CN100480259C - Telomerase inhibitory peptides and uses thereof - Google Patents
Telomerase inhibitory peptides and uses thereof Download PDFInfo
- Publication number
- CN100480259C CN100480259C CNB028208471A CN02820847A CN100480259C CN 100480259 C CN100480259 C CN 100480259C CN B028208471 A CNB028208471 A CN B028208471A CN 02820847 A CN02820847 A CN 02820847A CN 100480259 C CN100480259 C CN 100480259C
- Authority
- CN
- China
- Prior art keywords
- seq
- telomerase
- peptide
- teipp
- teipp1
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N9/00—Enzymes; Proenzymes; Compositions thereof; Processes for preparing, activating, inhibiting, separating or purifying enzymes
- C12N9/10—Transferases (2.)
- C12N9/12—Transferases (2.) transferring phosphorus containing groups, e.g. kinases (2.7)
- C12N9/1241—Nucleotidyltransferases (2.7.7)
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P35/00—Antineoplastic agents
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P43/00—Drugs for specific purposes, not provided for in groups A61P1/00-A61P41/00
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
Abstract
The present invention relates to peptides that inhibit telomerase, and uses of these peptides, particularly in a method of treating cancer. The invention includes telomerase inhibitory peptides having an amino sequence of GARTFRRXKRAXRLTSRVK (SEQ ID NO:1) (wherein X is E or Q) or functional equivalents or fragments thereof. The invention also includes a nucleotide sequence which encodes the telomerase inhibitory peptide (TEIPP).
Description
Technical field
The present invention relates to suppress the peptide of Telomerase, and the purposes of described peptide, the particularly purposes in cancer treatment method.
Background of invention
Telomerase is the specialization ribonucleoprotein complex that the eukaryotic cell fringes of chromosome is stablized and prolonged to a kind of energy, and it plays a significant role in the life-span at cell survival and replicability.
Telomerase is suppressed in a lot of human body somatic tissues, but then is activated at the early stage Telomerase of the tumor development of most of human cancer.
Telomerase is to keep genomic integrity and control cell survival necessary.Thereby cancer cell is kept telomere being immortalized of structure and infinite multiplication by Telomerase.
Telomerase activation is suppressed in multiple somatic tissue, then is activated during the tumor development of most of cancer.Telomerase appears in the cancer of most of types, and the appearance of Telomerase is that cancer development is necessary.
At present to Telomerase in the Telomerase positive cell how to be activated with and function be knowing little of how being regulated.It is necessary that activation is considered to the tumour cell immortalization; The activation-inducing genomic instabilityization of Telomerase and apoptosis.But although telomerase activation plays a role in cancer and other proliferative disorders, the method for effective inhibitor of Telomerase and inhibition Telomerase still awaits illustrating.
Therefore, one aspect of the present invention is to overcome or alleviate some problem of the prior art at least.
Summary of the invention
The invention provides a kind of peptide sequence, its coding has GARTFRRXKRAXRLT
The Telomerase inhibiting peptide (TEIPP) of the aminoacid sequence of SRVK (SEQ ID NO:1), its functional equivalent or variant, wherein X is E or Q.
Preferably, the invention provides a kind of peptide sequence, its coding has the Telomerase inhibiting peptide (TEIPP) of the aminoacid sequence of GARTFRREKRAERLTSRVK (SEQ ID NO:2) or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3), its functional equivalent or variant.
Preferably, the aminoacid sequence of TEIPP is corresponding to 641 to 659 amino acids of natural TERT aminoacid sequence.
The present invention also comprises the nucleotide sequence of (as another embodiment) coding side granzyme inhibiting peptide (TEIPP), and described sequence is selected from following sequence:
A) nucleotide sequence, its coding have the peptide of the aminoacid sequence of GARTFRRXKRAXRLTSRVK (SEQID NO:1), its functional equivalent or variant, and wherein X is E or Q.
B) nucleotide sequence, its coding have the peptide of the aminoacid sequence of GARTFRREKRAERLTSRVK (SEQID NO:2).
C) nucleotide sequence, its coding have the peptide of the aminoacid sequence of GARTFRRQKRAQRLTSRVK (SEQID NO:3).
D) can with a), b) or c) in the nucleotide sequence of sequence hybridization.
E) because the genetic code degeneracy and and a), b) or c) in the nucleotide sequence of sequence degeneracy; With
F) a) functional equivalent of arbitrary sequence, variant-e).
In another embodiment of the present invention, the composition that suppresses Telomerase is provided, described composition comprises Telomerase inhibiting peptide (TEIPP) and carrier, described Telomerase inhibiting peptide contains: the aminoacid sequence of GARTFRRXKRAXRLTSRVK (SEQ ID NO:1), its functional equivalent or variant, and wherein X is E or Q; The aminoacid sequence of GARTFRREKRAERLTSRVK (SEQID NO:2) or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3), its functional equivalent or variant
In the another embodiment of the invention, the composition that suppresses Telomerase also comprises other Telomerase inhibiting peptide, TEIPP1 (TEIPP1), its functional equivalent or variant.
The method that suppresses cell growth in the cell culture is provided in the another embodiment of the invention, described method comprises: impose the Telomerase inhibiting peptide of significant quantity to cell culture, described Telomerase inhibiting peptide is selected from TEIPP, TEIPP1 or its combination, its functional equivalent or variant.
The method of inducing cell death is provided in the another embodiment of the invention, and described method comprises: impose the Telomerase inhibiting peptide of significant quantity, described Telomerase inhibiting peptide is selected from TEIPP, TEIPP1 or its combination, its functional equivalent or variant.
The method for the treatment of cancer or other proliferative disorders in individuality is provided in the another embodiment of the invention, described method comprises: individuality is imposed the Telomerase inhibiting peptide of significant quantity, and wherein the Telomerase inhibiting peptide comprises the peptide of at least a TEIPP of being selected from and TEIPP1 or its functional equivalents variant.
The vaccine of treatment or preventing cancer or other proliferative disorders is provided in the another embodiment of the invention, and wherein vaccine comprises the Telomerase inhibiting peptide, and wherein the Telomerase inhibiting peptide comprises the peptide of at least a TEIPP of being selected from or TEIPP1.
The method of the inducing cell propagation by the generation that suppresses Telomerase inhibiting peptide in the cell is provided in the another embodiment of the invention, and wherein the Telomerase inhibiting peptide is at least one of TEIPP or TEIPP1.
Description of drawings
Fig. 1. human telomerase reverse transcriptase's (hTERT) the diagram and the source of TEIPP peptide.Detected five kinds of peptides, respectively it has been designated as A to E from hTERT.Show sequence and its α-Luo Xuanjiegou of inferring of TEIPP, and marked the residue and the electronegative residue of positively charged in both sides.
Fig. 2. shown peptide from telomerase catalytic subunit, called after TEIPP, its with sequence-and the dependent mode of enzyme/concentration of substrate suppress telomerase activation.(A) the telomere gradient of living again by from each swimming lane of 1 swimming lane to 10 swimming lane, differing 6 Nucleotide quantitatively, radioautograph demonstrates TEIPP to the active restraining effect of Telomerase.From the nuclear Telomerase extract (0.4 μ g) of human breast cancer cell under the situation that has or do not exist different concns TEIPP or non-rule (Scrambled) control peptide in typical telomerase activity experiment with 30 ℃ of incubations 30 minutes, gel electrophoresis analysis synthetic telomeric dna.Shown the telomere gradient, synthetic contrasts non-telomeric dna, the TEIPP of different concns and non-regular peptide.There is RNase in N and the active negative control of block side granzyme.(B) increase of Telomerase extract concentrations suppresses the influence of telomerase activation to TEIPP.The nuclear Telomerase extract of different concns shown in the telomerase activation that has or do not exist TEIPP is analyzed, using.Telomere level in every swimming lane has shown telomerase activation.(C) increase of Telomerase substrate (TS) concentration suppresses the influence of telomerase activation to TEIPP.The TS of different concns shown in the telomerase activation analysis that has or do not exist TEIPP, comprising.Telomere level in every swimming lane has shown telomerase activation.All the result is from one at least two similar experiments.
Fig. 3. shown that TEIPP1 and TEIPP suppress telomerase activation synergistically.(A) by the telomerase activity method, exist or do not have the non-regular control peptide of TEIPP1 (0.2～0.8 μ M) TEIPP that adds deduct (0.2～0.8 μ M) thus situation under incubation Telomerase extract measure the non-regular peptide of TEIPP1 associating TEIPP to the active influence of Telomerase.(B) the TEIPP1 associating influence that TEIPP produced.The result is the mean value SD from three similar experiments.
