, high expression level and hyg gene are cloned with the recombinaant CHO cell of anti-CD-20 monoclonal antibody light chain gene while high expression level simultaneously to make screening by G418 and hygmycin B obtain neo gene and anti-CD-20 monoclonal antibody heavy chain gene.
In a preferred embodiment, the heavy chain gene of neo gene and anti-CD-20 monoclonal antibody is structured in the same operon, be positioned at the back of IRES sequence behind the heavy chain gene of anti-CD-20 monoclonal antibody, thereby the weakened expression of selective marker gene neo of this carrier, make screening by G418 obtain neo gene and anti-CD-20 monoclonal antibody heavy chain gene simultaneously the recombinaant CHO cell of high expression level clone.The light chain gene of dhfr gene and anti-CD-20 monoclonal antibody is structured in the same operon, be positioned at the back of IRES sequence behind the light chain gene of anti-CD-20 monoclonal antibody, thereby the weakened expression of amplification gene dhfr of this carrier, thereby under MTX pressure culture condition, can screen dhfr gene and the anti-CD-20 monoclonal antibody light chain recombinaant CHO cell of high expression level simultaneously.
In a preferred embodiment, add under the hygmycin B screening at G418 or G418, the expression amount of optimized expression vectors has increased by 50% than original vector; In another preferred embodiment, under the MTX amplification, the average expression amount of the carrier of optimization has increased by 10% and 30% than original vector.
The object of the present invention is to provide a method that efficiently expresses anti-CD-20 monoclonal antibody, this method comprises:
A) provide a kind of dna molecular of codon optimized anti-CD-20 monoclonal antibody;
B) provide multiple optimized expression vectors, this carrier contains the step a) dna molecular and expresses the regulating and controlling sequence of this dna molecular;
C) with step a) described expression vector transformed host cell, comprise mammalian cell, HEK-293 particularly, CHO/dhfr-cell;
D) host cell of gained culturing step b under the culture condition that is fit to described monoclonal antibody);
With
E) expressed described monoclonal antibody purification procedures c).
Description of drawings
Fig. 1: the design of graphics of the anti-CD-20 monoclonal antibody contrast expression vector that a plurality of Nucleotide are codon optimized.
Fig. 2 a: the transient expression trend map of anti-CD-20 monoclonal antibody contrast expression vector in the HEK-293 cell that a plurality of Nucleotide are codon optimized.
Fig. 2 b: the codon optimized anti-CD-20 monoclonal antibody of a plurality of Nucleotide contrast expression vector transient expression amount of the 7th day in the HEK-293 cell.
Fig. 3 a: the sequence L-3 (SEQ ID NO:3) after comparing anti-CD-20 monoclonal antibody variable region of light chain original series (L-wt) and optimizing.
Fig. 3 b: the sequence H-3 (SEQ ID NO:7) after comparing anti-CD-20 monoclonal antibody variable region of heavy chain original series (H-wt) and optimizing.
Fig. 4: the design of graphics of the pIRESneo3hygd-anti-CD20 expression vector of optimization.
Fig. 5: the design of graphics of the pIRESneo3dhfr-anti-CD20 expression vector of optimization.
Fig. 6: behind the antibiotic-screening, the expression amount of anti-CD-20 monoclonal antibody in three kinds of expression vectors relatively.
After Fig. 7: the MTX amplification, the expression amount of anti-CD-20 monoclonal antibody in three kinds of expression vectors relatively.
Fig. 8 a: the HP-SEC of purifying anti-CD-20 monoclonal antibody analyzes.
Fig. 8 b: the electrophorogram of the anti-CD-20 monoclonal antibody of purifying and purifying in 13%SDS-PAGE not.
Embodiment
The present invention relates to a kind of by the codon optimized technology that improves antibody expression level in eukaryotic cell of Nucleotide.The invention of this technology and people's conventional thought are opposite, are because the expression level of antibody is higher usually on the one hand, are because in most cases antibody itself derives from eukaryotic cell on the other hand.Conventional logic is to derive from eukaryotic protein gene itself relatively to be suitable for obtaining to efficiently express in eukaryotic cell, and it is codon optimized not need to carry out Nucleotide again.Do not see the codon optimized report of relevant antibody gene Nucleotide in the document.Although the example that adopts among the present invention is a chimeric antibody that derives from people and mouse, the technology of announcing among the present invention can be easy to be applied to by those skilled in the art in this area the expression of antibody in eukaryotic cell of other kind.Also can adopt technology of the present invention according to selected eukaryotic cell kind (as mouse source Chinese hamster ovary celI, people source 293 cells etc.) optimize more targetedly according to the Nucleotide codon of the frequent confrontation body gene of codon use in this kind, the ultimate principle that is adopted is consistent, and those of ordinary skill in the art can finish with reference to technical scheme of the present invention.The codon optimized technology of Nucleotide that the present invention announces can be applied to other too and derive from the expression of eukaryotic recombinant protein in eukaryotic cell.
It is codon optimized and a series of preferred version is provided to the present invention relates to the Nucleotide of CD 20 antagonizing Chimeric antibody.Not preferred codon substitution rate can be selected arbitrarily, can be 0-20%, 20%-50%, 50%-70%, or 70-100%.Those skilled in the art can select a certain concrete codon substitution rate also can replace in different gene orders in this area, resulting gene order will be not exclusively the same with the specific examples announced among the present invention, but belong to scope of the present invention equally.
The invention still further relates to by optimizing eukaryotic expression vector and improve the expression level of target product in eukaryotic cell.Those of ordinary skill in the art can adopt other carrier for expression of eukaryon that the antibody of optimizing is expressed by the solution of the present invention.
The optimization of embodiment one, anti-CD-20 monoclonal antibody light chain and heavy chain variable region gene
The original series of anti-CD-20 monoclonal antibody derives from the patent US.5 of IDEC company, and 736,137, its expressing gene is collected by our company, and the variable region sequences of antibody also can connect acquisition by oligonucleotide chain.
