CN100471955C - A fusion gene, its expressed protein and its preparation method - Google Patents

Abstract

The invention belongs to the technical field of polypeptide drug production by genetic engineering in biotechnology pharmaceutical engineering. The fusion gene of CTB and human insulin B chain was constructed, and the fusion protein of CTB and human insulin B chain was highly expressed in silkworm larvae, pupae and strawberry fruit. After animal oral test, it had obvious inhibitory effect on diabetes in mice, becoming A novel method for preparing anti-type I diabetes medicine. Compared with the prior art, the raw material is easy to obtain, the production cost is low, and it has the advantages of oral or fresh food, relieves the pain of injection and the threat of infection for patients, has good therapeutic effect, and has very significant market development and application prospects.

Description

A fusion gene, its expressed protein and its preparation method

technical field

The invention relates to a fusion gene, its expressed protein and a preparation method. Specifically, the present invention relates to CTB and human insulin B chain fusion gene, its expressed protein and its preparation method.

Background technique

Type I diabetes (insulin-dependent diabetes mellitus, IDDM) results from defective insulin secretion and is an autoimmune disease targeting pancreatic beta cells. Although autoantigens that cause IDDM include insulin glutamic acid decarboxylase, insulin, heat shock protein, carboxypeptidase H and other antigens, only one autoantigen-insulin was orally administered to animals in the experiment, which induced immune tolerance. A protective effect was produced (Science, 1994, 265:1237). This is because oral administration of antigens can induce regulatory T cells to secrete inhibitory cytokines, such as TGF-β, which can inhibit all pathological immune responses induced by various antigens that are not related to each other but that occur in the same specific organ, that is, antigen Drive bystander suppression (Antigen-drivenBystander Suppression). The induction of bystander suppression is antigen-specific, while the effect is non-specific, which provides a new way to prevent autoimmune diseases such as type 1 diabetes (Immunol Today, 1998, 19:173). At the same time, studies have shown that cholera toxin B subunit (CTB) can be used as a powerful mucosal delivery system to induce oral tolerance, and CTB-coupled antigens may involve an immunomodulatory mechanism that is significantly different from the immune tolerance effect of traditional high-dose oral self-antigens , may be involved in the change of the mobile behavior of inflammatory cells (NatBiotechnol, 1998, 16, 292), suggesting that CTB-coupled autoantigens not only make the application of oral tolerance to prevent and treat autoimmune diseases such as type I diabetes more practical, but also There are potential therapeutic prospects (Proc Natl Acad Sci USA, 1997, 94:4610).

Contents of the invention

One of the objectives of the present invention is to provide a fusion gene of CTB and human insulin B chain.

The second object of the present invention is to provide the protein expressed by fusion gene of CTB and human insulin B chain.

The third object of the present invention is to provide a method for preparing a protein expressing fusion gene of CTB and human insulin B chain.

The present invention is realized through the following technical solutions.

(1) Construction of transfer plasmids pBac-CTBINB and pBI-CTBINB containing the fusion gene of CTB and human insulin B chain. Design two primers P1 and P2, use pBac-CTBINS plasmid (see 200310121132.1 patent application description) as a template, and P1 and P2 as primers to amplify to obtain fusion gene CTB-INB. The fusion gene sequence and its encoded amino acid sequence are respectively shown in SEQ ID NO.1 and SEQ ID NO.2. The target fragment was double-digested with BamHI and EcoRI, and connected to the transfer vector pBacPAK8, which was also double-digested with BamHI and EcoRI, to construct the bacmid transfer plasmid pBac-CTBINB containing the fusion gene of CTB and human insulin B chain. Further, pBac-CTBINB was digested with BamHI and SacI, and then connected to the transfer vector pBI121, which was also digested with BamHI and SacI, to construct the plant transfer plasmid pBI-CTBINB containing the fusion gene of CTB and human insulin B chain.

P1 <SEQ ID NO.3>: 5′CGGGATCCATGATTAAATTAAAATTTGG3′

P2<SEQ ID NO.4>: 5′GGGAATTCTTAGGTCTTGGGTGTGTAGA3′

(2) Obtaining the recombinant silkworm baculovirus BmBacCTBINB containing the fusion gene of CTB and human insulin B chain: the transfer plasmid pBac-CTBINB and the silkworm nuclear polyhedrosis virus DNA were co-transfected into the silkworm (Bombyx mori) cell BmN, and empty The recombinant baculovirus BmBacCTBINB containing the fusion gene of CTB and human insulin B chain was screened by plaque and Southern dot hybridization. The virus has been submitted to the General Microorganism Center of the China Microbiological Culture Collection Management Committee for preservation. The preservation date is April 22, 2004, and the preservation number is CGMCC No.1138.

(3) Expression of CTB and human insulin B-chain fusion protein in silkworm: Infect BmN silkworm cells with recombinant baculovirus BmBacCTBINB for virus amplification, and then inject the amplified recombinant baculovirus BmBacCTBINB into silkworm larvae and pupae .

(4) Expression of CTB and human insulin B-chain fusion protein in strawberry: the plant transfer plasmid pBI-CTBINB was introduced into Agrobacterium tumefaciens by electric shock method, co-cultivated by Agrobacterium tumefaciens and shoot tips, and kanamycin Media for screening transgenic plants.