Fig. 4. shown the survival condition of TEIPP to cell in active influence of Telomerase and the human breast cancer cell culture.(A) in the intact cell TEIPP1 and TEIPP to the active influence of Telomerase.MCF-7 cell of cultivating and usefulness penetratin link coupled TEIPP (7 swimming lane), TEIPP (6 swimming lane), TEIPP1 adds TEIPP (5 swimming lane), the non-regular peptide (S1 of TEIPP1,4 swimming lanes), non-rule T EIPP (S2,3 swimming lanes) or S1 add S2 (2 swimming lane) incubation 15 hours together, detect telomerase activation then in the karyorhexis thing.N, the negative control of telomerase activation.(B, C) TEIPP1 and TEIPP have induced necrocytosis fast.After the TEIPP1 shown in the usefulness and TEIPP handled 24 hours, the floating cell (floating cell) that phase microscope demonstrates mass mortality (B).After 48 hours, in the MCF-7 cell culture, cell number reduces (C) in a large number.The result has represented three independently experiments.
Fig. 5. shown that the aminoacid deletion of TEIPP1 and TEIPP suppresses the influence of telomerase activation to TEIPP.(A) disappearance of the N-of TEIPP or C-stub area can be blocked the inhibitory activity of TEIPP.Mensuration comprises that five kinds of peptides of TEIPP and the clipped form shown in it are to the active influence of Telomerase.There is the contrast of RNaseA in Ctl.There is not synthetic peptide in TE.Provide a result of experiment in three similar experiments.(B) from the multiple peptide of hTERT and multiple TEIPP derivative to the active inhibition effect of Telomerase.(C) from the multiple peptide of hTEP1 and TEIPP1 to the active inhibition effect of Telomerase.
Fig. 6. shown of the phosphorylation of different protein kinases to TEIPP.(A) protein kinase C α (PKC α), ERK1 and cdc 2 protein kinases (CDK1) are to the phosphorylation of TEIPP.TEIPP and Qi Fei rule control peptide with shown in different protein kinases be suitable under the condition of protein phosphorylation incubation (seeing embodiment for details) together.(B) different protein kinases are regulated TEIPP to the active restraining effect of Telomerase to the phosphorylation otherness ground of TEIPP.The inhibition of telomerase of the TEIPP of (P, 4 and 6 swimming lanes) and unphosphorylated (N, 3 and 5 swimming lanes) of the multiple protein tyrosine phosphorylation shown in detection is used.There is the contrast of RNaseA in C (1 swimming lane).T (2 swimming lane), the telomerase activation when not having any form TEIPP.(C) the inhibition activity of the monamino acid of the TEIPP of simulated albumin phosphorylation sudden change reduction TEIPP.Detect TEIPP, non-regular control peptide (A), have the TEIPP mutant (B) of T644D sudden change and have TEIPP mutant (C) that T655D suddenlys change the active influence of Telomerase.Shown in three kinds of concentration under, T644D and T655D have blocked TEIPP fully to the active restraining effect of Telomerase.The result has represented three independently similar experiments.
Detailed Description Of The Invention
Provide a kind of peptide sequence in first aspect of the present invention, its coding has GARTFRRXKRAXRLTSRVK (SEQ ID NO:1), its functional equivalent or The telomerase inhibitory peptides of the amino acid sequence of variant (TEIPP), wherein X is E or Q.
The present invention provides a kind of peptide sequence in a preferred aspect, and its coding has GARTFRREKRAERLTSRV (SEQ ID NO:2) or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3), its functional equivalent or The telomerase inhibitory peptides of the amino acid sequence of variant (TEIPP).
Preferably, this amino acid sequence is corresponding to 641 to 659 of natural TERT amino acid sequence Amino acids.
The applicant has identified the peptide of the inhibition unit that represents the Telomerase complex. With described peptide Be applied to the specific inhibitory effect that the cancer cell culture causes telomerase activation in the body, and induce The conspicuousness apoptosis of the cancer cell of cultivating. In addition, the applicant finds that the inhibitory action of described peptide can Further regulate by the method that changes charged residue and protein phosphorylation. Therefore, the present invention Useful Telomerase and cancer in the therapeutic modality exploitation for the treatment of illness such as malignant tumour is provided Inhibitor.
Human telomerase is made up of RNA subunit and some protein components. RNA subunit (hTR) bag The template that contains the telomeric dna reverse transcription, and protein component comprises the human telomerase reverse transcriptase (hTERT) and with the Telomerase associated protein 1 (hTEP1) of Telomerase copurification. HTR With the hTEP1 wide expression in Normal human tissue, but hTERT is the process at cellular immortalization In speed limit point and follow telomerase activation and express. Reconstitution experiments demonstrates hTERT and hTR Consisted of the lease core structure of Telomerase holoenzyme. Mandatory dystopy in non-immortal human cell Express hTERT and can induce Telomerase prolongation and cell to grow lastingly, this prompting hTERT is telomere The speed limit point of enzymatic activity suppresses Telomerase and then causes telomere corrosion, Growth of Cells ability to weaken, And higher proliferation Apoptosis. Have been found that hTERT and hTEP1 are phosphoproteins, egg White kinase c α is with its phosphorylation, and PP2A is with its dephosphorylation. Phosphorylation and dephosphorization Acidifying reversibly increases and reduces the activity of Telomerase.
HTERT and hTEP1 are large proteins, and their enzymatic activity is by between the Telomerase protein protomer With within molecule in and Molecular interaction control.
Telomerase and telomerase inhibitory peptides can be from any species, comprise people, ox, sheep, Pig, mouse, horse, preferred mammal. Preferably, in tumour, suppress Telomerase.
" telomerase inhibitory peptides " used herein comprises and reduces telomerase activation and/or with telomere Interactional peptide. Preferably, thus this peptide and Telomerase component structure are competed mutually and are reduced telomere Enzymatic activity. Most preferably, activity decreased is that inhibition by telomerase activation causes. Make herein With term " inhibition " or " inhibition " refer to the active basic basic inhibitory action that stops.
For simplicity, except referring else, telomerase inhibitor called after of the present invention TEIPP. When using TEIPP, all comprise its functional equivalents, variant and fragment. TEIPP It is the telomerase inhibitory peptides from the TERT sequence. Most preferred, TEIPP is from people TERT order Row.
Used herein " from " comprise basically and the corresponding peptide in TERT zone, also comprise merit Can the property active variant.
" functional equivalent or variant " used herein refers to bring into play in a similar manner function, but Disappearance, interpolation or replacement be can contain and the activity of peptide sequence or the sequence of function basically do not changed. Described change or not the peptide activity basically, and effectively, and biological function does not have or only Small reduction is arranged.
Term " fragment " refers to the partial peptide sequence, and it is shorter than full length sequence, but with the full length sequence peptide Similar mode is brought into play function.
In this specification, word " comprises " and other form of this word, as " comprising " and " comprises " do not get rid of other additives, component, entity (integers) or step.
The preparation of TEIPP can be adopted for a person skilled in the art well-known any skill Art includes but not limited to, uses the synthetic method of commercial peptide synthesizer device or the TEIPP can be from nature Separate and purifying in the source, or carry out subsequently fragmentation to obtain needed peptide. Synthetic TEIPP Peptide also can be available from commercial source such as Auspep International Pty.Ltd. (Victoria, Australia Big Leah) or Chiron Technologies Pty.Ltd. (Victoria, Australia)
Another aspect that the present invention includes is the nucleotide sequence of coding telomerase inhibitory peptides (TEIPP), and described sequence is selected from following sequence:
A) nucleotide sequence, its coding has GARTFRRXKRAXRLTSRVK (SEQ ID NO:1), the peptide of the amino acid sequence of its functional equivalent or variant, wherein X be E or Q;
B) nucleotide sequence, its coding has GARTFRREKRAERLTSRVK (SEQ The peptide of amino acid sequence ID NO:2);
C) nucleotide sequence, its coding has GARTFRRQKRAQRLTSRVK (SEQ The peptide of amino acid sequence ID NO:3);
D) can with a), b) or c) in the nucleotide sequence of sequence hybridization;
E) because the genetic code degeneracy and and a), b) or c) in the nucleotide sequence of sequence degeneracy; With
F) a) functional equivalent of arbitrary sequence or variant-e).