The host cell of expressing glycosylated anti-CD-20 monoclonal antibody can derive from multiple tissue, but preferred vertebrate cells.The monkey kidney CV1 clone (ATCC CRL 1651) that available clone has SV40 to transform, human embryonic kidney cell (293 or suspension culture 293) [Graham et al., J.Gen Virol.1977 36:59], baby's baby hamster kidney cell (BHK-21 ATCC CCL 10), Chinese hamster ovary cell (CHO/dhfr
-ATCCCRL 9096), monkey-kidney cells (CV1 ATCC CRL90), African green monkey kidney cell (VERO-76 ATCCCRL 1587), people's uterus carcinoma cell (HELA ATCC CCL2), Madin-Darby canine kidney(cell line) (MDCK, ATCC CCL34), human pneumonocyte (W138, ATCC CCL95), human liver cell (Hep G2, HB 8065) etc.The host cell of preferred expression anti-CD-20 monoclonal antibody is CHO/dhfr
-With the HEK-293 cell.
For can be at mammalian cell, as HEK-293 and CHO/dhfr
-Cell, particularly CHO/dhfr
-Obtain higher expressing quantity in the cell, heavy chain and chain variable region gene original series have been carried out the optimization of codon.Codon optimized document that can reference has Koresawa et al., J.Biochem, 2000,127 (3): 367; Robinson et al., Nucleic Acids Res.1984 12:6663.
Select in mouse preferred codon and the not preferred codon of codon replacement more preferably for use, see Table 1, mainly consider Ser, Leu, Val, Thr, Ala, Asn, Lys, the optimization of Arg and Gly codon, and consider the number of CG in the majorizing sequence simultaneously.The nucleotide sequence L-1 of the variable region of light chain after the optimization sees SEQ ID No:1, and the substitution rate of its not preferred codon is 20%, and the CG number is 9; The nucleotide sequence L-2 of the variable region of light chain after the optimization sees SEQ ID No:2, and the substitution rate of its not preferred codon is 40%, and the CG number is 11; The nucleotide sequence L-3 of the variable region of light chain after the optimization sees SEQ ID No:3, and the substitution rate of its not preferred codon is 70%, and the CG number is 3; The nucleotide sequence L-4 of the variable region of light chain after the optimization sees SEQ ID No:4, and the substitution rate of its not preferred codon is 85%, and the CG number is 12, sees Table 2.The nucleotide sequence of the variable region of heavy chain after the optimization sees that H-1 sees SEQ ID No:5, and the substitution rate of its not preferred codon is 20%, and the CpG number is 9; The nucleotide sequence H-2 of the variable region of heavy chain after the optimization sees SEQ IDNo:6, and the substitution rate of its not preferred codon is 40%, and the CG number is 8; The nucleotide sequence H-3 of the variable region of heavy chain after the optimization sees SEQ ID No:7, and the substitution rate of its not preferred codon is 60%, and the CG number is 10; The nucleotide sequence H-4 of the variable region of heavy chain after the optimization sees SEQ ID No:8, and the substitution rate of its not preferred codon is 85%, and the CG number is 9, sees Table 3.
Table 1 (Genbank)
| Amino acid | Coding password | Codon frequency/1000 | Amino acid | Coding password | Codon frequency/1000 |
| Ser | UCU | 1.17 | Tyr | UAU | 0.85 |
| UCC | 1.32 | UAC | 1.15 | ||
| UCA | 0.85 | Stop | UAA | 0.84 | |
| UCG | 0.31 | UAG | 0.72 | ||
| AGU | 0.91 | UGA | 1.44 | ||
| AGC | 1.43 | His | CAU | 0.80 | |
| Leu | UUA | 0.39 | CAC | 1.20 | |
| UUG | 0.79 | Gln | CAA | 0.50 | |
| CUU | 0.78 | CAG | 1.50 | ||
| CUC | 1.20 | Asn | AAU | 0.86 | |
| CUA | 0.47 | AAC | 1.14 | ||
| CUG | 2.37 | Lys | AAA | 0.77 | |
| Ile | AUU | 1.02 | AAG | 1.23 | |
| AUC | 1.51 | Asp | GAU | 0.89 | |
| AUA | 0.47 | GAC | 1.11 | ||
| Met | AUG | 1.00 | Glu | GAA | 0.80 |
| Val | GUU | 0.68 | GAG | 1.20 | |
| GUC | 0.99 | Cys | UGU | 0.96 | |
| GUA | 0.47 | UGC | 1.04 | ||
| GUG | 1.85 | Trp | UGG | 1.00 | |
| Pro | CCU | 1.22 | Arg | CGU | 0.51 |
| CCC | 1.22 | CGC | 1.05 | ||
| CCA | 1.14 | CGA | 0.72 | ||
| CCG | 0.42 | CGG | 1.15 | ||
| Thr | ACU | 1.00 | AGA | 1.27 | |
| ACC | 1.41 | AGG | 1.30 | ||
| ACA | 1.17 | Gly | GGU | 0.70 | |
| ACG | 0.43 | GGC | 1.33 | ||
| Ala | GCU | 1.17 | GGA | 1.03 | |
| GCC | 1.53 | GGG | 0.94 | ||
| GCA | 0.92 | Phe | UUU | 0.87 | |
| GCG | 0.38 | UUC | 1.13 |
Table 2
Table 3
Anti-CD-20 monoclonal antibody light chain of optimizing and heavy chain variable region gene sequence can adopt the mode of oligonucleotide chain splicing to obtain, also can be by synthetic obtain (Invitrogen) of the full gene of other companies.Wherein, 5 ' end design BamH I site of light chain variable region sequence, 3 ' end design BsiW I site, 5 ' end design EcoR V site of weight chain variabl area sequence, 3 ' end design Nhe I site.
The anti-CD-20 monoclonal antibody light chain can be people κ and λ type sequence, preferred K type sequence, and the constant region of heavy chain can be IgG1, IgG2, IgG3, IgG4 and IgM, preferred IgG1.With wt-L, L-1, L-2, L-3 links to each other with people κ with L-4, with wt-H, H-1, H-2, H-3 links to each other with the IgG1 constant region with H-4.Respectively with wt-L and wt-H, L-1 and H-1, L-2 and H-2, L-3 and H-3, the complete antibody sequence construct of L-4 and H-4 is in expression vector.
