CN100467063C - Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus - Google Patents
Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus Download PDFInfo
- Publication number
- CN100467063C CN100467063C CNB2004100691928A CN200410069192A CN100467063C CN 100467063 C CN100467063 C CN 100467063C CN B2004100691928 A CNB2004100691928 A CN B2004100691928A CN 200410069192 A CN200410069192 A CN 200410069192A CN 100467063 C CN100467063 C CN 100467063C
- Authority
- CN
- China
- Prior art keywords
- virus
- antigen
- hiv
- albumen
- hbv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Peptides Or Proteins (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
An immunoadjuvant used to prepare the antiviral vaccine or medicine for increasing the immune activity of the antigens for HBV, HCV, SARS coronavirus, fowl influenza virus, etc is a kind of human or animal's novel heat shock proteins gp96, hsp108 and hsp70.
Description
Technical field
The invention belongs to field of immunology.Specifically, relate to a class human or animal heat shock protein gp96 and hsp108 (all belonging to HSP90 family) or hsp70 full-length molecule or its n terminal fragment, improve the antigen immune activity as the new immunological adjuvant of a class.Virus epitopes peptide, covalently bound multi-epitope recombinant or proteantigen mix or covalently or non-covalently are connected use with above-mentioned heat shock protein full-length molecule or its n terminal fragment, this adjuvant can tens of times raising antigen immune activity, reach the order of removing virus, treatment disease.
Background technology
(heat shock protein HSP) claims stress protein again to heat shock protein, is that a class is conservative at the biological evolution camber, and extensively is present in the protein in protokaryon and the eukaryote.Mainly be divided into nearly ten families such as HSP90, HSP70 according to its molecular weight size and structure.Gp96 is the important member in the HSP90 family, and wide expression is all arranged in normal structure and tumor tissues, mainly be positioned endoplasmic (Endoplasmic reticulum, ER) on, be one of rich in protein among the ER.It is generally acknowledged that gp96 is an intracellular protein, but studies confirm that gp96 also has expression on some mouse tumor cell surface, and expression increases with immunogenicity of tumor.Being expressed in of cell surface gp96 kind is to have conservative in the generation, is not limited in some mammal tumor, also selective expression on more vertebrate immunocytes.Gp96 can stop protein aggregation in conjunction with not folding polypeptide chain as molecular chaperones, assists protein folding, stretching, extension, assembling and transhipment, suppresses the secretion of misfolded proteins matter.Under normal circumstances gp96 is low expression level in cell, but stressed condition such as heat shock, heavy metal poisoning, glucose shortage, antibacterial and viral infection and cell differentiation etc. can induce it to express to increase.Interferon-α (IFN-α) and interferon-γ (IFN-γ) also can be in the expression of transcriptional level adjusted gp96.
Using gp96 polypeptide complex vaccine can self-treating tumor.It is clinical that the melanoma self-treating of Antigenics company exploitation finished for three phases.Yet autovaccine can not be widely used in Different Individual, and often carries polyvalent antigen, is unfavorable for carrying out the immunization therapy of specific antigen targetedly.The immunological adjuvant of clinical practice at present mostly is aluminium porcelain enamelling, because its adjuvant effect instability, can not strengthen shortcoming such as cell immune response and makes its application limited.Our result of study shows that gp96, hsp108 or hsp70 full-length molecule and N end thereof can be used as immunological adjuvant, strengthen special ctl response or the special production of antibodies of albumen of peptide.
Summary of the invention
In order to overcome the deficiency of existing adjuvant, what one object of the present invention was to provide a class human or animal has immune-enhancing activity one a class novel adjuvant, it is characterized in that the albumen of being made up of the N end recombinant fragment of gp96, hsp108 or hsp70.This type of immunological adjuvant combines with corresponding antigen and forms immunologic stimulant, improves body to external antigenic immunoreation.
The present invention is our previous work " complex of antigen of hepatitis B virus polypeptide and heat shock protein and application thereof the " (patent No.: ZL 01 1 04060.2; Certificate number: No. 109175) new development.Because gp96 (NM_003299, http://www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? db=nucleotide﹠amp; Val=4507676) hsp70 (NM_005345http: //www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? db=nucleotide﹠amp; Val=26787973) and hsp108 (AF387865,
HttD: //www.ncbi.nlm.nih.gov/entrez/viewer.fcgi? db=nucleotide﹠amp;Val=14579648) full length DNA clonal expression unstable products is difficult to the usefulness as vaccine or medicine.We are to the aminoterminal of gp96, hsp70 and hsp108, and promptly studying in great detail of N-end fragment recombinant DNA proves that N-end expression product is stable and have the immunological adjuvant activity.
