CN100482803C - Probe sequence for qualitatively detecting transgenic crop containing Bar gene using fluorescence PCR and reagent case - Google Patents

Abstract

A fluorescence PCR qualitative determination for transgene crop probe sequence containing Bar gene and reagent kit thereof, the probe sequence includes, the probe sequence formed in the region by the extension of the sequence CCGAGCCGCAGGAACCGCAGGAG upstream by 5 bases and downstream by 5 bases. the reagent kit comprise nucleic acid extraction reagent, nucleic acid amplification reagent comprising BarPCR reaction solution, 18s-rRNA reaction solution, Taq enzyme (5U/ul), and UNG (1U/ul) and comparison article. The detecting sensibility of the reagent kit to the transgene crops to the Bar gene can reach 0.1%, and has good sensibility and specificity, As the plant endogenous gene 18S-rRNA is used as an internal standard, false negative can be prevented, and as the result of real time monitoring to the PCR product, testing time is saved substantially, manpower and expenditure consumption is also reduced.

Description

The fluorescent PCR qualitative detection contains Bar gene transgenic crop probe sequence and test kit

Technical field

The present invention relates to a kind of fluorescent PCR qualitative detection and contain Bar gene transgenic crop probe sequence and test kit.

Background technology

Use consultative centre (ISAAA) statistics according to international Agricultural biotechnologies, calendar year 2001, whole world genetically modified crops cultivated area was 5,260 ten thousand hectares, more than ten country planted genetically modified crops, wherein 99% genetically modified crops are planted in the U.S., Argentina, Canada and Chinese, approved commercialization genetically modified crops have soybean, corn, rape, cotton, tomato, potato, pimento, summer squash, pawpaw, beet, Dianthus caryophyllus L., petunia, flax, tobacco, watermelon, witloof etc., nearly 90 kinds of approved commercialization plantation.According to estimates, the food whole world with these genetically modified crops process for processing has nearly ten thousand kinds.

Security to transgenic product, particularly genetically modified food is to the health of humans and animals and to the influence of ecotope, since transgenic technology occurs, it just is the focal issue that international organizations such as countries in the world and United Nations are concerned about always, United Nations had passed through " Biosafety Protocol " in 2000, this protocol is passed in and out to except medicine all, and active genetically modified organisms are relevant to pass by, examine, detect, risk assessment and management, liability for damage etc. have been made detailed regulation, wherein one of most important measure will be tested to transgenic product exactly, with clear and definite its kind, determine whether to be transgenic product approved or that secured permission, to prevent that some transgenic product with risk from spreading arbitrarily, causes irremediable loss.Calendar year 2001, European Union required genetically modified food is carried out identity management, and proposed so long as not intentional pollution, contained in the food to be no more than 1% transgenic product (threshold value) and then need not to identify, and the transgenic product detection not only needs qualitatively like this, also needs detection by quantitative.The country variant threshold size is different, does not wait from 1-5%.China announces and implements " agriculture genetically modified organism security control regulations " May 9 calendar year 2001, and has announced agriculture genetically modified organism safety evaluation, sign and three supporting management ways of import security management on January 5th, 2002.The relevant laws and regulations of various transgenic product have been put into effect in 36 countries and regions, the whole world at present.In a word, the research of transgenic product, producing and selling all will be carried out in particular environment and place under the permission and supervision of relevant government department.

Though United Nations's subsidiary organ (FAO, WHO etc.) and some provincialism international organizations set up unified detection technique in the world and method standard convening, but because inconsistent for the aspects such as security, risk management measure and other interests of transgenic product, the still difficult suggestion of reaching an agreement in various countries at present.The detection technique of comprehensive countries in the world transgenic product, mainly be divided into following three types according to detecting target: detect the foreign gene that inserts, detect exogenous gene expression thing (RNA or protein), detect insert foreign gene to the influence of receptor biological genetic expression (mainly detect foreign gene to insert near the effect gene site and to the influence of whole meta-bolites).Because detection cost height, the required time of the 3rd type are long, and it is lower to be considered to importance, present detection shorter mention in real work to this respect.Related detection target comprises three types in preceding two types testing: DNA, RNA and protein.Mainly use serological method for proteinic detection, because some transgenic product not marking protein or expression amount instability, the serology detection method is only used in indivedual transgenic product detect.Gene diagnosis technology such as PCR and direct nucleic acid hybridization are mainly adopted in detection for DNA and RNA.Up to the present the gene amplification diagnostic method has experienced the development of the following aspects: PCR/ electrophoresis detection, conventional hybridization or order-checking; PCR-ELISA; Real-time fluorescence PCR.