The preparation of embodiment two, anti-CD-20 monoclonal antibody gene
(1) preparation of human kappa light chain constant region and human IgG1's CH
Collect Freshman whole blood 5ml, centrifugal 5min precipitation red corpuscle of 300g and white corpuscle.The operation scheme of pressing the classical total RNA isolation kit specification sheets of BBI company extracts white corpuscle RNA.Operation scheme by the MMLV first strand cDNA synthesis kit specification sheets of BBI company is cDNA with white corpuscle mRNA reverse transcription.Reaction system is 11 μ l RNA (2.7 μ g), 5 * reaction buffer4 μ l, and RNaseinhibitor (20U/ μ l) 1 μ l, dNTP mix (10mmol/L) 2 μ l, M-MuLV reverse transcriptase1 μ l, total reaction volume is 20 μ l.
According to known people κ and IgG1 sequences Design PCR primer.CDNA with reverse transcription is a template, and pcr amplification obtains goal gene.
The synthetic primer sequence:
L-F/BamH?I：5’GCG
GGATCCCGTACGGTGGCTGCACCATCT3’(SEQ?ID?NO：9)
L-R/Xho?I：5’GCG
CTCGAGCTAACACTCTCCCCTGTTGAAGCTC3’(SEQ?IDNO：10)
H-F/Eco52I：5’GCG
CGGCCGGCTAGCACCAAGGGCCCATCGG3’(SEQ?IDNO：11)
H-R/Xho?I：5’GCG
CTCGAGGATCCTCATTTACCCGGAGACAGGGAGAGGC3’(SEQ?ID?NO：12)
PCR reaction system: 20 μ l10
*Pyrobest buffer, 16 μ l 2.5mM dNTP, 14 μ l, 10 μ M heavy chains or constant region of light chain primer are right, 4 μ l human leukocyte cDNA, 2 μ l 5U/ μ l Pyrobest DNAPolymerase, reaction system is 200 μ l.
Amplification condition: 94 ℃ of 4min of sex change; 94 ℃ of 1min of sex change, the 60 ℃ of 1min that anneal extend 72 ℃ of 1min, 30 circulations; Extend 72 ℃ of 5min.
(2) preparation of a plurality of anti-CD-20 monoclonal antibody light chains
Adopt conventional Protocols in Molecular Biology well known to those skilled in the art [Sa curtain Brooker J etc., " molecular cloning test guide ", Beijing Science Press], the PCR product of kappa gene is used BamH I and Xho I (TaKaRa) double digestion respectively, in 30 μ l systems, add 3 μ l, 10 * K buffer, κ PCR purified product 20 μ l, Xho I 2 μ l, BamH I 3 μ l, 37 ℃ of enzymes are cut 1h.PcDNA3 (Invitrogen) carrier is also used BamH I and Xho I double digestion, adds 3 μ l, 10 * K buffer in 30 μ l systems, pcDNA3 10 μ l, and Xho I 2 μ l, BamH I 3 μ l, 37 ℃ of enzymes are cut 1h.DNA Ligation Kit Ver.2.1 test kit with TaKaRa is inserted into κ respectively among the pcDNA3, is configured to pcDNA3-κ, preserves behind the transform bacteria.
The chain variable region gene L-wt of anti-CD-20 monoclonal antibody, L-1, L-2, L-3, L-4 and pcDNA3-K use Kpn I (TaKaRa) enzyme to cut respectively, and enzyme is cut system for add 5 μ l, 10 * L buffer, chain variable region gene 30 μ l or pcDNA3-κ 10 μ l in 50 μ l systems, Kpn I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit of promega to carry out purifying, use BsiW I (ToYoBo) enzyme to cut again respectively, enzyme is cut system for add 5 μ l, 10 * Hbuffer in 50 μ l systems, chain variable region gene Kpn I enzyme cuts product 30 μ l or pcDNA3-κ Kpn I enzyme is cut product 30 μ l, BsiW I 3 μ l, 37 ℃ of enzymes are cut 1h.Variable region of light chain Kpn I and BsiW I enzyme that glue reclaims about 400bp are cut product, and variable region of light chain is inserted the pcDNA3-K carrier with the DNA Ligation Kit Ver.2.1 test kit of TaKaRa, be configured to pcDNA3-L-wt, pcDNA3-L-1, pcDNA3-L-2, pcDNA3-L-3, pcDNA3-L-4 preserves behind the transform bacteria.
(3) preparation of a plurality of anti-CD-20 monoclonal antibody heavy chains
The PCR product of IgG1Fc gene uses Eco52 I and Xho I (TaKaRa) enzyme to cut respectively, adds 3 μ l, 10 * H buffer in 30 μ l systems, IgG1 Fc PCR purified product 20 μ l, and Xho I 2 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit of promega to carry out purifying, re-using Eco52 I enzyme cuts, enzyme is cut system for adding 3 μ l10 * Basal buffer in 30 μ l systems, IgG1 Fc Xho I enzyme is cut product 20 μ l, 0.1%BSA 3 μ l, Eco52 I 2 μ l, 37 ℃ of enzymes are cut 1h.The pcDNA3 carrier is also used Eco52 I and Xho I double digestion, adds 3 μ l10 * H buffer in 30 μ l systems, pcDNA3 20 μ l, and Xho I 2 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit of promega to carry out purifying, re-using Eco52 I enzyme cuts, enzyme is cut system for adding 3 μ l, 10 * Basal buffer in 30 μ l systems, pcDNA3 Xho I enzyme is cut product 20 μ l, 0.1%BSA 3 μ l, Eco52 I 2 μ l, 37 ℃ of enzymes are cut 1h.DNALigation Kit Ver.2.1 test kit with TaKaRa is inserted into IgG1 Fc among the pcDNA3, is configured to pcDNA3-IgG1Fc, preserves behind the transform bacteria.
The heavy chain variable region gene H-wt of anti-CD-20 monoclonal antibody, H-1, H-2, H-3, H-4 and pcDNA3-IgG1 Fc use EcoR V (TaKaRa) enzyme to cut respectively, and enzyme is cut system for add 5 μ l, 10 * H buffer, heavy chain variable region gene 30 μ l or pcDNA3-IgG1 Fc 10 μ l in 50 μ l systems, EcoR V3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used promega Wizard SV Gel and PCR clean-up System purification kit to carry out purifying, use Nhe I (TaKaRa) enzyme to cut again respectively, enzyme is cut system for add 5 μ l, 10 * M buffer in 50 μ l systems, heavy chain variable region gene EcoR V enzyme cuts product 30 μ l or pcDNA3-IgG1 Fc EcoR V enzyme is cut product 30 μ l, Nhe I 3 μ l, 37 ℃ of enzymes are cut 1h.Variable region of heavy chain EcoR V and Nhe I enzyme that glue reclaims about 420bp are cut product, and variable region of heavy chain is inserted pcDNA3-IgG1 Fc carrier with the DNA LigationKit Ver.2.1 test kit of TaKaRa, be configured to pcDNA3-H-wt, pcDNA3-H-1, pcDNA3-H-2, pcDNA3-H-3, pcDNA3-H-4 preserves behind the transform bacteria.