The beneficial effect of the present invention is: the fusion protein of CTB and human insulin B chain is efficiently expressed by silkworm and strawberry, which is more active than the fusion protein of CTB and human insulin B chain expressed directly from prokaryotes, and silkworm can be sterile and large-scale breeding is economical Insects can be raised on a large scale at low cost without causing public nuisance. There are a variety of natural protein protectants in the silkworm body, which can protect the expression products and make the gene expression products very stable; strawberries are cultivated on a large scale and can be eaten fresh (And potatoes and tobacco cannot be eaten fresh). The fusion protein produced by silkworm and strawberry can be used as an oral or fresh vaccine, which relieves patients from the pain of injection and the threat of infection.

Description of drawings

Fig. 1 is the insect baculovirus transfer plasmid pBac-CTB-INB containing CTB and human insulin B chain fusion gene (illustration: AcMNPV/AcNPV: Autographa californica polyhedrosis virus polyhedrosis promoter 5' end/3 Side sequence at the ′ end; P: Autographa californica polyhedrosis virus polyhedron promoter; A (Polyhedin Poly A+signal) polyadenylation signal of polyhedrin gene; M13 ori: M13 phage replication origin; Amp: Ampicillin gene; ori: pUC origin of replication)

Fig. 2 is the SDS-PAGE analysis pattern of the silkworm expression product, wherein: M represents the standard protein molecular weight marker; 1 represents the hemolymph of the silkworm infected with BmCTBINB; 2 represents the hemolymph of the silkworm infected with the wild virus.

Figure 3 is the Western analysis of the expression product of silkworm, wherein: M represents the standard protein molecular weight marker; 1 represents the hemolymph of silkworm infected with BmCTBINB; 2 represents the hemolymph of silkworm infected with wild virus.

Detailed ways

The present invention is further set forth below by embodiment, but protection scope of the present invention is not limited.

[Example 1] Construction of transfer plasmids pBac-CTBINB and pBI-CTBINB containing fusion genes

The pBac-CTBINS plasmid (see 200310121132.1 patent application specification) was used as a template and P1 and P2 were used as primers for amplification. The reaction conditions were pre-denaturation at 94°C for 5 minutes, amplification at 94°C for 1 minute, 57°C for 1 minute, and 72°C for 1 minute. Minutes, react for 30 cycles, and finally incubate at 72°C for 10 minutes to obtain the target fusion gene CTB-INB with a size of about 500 bp, and the 5' and 3' ends of the gene have BamHI and EcoRI sites respectively. The above-mentioned target fusion gene was digested with BamHI and EcoRI and connected to pBacPAK8 (CLONTECH Company) which was also digested with BamHI and EcoRI to construct the bacmid transfer plasmid pBac-CTBINB containing CTB and human insulin B chain gene. After enzyme digestion analysis and PCR identified the correct insertion of the gene, automatic sequence determination showed that the sequence of the constructed fusion gene was completely correct. After pBac-CTBINB was digested by BamHI and SacI, it was connected to the transfer vector pBI121 (CLONTECH Company) which was also digested by BamHI and SacI, and the plant transfer plasmid pBI-CTBINB containing the fusion gene of CTB and human insulin B chain was constructed. .

[Example 2] Obtaining of recombinant baculovirus of fusion gene of CTB and human insulin B chain

Take 5ul insect baculovirus transfer plasmid pBac-CTBINB containing CTB and human insulin B-chain fusion gene and 6ul wild silkworm nuclear polyhedrosis virus DNA for co-transfection. Get 6ul Lipofectin (GIBCOBRL company) and add 100ul serum-free TC-100 medium and mix. The BmN cells previously cultured in a 35mm Dish were washed twice with serum-free TC-100 (GIBCOBRL company) medium, and the transfer plasmid and Lipofectin mixture was added dropwise, cultured at 27°C for 4-5 days, and the supernatant was collected for the second stage. One round of plaque screening. Take 5ul of the supernatant to infect the BmN cells in a 35mm Dish, discard the supernatant after 1 hour and add an equal amount of mixed TC-100 medium and low melting point agarose. Pick plaques after 4-5 days, infect BmN cells for 3-4 days, save the supernatant, lyse the cells with NaOH for Southern hybridization, and take the supernatant of positive clones for 10 rounds of plaque screening. The supernatant of positive clones was taken to infect BmN cells for expansion. A large number of recombinant baculoviruses containing fusion genes of CTB and human insulin B chain can be obtained.