Therefore can adopt the method reorganization preparation peptide sequence of the present invention of the nucleotide sequence of expressing coding TEIPP.
Term " fragment " is meant that it is shorter than full length sequence when relating to nucleotide sequence, but its can with the full length nucleotide hybridization of the aminoacid sequence of coding Telomerase inhibiting peptide described herein.
When these terms related to the nucleic acid molecule of change, described change can not cause peptide-coding region to read the change of frame, and the optimized encoding biological function does not have to change or only have the peptide of less reduction.
Owing to the degeneracy of genetic code, also comprise the nucleotide sequence of other encode identical or function equivalent aminoacid sequence in the scope of the present invention.The change of described nucleotide sequence can comprise the replacement of the different IPs thuja acid that can produce identical or function equivalent gene product.
TEIPP can be available from sequence wetting ability and electrical characteristic analysis, this Analysis and Identification participate in Telomerase component inner or between intramolecularly and/or intermolecular interactional aminoacid sequence.Can be selected from following sequence: CRAVRSLLRSHYREV (SEQ ID NO:4), GPPSTSRPPRPWDTPC (SEQ ID NO:5), CAREKPQGSVAAPEEEDTD (SEQ ID NO:6), GARTFRREKRAERLTSRVK (SEQ ID NO:2), GARTFRRQKRAQRLTSRVK (SEQ ID NO:3) and ANPALSSDFKTILD (SEQ ID NO:7) or its functional equivalent or variant with the zone of the corresponding natural TERT of these features, or the like.More preferably should the zone corresponding to being selected from following sequence:
7CRAVRSLLRSHYREV
21(SEQ ID NO:4),
306GPPSTSRPPRPWDTPC
321(SEQ ID NO:5),
426CAREKPQGSVAAPEEEDTD
444(SEQ ID NO:6),
641GARTFRREKRAERLTSRVK
659(SEQ ID NO:2),
641GARTFRRQKRAQRLTSRVK
659(SEQ ID NO:3) and
1119ANPALSSDFKTILD
1132(SEQ ID NO:7) or its functional equivalent or variant, or the like.Preferably, the TEIPP peptide is
641GARTFRREKRAERLTSRVK
659(SEQ IDNO:2) or
641GARTFRRQKRAQRLTSRVK
659(SEQ ID NO:3) or its functional equivalent or variant.Can obtain other functional equivalent by changing charged residue.The applicant has been found that in the interaction of charged residue between Telomerase inhibiting peptide and Telomerase holoenzyme and plays an important role.
Preferably, the molecular weight of TEIPP is about 2421 dalton.More preferably, the Telomerase inhibiting peptide is significantly less than the component TERT and the TEP1 (being respectively～130,000 and 300,000 dalton) of Telomerase
Preferably, the TEIPP peptide forms alpha-helix, is the amino-acid residue of electronegative/potential electronegative (phosphorylation site) on the amino-acid residue opposite side for positively charged on the side of this spiral.More preferably, the TEIPP spiral interacts with the electrochemical polarization ditch on Telomerase surface by the electrostatic attraction each other that is subjected to protein phosphorylation (adding the phosphoric acid part) adjusting.Therefore, bound by theory not, telomerase inhibitor of the present invention can cause cancer cell death by following mechanism, and described mechanism comprises interaction and the competition of Telomerase internal sequence that comprises electrostatic force by a kind of, suppresses the interaction between Telomerase and the telomere thus.
Preferably, TEIPP and Telomerase holoenzyme interact.More preferably, the TEIPP peptide forms alpha-helix, is the amino-acid residue of electronegative/potential electronegative (phosphorylation site) on the amino-acid residue opposite side for positively charged on the side of this spiral.More preferably, the TEIPP spiral is by electrostatic attraction each other and interact with the electrochemical polarization ditch on Telomerase surface.Described electrostatic attraction each other can be subjected to the adjusting of protein phosphorylation.
Phosphorylation and the phosphorylation simulation sudden change of inferring phosphorylation site can suppress the inhibit feature of peptide of the present invention.Therefore, the adjusting of phosphorylation mechanism for example reduces or the phosphorylation of arrestin kinase c can strengthen the restraining effect of peptide of the present invention to Telomerase.The example of phosphorylation mechanism includes but not limited to, relates to the mechanism of protein kinase C α, ERK1 and cdc2 protein kinase.
Preferred phosphorylation is regulated and is included but not limited to the phosphorylation of Threonine or serine residue.Most preferably, increase inhibition by residue dephosphorylation to Telomerase at least one or a plurality of these potential phosphorylations.
The composition that suppresses Telomerase is provided in another aspect of the present invention, and described composition comprises: the Telomerase inhibiting peptide (TEIPP) and the carrier that comprise the aminoacid sequence of GARTFRREKRAERLTSRVK (SEQ ID NO:2) or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3), its functional equivalent or variant.
Of the present invention one preferred aspect in, the composition that suppresses Telomerase also comprises other Telomerase inhibiting peptide, TEIPP1 (TEIPP1), its functional equivalent or variant.
TEIPP1 and TEIPP can combine with one another and use, so that synergistic effect to be provided, and/or co-administered with other factor as a mixture part.The mixture that is suitable for can comprise radio isotope or toxin.Preferably, the TEIPP of lower concentration and TEIPP1 unite to make and are used for suppressing Telomerase.Bound by theory not, TEIPP1 and TEIPP can bring into play it in the different loci that is subjected to trans mechanism coordination and act on.
Preferably, the TEIPP1 peptide is selected from following sequence: HRAKRHPRRPPRSPG (SEQID NO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10), DSEPTPHLKTRQRR (SEQ ID NO:11) or its functional equivalent or variant, or the like.More preferably, described peptide is selected from following sequence:
385HRAKRHPRRPPRSPG
399(SEQ ID NO:8),
599TRNEKNRPRRRFLC
612(SEQ ID NO:9),
943WGVTEEETRRNRQLEVC
959(SEQ ID NO:10),
2538DSEPTPHLKTRQRR
2551(SEQ ID NO:11) or its functional equivalent or variant, or the like, the corresponding amino acid of wherein digital corresponding natural TERT molecule.Most preferably, the TEIPP1 peptide is
385HRAKRHPRRPPRSPG
399(SEQ ID NO:8) or its functional equivalent or variant.
Preferably, use the Telomerase inhibiting peptide of micromole's dosage.More preferably, use the Telomerase inhibiting peptide of 0.1-100 μ M.Most preferably, the about 1.8 μ M of half of the maximum inhibition concentration of TEIPP peptide and when about 4.2 μ M near suppressing fully.
Composition of the present invention can be by the following route of administration of individuality is prepared: in oral, per rectum, enteron aisle outer (being intravenously, intramuscular or subcutaneous), the brain pond, intravaginal, intraperitoneal, part (as by pulvis, ointment or drops), in skin, oral cavity, or as mouth or nasal spray.
Composition of the present invention also can comprise the suitable carrier that can promote the peptide picked-up, the perhaps acceptable vehicle of pharmacy.Can in peptide, add the carrier that is suitable for so that the sending of peptide, described carrier comprises in those prior aries well-known, include but not limited to the carrier peptides in DrosophilaAtennapedia homeodomain source, i.e. penetratin (C-RQIKIWFQNRRMKWKK) (SEQ ID NO:12).Preferably, carrier and telomerase inhibitor with etc. mol ratio preparation.
Be used for the sterile powder that the medicinal compositions of the present invention of parenteral injection comprises the acceptable sterile water solution of pharmacy or non-aqueous solution, dispersion liquid, suspension or emulsion and is used for reconstituting before use sterilization injection solution or dispersion liquid.The water-based that is suitable for and the example of non-aqueous carrier, thinner, solvent or vehicle comprise water, ethanol, polyvalent alcohol (as glycerine, propylene glycol, polyoxyethylene glycol or the like) and the mixture that is suitable for thereof, vegetables oil (as sweet oil) and injection organic ester such as ethyl oleate.Can use and coat material such as Yelkin TTS, keep the particle size (under the situation of dispersion liquid) that needs and use tensio-active agent to keep suitable flowability by for example.
Described these compositions also can comprise adjuvant such as sanitas, wetting Agent for Printing Inks, emulsifying agent and dispersion agent.For example parabens, chlorobutanol, phenol Sorbic Acid etc. can guarantee to stop action of microorganisms with multiple antibiotic and anti-mycotic agent.Suitably, it can comprise that also isotonic agent is as sugar, sodium-chlor etc.Can postpone the absorption that the factor that absorbs such as aluminum monostearate and gelatin prolong the injection medicament by comprising.