The structure of embodiment three, anti-CD-20 monoclonal antibody expression vector
The expression of anti-CD-20 monoclonal antibody gene in eukaryotic cell need by means of one efficiently carrier for expression of eukaryon antibody gene mediation is entered host cell.Need to contain signal sequence in these carriers, replication orgin, one or more marker gene, enhancer sequence, promotor and transcription termination sequence.The present invention adopts commercial pIRESneo3 and pIREShyg (Clontech) to be the basis, the polycistronic principle of utilizing IRES to form is optimized expression vector, make a plurality of marker gene reductions, thus the cell clone of screening anti-CD-20 monoclonal antibody high expression level.
Adopt conventional Protocols in Molecular Biology well known to those skilled in the art, CD20 monoclonal antibody heavy chain is inserted into [Sa curtain Brooker J etc. in mammalian expression vector pIRESneo3d (obtaining) the multiple clone site district of our company preparation by in the pIRESneo3 carrier, inserting the dhfr expression cassette, " molecular cloning test guide ", Beijing Science Press].Concrete operations be pIRESneo3d through EcoR V and BamH I double digestion, the enzyme system of cutting is to add 5 μ l, 10 * K buffer in the 50 μ l systems, pIRESneo3d 15 μ l, EcoR V 3 μ l, BamH I 3 μ l, 37 ℃ of enzymes are cut 1h.Heavy chain expression plasmid pcDNA3-H-wt, pcDNA3-H-1, pcDNA3-H-2, pcDNA3-H-3, pcDNA3-H-4 carrier glue behind EcoR V and BamH I double digestion reclaims the endonuclease bamhi of 1.4Kb, and the enzyme cutting system is the same.With the DNA Ligation Kit Ver.2.1 test kit of TaKaRa heavy chain fragment and pIRESneo3d carrier being carried out cohesive end is connected.The recombinant plasmid pIRESneo3d-H-wt that obtains, pIRESneo3d-H-1, pIRESneo3d-H-2, pIRESneo3d-H-3, pIRESneo3d-H-4 preserve after transforming DH5 α bacterium.
Light chain with the CD20 monoclonal antibody is inserted in the pIRESneo3d-H carrier again.Concrete operations are heavy chain expression plasmid pIRESneo3d-wt, pIRESneo3d-H-1, pIRESneo3d-H-2, pIRESneo3d-H-3, pIRESneo3d-H-4 carrier are through Nru I single endonuclease digestion, and enzyme is cut system for add 5 μ l, 10 * basal buffer in 50 μ l systems, heavy chain expression plasmid 15 μ l, 0.1%BSA 0.5 μ l, Nru I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used promega Wizard SV Gel and PCR clean-up System purification kit to carry out purifying, use CIAP enzyme dephosphorylation again, 10 * AlkalinePhosphatase Buffer, 5 μ l in 50 μ l systems, CIAP 2 μ l, heavy chain expression plasmid Nru I enzyme is cut product 43 μ l, 50 ℃ of reaction 30min make the CIAP enzyme deactivation more than 65 ℃ of heat treated 30min.Light chain expression plasmid pcDNA3-L-wt, pcDNA3-L-1, pcDNA3-L-2, pcDNA3-L-3, pcDNA3-L-4 with NruI and Nae I respectively enzyme cut, enzyme is cut system for add 5 μ l, 10 * basal buffer in 50 μ l systems, light chain expression plasmid 30 μ l, 0.1%BSA 0.5 μ l, Nru I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit of promega to carry out purifying, carrying out enzyme with Nae I again cuts, the enzyme system of cutting is to add 5 μ l, 10 * Lbuffer in the 50 μ l systems, light chain expression plasmid NruI enzyme is cut product 30 μ l, Nae I 3 μ l, 37 ℃ of enzymes are cut 1h.Glue reclaims Nru I～Nae I fragment of the 1.8kb that contains the light chain expression box, and with the DNA Ligation Kit Ver.2.1 test kit of TaKaRa with the light chain expression box respectively with pIRESneo3d-H-wt, pIRESneo3d-H-1, pIRESneo3d-H-2, pIRESneo3d-H-3, pIRESneo3d-H-4 carrier carry out flush end and connect.The recombinant plasmid pIRESneo3d-anti-CD20-wt that obtains, pIRESneo3d-anti-CD20-1, pIRESneo3d-anti-CD20-2, pIRESneo3d-anti-CD20-3, pIRESneo3d-anti-CD20-4 preserve after transforming DH5 α bacterium.Fig. 1 is the design of graphics of the expression vector of CD20 monoclonal antibody.
Embodiment four, the transient expression of anti-CD-20 monoclonal antibody in the HEK-293 cell
Anti-CD-20 monoclonal antibody transfection mammalian host cell can carry out with routine techniques well known to those skilled in the art.When host cell is 293 cells, can select following DNA transfection method for use: coprecipitation of calcium phosphate method [Jordan et al., Nucleic Acids Res.1996 24:4], liposome packing method (as 1ipofectamine 2000) [Audouy S.et al., Mol Membr Biol.2001 18 (2): 129], electroporation and microinjection [Morrison et al., Science 1985 229:1202].We adopt lipofectamine2000 (Cat:invitrogen) infection protocol, and by its operation instruction, the mixture of parallel preparation 1.6 μ g expression vector plasmids and 4.0 μ l lipofectamine 2000 is in the hole of each transfection 12 orifice plate 8 * 10
5Individual HEK-293 attached cell behind the transfection 4h, is cleaned cell once with the DMEM+10%FBS substratum, adds an amount of DMEM+10%FBS substratum again, is sampled to the 7th day every day.