In at present seen genetically modified crops, the goal gene that changes over to is of a great variety, and function is different.In order to make the gene successful expression that changes over to, all need to insert certain exogenous regulating and controlling sequence, statistics shows, 35S promoter, FMV promotor, no terminator, nptII, cry3A, these seven kinds of gene fragments of bar and pat then can cover most GMO kinds when being used as examination purpose target nucleotide sequences.(for details, see the appendix one: the qualitative screening-gene that commercial genetically modified crops kind contains).The Bar gene source is a kind of enzyme gene " the enzyme phosphinothricin acetyltransferase (PAT) in streptomycete Streptomyces hygroscopicus or Streptomyces viridochromogenes.

Summary of the invention

Purpose of the present invention will provide a kind of fluorescent PCR qualitative detection to contain Bar gene transgenic crop probe sequence and test kit exactly.

For achieving the above object, the present invention by the following technical solutions:

Described fluorescent PCR qualitative detection contains Bar gene transgenic crop probe sequence and comprises: sequence C CGAGCCGCAGGAACCGCAGGAG upstream extends 5 bases, extends the sequence that forms in the zone of 5 bases downstream.Upstream primer: ACAAGCACGGTCAACTTCC, downstream primer: ACTCGGCCGTCCAGTCGTA.

Described test kit consists of:

Nucleic acid extracting reagent

Nucleic acid amplification reagent

BarPCR reaction solution (qualitative)

18s-rRNA PCR reaction solution

Taq enzyme (5U/ul)

UNG(1U/ul)

Purified water

Reference substance

The Bar positive reference substance

The 18s-rRNA positive reference substance

Genom sequence is seen appendix two

Nucleic acid extracting reagent is relevant with extracting method, can use traditional DNA of plants extracting method, CTAB method for example, also can adopt Promega company Wizard Magnetic DNA Purification System for Food test kit (CatFF3750,200tests).

Concrete principle of the present invention is to utilize the Auele Specific Primer of a pair of target nucleotide sequences, a specificity fluorescent probe, adopt hot resistant DNA polymerase (Taq enzyme), four kinds of nucleotide monomer compositions such as (dNTP), and use the nucleic acid fragment amplification that round pcr is realized target nucleotide sequences.While combined with fluorescent probe in detecting technology, this probe can combine with primer amplification zone one section template generation of intermediary specificity, carrying out along with the PCR process, the corresponding variation takes place in fluorescent signal, use the fluorescent PCR detector of on-line monitoring, can realize simultaneously the amplification of target nucleotide sequences and detection automatically according to the fluorescent signal of collecting record, are judged the existence of target nucleotide sequences in the sample to be tested.For getting rid of false-negative appearance, this test kit series also comprises the 18s-rRNA gene detection system that plant is total, is used to detect the extraction and the PCR reaction process of sample DNA.

Description of drawings:

Fig. 1: the fluorescent PCR qualitative detection contains Bar gene transgenic crop amplification figure

Positive is: 0.1% corn, 2, be the transgene rape seed, 3, be the Cry9c corn.Negative sample is a U.S. soybean, 0.1%Fluka soybean standard substance, 0% corn.Among Fig. 1,1, be 0.1% corn, 2, be Semen Brassicae campestris, 3, be the Cry9c corn.

Embodiment

Primer, probe design:

The multiple Bar gene order of selecting for use among the GMO (comprise the native sequences of Bar and manually reconstruct sequence) is compared, and selection wherein lacks secondary structure and conservative gene regions designs many to primer.Primer length is generally about 20 bases, and GC content is 50%-60%, no secondary structure and repeatability in the primer, and with the interior no complementary sequence of primer, the melting temperature (Tm) between primer (Tm value) differs less than 5 ℃ between primer.The length of probe is about 25 bases, and the Tm value is worth high about 5 ℃ than primer Tm.As follows according to primer, probe that mentioned above principle is designed:

Upstream: 27u, 46u, 89u, 116u, 129u159u, 195u, 332u, 336u, 383u, 408u, 438u, 479u, 491u, 518u

Downstream: 198r, 278r, 396r, 488r, 498r, 506r, 578r

Probe: BAR143tdB, BAR228fb, BAR422fb, BAR467fb, BAR548fb

Optimum primer, probe sequence are as follows:

Primer: upstream primer: Bar129u:ACAAGCACGGTCAACTTCC

Downstream primer: Bar278r:ACTCGGCCGTCCAGTCGTA

Probe sequence: BAR143tdB:Fam-CCGAGCCGCAGGAACCGCAGGAG-TAMRA

The foundation of reaction system and optimization:

The target region template that is adopted in the foundation of reaction system and the optimization obtains with following method: with the confirmed transgenic rapeseed that changes this gene over to is material, extract genomic nucleic acids with Promega Purification kit, carry out pcr amplification with the primer of the longest amplified fragments in the above-mentioned detection sequence area respectively again.Amplified production carries out 10 times of gradient dilutions with 1 * TE, chooses 10 ^-3, 10 ^-4, 10 ^-5, 10 ^-6, 10 ^-7Totally 5 extent of dilution are serial positive template, and the template when getting Ct value 23 wherein the person is as reaction system optimization later between 27.

The screening of primer, probe:

In the primer screening experiment with above-mentioned upstream primer and downstream primer in conjunction with special probe, pairing experimentizes arbitrarily.The fluorescent PCR instrument adopts PE7700 fluorescent PCR instrument.The PCR reaction system that is adopted is as shown in the table.

The PCR reaction system

The component final concentration

10 * PCR reaction solution 1 *

DNTP (containing dUTP) 0.2mmol/L

Taq enzyme 2Unit

Mg2+ concentration 2.5mmol/L

Primer (upstream) 0.2umol/L

Primer (downstream)	0.2umol/L
		Probe	0.1umol/L
Template DNA	2ul
		Mend DEPC water extremely	40ul

The selection of PCR condition: according to our company's experience in the past, the selection of PCR condition is as follows:

Under same template amount, same reaction conditions, the Ct value and the Rn value that are obtained with the specific fluorescence probe signals of Bar gene order are index (the two can reflect pulsating amount of amplification and matter), the amplification situation of more different primers to making up.Select Ct value and the high person of Rn value, right as the primer that DNA/PCR to be selected detects.

Selected following best primer/probe combinations is a best of breed from repeated experiments repeatedly: upstream primer: Bar 129u; Downstream primer: Bar 278r; Probe: BAR 143tdB.

With the best upstream and downstream primer of selecting to carrying out the optimization of PCR reaction system.

The optimization of primer and concentration and probe concentration

In the experiment primer concentration is increased progressively with 0.1umol/L from 0.1umol/L to 0.8umol/L, concentration and probe concentration increases progressively with 0.025umol/L from 0.025umol/L to 0.2umol/L.Proportioning to primer and probe different concns compares.Best primer and probe final concentration result are as follows::

The best final concentration of probe title: BAR143tdB: 0.1 μ M.

The optimization of magnesium ion concentration

In the experiment magnesium ion concentration is increased progressively with 0.5mmol/L from 1.0mmol/L to 2.5mmol/L.

From repeatedly selecting 2.5mmol/L MgCl the repeated experiments ₂Be test kit reaction system magnesium ion concentration.

The optimization of Taq archaeal dna polymerase (Taq enzyme) consumption

The optimization experiment result of Taq enzyme dosage (in the U of unit), selected 2U Taq enzyme is as using Taq enzyme amount in the test kit.

The optimization of dNTPs concentration

Selected several final concentrations of 0.2mmol in the optimization experiment of dNTPs concentration as test kit dNTPs.

Comprehensive above reaction system optimization experimental result, the PCR reaction system after the optimization sees the following form.

PCR reaction system after the optimization

Component	Final concentration
		10 * PCR reaction buffer (pH=8.9)	1×
Mg 2+Concentration	2.5mmol it is several
		DNTPs (containing dUTP)	0.2mmol/L
The Taq enzyme	2U

Primer (upstream)	0.2umol/L
		Primer (downstream)	0.2umol/L
Probe	0.1umol/L
		Template	2ul
Moisturizing extremely	40ul

The 18s-rRNA gene test

The 18s-rRNA gene is a kind of gene that is present in all plants, so this test kit selects for use it as internal standard gene, is used for that monitoring of DNA is extracted and the whole process of fluorescent PCR, and setting up of 18s-rRNA system is the same, and primer, probe sequence are as follows:

Upstream primer sequence: 18s-rRNA1403u:cctgagaaacggctaccat

Downstream primer sequence: 18s-rRNA1449r:cgtgtcaggattgggtaat

Probe sequence: 18s-rRNA1423fb:FAM-TGCGCGCCTGCTGCCTTCCT-TAMRA

The Bar test kit is formed

Composition (48tests/ box)	Volume
		CTAB method nucleic acid extracting reagent CTAB damping fluid CTAB precipitation buffering liquid precipitate lysate nucleic acid amplification reagent Bar PCR reaction solution (qualitative) 18s-rRNA PCR reaction solution Taq enzyme (5U/ul) UNG (1U/ul) purified water reference substance Bar positive reference substance 18s-rRNA positive reference substance	40ml * 1 pipe 40ml * 1 pipe 24ml * 1 pipe 1ml * 2 pipe 1ml * 2 pipe 40ul * 1 pipe 10ul * 1 pipe 100ul * 1 pipe 30ul * 1 pipe 30ul * 1 pipe

UNG is UNG enzyme (uridylic-N-Glycosylase Uracil-Nglycosylase)

Each component prescription of test kit

BarPCR reaction solution: get qualified 25mmol/L MgCl ₂, 100mmol/L dATP, 100mmol/L dUTP, 100mmol/L dGTP, 100mmol/L dCTP, 50umol/L Bar upstream primer, 50umol/L Bar downstream primer, 50umol/L Bar probe, 10 * PCR damping fluid, 1U/ul UNG and purified water, by following formulated PCR reaction solution.

The reagent composition	Final concentration
		10xbuffer	1x
MgCl 2	2.5mM

dNTPs(u)	200uM
		Taq enzyme (adding in addition during detection)	(2U)
The Bar upstream primer	0.2uM
		The Bar downstream primer	0.2uM
The Bar probe	0.1uM
		Template (adding in addition during detection)	(5ul)
Water
		Final volume (ul)	40ul

CTAB method sample process agent prescription;

The CTAB damping fluid	20g CTAB/L，1.4M NaCl，0.1M Tris/HCl， 20mM EDTA(ph＝8.0)
		CTAB precipitation buffering liquid	5g CTAB/L，0.04M NaCl
Resolution of precipitate liquid	1.2MNaCl

18s-rRNA PCR reaction solution: get qualified 25mmol/L MgCl ₂, 100mmol/L dATP, 100mmol/L dUTP, 100mmol/L dGTP, 100mmol/L dCTP, 50umol/L18s-rRNA upstream primer, 50umol/L18s-rRNA downstream primer, 50umol/L 18s-rRNA probe, 10 * PCR damping fluid, 1U/ul UNG and purified water, by following formulated PCR reaction solution.

The reagent composition	Final concentration
		10 x buffer	1x
MgCl 2	2.5mM
		dNTPs(u)	200uM
Taq enzyme (adding in addition during detection)	(2U)
		The 18s-rRNA upstream primer	0.2uM
The 18s-rRNA downstream primer	0.2uM
		The 18s-rRNA probe	0.1uM
Template (adding in addition during detection)	(5ul)
		Water
Final volume (ul)	40ul

The preparation of purified water

Use the tap water single flash,, collect the water of resistivity 〉=18.0M Ω .cm, store in the aseptic bottle through Millipore MILLI-Q PF PLUS pure water instrument purifying.

The preparation of positive reference substance.

Get corresponding positive, CTAB method sample process reagent extracts DNA, with the above-mentioned DNA for preparing, with the primer amplification longer (using dTTP but not dUTP) than detection reaction amplified fragments, purpose nucleic acid fragment in the above-mentioned PCR product of Wizard PCRPreps DNA Purification System test kit purifying of employing Promega company, with the method for 1.5% agarose gel electrophoresis the amplified production of purifying is carried out quantitatively roughly again, the PGEM-TEasy Vector System II test kit with Promega company is connected the purpose fragment with the T carrier then; To connect product again and be transformed into the JM109 competent cell, use X-Gal and IPTG agar plate screening and cloning purpose bacterium colony then, PCR reaction evaluation.Carry out the amplification of plasmid with the LB liquid nutrient medium.Wizard Plus Minipreps DNAPurification System test kit with Promega company carries out the purification of plasmid at last, still the plasmid of purifying is carried out purity detecting, the positive reference substance mother liquor of eligible with the method for 1.5% agarose gel electrophoresis.Carry out Macrodilution with 1 X TE.

The plasmid of dilution detects with qualified test kit, gets the Ct value 28～30, keeps somewhere in a large number, is used as and joins test kit, also is used as tentative company standard product.