Immunological adjuvant provided by the invention comprises: Hgp96, Hhsp70, the N-of Chsp108 end recombinant fragment has the albumen that 349 amino acid whose sequences are formed shown in albumen with 333 amino acid whose sequences shown in the disconnected albumen with 267 amino acid whose sequences, the albumen with 315 amino acid whose sequences shown in the sequence table 1No.4, sequence table 1No.6 shown in sequence table 1No.2 of: people Hgp96N-dististyle and the sequence table 1No.8; People hsp70 (Hhsp70) N-dististyle is disconnected to have the albumen of being made up of 202 aminoacid sequences shown in sequence table 2No.2; Chicken hsp108 (Chsp108) N-dististyle is disconnected to have the albumen of being made up of 335 aminoacid sequences shown in sequence table 3No.2; Also comprise since the disappearance of its gene, insertion and sudden change produce hold each segmental aminoacid sequence to have 60% homology at least with above-mentioned described Hgp96, Chsp108 and Hhsp70N-, and have the derived protein of identical function.The present invention is animal model with the mice, to hepatitis B viruses (HBV) epitope peptide: STLPETTVVRR, and FLPSDFFPSV, IPIPSSWAF, WLSLLVPFV, FLLSLGIHL; The epitope peptide of HCV: YLLPPRGPRL, GFADLMGYIPL; The epitope peptide of HIV-1: SILDIRQGPK, CQGVGGPGHK; The epitope peptide of SARS-CoV: LLLDRLNQL, VVFLHVTYV; The epitope peptide of FMDV: IKRAETYCPR, HKQKIVAPEK study, obtain same conclusions, immunological adjuvant provided by the invention can promote the specific ctl responses of virus epitopes such as HBV, HCV, HIV-1, SARS-CoV, FMDV, improves body to external antigenic immunne response.One of them example is to adopt the hepatitis B virus restrictive epitope peptides of viral Mus source Kd such as (HBV), and special 9 peptides of its HBV and gp96N terminal fragment gp96 N22-355 mixture immune mouse stimulate the generation that strengthens the special CTL of mice.The surface antigen HBsAg complex immune mouse of immunological adjuvant provided by the invention and hepatitis B virus can strengthen HBsAg antibody significantly and produce titre.
Immunological adjuvant provided by the present invention can strengthen epitope peptide, CTL level and antibody horizontal that covalently bound multi-epitope recombinant and albumen antigen produce.Virus epitopes peptide, covalently bound multi-epitope recombinant or proteantigen are with above-mentioned heat shock protein full-length molecule or its n terminal fragment mixes or covalently bound use, as the antigen adjuvant of virus such as hepatitis B virus (HBV), hepatitis C virus (HCV), HIV (human immunodeficiency virus) (HIV), sars coronavirus (SARS-CoV), foot and mouth disease virus (FMDV), bird flu virus (AIV), newcastle disease virus (NDV), chook MDV or antigen vectors can tens of times raising antigen immune activity, reach the purpose of removing virus, treatment disease.So immunological adjuvant provided by the present invention can be applied to the preparation of vaccine or medicine.
Immunological adjuvant provided by the invention can directly mix with antigenic substance, the non-covalent connection or mode such as covalently bound, adopts intradermal injection or modes such as subcutaneous injection or lumbar injection to carry out immunity.Immunizing dose is 0.10 μ mol or 100 μ mol.
Description of drawings
Fig. 1. with ELISPOT technical measurement HBV 9 peptides and Mus gp96-N end fragment immunocompetence is example.
Fig. 2. is example with the Tetramer technical measurement with HBV 9 peptides and Mus gp96-N end fragment immunocompetence.
Fig. 3
51The Cr release experiment is measured HBV 9 peptides and Mus gp96-N end fragment immunocompetence is an example.
It is example that Fig. 4 measures with HBV surface antigen and Mus gp96-N end fragment immunocompetence with elisa technique.
Fig. 5 is example with the ELISPOT technical measurement with HBV surface antigen and Mus gp96-N end fragment immunocompetence.
Fig. 6 induces sophisticated DC cell through the Hgp96N end.
The N22-336 of Fig. 7 .Hgp96 promotes the maturation of DC cell, and showing as CD40 increases (under the A), and CD80 increases (under the B), and positive (under the C) appears in CD83, and CD86 expresses increases (under the D).
Fig. 8 .Hgp96 N22-336 promotes the specific amplified of the T lymphocyte of HLA-2 restricted type to cAg 18-27 epi-position.