The ELISA detection by quantitative of anti-CD-20 monoclonal antibody adopts sandwich assay to carry out ELISA and detects.Coating buffer is the anti-human IgG of goat (Fc) polyclonal antibody (KPL) of the 1 μ g/ml of 50 μ l, confining liquid is 2%BSA, seal 3h under the room temperature, standard substance are Human IgG1, KAPPA (Sigma), room temperature is placed 4h, and second antibody is the anti-human IgG of horseradish enzyme labelling goat (H+L) (company limited of China fir Golden Bridge in Beijing) of 50 μ l 1:2000 dilution, 37 ℃ of following incubation 2h, the TMB colour developing.The value of reading under the OD450.The results are shown in Figure 2a, compare original series, the expression amount of codon optimized anti-CD-20 monoclonal antibody all increases, and the 7th day expression amount is compared the multiple that is provided with original series and seen Fig. 2 b.Expression amount the highest (Fig. 3 a and Fig. 3 b) with the antibody of L-3 after optimizing and H-3 combination.
The optimization of embodiment five, anti-CD-20 monoclonal antibody expression vector
(1) structure of pIRESneo3hygd-anti-CD20 expression vector
A): the structure of pIREShyg-L-3
The pcr amplification of anti-CD-20 monoclonal antibody light chain gene obtains to contain the L-3 light chain gene of EcoT22 I and Not I restriction enzyme site, and synthetic primer is:
CD20-L-F1/EcoT22?I：5’GCG
ATGCATATGGATTTTCAGGTGCAGATT3’(SEQID?NO：13)CD20-L-R1/Not?I：5’GCG
GCGGCCGCCTAACACTCTCCCCTGTTGAAG3’(SEQ?ID?NO：14)
Adopt conventional Protocols in Molecular Biology well known to those skilled in the art, CD20 monoclonal antibody light chain is inserted in the multiple clone site district of mammalian expression vector pIREShyg (Clontech).Concrete operations are that pIREShyg cuts through EcoT22 I enzyme, and the enzyme system of cutting is to add 5 μ l, 10 * H buffer in the 50 μ l systems, pIREShyg 15 μ l, and EcoT22 I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used promega Wizard SVGel and PCR clean-up System purification kit to carry out purifying.Carry out enzyme with Not I again and cut, the enzyme system of cutting is to add 5 μ l, 10 * H buffer in the 50 μ l systems, 5 μ l 0.1%BSA, and 5 μ l 0.1%Triton X-100, pIREShyg EcoT22 I 15 μ l, Not I 3 μ l, 37 ℃ of enzymes are cut 1h.Light chain PCR product is through EcoT22 I and Not I double digestion, and the enzyme cutting system is the same.With the DNA Ligation Kit Ver.2.1 test kit of TaKaRa light chain segments and pIREShyg carrier being carried out cohesive end is connected.The recombinant plasmid pIREShyg-L-3 that obtains preserves behind the conversion DH5 α bacterium.
B): the structure of pIRESneo3hygd-anti-CD20 expression vector
The light chain of CD20 monoclonal antibody is inserted in the pIRESneo3d-H-3 carrier.Concrete operations are that heavy chain expression plasmid pIRESneo3d-H-3 carrier is through Nru I single endonuclease digestion, enzyme is cut system for add 5 μ l, 10 * basal buffer, pIRESneo3d-H-3 15 μ l, 0.1%BSA 0.5 μ l in 50 μ l systems, Nru I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit of promega to carry out purifying, use CIAP enzyme (TaKaRa) dephosphorylation again, 10 * AlkalinePhosphatase Buffer, 5 μ l in 50 μ l systems, CIAP 2 μ l, pIRESneo3d-H-3Nru I enzyme is cut product 43 μ l, 50 ℃ of reaction 30min make the CIAP enzyme deactivation more than 65 ℃ of heat treated 30min.
Light chain expression plasmid pIREShyg-L-3 cuts through Nru I enzyme, and enzyme is cut system and is adding 5 μ l 10 * basal buffer in 50 μ l systems, 0.5 μ l 0.1%BSA, and pIREShyg-L-3 30 μ l, Mlu I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut and is cut with Xho I enzyme after product uses promega Wizard SV Gel and PCR clean-up System purification kit purifying, enzyme is cut system in 50 μ l reaction systems, 10 * H Buffer, 5 μ l, pIREShyg-L-3Nru I enzyme is cut product 38 μ l, Xho I 2 μ l, 37 ℃ of reaction 1h.Use promegaWizard SV Gel and PCR clean-up System purification kit glue to reclaim 4kb left and right sides fragment.Klenow (TaKaRa) enzyme is mended flat enzyme and is cut product, in 50 μ l reaction systems, and 10 * Klenow FragmentBuffer, 5 μ l, pIREShyg-L-3NruI～Xho I enzyme is cut product 38 μ l, dNTP (2.5mM) 5 μ l, Klenow enzyme (4U/ μ l) 2 μ l.37 ℃ of reaction 1h.With the DNA Ligation Kit Ver.2.1 test kit of TaKaRa light chain expression box and pIRESneo3d-H-3 carrier being carried out flush end is connected.The recombinant plasmid pIRESneo3hygd-anti-CD20 that obtains preserves behind the conversion DH5 α bacterium.Fig. 4 is the design of graphics of the expression vector of pIRESneo3hygd-anti-CD20 anti-CD-20 monoclonal antibody.
(2) structure of pIRESneo3dhfr-anti-CD20 expression vector
A): the structure of pIRESdhfr-L-3
The pcr amplification of anti-CD-20 monoclonal antibody light chain gene obtains to contain the L-3 light chain gene of EcoR V and BamH I restriction enzyme site, and synthetic primer is:
CD20-L-F2：/EcoR?V5’GCG
GATATCATGGATTTTCAGGTGCAGATT?3’(SEQ?IDNO：15)
CD20-L-R2/BamH?I：5’GCG
GGATCCCTAACACTCTCCCCTGTTGAAG?3’(SEQID?NO：16)
Adopt conventional Protocols in Molecular Biology well known to those skilled in the art, CD20 monoclonal antibody light chain is inserted in the multiple clone site district of mammalian expression vector pIRESdhfr (obtaining) of our company preparation by the neo gene among the pIRESneo3 being replaced with the dhfr gene.Concrete operations be pIRESdhfr through EcoRV and BamH I double digestion, the enzyme system of cutting is to add 5 μ l, 10 * K buffer in the 50 μ l systems, pIRESdhfr15 μ l, EcoR V 3 μ l, BamH I 3 μ l, 37 ℃ of enzymes are cut 1h.Light chain PCR product is through EcoR V and BamH I double digestion, and the enzyme cutting system is the same.With the DNA Ligation Kit Ver.2.1 test kit of TaKaRa light chain segments and pIRESdhfr carrier being carried out cohesive end is connected.The recombinant plasmid pIRESdhfr-L-3 that obtains preserves behind the conversion DH5 α bacterium.