If needed, and for more effective distribution, compound can be in conjunction with slowly-releasing or targeted delivery systems, as polymeric matrix, liposome and microballoon.
The sterilising treatment of injectable dosage forms can adopt following method, and as the filtration of the filter by holding back bacterium, or by the disinfectant in conjunction with the aseptic solid composite form, it can be dissolved in or be dispersed in the sterilized water or other aseptic injection medium before use.
The solid dosage of oral administration comprises capsule, tablet, pill, pulvis and granule.In described solid dosage, active compound and at least a inertia, pharmaceutical acceptable excipient and carrier mix, described vehicle and carrier be Trisodium Citrate or secondary calcium phosphate and/or a) stopping composition or supplement such as starch for example, lactose, sucrose, glucose, N.F,USP MANNITOL and silicic acid, b) tackiness agent, as carboxymethyl cellulose, alginate, gelatin, polyvinylpyrrolidone, sucrose and Sudan Gum-arabic, c) wetting Agent for Printing Inks such as glycerine, d) disintegrating agent such as agar-agar, lime carbonate, potato or tapioca (flour), Lalgine, specific silicate and yellow soda ash, e) retarding solvent such as paraffin, f) absorption enhancer such as quaternary ammonium compound, g) wetting agent such as hexadecanol and glycerol monostearate, h) sorbent material such as kaolin and bentonite, and i) lubricant such as talcum, calcium stearate, Magnesium Stearate, solid polyethylene glycol, sodium lauryl sulphate and its mixture.In the situation of capsule, tablet and pill, formulation also can comprise buffer reagent.
The solids composition of similar type also can be under the situation of using described vehicle such as lactose or toffee (milk sugar) and high molecular weight polyethylene glycol etc., as the filler of soft hard-filled gelatin capsule.
The solid dosage of tablet, sugar-coat agent, capsule, pill and granule can adopt that well-known dressing is prepared in dressing and shell such as casing and other the existing pharmaceutical formulations technology.They can randomly comprise opacifying agent and can also be a kind of compositions, and described composition only or preferably randomly discharges active ingredient with a kind of delayed mode in the specific region of enteron aisle.The example of available embedding composition comprises polymkeric substance and wax.
If needed, and for more effective distribution, compound can be in conjunction with slowly-releasing or targeted delivery systems, as polymeric matrix, liposome and microballoon.
If active compound can also be the microcapsule formulations that comprises one or more above-mentioned vehicle suitably.
The liquid dosage form of oral administration comprises the acceptable emulsion of pharmacy, solution, suspension, syrup and elixir.Remove the active ingredient beyond the region of objective existence, liquid dosage form also can comprise inert diluent usually used in this field, as water or other solvent, solubility promoter and emulsifying agent such as ethanol, Virahol, ethyl-carbonate, ethyl acetate, phenylcarbinol, peruscabin, propylene glycol, 1,3-butyleneglycol, DIMETHYL FORMAMIDE, oil (particularly, Oleum Gossypii semen, Peanut oil, embryo (germ) oil, sweet oil, Viscotrol C and sesame oil), glycerine, tetrahydrofurfuryl alcohol, polyoxyethylene glycol and sorbitan aliphatic ester and composition thereof.
Except inert solvent, oral compositions also can comprise adjuvant such as wetting agent, emulsification and suspending agent, sweeting agent, seasonings and perfuming agent.
Remove the active ingredient beyond the region of objective existence, suspension also can comprise suspension agent, for example isooctadecane alcohol, polyoxyethylene sorbitol and the sorbitan ester of ethoxylation, Microcrystalline Cellulose, inclined to one side aluminium hydroxide (aluminum metahydr0xide), bentonite, agar-agar, western alpine yarrow glue and its mixture.
Can with compound of the present invention and the nonirritant excipient that is suitable for or carrier such as theobroma oil, polyoxyethylene glycol or suppository with wax phase mix prepare be used for rectum or vagina administration composition its be preferably suppository, described suppository with wax at room temperature for solid-state be liquid under body temperature, therefore can melt and discharge active compound at internal rectum or intravaginal.
The topical application formulation of The compounds of this invention comprises pulvis, sprays, ointment and inhalation.Active compound mixes mutually with the stablizer of pharmaceutical acceptable carrier and any needs, the propelling agent that damping fluid maybe may need under aseptic condition.
TEIPP1 in the composition or TEIPP can also put together or connect other molecule, as antigen, antibody, part or cytotoxic agent such as toxin or radio isotope.
In another aspect of the present invention, a kind of method that suppresses cell growth in the cell culture is provided, described method comprises that the pair cell culture imposes the Telomerase inhibiting peptide of significant quantity, and described Telomerase inhibiting peptide is selected from TEIPP1, TEIPP or its combination, its functional equivalent, variant or fragment.
" cell growth inhibiting " of Shi Yonging includes but not limited to herein, and inducing cell death significantly reduces cell proliferation or inducing cell aging.Preferably, cell growth inhibiting is relevant with intracellular apoptosis.
Cell culture includes but not limited to, primary culture, cell transformed system, cancer cells, immortalized cell line or explant culture.Preferably, cell culture is the breast cancer cell culture.More preferably, cell culture is PMC42 or MCF-7 cell culture.
Preferably, use the Telomerase inhibiting peptide of micromole's dosage.More preferably, use the Telomerase inhibiting peptide of 0.1-100 μ M.Most preferably, half of the maximum inhibition concentration of TEIPP1 and TEIPP peptide is about 0.4 μ M and 1.8 μ M respectively, and approaching inhibition fully when being about 1.0 μ M and 4.2 μ M respectively.
TEIPP1 and TEIPP can combine with one another and use so that synergistic effect to be provided, and/or co-administered with other factor as a mixture part.The mixture that is suitable for can comprise radio isotope or toxin.Preferably, the TEIPP of lower concentration and TEIPP1 unite to make and are used for suppressing Telomerase.Bound by theory not, TEIPP1 and TEIPP can bring into play it in the different loci that is subjected to trans mechanism coordination and act on.
The method of inducing cell death is provided in another aspect of the present invention, and described method comprises: impose the Telomerase inhibiting peptide of significant quantity, described Telomerase inhibiting peptide is selected from TEIPP, TEIPP1 or its combination, its functional equivalent, variant or fragment.
" necrocytosis " of Shi Yonging herein includes but not limited to, apoptosis, necrosis or molten born of the same parents.Preferably, necrocytosis is relevant with apoptosis.The interior degraded of nuclear that can adopt the blebbing of (but being not limited to) serous coat, cell volume to reduce, examine condensing and nucleosome gap duplex dna comes characterize cell death.
Another aspect of the present invention provides a kind of method for the treatment of individual cancer or other proliferative disorders, and described method comprises:
Individuality is imposed the Telomerase inhibiting peptide of effective dose, and wherein the Telomerase inhibiting peptide comprises the peptide of at least a TEIPP1 of being selected from, TEIPP or its functional equivalent variant.
TEIPP1 and TEIPP can combine with one another and use and/or co-administered with other factor as a mixture part.The mixture that is suitable for can comprise radio isotope or toxin.Preferably, the TEIPP of lower concentration and TEIPP1 unite to make and are used for suppressing Telomerase.Bound by theory not, TEIPP1 and TEIPP can bring into play it in the different loci that is subjected to trans mechanism coordination and act on.
" cancer " of Shi Yonging comprises malignant tumour and cell thereof herein, also comprises preceding tissue of cancer and cancer and cell.Individuality can comprise people, ox, sheep, pig, mouse, horse, preferred mammal from any species.Preferably, cancer is epithelium cancer such as mammary cancer, prostate cancer, kidney, thyroid carcinoma or lung cancer, is derived from mesoblastic sarcoma or is derived from the leukemia of blood.
The term of Shi Yonging " precancerous cell " is meant the cell that shows the Histological change relevant with cancer development excessive risk herein.Example comprises the mole and the atypical hyperplasia of mammary gland of adenoma of colon polyp, dermatodyspasia.Usually the specific symptoms that shows precancerous cell also uses term " before the cancer " to represent, comprises dysplastic nevus syndromes and polyp of colon syndromes.Whether " before the cancer " is meant these cells or the syndrome of multiple tissue, and can discern clinically regardless of described cell.
Proliferative disorders of the present invention includes, but not limited to illness relevant with telomerase activation or that be correlated with the telomerase activation that relative standard state increases.