The specific embodiment
For a better understanding of the present invention, below further be described by specific embodiment, still, present embodiment is not to be limitation of the invention.
Embodiment one
Present embodiment is animal model with the mice, and HBV, HCV, HIV-1, SARS-CoV, FMDV are studied, and obtains same conclusions, and existing is example with HBV:
1. the clone of laboratory animal Mus gp96-N22-355 genetic fragment
PET-30a plasmid (from novagen), (gp96 sees the patent No. to the Mus pET-30a-gp96 that laboratory is preserved: ZL01104060.2).In the plasmid clone's N end group because of.The primer is:
Primer 1:5 ' CCGGATCCGAACTTGATGTGGATGGTACA3 '
Primer 2: 5 ' CCGAGCTCCCAAATGGTGAGAGTATAATTTAC3 '
The PCR reaction condition is as follows: 94 ℃ 4 minutes; 94 ℃ 50 seconds, 55 ℃ 50 seconds, 72 ℃ 3 minutes, totally 30 the circulation; 72 ℃ 5 minutes.Result's proof is identical with known array.
The PCR product is the fragment of about 1Kd, and artificial BamHI and two restriction enzyme sites of SacI introduced of segmental 5 ' end and 3 ' end check order amplified fragments.Its sequence is identical with known array.
2. expression and the protein purification of Mus gp96-N22-355 fragment in escherichia coli
Amplified fragments is connected to behind BamHI and SacI enzyme action among the expression vector pGEX6p-1 (invitrogen company), and transformed into escherichia coli BL21 (BL21: available from Invitrogen Cat.No.C6000-03).After the 1mM isopropyl-P-P-thiogalactoside (IPTG) is induced 4 hours, obtain expression product, detecting the expression product molecular weight with 10% dodecane (base) sodium sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and coomassie brilliant blue staining is 45Kda, consistent with theoretical value.
With gp96-N22-355 albumen glutathione-S-transferase (GST) chromatographic column (Pharmacia company), carry out purification through affinity chromatograph and molecular sieve superdex G200 (PE company), dye evaluation purity with 10%SDS-PAGE electrophoresis and silver, obtain N end protein greater than 95% purity.The expressed proteins product carries out Western with gp96 monoclonal antibody (NeoMarkers company) to be identified, obtains positive findings.
3.gp96 the polypeptide of-N22-355 fragment and synthetic, multi-epitope recombinant and the test of proteantigen immune mouse
Select for use the female BALB/cJ mice (MHC is H-2dKd) in growth 6-8 week to be this laboratory animal.
Immunization ways adopts sample is dissolved in nape subcutaneous injection among the PBS of 100 μ l.The suitableeest immunizing dose of antigen is 10 μ g.Immune programme for children is to carry out the immunity second time after the immune week for the first time, and effect is better than immunity once.Adopt subcutaneous injection, with gp96-N22-355 fragment albumen and Kd restricted type antigen mixture be dissolved in buffer (90%PBS, 10%DMSO/0.1%TFA) in, every mouse immune dosage is respectively 0.2nmol, 2nmol and 20nmol are with immune mouse after antigen and the Freund adjuvant emulsifying.Gp96-N22-355 albumen and Kd restricted type antigenic compound immunizing dose 0.1nmol adopt the nape subcutaneous injection, carry out the booster immunization second time after the immune week for the first time, carry out CTL after 7 days and analyze.Each is handled and uses 10 mices.
4. measure mice peptide C TL with the ELISPOT method
Mouse immune after 7 days from every mice gather in the crops about 3 * 10
7Splenocyte is used the secretion level of ELISPOT technical measurement cytotoxic T cell secretion IFN-.With bag by 96 orifice plates of anti-IFN-antibody with after the defatted milk powder sealing, add splenocyte to be measured.After stimulating 18 to 40 hours with polypeptide antigen, supernatant discarded adds two of anti-IFN-and resists, and after 37 degree are hatched 1 to 2 hour, adds the alkali phosphatase that is connected with streptavidin, after 37 degree are hatched 1 hour, add chromogenic substrate pentabromo--tetrachloro-three indole phosphate ester/nitroblue tetrazolium (BCIP/NBT).Distilled water color development stopping after 20 minutes.Counting can be secreted the cell of IFN-.The mice of using gp96-N22-355 and antigen immune does not separately produce the CTL cell of the secreted IFN-of antigen-specific, and application gp96-N22-355 and antigen mixture mice immunized produce the CTL cell of the secreted IFN-of antigen-specific, and the CTL cell quantity increases (Fig. 1) along with the increase of immunizing dose.Illustrate that gp96-N22-355 has tangible potentiation to immunogenicity of antigens.