B): the structure of pIRESneo3-H-3
Adopt conventional Protocols in Molecular Biology well known to those skilled in the art, CD20 monoclonal antibody heavy chain is inserted in mammalian expression vector pIRESneo3 (Clontech) the multiple clone site district.Concrete operations be pIRESneo3 through EcoRV and BamH I double digestion, the enzyme system of cutting is to add 5 μ l, 10 * Kbuffer in the 50 μ l systems, pIRESneo3 15 μ l, EcoR V 3 μ l, BamH I 3 μ l, 37 ℃ of enzymes are cut 1h.Heavy chain expression plasmid pcDNA3-H-3 carrier glue behind EcoR V and BamH I double digestion reclaims the endonuclease bamhi of 1.4Kb, and the enzyme cutting system is the same.With the DNA Ligation Kit Ver.2.1 test kit of TaKaRa heavy chain fragment and pIRESneo3 carrier being carried out cohesive end is connected.The recombinant plasmid pIRESneo3-H-3 that obtains preserves behind the conversion DH5 α bacterium.
C): the structure of pIRESneo3dhfr-anti-CD20 expression vector
The light chain of CD20 monoclonal antibody is inserted in the pIRESneo3-H-3 carrier.Concrete operations be heavy chain expression plasmid pIRESneo3-H-3 carrier through Nru I single endonuclease digestion, enzyme is cut system for adding 5 μ l, 10 * basal buffer in 50 μ l systems, heavy chain expression plasmid 15 μ l, 0.1%BSA 0.5 μ l, Nru I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit of promega to carry out purifying, use CIAP enzyme (TaKaRa) dephosphorylation again, 10 * AlkalinePhosphatase Buffer, 5 μ l in 50 μ l systems, CIAP 2 μ l, heavy chain expression plasmid Nru I enzyme is cut product 43 μ l, 50 ℃ of reaction 30min make the CIAP enzyme deactivation more than 65 ℃ of heat treated 30min.
Light chain expression plasmid pIRESdhfr-L-3 cuts through Mlu I (TaKaRa) enzyme, and enzyme is cut system and is adding 5 μ l 10 * H buffer in 50 μ l systems, pIRESdhfr-L-3 30 μ l, and Mlu I 3 μ l, 37 ℃ of enzymes are cut 1h.Enzyme is cut product and is used the Wizard SV Gel and PCR clean-up System purification kit glue of promega to reclaim the 3.5Kb fragment, Klenow (TaKaRa) mends flat Mlu I restriction enzyme site, in 50 μ l reaction systems, 10 * Klenow Fragment Buffer, 5 μ l, pIRESneo3-L-3Mlu I enzyme is cut product 38 μ l, dNTP (2.5mM) 5 μ l, Klenow enzyme (4U/ μ l) 2 μ l.37 ℃ of reaction 1h.With the DNA LigationKit Ver.2.1 test kit of TaKaRa the light chain expression box being carried out flush end with the pIRESneo-H-3 carrier respectively is connected.The recombinant plasmid pIRESneo3dhfr-anti-CD20 that obtains preserves behind the conversion DH5 α bacterium.Fig. 5 is the design of graphics of the expression vector of pIRESneo3dhfr-anti-CD20 anti-CD-20 monoclonal antibody.Embodiment six, anti-CD-20 monoclonal antibody are at CHO/dhfr
-Expression in the cell
Among the present invention, produce the anti-CD-20 monoclonal antibody cell, can be incubated in the multiple substratum as Chinese hamster ovary celI.Business-like substratum such as DMEM, MEM, Ham ' s F12, RPMI-1640 (Gibco) can be used for the cultivation of host cell.In addition, Ham et al., Meth.Enz.1979 58:44; Barnes et al., Anal.Biochem.1980 102:255; U.S.Pat.Nos.4,767,707; 4,657,866; Substratum in 4,927,762 all can be used for cultivating host cell.The culture condition of host cell, as temperature, pH value etc. also is a normal condition well known to those skilled in the art.
The anti-CD-20 monoclonal antibody transfection host cell can carry out with routine techniques well known to those skilled in the art as the CHO/dhfr-cell.We adopt liposome lipofectamine 2000 (invitrogen) infection protocol, and by its operation instruction, three kinds of carriers respectively prepare the mixture of 1.5 μ g expression vector plasmids and 4.5 μ l lipofectamine 2000, each transfection 6 * 10
5Individual CHO/dhfr
-Cell after the transfection of spending the night, will be selected the screening of gene in cell evenly distribute to 1 96 orifice plate.
The Chinese hamster ovary celI of anti-CD-20 monoclonal antibody pIRESneo3d-anti-CD20 and pIRESneo3dhfr-anti-CD20 transfection screens under DMEM+5%dFBS+1.0mg/ml G418, the Chinese hamster ovary celI of CD20 monoclonal antibody pIRESneo3hygd-anti-CD20 transfection screens under DMEM+5%dFBS+1.0mg/mlG418+0.6mg/ml hygromycin B, changed screening culture medium in 2～3 days, cultivate and respectively obtain more than 30 screening cell clone 2-3 week.Three kinds of anti-CD-20 monoclonal antibody expression vector transfection CHO cells are respectively got 30 mono-clonals to be reached in 24 orifice plates by identical density, in 0.5ml DMEM+5%dFBS substratum, cultivated 5 days, ELISA detects the expression amount of CD20 monoclonal antibody in the medium supernatant, and wherein the expression amount clone that is higher than 5mg/L the results are shown in Figure 6.