Provide equipment and reagent for oneself

Water-bath, whizzer; Chloroform, Virahol (20 ℃ of precoolings), 70% ethanol (20 ℃ of precoolings)

Be suitable for instrument PE Gene Amp 7700 fluorescent PCR detectors or other suitable fluorescent PCR instrument

Using method

The sample nucleic acid extraction

1.1 the CTAB method is extracted DNA

1.1.1 the plant sample that takes by weighing after 100mg fully pulverizes is put into the 2ml centrifuge tube, adds 800ul CTAB damping fluid, behind the mixing in 65 ℃ of incubations 30 minutes;

1.1.2 centrifugal 10 minutes of 15500g shifts upper strata liquid to the pipe that contains the 400ul chloroform, mixing 30 seconds, again with centrifugal 10 minutes of 15500g until stratified liquid, draw upper strata liquid to clean centrifuge tube;

1.1.3 add 2V CTAB precipitation buffering liquid, incubation is 60 minutes under the room temperature;

1.1.4 mixed solution centrifugal 5 minutes with 15500g is abandoned supernatant;

1.1.5 add 500ul resolution of precipitate liquid dissolution precipitation, and add the 500ul chloroform, mixing after 30 seconds centrifugal 10 minutes with 15500g;

1.1.6 shift supernatant to another new pipe, add 0.6 times of volume Virahol, 15500g is centrifugal 10 minutes behind the abundant mixing, abandons supernatant liquor;

1.1.7 add 70% ethanol 500ul in containing sedimentary tubule, behind the careful mixing washing tube wall centrifugal 10 minutes (15500g), abandon supernatant;

1.1.8 drying at room temperature is dissolved in DNA (if sample DNA did not use the same day, please in-20 ℃ of preservations) in the 100ul aseptic deionized water then.

1.2 the Promega method is extracted the step (alternative) of DNA

The former method sample amount of taking by weighing is 200mg.According to the experience of our company, this measures extremely difficult mixing, so change the sample amount of taking by weighing into 100mg, reagent dosage thereafter and operation steps are then undertaken by former method fully.

2. reagent preparation (area in preparation before the PCR)

Take out from test kit and respectively manage reagent, room temperature is melted, centrifugal 5 seconds of 2000rpm.

A) establishing the needed pipe number of Bar PCR is n (n=sample number * 2+1 pipe blank+1 pipe Bar positive reference substance);

B) establishing the needed pipe number of 18s-rRNA PCR is m (m=sample number * 2+1 pipe blank+1 pipe 18s-rRNA positive reference substance);

Each test reaction system is formulated as follows table:

Bar PCR reaction system	Bar PCR reaction solution 34.6ul	Taq enzyme 0.4ul	UNG 0.06ul
				The 18s-rRnA reaction system	18s-rRNA PCR reaction solution 34.6ul	Taq enzyme 0.4ul	UNG 0.06ul

Calculate the usage quantity of good each reagent, add in the proper volume test tube, thorough mixing is even, adds each 35ul of Bar PCR reaction solution respectively in n the PCR reaction tubes of setting; In m the PCR reaction tubes of setting, add each 35ul of 18s-rRNA PCR reaction solution reaction solution respectively, together be transferred to the sample process district.

2.1 application of sample (sample process district)

If sample DNA is kept at-20 ℃, puts room temperature earlier and thaw.

In the PCR of each setting reaction tubes, add above-mentioned sample DNA solution, purified water (blank) and each 5ul of corresponding positive reference substance respectively, build PCR reaction tubes lid, be transferred to detection zone, place on the quantitative PCR detector and write down sample and put order.

2.2.PCR amplification (detection zone)

2.2.1 cycling condition setting

37℃：5min；95℃：3min；

95 ℃: 15sec, 60 ℃: 1min, 40 circulations.Reaction system is made as 40ul.

(different fluorescent PCR instrument cycling conditions may slightly be adjusted)

2.2.2 instrument detecting channel selecting

All PCR reaction tubes fluorescent signals are collected and are made as the Fam fluorescence channel.

Concrete method to set up please refer to the instrument working instructions.

3. quality control standard

The detected result of Bar blank should be negative;

Ct value≤32.0 of Bar positive reference substance;

The detected result of 18s-rRNA blank should be negative;

Ct value≤30.0 of 18s-rRNA positive reference substance;

These parameters has the person of not meeting, the pcr amplification of should reforming.

4. the result judges

4.1. the threshold setting principle makes the negative control product become negative findings to be as the criterion with the vertex of threshold line just above normal negative control product amplification curve.

4.2. sample to be tested 18s-rRNA Ct value should≤17.0, if not in this scope, then need extract sample DNA again, the pcr amplification of reforming.

4.3. the Ct value of two parallel pipes of same sample is averaged, as the testing sample Ct value of judging usefulness.