5.Tetramer method is measured the CTL of antigen to mice
Mouse immune after 7 days from every mice gather in the crops about 3 * 10
7Splenocyte, the level of the special TXi Baoshouti of application Tetramer technical measurement cytotoxic T cell antigen expressed.Polypeptide antigen is synthesized the special tetramer complex (Tetramer) of Kd9 peptide with MHC heavy chain and light chain in external renaturation.Collect splenocyte, add tetramer and hatched 20 minutes, add the anti-CD8 antibody of Fluorescein isothiocyanate (FITC) labelling and the anti-cd 3 antibodies of PE-cy5 labelling again in 37 degree.On flow cytometer, analyze Tetramer, CD8, CD3 all is positive cells.What the mice of using separately gp96-N22-355 or antigen immune did not produce antigen-specific can be by the painted CTL cell of antigen Tetramer, and use gp96-N22-355 and mixtures of polypeptides mice immunized produce antigen-specific by the painted CTL cell of polypeptide antigen Tetramer, and the CTL cell quantity increases (Fig. 2) along with the increase of immunizing dose.Illustrate that gp96-N22-355 has tangible potentiation to the immunogenicity of polypeptide.
6. use
51The Cr release experiment is measured mice peptide C TL
Behind the mouse immune 7 days, from every mice gather in the crops about 3 * 10
7Splenocyte is used
51The Cr release experiment is measured the external function of killing and wounding target cell of cytotoxic T cell.Splenocyte is suspended from and contains 10mMHEPES buffer, 5 * 10
-5The M mercaptoethanol in antibiotic and 10% (V/V) hyclone (FCS) culture fluid, is collected splenocyte and is carried out 4 hours standards after 6 days
51(concrete grammar is seen Kuhrober to the Cr release experiment, A, et al.1997.International Immunology, 9 (8): 1203-1212) measure cellular cytoxicity activity.Target cell adds the effector lymphocyte of varying number with 10 μ g/ml antigens in 37 ℃ of sensitization after 30 minutes, reaction system is the complete medium of 100 μ l.Cultivate altogether after 4 hours for 37 ℃ and collect supernatant and measure special cleavage rate.The mice of using gp96-N22-355 and polypeptide immune does not separately produce the CTL cell of the target cell killed and wounded of antigen-specific, and application gp96-N22-355 and antigen mixture mice immunized produce the CTL cell that can kill and wound target cell of antigen-specific, and the CTL cell quantity increases (Fig. 3) along with the increase of immunizing dose.Illustrate that gp96-N22-355 has tangible potentiation to immunogenicity of antigens.
7.gp96-N22-355 fragment and HBV surface antigen immune mouse
Select for use the growth 6-8 week female BALB/cJ mice (MHC is H-2
dKd) be this laboratory animal.
The immunization ways employing is dissolved in sample 1001 the middle nape subcutaneous injection of phosphate buffer (PBS).The suitableeest immunizing dose of albumen is 10 μ g.Immune programme for children is to carry out the immunity second time after the immune week for the first time, and effect is better than immunity once.Adopt subcutaneous injection, gp96-N22-355 fragment and above-mentioned viral surface antigen conjugate are dissolved in buffer, and (among the 90%PBS, 10% dimethyl sulfoxide/0.1%TFA), every mouse immune dosage is respectively 10 μ g.Each immunity was got blood in back 15 days, measured the antibody of anti-surface antigen and carried out the CTL analysis.Use the antibody that the gp96-N22-355 mice immunized does not produce antigen-specific separately, and use the antibody that gp96-N22-355 and HBV, AIV or NDV surface antigen conjugate mice immunized produce antigen-specific, its antibody amount is 10 times (Fig. 4) that independent application surface antigen produces antibody.The CTL cell that kills and wounds target cell also has corresponding increase, and the CTL cell quantity increases along with the increase of immunizing dose.Illustrate that gp96-N22-355 has tangible potentiation to the immunogenicity of virus antigen.Use the CTL cell that can kill and wound target cell that the gp96-N22-355 mice immunized does not produce antigen-specific separately, and application gp96-N22-355 and viral surface antigen conjugate mice immunized produce 5 times (Fig. 5) that the CTL of antigen-specific is independent application surface antigen generation CTL.Illustrate that gp96-N22-355 has tangible potentiation to the immunogenicity of proteantigen.