The aminoacid sequence of peptide is shorter than the albumen that constitutes our health assembly, and peptide is easier to absorb and be easier to be delivered in the body as medicine than albumen as nutrition.
Telomerase inhibiting peptide of the present invention can be by the following route of administration of individuality is prepared: in oral, per rectum, enteron aisle outer (as intravenously, intramuscular or subcutaneous), the brain pond, intravaginal, intraperitoneal, part (as by pulvis, ointment or drops), in skin, oral cavity or as mouth or nasal spray or with or carry out injecting in the tumour without endoscope.
The Telomerase inhibiting peptide can be used at any time.Preferably, after cancer or proliferative disorders diagnosis, use the Telomerase inhibiting peptide.Preferably, use the Telomerase inhibiting peptide that the micromole suppresses dosage.More preferably, use the Telomerase inhibiting peptide of 0.1-100 μ M.
The Telomerase inhibiting peptide can be in conjunction with vector administration so that the picked-up of peptide.The carrier that is suitable for comprises in those prior aries well-known, includes but not limited to the carrier peptides in Drosophila Atennapedia homeodomain source, i.e. penetratin (C-RQIKIWFQNRRMKWKK) (SEQ ID NO:12).Preferably, carrier and telomerase inhibitor with etc. mol ratio preparation.
Preferably, the TEIPP peptide forms alpha-helix, is the amino-acid residue of electronegative/potential electronegative (phosphorylation site) on the amino-acid residue opposite side for positively charged on the side of this spiral.More preferably, the TEIPP spiral interacts with the electrochemical polarization ditch on Telomerase surface by the electrostatic attraction each other that is subjected to protein phosphorylation (adding the phosphoric acid part) adjusting.
" significant quantity " of Shi Yonging is meant and can suppresses cancer growth or diffusion herein, or alleviates the amount of proliferative disorders or inducing cell death.Preferably, individuality is treated the death that causes cancer cells or proliferative disorders cell with the Telomerase inhibiting peptide.More preferably, the Telomerase inhibiting peptide can cause necrocytosis by following mechanism, and described mechanism comprises by interaction that comprises electrostatic force and the competition of Telomerase internal sequence, suppresses the interaction between Telomerase and the telomere thus.Most preferably, cause the necrocytosis relevant with the treatment of Telomerase inhibiting peptide with apoptosis.
The vaccine of treatment or preventing cancer or other proliferative disorders is provided in another aspect of the present invention, and wherein vaccine comprises the Telomerase inhibiting peptide, and wherein the Telomerase inhibiting peptide comprises the peptide of at least a TEIPP of being selected from and TEIPP1.
The method of the inducing cell propagation by the generation that suppresses Telomerase inhibiting peptide in the cell is provided in another aspect of the present invention, and wherein the Telomerase inhibiting peptide is at least one of TEIPP or TEIPP1.
Appended embodiment and accompanying drawing are to more detailed description of the present invention.But it should be understood that: following description just is used for illustrating rather than on any way scope of the present invention being made restriction.
Embodiment
Embodiment 1: the Telomerase inhibiting peptide is to the active competitive inhibition of Telomerase
Use following chemical reagent, protein kinase and peptide to detect inhibitor.ATP, the Taq archaeal dna polymerase, dNTP and T4 gene 32 albumen are available from Boehringer Mannheim AustraliaPty. company limited (New South Wales, Australia).[α-
32P] ATP and [γ-
32P] ATP is available from Amersham Australian Pty. company limited (New South Wales, Australia).Gel electrophoresis reagent is available from Bio-Rad.All other chemical reagent is available from Sigma Chemical.Protein kinase B α (Akt1), (cyclin dependant protein kinase 1 is CDK1) available from Upstate Biotechnology company (Lake Placid, New York) for extracellular signal-regulated kinase 1 (ERKl) and cdc2 protein kinase.Protein kinase C α available from BIOMOL ResearchLaboratories company (Plymouth Meeting, PA).Casein kinase i, casein kinase i I and dna dependent protein kinase available from Promega Corporation (Madison, WI).
The analysis of sequence wetting ability and charge characteristic be used to identify inner with the Telomerase component or between the intramolecularly potential aminoacid sequence relevant with molecular interaction.The regional corresponding peptide of synthetic high both sexes with human telomerase associated protein 1 (hTEP1) and human telomerase reverse transcriptase (hTERT), and through the Auspep International Pty. (Victoria of company limited, Australia) or ChironTechnologies Pty. company limited (Victoria, Australia) with described peptide purification to purity 90%.
Different zones according to human telomerase reverse transcriptase (hTERT) has prepared five kinds of peptides, has synthesized four kinds of peptides according to the different zones of human telomerase associated protein 1 (hTEP1).Described four kinds of peptides from hTEP1 are
385HRAKRHPRRPPRSPG
399(TEIPPI) (SEQ IDNO:8),
599TRNEKNRPRRRFLC
612(SEQ ID NO:9),
943WGVTEEETRRNRQLEVC
959(SEQ ID NO:10) and
2538DSEPTPHLKTRQRR
2551(SEQ ID NO:11).Described five kinds of hTERT peptides are
7CRAVRSLLRSHYREV
21(SEQ ID NO:4),
306GPPSTSRPPRPWDTPC
321(SEQ ID NO:5),
426CAREKPQGSVAAPEEEDTD
444(SEQ ID NO:6),
641GARTFRREKRAERLTSRVK
659(TEIPP) (SEQ ID NO:2) and
1119ANPALSSDFKTILD
1132(SEQ ID NO:3).In addition, as shown in each embodiment, from identical supplier also obtained some brachymemmas with the sudden change peptide.
Subsequently these peptides are carried out the telomerase activation experiment to determine whether they can competitively regulate telomerase activation.Adopt telomerase activation (TRAP) assay method.Basically according to Kim, N.W., Piatyszek, M.A., Prowse, K.R., Hraley, C.B., West, M.D., Ho, P.L., Coviello, G.M., Wright, W.E., Weinrich, S.L. and Shay, J.W. (1994) Science 266, the content of being put down in writing among the 2011-2015 is implemented the TRAP assay method to determine that multiple peptide is to the active influence of Telomerase.Briefly, the nuclear Telomerase extract of same amount (0.4 μ g) carries out incubation under the situation that has or do not exist the synthetic peptide of difference shown in each embodiment.Behind the incubation, the telomere with pcr amplification is lived again obtains
32The product of P mark carries out electrophoretic analysis, radioautograph subsequently with the polyacrylamide slab gel.For getting rid of peptide to any potential impact of PCR reaction, behind incubation, the synthetic telomere that will live again with phenol and chloroform extracts, use side granzyme and isolating telomere in pcr amplification.In addition, influence so that monitor non-specific PCR by using additional primer NT (ATCGCTTCTCGGCCTTTT) (SEQ ID NO:13) and TSNT (AATCCGTCGAGCAGAGTTAAAAGGCCGAGAAGCGAT) (SEQ ID NO:14) to use internal contrast.All comprise negative control in the experiment of each mensuration telomerase activation, described negative control comprises RNase-A, the alkaline phosphatase of adding, thereby or by being heated to the sample of 80 ℃ of deactivation Telomerases.
Under different concns, two kinds of peptides, promptly TEIPP1 and TEIPP demonstrate and can suppress telomerase activation.Corresponding to hTEP1
385-399Half of maximum inhibition concentration of TEIPP1 in zone be 0.4 μ M and when 1 μ m near suppress fully (Li, H., Cao, Y., Berndt, M.C., Funder, J.W., and Liu, J.P. (1999) Oncogene18,6785-6794).Corresponding to hTERT
641-6559Half of maximum inhibition concentration of TEIPP (Fig. 1) be 1.8 μ M and when 4.2 μ M near suppressing (Fig. 2 A) fully.Irregular control peptide and do not have the effect that suppresses telomerase activation from other peptide (shown in Fig. 1 legend) of hTEP1 and hTERT different zones, this has confirmed that TEIPP1 and TEIPP produce inhibiting specificity, and it depends on aminoacid sequence and peptide concentration two aspect factors.