Equal 40.0 4.4. sample to be tested Bar measures the Ct value, report Bar gene order feminine gender.(other fluorescent PCR instrument to the expression of feminine gender also may for 0.0 or blank no numerical value)

4.5. sample to be tested Bar measures Ct value≤34.0, reports the Bar gene order positive.

If 4.6. 34.0＜sample to be tested Bar genetic testing Ct value＜40.0 need be done pcr amplification again.

Still＜40.0 report the Bar gene order positive as amplification Bar genetic testing Ct value once more.

Equal 40.0 as amplification Bar genetic testing Ct value once more, then report Bar gene order feminine gender.

The test kit application notice

Relevant Good Laboratory Practice is please carried out in strict accordance with the breadboard management regulation of related gene amplification check of industry administrative responsibile institution promulgation.

Test kit sensitivity is: 0.1%GMO, 0.1% standard substance are done 5 times of dilutions after, still can detect target fragment.

The test of test kit accuracy

3 operator that are skilled in technique respectively do 3 accuracy test experience (amounting to 9 times) at 3 different times in the company, each 10 parts of accuracy reference products of parallel processing.Ct value to per 10 gained is carried out statistical procedures with Microsoft Excel analysis software, draws the CV value of mean value and 10 Ct values, and experimental result shows that the CV value of Ct value shows that below 5.0% this test kit has good accuracy.

The test of test kit specificity

This test kit does not all have non-specific amplification to negative soybean, corn, rape, potato sample, shows that this test kit has good specificity.

All should increase for all DNA of plants.Method by this test kit is extracted DNA, and its Ct value is between 9 to 25.

Preserve and the validity period test

Sample process reagent is put room temperature preservation; Other reagent are put-20 ℃ of preservations, avoid multigelation.From the calibrating qualified from validity period be 12 months.Three batches of test kits of quantity-produced are preserved under the storing temp of test kit requirement from qualified from examining and determine, and every month, proportionately product examine set pattern journey detected once, until 14 months the time, every index is all qualified, determines that therefore the test kit validity period is 12 months.

The invention effect: obtaining best of breed through repeated screening is: upstream primer: Bar129u; Downstream primer: Bar278r; Probe Bar 143tdB.

The DNA that extracts with confirmed genetically modified 0.1% transgenic rapeseed does template, and the Ct value that obtains is between 29.0-33.0, and this is the reliable detection lower limit of present different fluorometric assay instruments; And 0.1% detection sensitivity has reached the examination criteria of present international like product.

Embodiment 1

Choose transgenosis and not genetically modified agricultural-food such as soybean, corn, rape, tomato, potato, extract genomic dna with the Promega paramagnetic particle method, be specially: the 100mg vegetable material of weighing places the 2ml centrifuge tube; Add 500ul LysisBuffer A and 5ul RNase A, with the material mixing; Add 250ul Lysis Buffer B, mixing, room temperature was placed 10 minutes; Add 750ul precipitation buffering liquid, high speed centrifugation behind the mixing (13000 * g) 10 minutes; Draw supernatant in clean 2ml centrifuge tube, add the 50ul magnetic powder fluid, mixing; Add 0.8 volume Virahol in the mixed solution, mixing, room temperature was placed 5 minutes; Centrifuge tube is placed magnet stand last 1 minute, remove clear liquor; Take out centrifuge tube, add 250ul Lysis Buffer B again, mixing is placed on magnet stand last 1 minute, removes clear liquor; Clean magnetic with 1ml70% ethanol, place magnet stand last 1 minute, remove clear liquor; Step repeats 2 times; Take out centrifuge tube, in 65 ℃ of dried baths under dry 5 minutes or the room temperature dry 15-30 minute; Add the 100ul deionized water in the centrifuge tube, in 65 ℃ of dried baths, hatched 5 minutes behind the mixing, move to magnet stand last 1 minute again, draw clear liquor in the clean centrifuge tube of 0.5ml, standby as dna profiling.

Do fluorescent PCR with this test kit and detect, be specially: in the 40ul reaction system, add plant genome DNA 5ul, carry out fluorescent PCR and detect, concrete reaction conditions is the same.After testing, the amplification that all is positive of the genetically modified crops of the above-mentioned Bar of changing over to gene, its detection sensitivity all can reach 0.1%; And not genetically modified agricultural-food such as conventional corn, white maize etc. all do not have amplified signal, point out this primer to having good sensitivity and specificity (specifically seeing figure one).

Primer probe in this test kit also can be done the hybridization probe detection and contain Bar gene transgenic crop.