The 22-288 of this laboratory is recombinant expressed first HUMAN HEAT SHOCK PROTEINS Hhsp HSP70 gp96N end, 22-336,22-355, the 161-362 of 22-370 and hsp70N end.Utilize the heat shock protein that extracts and recombinate to stimulate the external non-mature dendritic cell (DC cell) that comes by the peripheral blood induction, the recombinant fragment of discovery gp96 can be induced the maturation of non-ripe DC cell, make costimulatory molecules CD80, CD86 expresses raising, make significant cell surface molecule CD83 become the positive, make the ability of DC presented by cells process antigen strengthen by feminine gender.With HUMAN HEAT SHOCK PROTEINS Hhsp HSP70 gp96 and recombinant fragment thereof respectively with the core epi-position combined stimulation antigen-presenting cell of HBV, HCV, HIV-1 or SARS-CoV hepatitis B virus, then with the healthy human peripheral blood source
The T lymphocyte mixes, can the specific CTL cell of external evoked generation viral peptide.Experimental result shows that the CTL cell of generation can specificly kill and wound the target cell that has corresponding epi-position.
Embodiment two
Be material with the people DC cell that plays an important role in the antigen presentation process on the cellular level, research heat shock protein Hgp96 and Hhsp70 different fragments are to the influence of DC cell activation.HBV, HCV, HIV-1, SARS-CoV, FMDV being studied, obtain same conclusions, is example with HBV:
8. purification Hgp96 full-length proteins from human liver tissue
Centrifugal after the normal person liver tissue homogenate with the 50g traffic death, (NH4) 2S04 precipitation with 50%-70%, adopt ConA Sepharose (Pharmacia company) to carry out affinity chromatograph behind the resolution of precipitate, bonded albumen is with 10% α-Jia Jiputaotanggan eluting, POROS 20QE on the eluent (BioCAD of PE company perfusion chromatography system) carries out anion chromatography, obtains through this three steps purification〉the Hgp96 albumen of 95% purity.Hgp96 albumen carries out Western blot with gp96/grp94 monoclonal antibody (NeoMarkers company) to be identified.Its purity is dyed with SDS-PAGE, silver and reversed-phase high-performance liquid chromatography (HPLC) is identified.
9.Hgp96N the gene clone of end and Hhsp70N end recombinant fragment and recombinant expressed
The design primer, from the pET-30a-Hgp96 plasmid clone's N end group because of.Designed primer and reaction condition are:
(sequence, its coded albumen that DNA sequence has 801 nucleotide shown in table sequence 1No.1 has 267 amino acid whose sequences shown in sequence table 1No.2 to Hgp96N end 22-288.)
Primer 1:CTGGATCCGACGATGAAGTTGATGTGGATG
Primer 2: GCCTCGAGTCAAGTTTCAGTCTTGCTGCT
Hgp96N end 22-336 (sequence, its coded albumen that DNA sequence has 945 nucleotide shown in table sequence 1No.3 has 315 amino acid whose sequences shown in sequence table 1No.4):
Primer 1:CTGGATCCGACGATGAAGTTGATGTGGATG
Primer 2: GCACTCGAGTCACATAAGTTCCCAGTCCCA
(sequence, its coded albumen that DNA sequence has 999 nucleotide shown in table sequence 1No.5 has 333 amino acid whose sequences shown in sequence table 1No.6 to Hgp96N end 22-355.)：
Primer 1:CTGGATCCGACGATGAAGTTGATGTGGATG
Primer 2: GCACTCGAGTCATTCATCTTCTTCTACTTC
(sequence, its coded albumen that DNA sequence has 1047 nucleotide shown in table sequence 1No.7 has 349 amino acid whose sequences shown in sequence table 1No.8 to Hgp96N end 22-370.)：
Primer 1:CTGGATCCGACGATGAAGTTGATGTGGATG
Primer 2: GGTCTCGAGTCACATGGGGTCATCACTTTC
(sequence, its coded albumen that DNA sequence has 606 nucleotide shown in table sequence 2No.1 has 202 amino acid whose sequences shown in sequence table 2No.2 to Hhsp70 N end 161-362.)
Primer 1:CTGGATCCGCGGGTGTGATCGCGGGGCT
Primer 2: GGTCTCGAGTCAGCTCTTTGCACCTTGG
The PCR reaction condition is as follows: 94 ℃ of degeneration 1 minute; Annealed 1 minute for 56 ℃, 72 ℃ were extended 1 minute, totally 30 circulations; 72 ℃ of lasts extended 15 minutes.