Whether active inhibition relies on the amount of Telomerase extract and/or the amount of Telomerase substrate DNA (TS) to Telomerase in order to disclose TEIPP1 and TEIPP, has analyzed the activity of Telomerase under the situation that has or do not exist different concns Telomerase extract or TS (increasing or reduce TEIPP1 or TEIPP).The nuclear Telomerase extract amount that increases can cause the increase of basic telomerase activation, and TEIPPI (not shown) and TEIPP (Fig. 2 B) have then overcome the dose-dependently mode to the inhibition of Telomerase.This effect peptide degraded no thanks to, this is can not reverse play a role on the Telomerase restraining effect (data not shown) because the nuclear Telomerase extract amount that increases can cause the increase (Fig. 2 B) of basic telomerase activation and the mixed system of different proteinase inhibitor different concns.In addition, concentration to the 1 μ M that increases TS can not change telomerase activation under the situation that does not have TEIPP, nor can influence TEIPP1 (not shown) or TEIPP (Fig. 2 C) to the active restraining effect of Telomerase.Therefore, thus TEIPP suppresses telomerase activation by competing mutually with the ad hoc structure of Telomerase component rather than with Telomerase substrate DNA.
Since TEIPP1 and TEIPP all be with clean positive electricity and also be rich in arginine, by the TEIPP1 that measures different concns add TEIPP to the active influence of Telomerase just can determine these two kinds of peptides whether with the same loci interaction of Telomerase holoenzyme.Although the non-regular peptide of TEIPP can not influence TEIPP1 to the active restraining effect of Telomerase at different concns (1-4 μ M), the TEIPP of lower concentration has strengthened TEIPP1 to the active inhibition effect of Telomerase, and these concentration of still independent use TEIPP are minimum to the influence of basic telomerase activation.These Notes of Key Datas TEIPP1 and TEIPP play a role in different loci by trans mechanism coordination.
Embodiment 2:TEIPP is to the work of the cell viability in telomerase activation and the cell culture
With.
Be to determine the biological activity of Telomerase inhibiting peptide in cell proliferation, cultivator mammary cancer MCF-7 cell, and with or handle to carry out its telomerase activation and cytobiology analysis without TEIPP1, TEIPP, the two combination or irregular control peptide.
TEIPP1, TEIPP and their non-regular peptides are not separately modified, or be cross-linked to the penetratin (carrier peptides (C-RQIKIWFQNRRMKWKK) (SEQ ID NO:12) in Drosophila Antennapedia homeodomain source by the terminal Cys-Cys key of N-, it is described in Schwarze, S.R., and Dowdy, S.F. (2000) Trends Pharmacol Sci21,45-48).Form with carrier-peptide conjugate in the human breast carcinoma MCF-7 cell of cultivating is introduced peptide, and (sees figure) in contrast with carrier-carrier and carrier-non-rule peptide.In brief, penetratin or Telomerase inhibiting peptide (600 μ M) use respectively three-(2-propyloic) phosphine hydrochlorides (TCEP, Molecular Probes) with etc. mol ratio handle.Before the TEIPP with ultimate density～100 μ M is used for cell culture, mix the penetratin and the TEIPP of equimolar amount, in 37 ℃ of incubations 1 hour.In handling back 24 hours, 48 hours and 72 hours detection morphocytologies and counting.
Handle the remarkable restraining effect that the MCF-7 cell brought out telomerase activation in 24 hours with TEIPP1 and TEIPP, unite and use TEIPP1 and TEIPP to carry out result to have caused in the MCF-7 cell culture the restraining effect that increases at telomerase activation.
With death and the vigor of phase microscope observation with the cell of peptide processing, the different time after the peptide transduction is taken Photomicrograph.There is or is not existed terminal enzyme (DNA) in the cell of fixed and perviousness in suitable damping fluid, carry out incubation under the situation of fluorescein-dUTP and tetramethyl-rhodamine-5-dUTP, carry out TUNEL (TdT-mediated dUTP nick end labeling-vitamin H otch end mark (TdT-mediated dUTP-biotin nick endlabelling)) according to standard step.Include the positive and negative control in each experiment.Detect the chromosomal DNA of fluorescently-labeled specific antigens or fracture with fluorescent microscope.
After handling 24 hours with TEIPPI or TEIPP, necrocytosis all appears, show as that buoyant takes off wall round cell (Fig. 4 B) in the substratum.After handling 48 hours with TEIPP1 or TEIPP, flushing is also removed dead cell from substratum, all observes to surpass 50% loss cell (Fig. 4 C) in substratum.The result that TEIPP1 and TEIPP unite use causes the necrocytosis moderate to increase, and TUNEL has determined by the inductive necrocytosis of Telomerase inhibiting peptide and apoptosis-related (not illustrating).
Embodiment 3: peptide sequence and activation analysis
Be the minimal structure of research Telomerase inhibiting peptide, the N-of disappearance TEIPP and the amino-acid residue of C-end regions use the telomerase activity method to detect the TEIPP of brachymemma then.As shown in Figure 5, N-or the C-end regions of disappearance TEIPP all can make it not have the active restraining effect of Telomerase (Fig. 5 A and B).
The sudden change of TEIPP acidic residues can strengthen the inhibition of telomerase of TEIPP, this points out electronegative residue to play a significant role in the Telomerase restraining effect of peptide, and can obtain to have kept specific live end granzyme inhibiting peptide by modifying these residues.
Glutaminic acid residue is replaced with the inhibition of telomerase that glutamine can strengthen TEIPP, then eliminated with aspartic acid replacement Threonine or Serine and suppressed active (Fig. 5 B).Similar, the serine residue among the TEIPP1 is replaced with the inhibition activity (Fig. 5 C) that aspartic acid also can reduce peptide.Especially, potential phosphorylation site Threonine 644, Threonine 655 or Serine 656 are replaced with the inhibition activity that aspartic acid has then been eliminated TEIPP.Therefore the TEIPP spiral may interact with the electrochemical polarization ditch on Telomerase surface by the electrostatic attraction each other that is subjected to the protein phosphorylation adjusting.
These data presentation play an important role in the interaction of charged residue between Telomerase inhibiting peptide and Telomerase holoenzyme.
Because hTEP1 and hTERT are phosphorproteins, its phosphorylation is very important to telomerase activation, and because TEIPP comprises the serine/threonine phosphorylation site of deduction, we have determined whether the retarding effect of TEIPP can carry out reversible by protein phosphorylation and regulate.
Telomerase suppress the wild-type of polypeptide l (TEIPP1) and Telomerase inhibition polypeptide 2 (TEIPP) and mutant respectively comprise ATP (～40 μ M, 3 μ Ci[γ-
32P] ATP), Mg
2+(1mM) and in the phosphorylation damping fluid (50 μ l) of other kinases specificity activator with multiple protein kinases incubation together.This reacts on and carried out under 30 ℃ 10 minutes, uses the souring method termination reaction, the cooling reactant.The protein kinase of purifying comprises casein kinase i (10 units), casein kinase i I (10 units), protein kinase B α (Akt1,500ng), protein kinase C α (25ng), the protein kinase of extracellular Signal Regulation (ERK1,200ng), cdc2 protein kinase (15ng) and dna dependent protein kinase (15 units).Before the use, comprising ATP (100 μ M), Mg
2+(10mM), (PDK1 is 5ng) in 30 ℃ of following activated protein kinase B30 minutes with PI (3,4,5) P3-deopendent protein kinase 1 in the suitable damping fluid (20ul) of phosphatidylserine (80 μ g/ml) and glycerol dioleate (8mg/ml).Use phosphatidylserine (40 μ g/ml), glycerol dioleate (4mg/ml) and Ca
2+(200 μ M) activated protein kinase C a and with linear DNA plasmid (300ng/ μ l) activated dna deopendent protein kinase.With protein kinase B, protein kinase C α and ERK1 respectively parallel phosphorylation crostide, MARCKS peptide and myelin basic protein (MBP) in contrast.With the peptide point of phosphorylation on the P81 chromatographic paper, then with 75-mM phosphoric acid flushing chromatographic paper to remove free
32P-ATP counts with the β counter then.For determining the peptide phosphorylation to the active influence of Telomerase, under the condition that cold ATP exists, in 32 ℃ down with multiple protein tyrosine phosphorylation TEIPP and control peptide 30 minutes, by being heated to 80 ℃ of 2 minutes and termination reactions.The phosphorylation mixture is used for the analysis of telomerase activation subsequently.