Wherein:

The methodology principle brief introduction of PCR-ELISA

This experiment will design one couple of PCR primers and a probe, they all with the complementation of template DNA chain, and the combining site of probe is between the primer combining site.With fluorescein (Fluorescein) on a primer 5 ' the end mark of PCR, carry out pcr amplification, the amplified production that obtains has fluorescein-labelled.With vitamin H (Biotin) on 5 ' the end mark of probe, be coated with avidin (Avidin) on the elisa plate simultaneously, the affinity interaction by vitamin H and avidin is coated on probe on the elisa plate.During detection, the amplified production sex change is become strand, on elisa plate, carry out special combining with probe, wash plate, add the fluorescein antibody of horseradish peroxidase again, pass through chromogenic reagent, on enzyme plate, read the OD value, according to the yin and yang attribute of OD value judgement sample.

Embodiment

With 5 ' the end mark vitamin H of above-mentioned probe BAR143td, 3 ' end does not make marks; With fluorescein on 5 ' the end mark of primer Bar278r.Probe is coated on the elisa plate of avidin in advance.

(CTAB method or paramagnetic particle method) extracts the DNA in the sample according to a conventional method.By 10 * PCR damping fluid, dNTPs, Mg ²⁺, Taq enzyme, upstream and downstream primer, H ₂O, and dna profiling composition PCR reaction system increase.

Amplification becomes strand with the amplified production sex change after finishing, and is added to bag by on the elisa plate of probe, if specific amplification is arranged, chain in the amplified production and probe hybridization are washed plate, add enzyme connection fluorescein antibody, wash plate, add developer, developed the color 10 minutes, stop colour developing, on microplate reader, read the OD value, according to the yin and yang attribute of OD value judgement sample.Following table is an experimental result once:

Sample	0.0% corn	0.1% corn	The Cry9c corn	The GMO rape	U.S. soybean	Argentina soybean	0.1% Fluka soybean mark
								The OD value	0.128	0.322	>3.000	>3.000	0.164	0.187	0.128
The result judges	-	+	+	+	-	-	-

Sample	Blank	The Moh810 soybean	0% soybean	Potato	Tomato	Cotton
							The 0D value	0.098	0.127	0.136	0.155	0.164	0.182
The result judges	-	-	-	-	-	-

Experimental result shows: as long as it is all positive through this system's detected result to contain the genetically modified crops of Bar gene order, and the crop that does not contain the Bar gene order detects all negative through this system.

Advantage of the present invention:

1. this test kit can reach 0.1% for the genetically modified crops detection sensitivity that changes the Bar gene over to, illustrates that this test kit has good sensitivity.

2. this test kit does not all have amplified signal for not genetically modified agricultural-food such as soybean, corn etc., illustrates that this test kit has good specificity.

3. because this test kit has adopted fluorescent PCR as detection method, and the equal stopped pipe of entire reaction carries out, avoided other nucleic acid detection methods such as PCR-electrophoresis etc. to be easy to form aerosol and polluted and cause false positive.

4. because this test kit has adopted plant endogenous gene 18S-rRNA as interior mark, avoided false-negative generation.

5. because present method has been carried out real-time monitoring to the PCR product, save detection time greatly, saved manpower and materials.

Remarks:

The capital and small letters such as title of the title of the primer probe that English alphabet is represented, the sequence of primer probe, gene are general;

The English full name of " Ct value " is " Threshold Cycles ", residing cycle number when meaning fluorescent value above threshold value.On different fluorescent PCR instrument, different titles is arranged, but implication is the same.

Appendix one

Appendix two

ATGAGCCCAGAACGACGCCCGGCCGACATCCGCCGTGCCACCGAGGCGGACATGCCG

GCGGTCTGCACCATCGTCAACCACTACATCGAG ACAAGCACGGTCAACTTCCGTACCG

Bar 129u

TGGACGGACGACCTCGTCCGTCTGCGGGAGCGCTATC

BAR143tdB

CCTGGCTCGTCGCCGAGGTGGACGGCGAGGTCGCCGGCATCGCCTACGCGGGCCCCT

GGAAGGCACGCAACGCC TACGACTGGACGGCCGAGTCGACCGTGTACGTCTCCCCCC

Bar278r

GCCACCAGCGGACGGGACTGGGCTCCACGCTCTACACCCACCTGCTGAAGTCCCTGG

AGGCACAGGGCTTCAAGAGCGTGGTCGCTGTCATCGGGCTGCCCAACGACCCGAGCG

TGCGCATGCACGAGGCGCTCGGATATGCCCCCCGCGGCATGCTGCGGGCGGCCGGCTT

CAAGCACGGGAACTGGCATGACGTGGGTTTCTGGCAGCTGGACTTCAGCCTGCCGGTA

CCGCCCCGTCCGGTCCTGCCCGTCACCGAGATCTGA

Sequence table

＜110〉National Entry-Exit Inspection and Quarantine Bureau Animals and Plants Quarantine Laboratory PiJi Biology Engineering Co., Ltd., Shenzhen City