The PCR product is about the fragment of 800-1000bp respectively, artificial two restriction enzyme site BamHI and the XholI of introducing of segmental 5 ' end and 3 ' end.
With amplified fragments through being connected to behind BamHI and the XholI enzyme action on the expression vector pGEX-6p1 (invitrogen company), transformed into escherichia coli BL21, induce 4 hours afterproducts to express through 1mM IPTG, detect the expression product molecular weight with 10%SDS-PAGE electrophoresis and coomassie brilliant blue staining and be respectively 30Kda, 36Kda, 38Kda, 40Kda is consistent with theoretical value.
Hgp96 N end recombiant protein is crossed glutathione agarose (Glutathione Sepharose) 4B affinity column (Pharmacia company) carry out affinity chromatograph, carry out sieve chromatography with superdex 200 then.The SDS-PAGE electrophoresis is identified purity, obtains the Hgp96N end recombiant protein greater than 95% purity.The Hgp96 protein product of expressing carries out Western blot with gp96/grp94 monoclonal antibody (NeoMarkers company) and GST antibody to be identified, proves to obtain the part that product is Hgp96.
10.Hgp96 stimulator antigen is the activation of delivery cell
With the Hgp96 albumen of purification and polymyxin (polymyxin B sulfate) (sigma) 10ug/ml mix, room temperature was placed 1 hour, perhaps the Hgp96 with purification crosses detoxi post (Pierce) post, removes endotoxic influence.LPS is 0.2ng/ml according to the Concentraton gradient dilution, 10ng/ml, 100ng/ml, 1000ng/ml mixes with polymyxin (sigma) 10ug/ml then, and room temperature was placed 1 hour.With Hgp96 (the Concentraton gradient 0.3ug/ml that handles well, 3ug/ml, 10ug/ml, 100ug/ul) and LPS (Concentraton gradient 0.2ng/ml, 10ng/ml, 100ng/ml, 1000ng/ml) join peripheral blood lymphocytes (PBMC) induce the 6th day non-mature dendritic cell (imDC) breaking up (Fig. 6) in, cultivated 24 hours in the CO2 incubator of 37 degree 5%, measure the variation of dendritic cell surface molecular, detect and be CD14-, HLA-DR+, CD40high, CD86high, CD83+ was with the 6th day imDC (CD14-, HLA-DR+, CD40low, CD86low, CD83-,) relatively, the Hgp96 of 3-10ug/ml (0.02-0.1nm) and can promote the maturation (Fig. 6) of antigen-presenting cell.Experimental results show that gp96 is not because the endotoxin that pollutes causes to the activation of antigen-presenting cell.
11.Hgp96 N end promote the activation of antigen-presenting cell DC
(N355 N370) crosses detoxi post (Pierce) post and removes endotoxin for N288, N336 with the gp96N end protein of purification.Before stimulating it is mixed with polymyxin (sigma) 10ug/ml, room temperature was placed 1 hour, according to Concentraton gradient gradient 0.3ug/ml, 3ug/ml, 10ug/ml, 100ug/ul join in the non-mature dendritic cell (imDC) of cultivating the 6th day, cultivated 24 hours in the CO2 incubator of 37 degree 5%, measure the variation of dendritic cell surface molecular, detect and be CD14-, HLA-DR+, the CD86 height, CD83+ was with the 6th day imDC (CD14-, HLA-DR+, CD86 is low, CD83-) relatively, the gp96N of 3-10ug/ml (0.02-0.1nm) holds and can promote the activation of antigen-presenting cell.Experimental results show that gp96 is not because the endotoxin that pollutes causes to the activation of antigen-presenting cell.And N336 in the N end fragment and N355 are to antigen presentation cell activity strong (Fig. 7).
12.Hgp96 activatory DC cell and hepatitis B virus core antigen specific epitopes stimulation innocence (
) the lymphocytic amplification of T
With A2 type hepatitis B virus core antigen epi-position according to gradient (10ug/ml, 50ug/ml, 100ug/ml) with gp96 induce activatory after body DC cell 37 degree stimulates 4 hours, with the roentgenization of 30Gy, then with the isolating innocence of peripheral blood (
) mixing of T lymphocyte, cultivate in the 37 degree 5%CO2 incubators.The post-stimulatory recombinant human il-2 who added 10U/ml in second day.After 7 days, the stimulation that uses the same method added the recombinant human il-2 of 10U/ml in second day.Third round stimulated after 7 days, measured release and the 51Cr release experiment of IFN-r.The result confirms that Hgp96 induces activatory DC cell can strengthen the generation of the special CTL of peptide, and the quantity of the CTL that produces presents dosage effect.