For the anti-CD-20 monoclonal antibody cell that makes G418 or G418 add hygmycin B screening is expressed more efficiently, every kind of carrier reconstitution cell selected 10 high expressing cells with the MTX expression of increasing.Concrete operations are, recombinaant CHO cell is cultivated in the DMEM+5%dFBS substratum, and in culturing process, add the MTX concentration that progressively increases, and continue to monitor the expression level of antibody in the culturing process, when being increased to the cell growth, MTX concentration stops to increase MTX concentration in the time of can't tolerating.When MTX increased to 300nM, cell inserted by identical quantity and contains in the T25 culturing bottle of 5ml DMEM+5%dFBS+300nM MTX substratum, cultivated after five days the expression amount of CD20 monoclonal antibody in the ELISA detection substratum clear liquid, the results are shown in Figure 7.
Embodiment seven, CD20 Purification of Monoclonal Antibodies and SDS-PAGE analyze
Chinese hamster ovary celI nutrient solution 20L filters clarification through the Prostak tangential flow 0.45 μ m of system.Filter the back nutrient solution and advance Protein A Sepharose FF. post affinity purification [Lindmark et al., J.Immunol.Meth.1983 62:1], 0.1M pH2.7 citrate buffer solution wash-out.The affinity chromatography elution peak is transferred pH3.5, incubated at room 1hr with 1M Tris pH9.0.Sample adds solid NaCl to final concentration 1.5M, transfers pH7.5, and 0.45 μ m filters laggard Butyl Sepharose FF hydrophobic chromatography and separates 20mM Na3PO4, pH7.5 wash-out.The HIC elution peak is transferred pH6.3 with 6M HCl, advances CM Sepharose FF and separates 50mM Citrate/250mMNaCl pH7.3 wash-out.The finished product 0.22 μ m filters the back freeze-drying and preserves.Finished product detects purity through HP-SEC, and (Fig. 8 a) more than 97%.Visible heavy chain and the light chain band (Fig. 8 b) that cleans of 13%SDS-PAGE electrophoresis.
Sequence table
(1) general information
(i) applicant: Shenzhou Cell Engineering Co., Ltd.
(ii) denomination of invention: a kind of monoclonal antibody of optimization
(iii) sequence number: 16
(2) information of SEQ ID NO:1:
(i) sequence signature
(A) length: 384
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of light chain codon optimized sequence-1
(iii) sequence description: SEQ ID NO:1
(2) information of SEQ ID NO:2:
(i) sequence signature
(A) length: 384
(category-B type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of light chain codon optimized sequence-2
(iii) sequence description: SEQ ID NO:2
(2) information of SEQ ID NO:3:
(i) sequence signature
(A) length: 384
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of light chain codon optimized sequence-3
(iii) sequence description: SEQ ID NO:3
(2) information of SEQ ID NO:4:
(i) sequence signature
(A) length: 384
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of light chain codon optimized sequence-4
(iii) sequence description: SEQ ID NO:4
(2) information of SEQ ID NO:5:
(i) sequence signature
(A) length: 420
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of heavy chain codon optimized sequence-1
(iii) sequence description: SEQ ID NO:5
(2) information of SEQ ID NO:6:
(i) sequence signature
(A) length: 420
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of heavy chain codon optimized sequence-2
(iii) sequence description: SEQ ID NO:6
(2) information of SEQ ID NO:7:
(i) sequence signature
(A) length: 420
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of heavy chain codon optimized sequence-3
(iii) sequence description: SEQ ID NO:7
(2) information of SEQ ID NO:8:
(i) sequence signature
(A) length: 420
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: anti-CD-20 monoclonal antibody variable region of heavy chain codon optimized sequence-4
(iii) sequence description: SEQ ID NO:8
(2) information of SEQ ID NO:9:
(i) sequence signature
(A) length: 30
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:9
(2) information of SEQ ID NO:10:
(i) sequence signature
(A) length: 34
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:10
(2) information of SEQ ID NO:11:
(i) sequence signature
(A) length: 31
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:11
(2) information of SEQ ID NO:12:
(i) sequence signature
(A) length: 40
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:12
(2) information of SEQ ID NO:13:
(i) sequence signature
(A) length: 30
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:13
(2) information of SEQ ID NO:14:
(i) sequence signature
(A) length: 33
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:14
(2) information of SEQ ID NO:15:
(i) sequence signature
(A) length: 30
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:15
(2) information of SEQ ID NO:16:
(i) sequence signature
(A) length: 31
(B) type: nucleic acid
(C) chain: strand
(D) topological framework: linearity
(ii) molecule type: DNA
(A) describe: primer
(iii) sequence description: SEQ ID NO:16
Claims (6)
1. optimize the method for the expression level of anti-CD20 antibodies according to the peculiar protein gene codon usage frequency of host cell kind for one kind, it is characterized by:
A) determine the frequency of utilization of protein gene codon in the host cell;
B) select each amino acid whose codon usage frequency the highest for preferred codon, frequency of utilization second is high is codon more preferably, what all the other frequencies of utilization were lower is not preferred codon;
C) a certain proportion of not preferred codon in the protein gene sequence is replaced to preferred codon or codon more preferably;
D) check the number of CG sequence, on the basis that guarantees not preferred codon replacement rate, reduce or do not increase the number of CG sequence;
E) codon optimized protein gene is inserted a carrier for expression of eukaryon;
F) will contain target protein expression carrier transfection mammalian cell efficiently expresses.
2. the described method of claim 1 is characterized in that not preferred codon replacement ratio is 20-85%.
3. the described method of claim 1 is characterized in that the source of the anti-CD20 antibodies optimized is selected from mouse source antibody, human antibody or human mouse chimeric antibody.
4. anti-CD-20 monoclonal antibody dna molecular that adopts the described method optimization of claim 1 to obtain is characterized in that the sequence of dna molecular of the variable region of light chain of antibody is SEQ ID NO:3, and the dna molecular of variable region of heavy chain is SEQ ID NO:7.
5. the anti-CD-20 monoclonal antibody expression vector of an optimization comprises the described dna molecular of claim 4, and its concrete structure is seen the pIRESneo3dhfr-anti-CD20 carrier of accompanying drawing 5.