＜120〉the fluorescent PCR qualitative detection contains Bar gene transgenic crop probe sequence and test kit

<130>

<160>6

<170>PatentIn version 3.1

<210>1

<211>23

<212>DNA

＜213〉synthetic

<400>1

<210>2

<211>19

<212>DNA

＜213〉synthetic

<400>2

<210>3

<211>19

<212>DNA

＜213〉synthetic

<400>3

<210>4

<211>20

<212>DNA

＜213〉synthetic

<400>4

<210>5

<211>19

<212>DNA

＜213〉synthetic

<400>5

<210>6

<211>19

<212>DNA

＜213〉synthetic

<400>6

Claims (4)

1, a kind of fluorescent PCR qualitative detection contains Bar gene transgenic crop probe sequence, it is characterized in that: the sequence of described probe sequence is CCGAGCCGCAGGAACCGCAGGAG.

2, the test kit made of a kind of a kind of fluorescent PCR qualitative detection according to claim 1 genetically modified crops probe sequence of containing the Bar gene is characterized in that: the consisting of of described test kit:

Nucleic acid extracting reagent

Nucleic acid amplification reagent

BarPCR reaction solution (qualitative)

The 18s-rRNAPCR reaction solution

Taq enzyme (5U/ul)

UNG(1U/ul)

Purified water

Reference substance

The Bar positive reference substance

The 18s-rRNA positive reference substance

Wherein, the upstream primer sequence of BarPCR reaction solution: ACAAGCACGGTCAACTTCC, downstream primer sequence: ACTCGGCCGTCCAGTCGTA, probe sequence: CCGAGCCGCAGGAACCGCAGGAG; 18s-rRNA upstream primer sequence: cctgagaaacggctaccat wherein, downstream primer sequence: cgtgtcaggattgggtaat, probe sequence: TGCGCGCCTGCTGCCTTCCT.

3, a kind of a kind of fluorescent PCR qualitative detection according to claim 2 contains the test kit that Bar gene transgenic crop probe sequence is made, and it is characterized in that: the consisting of of described test kit:

Composition (48tests/ box) volume

CTAB method nucleic acid extracting reagent

CTAB damping fluid 40ml * 1 pipe

CTAB precipitation buffering liquid 40ml * 1 pipe

Resolution of precipitate liquid 24ml * 1 pipe

Nucleic acid amplification reagent

BarPCR reaction solution (qualitative) 1ml * 2 pipes

18s--rRNAPCR reaction solution 1ml * 2 pipes

Taq enzyme (5U/ul) 40ul * 1 pipe

UNG (1U/ul) 10ul * 1 pipe

Purified water 100ul * 1 pipe

Reference substance

Bar positive reference substance 30ul * 1 pipe

18s-rRNA positive reference substance 30ul * 1 pipe

Each component prescription of test kit:

The BarPCR reaction solution is: final concentration

10×buffer 1×

MgCl2 2.5mM

dNTPs(u) 200uM

Taq enzyme (adding in addition during detection) (2U)

Bar upstream primer 0.2uM

Bar downstream primer 0.2uM

Bar probe 0.1uM

Template (adding in addition during detection) (5ul)

Water

Final volume (ul) 40ul

The 18s-rRNAPCR reaction solution:

Reagent composition final concentration

10×buffer 1×

MgCl ₂ 2.5mM

dNTPs(u) 200uM

Taq enzyme (adding in addition during detection) (2U)

18s-rRNA upstream primer 0.2uM

18s-rRNA downstream primer 0.2uM

18s-rRNA probe 0.1uM

Template (adding in addition during detection) (5ul)

Water

Final volume (ul) 40ul

CTAB method sample process agent prescription is:

CTAB damping fluid 20gCTAB/L, 1.4MNaCl,

0.1MTris/HCl，20mMEDTA(ph＝8.0)

CTAB precipitation buffering liquid 5gCTAB/L, 0.04MNaCI

Resolution of precipitate liquid 1.2MNaCl.

4, a kind of a kind of fluorescent PCR qualitative detection according to claim 1 contains the genetically modified crops probe sequence of Bar gene, it is characterized in that: described probe detects the genetically modified crops that contain the Bar gene as hybridization probe.

Images