As shown in Figure 6A, with TEIPP and multiple protein kinases incubation, casein kinase i as a result, casein kinase i I, protein kinase B and dna dependent protein kinase do not make the peptide phosphorylation, but non-regular control group then is able to phosphorylation by protein kinase B.On the contrary, protein kinase C α, the degree of ERK1 and cdc2 protein kinase phosphorylation TEIPP is higher than non-regular control group (Fig. 6 A).The known substrate of protein kinase B, protein kinase C α or ERK1 compared with the TEIPP phosphorylation shown that protein kinase C α or ERK1 will be higher than phosphorylation level to protein kinase C substrate MARCKS peptide and ERK1 substrate myelin basic protein (MBP) to the phosphorylation level of TEIPP.
For determining the potential effect of TEIPP phosphorylation, by protein kinase C α, ERK1 and cdc2 protein kinase carry out chemistry phosphorylation quantitatively to TEIPP, detect phosphorylated peptide subsequently to the active effect of Telomerase respectively.Can not influence TEIPP to the active restraining effect of Telomerase although demonstrate with the peptide of protein kinase B or casein kinase i I incubation, by protein kinase C α, the peptide of cdc2 protein kinase (Fig. 6 B) or ERK1 (not shown) phosphorylation all demonstrates the inhibition activity of reduction.The phosphorylation site Threonine of inferring
644, Threonine
655And Serine
656Sport aspartic acid with the simulation phosphorylation, the result has eliminated TEIPP to the active retarding effect of Telomerase (Fig. 5 B and 6C).
Participate in electrostatic interaction and be subjected to the hypothesis of adjusting of protein phosphorylation consistent, TEIPP is by protein kinase C α, ERK 1 and cdc 2 protein kinases and phosphorylation, and be not to pass through casein kinase i, casein kinase i I, protein kinase B or dna dependent protein kinase phosphorylation.Phosphorylation and the phosphorylation site of inferring sport the simulation phosphorylation simulation sudden change of aspartic acid, have all suppressed the inhibit feature of TEIPP, and this prompting TEIPP sequence is a straining element, and it can be by closing the phosphorylation of Threonine or serine residue.These discoveries provide a kind of specious mechanism thus, thus wherein protein kinase C by protein phosphorylation shutdown side granzyme holoenzyme from the inhibition element, and then induce telomerase activating.Therefore the molecular targeted effect of these regulatory elements can provide a kind of new mode that suppresses Telomerase in high proliferation or immortalized cells.
At last, should understand under the situation that does not deviate from spirit described in the invention, implementing the present invention can have a lot of other changes and/or modification.
Organize the applicant
Street: Alfred Laane
City: Prahran
State: Victoria
Country: Australia
Postcode: 3191
Phone: 613 8,532 1111
Fax:
The Email address:
＜110〉organization name: The Baker Medical Research Institute
Nature person applicant
Street: 21-23 Charles Street
City: Prahran
State: Victoria
Country: Australia
Postcode: 3181
Phone:
Fax:
The Email address:
＜110〉surname: Jun-Ping
＜110〉name: Liu
<110>Middlelnitial：
<110>Suffix：
Nature person applicant
Street: 21-23Charles Street
City: Prahran
State: Victoria
Country: Australia
Postcode: 3181
Phone:
Fax:
The Email address:
＜110〉surname: He
＜110〉name: Li
<110>Middlelnitial：
<110>Suffix：
The application project
＜120〉title: Telomerase inhibiting peptide and uses thereof
<130>AppFileReference：652689
＜140〉the application number:
＜141〉the application submits day to:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
GARTFRRXKR?AXRLTSRVK
＜212〉type: PRT
＜211〉length: 19
Sequence name: SEQ ID NO:1
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
GARTFRREKR?AERLTSRVK
＜212〉type: PRT
＜211〉length: 19
Sequence name: SEQ ID NO:2
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
GARTFRRQKR?AQRLTSRVK
＜212〉type: PRT
＜211〉length: 19
Sequence name: SEQ ID NO:3
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
CRAVRSLLRS?HYREV
＜212〉type: PRT
＜211〉length: 15
Sequence name: SEQ ID NO:4
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
GPPSTSRPPR?PWDTPC
＜212〉type: PRT
＜211〉length: 16
Sequence name: SEQ ID NO:5
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
CAREKPQGSV?AAPEEEDTD
＜212〉type: PRT
＜211〉length: 19
Sequence name: SEQ ID NO:6
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
ANPALSSDFK?TILD
＜212〉type: PRT
＜211〉length: 14
Sequence name: SEQ ID NO:7
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
HRAKRHPRRP?PRSPG
＜212〉type: PRT
＜211〉length: 15
Sequence name: SEQ ID NO:8
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
TRNEKNRPRR?RFLC
＜212〉type: PRT
＜211〉length: 14
Sequence name: SEQ ID NO:9
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
WGVTEEETRR?NRQLEVC
＜212〉type: PRT
＜211〉length: 17
Sequence name: SEQ ID NO:10
Sequence description:
Sequence
＜213〉OrganismName: homo sapiens
<400>PreSequenceString：
DSEPTPHLKT?RQRR
＜212〉type: PRT
＜211〉length: 14
Sequence name: SEQ ID NO:11
Sequence description:
Sequence
＜213〉OrganismName: fruit bat
<400>PreSequenceString：
CRQIKIWFQN?RRMKWKK
＜212〉type: PRT
＜211〉length: 17
Sequence name: SEQ ID NO:12
Sequence description:
Sequence
＜213〉OrganismName: artificial
<400>PreSequenceString：
atcgcttctc?ggcctttt
＜212〉type: DNA
＜211〉length: 18
Sequence name: SEQ ID NO:13
Sequence description:
Sequence
＜213〉OrganismName: artificial
<400>PreSequenceString：
aatccgtcga?gcagagttaa?aaggccgaga?agcgat
＜212〉type: DNA
＜211〉length: 36
Sequence name: SEQ ID NO:14
Sequence description:
Claims (28)
1. the Telomerase inhibiting peptide of being made up of the aminoacid sequence of GARTFRRXKRAXRLTSRVK (SEQ ID NO:1) (TEIPP), wherein X is E or Q.
2. according to the peptide of claim 1, it is by aminoacid sequence GARTFRREKRAERLTSRVK (SEQ ID NO:2); Or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3) forms.
3. according to the peptide of claim 1 or 2, wherein said aminoacid sequence is corresponding to 641 to 659 amino acids of natural TERT.
4. according to the peptide of claim 1 or 2, wherein this peptide is selected from people, ox, sheep, pig, mouse or horse.
5. the nucleic acid molecule of forming by the nucleotide sequence of coding side granzyme inhibiting peptide (TEIPP), described sequence is selected from following sequence:
A) nucleotide sequence, the peptide that its coding is made up of GARTFRRXKRAXRLTSRVK (SEQ IDNO:1) aminoacid sequence, wherein X is E or Q;
B) nucleotide sequence, the peptide that its coding is made up of the aminoacid sequence of GARTFRREKRAERLTSRVK (SEQ IDNO:2);
C) nucleotide sequence, the peptide that its coding is made up of the aminoacid sequence of GARTFRRQKRAQRLTSRVK (SEQ IDNO:3); With
D) because the genetic code degeneracy and and a), b) or c) in the nucleotide sequence of nucleotide sequence degeneracy.
6. by the peptide of the nucleic acid molecule encoding of claim 5.
7. be used to suppress the composition of Telomerase, described composition comprises carrier and Telomerase inhibiting peptide (TEIPP), described Telomerase inhibiting peptide is selected from GARTFRRXKRAXRLTSRVK (SEQ ID NO:1), wherein X is E or Q, GARTFRREKRAERLTSRVK (SEQ ID NO:2) or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3); With peptide according to claim 6, or its combination.
8. according to the composition of claim 7, also comprise TEIPP1 (TEIPP1), wherein the TEIPP1 peptide is selected from HRAKRHPRRPPRSPG (SEQ ID NO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10) and DSEPTPHLKTRQRR (SEQ ID NO:11).
9. composition according to Claim 8, wherein the TEIPP1 peptide is HRAKRHPRRPPRSPG (SEQ ID NO:8).
10. according to each composition among the claim 7-9, wherein composition comprises Telomerase inhibiting peptide (TEIPP), and the application concentration of described peptide is 0.1～100 μ M.
11. Telomerase inhibiting peptide TEIPP is used for suppressing the purposes of the active medicine of Telomerase in the cell in preparation, described Telomerase inhibiting peptide TEIPP is selected from GARTFRRXKRAXRLTSRVK (SEQ ID NO:1), wherein X is E or Q, GARTFRREKRAERLTSRVK (SEQ ID NO:2) or GARTFRRQKRAQRLTSRVK (SEQ ID NO:3); With peptide according to claim 6, or its combination.