13.Hgp96 the hepatitis B virus core antigen epi-position combined stimulation of N end recombinant fragment and HLA-A2 type, promote innocence (
) the lymphocytic peptide specific amplification of T
With A2 type HBV and HCV epitope according to gradient (10ug/ml, 50ug/ml, 100ug/ml) with the gp96N end fragment induce activatory after body DC cell 37 stimulates 4 hours, with the roentgenization of 30Gy, isolating with peripheral blood then
The T lymphocyte mixes, and cultivates in the 375%CO2 incubator.The post-stimulatory recombinant human il-2 who added 10U/ml in second day.After 7 days, the stimulation that uses the same method added the recombinant human il-2 of 10U/ml in second day.Second take turns post-stimulatory 7 days after, measure release and the 51Cr release experiment of IFN-r.The result confirms that Gp96N end induces activatory DC cell can strengthen the generation of the special CTL of peptide, and the quantity of the CTL that produces presents dosage effect (Fig. 8) to peptide.With HBV is example, the results are shown in Figure 8.
14.Hgp96, promote the CTL amplification that peptide is special with the hepatitis B virus epi-position combined stimulation of other restricted type
According to following epi-position (table 2) combined stimulation of embodiment 3 described methods with Hgp96 and HLA-A2, A11, A24 and A31/68 type
The confirmation of dyeing of T lymphocyte, TETRAMER can cause the CTL cell clone amplification at other epi-position.
HLA-A2, the A11 of table 2.HBV, A24 and A31/68 restriction epitope polypeptide
15.Hgp96 the hepatitis B virus epi-position combined stimulation of N end and listed other restricted type of table 1, promote the CTL amplification that peptide is special
According to the method for embodiment 14 N end and the listed epi-position combined stimulation of table 1, can cause the amplification of the special CTL of peptide with gp96.
16.Hgp96, promote the amplification of the CTL that a plurality of peptides are special with the listed multi-epitope combined stimulation of the table 1 of hepatitis B virus
Method according to embodiment 14 is united gp96 and a plurality of epi-position, and TETRAMER dyeing proof can be induced the amplification of the special ctl clone of a plurality of peptides.
17.Hgp96 the multi-epitope combined stimulation of N end and hepatitis B virus, promote the amplification of the CTL that a plurality of peptides are special
According to the method for embodiment 13, with N end and a plurality of epi-position associatings of gp96, TETRAMER dyeing proof can be induced the amplification of the special ctl clone of a plurality of peptides.
Embodiment three
Present embodiment is an animal model with the SPF chicken, is adjuvant with Chsp108 N21-355, and MDV, AIV and NDV proteantigen are studied, and obtains same conclusions.Now be example with MDV:
1. from chicken liver, extract the Chsp108 and the gene sequencing thereof of HSP90 family
According to above-mentioned extracting method. health and the chook MDV (MDV) of getting-70 ℃ of preservations respectively infect chicken tumor liver organization 80 grams that cause, add 4 times of volume hypotonic buffer liquid, removed cell debris and other impurity in centrifugal 30 minutes for broken .14000 rev/min with the above hepatocyte of homogenizer homogenate to 95% to the ice bath, ultracentrifugation. supernatant is with 50%～70% saturated ammonium sulphate precipitation, cross affinity column behind the resolution of precipitate. bonded glycoprotein is with 10% phlorose thuja acid sodium eluting. collect eluent. on the AKTA tomographic system, cross anion column. bonded albumen is earlier with 300 mMs/rise NaCl eluting, then gradient elution until NaCl concentration be 1000 mMs/liter. collect 1 time for per 1 milliliter, collect liquid and dye detection through SDS-PAGE electrophoresis and silver. eluted the Chsp108 albumen that obtains purification when the NaCl of 400～600 mMs/rise concentration, the about 108kDa. silver of molecular weight dyes the result and shows that purity is more than 95%.Chsp108 has been carried out gene sequencing, and the Chsp108 of the chicken tumor liver organization that the MDV infection causes is identical with the Chsp108 aminoacid of normal chicken liver tissue, does not morph;
2.Chsp108 the segmental clone of N21-355
Clone N end group is because of (the hsp108 source: for GeneBank includes, the number of including is AF387865) from the chicken pET-30a-hsp108 plasmid that laboratory is preserved.The primer is:
Primer 1:5 ' TTACCCGGGTGAGGAGGTGGATGTGGAT3 '
Primer 2: 5 ' CCGAGCTCCCAAATGGTGAGAGTATAATTTAC3 '
The PCR reaction condition is as follows: 94 ℃ 4 minutes; 94 ℃ 50 seconds, 55 ℃ 50 seconds, 72 ℃ 3 minutes, totally 30 the circulation; 72 ℃ 5 minutes.Result's proof is identical with known array.