[Example 3] Expression of CTB and human insulin B chain fusion gene in silkworm larvae and pupae

Take the amplified recombinant baculovirus containing the fusion gene of CTB and human insulin B chain and inject it into the fifth instar silkworm (Bombyx mori) larvae and pupae, inject about 2 ul per head (titer is 1×10 ⁷ /ml), respectively Take the silkworm lymph and pupal blood expressed at 24, 48, 72, 96, 120 and 144 hours, centrifuge at 5000rpm for 5min, take the supernatant, dilute 10 times with PBS pH7.4, add an equal volume of 2× protein loading buffer (100Mm Tris.HCl, 4% SDS, 0.1% bromophenol blue, 10% glycerol), take 20ul for SDS-PAGE analysis, see Figure 2. The results showed that the fusion protein of CTB and human insulin B chain was highly expressed in silkworm and pupae, and the molecular weight of the expressed product was 18kD by Western hybridization (accompanying drawing 3). The hemolymph of silkworm larvae and pupal bodies containing the fusion protein of CTB and human insulin B chain was subjected to high-speed freezing and centrifugation, and the supernatant was taken. Diluted 1000 times and then coated the microtiter plate. At the same time, CTB was used as a standard, and the routine ELISA procedure was followed, wherein the rabbit anti-CT primary antibody (purchased from SIGMA) was diluted 5000 times, and the goat anti-rabbit secondary antibody (purchased from Huamei Biotechnology Co., Ltd.) was diluted 5000 times. engineering company) was diluted 1000 times, developed color with OPD (purchased from Shanghai Chemical Reagent Company), and measured OD value at 492nm. ml and 400 μg/ml.

[Example 4] Expression of fusion protein of CTB and human insulin B chain in strawberry

The plant transfer plasmid pBI-CTBINB was introduced into Agrobacterium tumefaciens LBA4404 (CLONTECH company) by electric shock method, and introduced into strawberries through co-cultivation of Agrobacterium tumefaciens and strawberry shoot tips, and screened on the screening medium. The screening medium was MS agar medium containing 0.6mg/L IAA, 1.5mg/L BA, 500mg/L carbenicillin and 100mg/L kanamycin, etc., cultured at 28°C under a light-dark cycle of 16h/8h for 2- After 4 months, the transgenic seedlings were transferred to MS medium containing 100mg/L kanamycin to make them take root. Finally, the regenerated seedlings were moved to the greenhouse to obtain transgenic plants. It was confirmed by Southern hybridization and PCR techniques that CTB and The human insulin B-chain fusion gene has been integrated in the strawberry genome, and the primers identified by PCR technology are P1 and P2, which are operated according to the conventional method of "Molecular Cloning" (Sambrook et al., translated by Jin Dongyan, etc., Science Press, 1992). Extract protein from transgenic plant fruit, add an equal volume of 2× protein loading buffer (100Mm Tris.HCl, 4% SDS, 0.1% bromophenol blue, 10% glycerol), take 20ul for SDS-PAGE analysis and Wersten blotting analyze. It can be seen from the results that the expression product of CTB and human insulin B chain fusion gene in strawberry fruit is about 18kD, which is consistent with the predicted size. Immune activity identification of the expression product fused with CTB and human insulin B chain (operation method is the same as in Example 3), the result shows that the expression product has strong immune activity, and the expression level in strawberry fruit can be calculated by CTB standard Up to 0.5% of the soluble protein content.

〔Example 5〕The animal test of the CTB and human insulin B-chain fusion protein effect expressed in silkworm larva silkworm chrysalis and strawberry fruit

Express CTB and human insulin B-chain fusion protein in silkworm larvae and pupae, filter (100KD ultrafiltration), centrifuge at 16000rmp and 35000rmp, freeze-dry, and use silkworm larvae and silkworm pupae as fillers to prepare oral medicine, strawberry fruit Then it is directly used for oral animal experiments after grinding. The 4-week-old female NOD mice were randomly divided into 4 groups, 5 in each group, and were fed from the 5th week at a dose of 100 μg/mouse, administered twice a week for 5 consecutive weeks. Oral administration of normal silkworm hemolymph and strawberry fruit was used as a negative control, and the mice were sacrificed at the 10th week, and the islets of the mice were taken for histopathological sections to observe the occurrence of insulitis and score accordingly. The results showed that the insulitis index of the mice in the administration group was 1.5±1.3, while the insulitis index of the mice in the control group was as high as 4.2±1.7, and the insulitis index in the administration group was significantly lower than that in the control mice.

sequence listing

<110> Zhejiang University

<120> A fusion gene, its expressed protein and its preparation method

<140>200410056850.X

<141>2004-08-25

<160>4

<210>1

<211>477

<212>DNA

<213> Artificial sequence

<400>1

<210>2

<211>158

<212>PRT

<213> Artificial sequence

<400>2

<210>3

<211>28

<212>DNA

<213> Artificial sequence

<400>3

<210>4

<211>28

<212>DNA

<213> Artificial sequence

<400>4

Claims (3)

1. A fusion gene of CTB and human insulin B chain, characterized in that it is the base sequence shown in SEQ ID NO.1. 2. The protein expressed by fusion gene of CTB and human insulin B chain, characterized in that it is the protein sequence shown in SEQ ID NO.2. 3. A method for expressing CTB and human insulin B chain fusion group protein, comprising the steps of: The recombinant baculovirus BmBacCTBINB CGMCC No.1138 was used to infect BmN silkworm cells for virus amplification, and then the amplified recombinant baculovirus BmBacCTB1NB was injected into silkworm larvae and pupae, and the lymphatic blood of silkworm larvae and pupae was extracted respectively.

Images