12. according to the purposes of claim 11, wherein the application concentration of Telomerase inhibiting peptide (TEIPP) is 0.1～100 μ M.
13. purposes according to claim 11 or 12, wherein TEIPP1 and TEIPP are co-administered, and described TEIPP1 is selected from HRAKRHPRRPPRSPG (SEQ ID NO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10) and DSEPTPHLKTRQRR (SEQ ID NO:11).
14. a method that suppresses the growth of cell in the cell culture, described method comprise that the pair cell culture imposes among the claim 1-4 of significant quantity the Telomerase inhibiting peptide (TEIPP) of each or claim 6.
15. according to the method for claim 14, wherein cell growth inhibiting is selected from inducing cell death, significantly reduces cell proliferation or inducing cell dormancy.
16. according to the method for claim 15, wherein the application concentration of Telomerase inhibiting peptide (TEIPP) is 0.1～100 μ M.
17. according to each method among the claim 14-16, wherein TEIPP1 and TEIPP are co-administered, and described TEIPP1 is selected from HRAKRHPRRPPRSPG (SEQ IDNO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10) and DSEPTPHLKTRQRR (SEQ ID NO:11).
18. be used for the purposes of the medicine of inducing cell death in preparation according to the Telomerase inhibiting peptide (TEIPP) of each or claim 6 among the claim 1-4.
19. according to the purposes of claim 18, wherein necrocytosis is selected from apoptosis, necrosis or molten born of the same parents.
20. according to the method for claim 15, wherein the application concentration of Telomerase inhibiting peptide (TEIPP) is 0.1～100 μ M.
21. according to each purposes among the claim 18-20, wherein TEIPP and TEIPP1 are co-administered, and described TEIPP1 is selected from HRAKRHPRRPPRSPG (SEQID NO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10) and DSEPTPHLKTRQRR (SEQ ID NO:11).
22. according to the purposes of Telomerase inhibiting peptide (TEIPP) in the preparation medicine of each or claim 6 among the claim 1-4, described medicine is used for the treatment of cancer or proliferative disorders.
23. purposes according to claim 22, wherein said Telomerase inhibiting peptide and TEIPP1 are co-administered, and described TEIPP1 is selected from HRAKRHPRRPPRSPG (SEQ ID NO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10) and DSEPTPHLKTRQRR (SEQ ID NO:11).
24. according to the purposes of claim 22 or 23, wherein said cancer is a mammary cancer.
25. according to the purposes of claim 22 or 23, the telomerase activation relevant illness of wherein said proliferative disorders for increasing with telomerase activation or with relative standard state.
26. according to each purposes among the claim 22-23, wherein the application concentration of Telomerase inhibiting peptide (TEIPP) is 0.1～100 μ M.
27. the inhibitor that the Telomerase inhibiting peptide generates is used for the purposes of the medicine of inducing cell propagation by the generation that suppresses Telomerase inhibiting peptide in the cell in preparation, wherein said Telomerase inhibiting peptide is that described TEIPP1 is selected from HRAKRHPRRPPRSPG (SEQ ID NO:8), TRNEKNRPRRRFLC (SEQ ID NO:9), WGVTEEETRRNRQLEVC (SEQ ID NO:10) and DSEPTPHLKTRQRR (SEQ ID NO:11) according to each or the TEIPP of claim 6 or the combination of described TEIPP and TEIPP1 among the claim 1-4.
28. according to the purposes of claim 27, the application concentration of wherein said Telomerase inhibiting peptide (TEIPP) is 0.1-100 μ M.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| AUPR7697A AUPR769701A0 (en) | 2001-09-14 | 2001-09-14 | Telomerase inhibitory peptides and uses thereof |
| AUPR7697 | 2001-09-14 |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1575300A CN1575300A (en) | 2005-02-02 |
| CN100480259C true CN100480259C (en) | 2009-04-22 |
Family
ID=3831537
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB028208471A Expired - Fee Related CN100480259C (en) | 2001-09-14 | 2002-09-13 | Telomerase inhibitory peptides and uses thereof |
Country Status (3)
| Country | Link |
|---|---|
| CN (1) | CN100480259C (en) |
| AU (1) | AUPR769701A0 (en) |
| WO (1) | WO2003024997A1 (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US20090220534A1 (en) * | 2006-03-16 | 2009-09-03 | Leiden University Medical Center | Methods for identifying t-cell epitopes associated with impaired peptide processing and applications of the identified epitopes |
| ES2758451T3 (en) * | 2012-09-19 | 2020-05-05 | Gemvax & Kael Co Ltd | Cell penetration peptide, conjugate comprising the same and composition comprising the conjugate |
| CN108129553B (en) * | 2018-01-05 | 2020-12-08 | 杭州端丽生物技术有限公司 | Polypeptide for preventing and treating diseases related to telomere dysfunction and medical application thereof |
| CN114920802B (en) * | 2022-05-16 | 2023-05-23 | 中国地质大学（武汉） | Polypeptide probe for regulating movement of telomerase speed-limiting protein, and complex and method thereof |
Family Cites Families (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998007838A1 (en) * | 1996-08-21 | 1998-02-26 | Mitsubishi Chemical Corporation | Higher animal telomerase protein and gene encoding the same |
| DE69739497D1 (en) * | 1996-10-01 | 2009-08-27 | Geron Corp | Menschlische telomerase catalytic subunit |
| US7390891B1 (en) * | 1996-11-15 | 2008-06-24 | Amgen Inc. | Polynucleotides encoding a telomerase component TP2 |
-
2001
- 2001-09-14 AU AUPR7697A patent/AUPR769701A0/en not_active Abandoned
-
2002
- 2002-09-13 CN CNB028208471A patent/CN100480259C/en not_active Expired - Fee Related
- 2002-09-13 WO PCT/AU2002/001263 patent/WO2003024997A1/en not_active Application Discontinuation
Also Published As
| Publication number | Publication date |
|---|---|
| AUPR769701A0 (en) | 2001-10-11 |
| CN1575300A (en) | 2005-02-02 |
| WO2003024997A1 (en) | 2003-03-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Liu et al. | Flap endonuclease 1: a central component of DNA metabolism | |
| EP1093381B1 (en) | Antigenic peptides derived from telomerase | |
| US20030153521A1 (en) | Nucleic acid treatment of diseases or conditions related to levels of Ras | |
| US20020068709A1 (en) | Therapeutic uses of LNA-modified oligonucleotides | |
| EA018201B1 (en) | Lyophilised antigen composition | |
| EA013468B1 (en) | Immunostimulatory single-stranded ribonucleic acid with phosphodiester backbone | |
| EA005424B1 (en) | Methods of treatment of a bcl-2disorder using bcl-2 antisense oligomers | |
| CN101613688A (en) | Enzyme is cut the proteolytic enzyme of the model Wilbond factor (vWF) | |
| CA3093715A1 (en) | Synthetic rig-i-like receptor agonists | |
| BR112020003026A2 (en) | stabilized nucleic acids encoding messenger ribonucleic acid (mrna) | |
| US8476245B2 (en) | Inhibition of tumor growth and invasion by anti matrix metalloproteinase DNAzymes | |
| JPH11507818A (en) | Essential oligonucleotides for vertebrate telomerase | |
| JP2003525037A (en) | Methods and reagents for regulation and diagnosis of CD20 and NOGO gene expression | |
| JP2017506232A (en) | Inhibitory oligonucleotides for treating tumors | |
| US7326418B2 (en) | Identification of novel factors that block programmed cell death or apoptosis by targeting JNK | |
| CN100480259C (en) | Telomerase inhibitory peptides and uses thereof | |
| EP1453467A2 (en) | Methods and compositions for modulating apoptosis | |
| PT1352056E (en) | Polypeptides capable of eliciting an immune reaction against cancer | |
| ES2327815T3 (en) | 18477, HUMAN KINASE PROTEIN AND USES OF THE SAME. | |
| KR100748293B1 (en) | Modulators of the function of receptors of the tnf/ngf receptor family and other proteins | |
| US20020102694A1 (en) | Nucleozymes with endonuclease activity | |
| US7071311B2 (en) | Antibodies having specificity for 2′-C-allyl nucleic acids | |
| US20030065155A1 (en) | Nucleic acid sensor molecules | |
| AU2002325676A1 (en) | Telomerase inhibitory peptides and uses thereof | |
| EP3044314A2 (en) | Methods and compositions for interference with dna polymerase and dna synthesis |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090422 Termination date: 20130913 |