6. an antibody expression method is characterized in that expressing the CD20 antibody protein with the described expression vector of claim 5 in Chinese hamster ovary cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100120013A CN100494370C (en) | 2006-05-26 | 2006-05-26 | Optimized monoclonal antibody |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100120013A CN100494370C (en) | 2006-05-26 | 2006-05-26 | Optimized monoclonal antibody |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN101058807A CN101058807A (en) | 2007-10-24 |
| CN100494370C true CN100494370C (en) | 2009-06-03 |
Family
ID=38865113
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100120013A Active CN100494370C (en) | 2006-05-26 | 2006-05-26 | Optimized monoclonal antibody |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100494370C (en) |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3856910A4 (en) * | 2018-09-24 | 2022-09-28 | Merck Sharp & Dohme Corp. | Expression vectors for eukaryotic expression systems |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103555734B (en) * | 2012-09-17 | 2015-07-15 | 青岛康立泰药业有限公司 | Coding gene of human interleukin-12, eukaryotic host cell and expression method thereof |
| RU2549692C1 (en) * | 2013-10-08 | 2015-04-27 | Федеральное государственное унитарное предприятие "Государственный научно-исследовательский институт генетики и селекции промышленных микроорганизмов" (ФГУП "ГосНИИгенетика") | Infliximab, optimised gene of monoclonal antibody (versions), recombinant cell line, antibody producer and method for biosynthesis thereof |
| CN105820248A (en) * | 2015-01-07 | 2016-08-03 | 上海张江生物技术有限公司 | Method for preparing novel anti-EGFR monoclonal antibody and application thereof |
| CN109988751A (en) * | 2019-01-15 | 2019-07-09 | 济宁学院 | A kind of cell strain construction method being used to prepare the full Humanized monoclonal antibodies of anti-EGFR |
-
2006
- 2006-05-26 CN CNB2006100120013A patent/CN100494370C/en active Active
Non-Patent Citations (4)
| Title |
|---|
| CHARACTERIZATION OF A NEW HUMANIZED ANTI-CD20MONOCLONAL ANTIBODY, IMMU-106, AND ITS USE INCOMBINATION WITH THE HUMANIZED ANTI-22ANTIBODY, EPRATUZUMAB, FOR THE THERAPY OFNON-HODGKIN'S LYMPHOMA. STEIN R, ET AL.CLIN CANCER RES,Vol.10 No.8. 2004 |
| CHARACTERIZATION OF A NEW HUMANIZED ANTI-CD20MONOCLONAL ANTIBODY, IMMU-106, AND ITS USE INCOMBINATION WITH THE HUMANIZED ANTI-22ANTIBODY, EPRATUZUMAB, FOR THE THERAPY OFNON-HODGKIN'S LYMPHOMA. STEIN R, ET AL.CLIN CANCER RES,Vol.10 No.8. 2004 * |
| 人CD20胞外区基因在原核系统中的表达. 洪海燕等.免疫学杂志，第16卷第3期. 2000 |
| 人CD20胞外区基因在原核系统中的表达. 洪海燕等.免疫学杂志，第16卷第3期. 2000 * |
Cited By (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| EP3856910A4 (en) * | 2018-09-24 | 2022-09-28 | Merck Sharp & Dohme Corp. | Expression vectors for eukaryotic expression systems |
Also Published As
| Publication number | Publication date |
|---|---|
| CN101058807A (en) | 2007-10-24 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CA2695484C (en) | Production method of therapeutic proteins based on codon adaptation | |
| EP0770136B1 (en) | Method for selecting high-expressing host cells | |
| AU2008233196B2 (en) | Recombinant expression vector elements (rEVEs) for enhancing expression of recombinant proteins in host cells | |
| Geisse et al. | Eukaryotic expression systems: a comparison | |
| RU2494147C2 (en) | Expression vector of mammals | |
| Schatz et al. | Higher expression of Fab antibody fragments in a CHO cell line at reduced temperature | |
| EP2401295B1 (en) | Method for producing antibodies | |
| CN100494370C (en) | Optimized monoclonal antibody | |
| WO2012063799A1 (en) | Novel expression vector | |
| KR101494072B1 (en) | An expression vector comprising a polynucleotide encoding a modified glutamine synthetase and a method for preparing a target protein employing the same | |
| Mielke et al. | Stabilized, long-term expression of heterodimeric proteins from tricistronic mRNA | |
| US20210317435A1 (en) | Double knock-out cho cell line method of its generation and producing therapeutic proteins therefrom | |
| Yoshikawa et al. | Flow cytometry: an improved method for the selection of highly productive gene‐amplified CHO cells using flow cytometry | |
| CA2611946C (en) | Expression vector and methods of producing high levels of proteins | |
| US20050019925A1 (en) | Intron fusion construct and method of using for selecting high-expressing production cell lines | |
| CN103525867B (en) | Construction and application of vector used for developing high-expression cell strain | |
| AU2012200227B2 (en) | Recombinant expression vector elements (rEVEs) for enhancing expression of recombinant proteins in host cells | |
| Berry et al. | Fc‐Fusion Protein Expression Technology | |
| CA3099955A1 (en) | Novel vector and use thereof | |
| Kunert et al. | Protein Mass Production in Hybridomas and Recombinant CHO Cells | |
| Schüler | Development of a novel expression system for the production of recombinant proteins in Chinese hamster ovary cells based on the selection with a metabolic enzyme | |
| CA2943719A1 (en) | Method for production of polypeptides |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| EE01 | Entry into force of recordation of patent licensing contract |
Assignee: Beijing Yiqiao Shenzhou Biological Technology Co.,Ltd. Assignor: Shenzhou Cell Engineering Co., Ltd. Contract fulfillment period: 2009.10.12 to 2015.10.12 contract change Contract record no.: 2009990001237 Denomination of invention: Optimized monoclonal antibody Granted publication date: 20090603 License type: Exclusive license Record date: 20091110 |
|
| LIC | Patent licence contract for exploitation submitted for record |
Free format text: EXCLUSIVE LICENSE; TIME LIMIT OF IMPLEMENTING CONTACT: 2009.10.12 TO 2015.10.12; CHANGE OF CONTRACT Name of requester: BEIJING SINO BIOLOGICAL INC. Effective date: 20091110 |
|
| DD01 | Delivery of document by public notice |
Addressee: Hu Yueqiu Document name: Notification of Passing Examination on Formalities |
|
| DD01 | Delivery of document by public notice |