The PCR product is the fragment of about 1Kd, and artificial SmaI and two restriction enzyme sites of SacI introduced of segmental 5 ' end and 3 ' end check order amplified fragments.Its sequence is identical with above-mentioned sequence, and its sequence has the nucleotide sequence shown in sequence table 3No.1, and its coded albumen has 335 aminoacid sequences shown in sequence table 3No.2.
3.Chsp108 N21-355
Expression in the enterobacteria and protein purification
Amplified fragments is connected among the expression vector pGEX6p-1 behind SmaI and SacI enzyme action, and transformed into escherichia coli BL21, after the 1mM isopropyl-p-p-thiogalactoside (IPTG) is induced 4 hours, obtain expression product, detecting the expression product molecular weight with 10% dodecane (base) sodium sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) electrophoresis and coomassie brilliant blue staining is 45kDa, consistent with theoretical value.
With Chsp108 N-end fragment albumen glutathione-S-transferase (GST) chromatographic column (Pharmacia company), carry out purification through affinity chromatograph and molecular sieve superdex G200 (PE company), dye evaluation purity with 10%SDS-PAGE electrophoresis and silver, obtain N end protein greater than 95% purity.The expressed proteins product carries out Western with gp96 monoclonal antibody (NeoMarkers company) to be identified, obtains positive findings.
4.Chsp108 N21-355 and MDV gB glycoprotein antigen immunity chicken
Immunization ways adopts the middle subcutaneous injection of phosphate buffer (PBS) that sample is dissolved in 100ml.Immune programme for children is to carry out the immunity second time after immune three weeks for the first time.Adopt subcutaneous injection, Chsp108 N-end fragment and above-mentioned MDV gB glycoprotein antigen conjugate are dissolved in buffer, and (among the 90%PBS, 10% dimethyl sulfoxide/0.1%TFA), every chicken immune dosage is respectively 10 μ g.Each immunity was got blood in back 15 days, measured the antibody of anti-MDV gB glycoprotein antigen.The chicken of using the immunity of Chsp108 N-end fragment does not separately produce the antibody of antigen-specific, and application Chsp108N-end fragment and MDV gB glycoprotein antigen conjugate mice immunized produce the antibody of antigen-specific, and its antibody amount is 10 times that the independent MDV of application gB glycoprotein antigen produces antibody.Illustrate that Chsp108 N-end fragment has tangible potentiation to the immunogenicity of proteantigen.Research method in the research of Avian pneumo-encephalitis virus and bird flu virus in the application implementation 2,3 finds that chicken liver Chsp108 N-end fragment can strengthen the immunoreation of chicken to above-mentioned virus antigen equally.
Sequence table 1
＜110〉Institute of Microorganism, Academia Sinica
＜120〉immunological adjuvant that a class is new and the application in antiviral vaccine or drug development thereof
<130>tianpo-6-21
<160>8
<170>PatentIn?version?3.1
<210>1
<211>801
<212>DNA
<213>Human?gp96
<400>1
<210>2
<211>267
<212>PRT
<213>Human?gp96
<400>2
<210>3
<211>945
<212>DNA
<213>Human?gp96
<400>3
<210>4
<211>315
<212>PRT
<213>Human?gp96
<400>4
<210>5
<211>999
<212>DNA
<213>Human?gp96
<400>5
<210>6
<211>333
<212>PRT
<213>Human?gp96
<400>6
<210>7
<211>1047
<212>DNA
<213>Human?gp96
<400>7
<210>8
<211>349
<212>PRT
<213>Human?gp96
<400>8
Sequence table 2
＜110〉Institute of Microorganism, Academia Sinica
＜120〉immunological adjuvant that a class is new and the application in antiviral vaccine or drug development thereof
<130>tian-po-6-21
<160>2
<170>PatentIn?version?3.1
<210>1
<211>606
<212>DNA
<213>Human?HSP70?N161-362
<400>1
<210>2
<211>202
<212>PRT
<213>Human?HSP70?N161-362
<400>2
Sequence table 3
＜110〉Institute of Microorganism, Academia Sinica
＜120〉immunological adjuvant that a class is new and the application in antiviral vaccine or drug development thereof
<130>PATENT
<160>2
<170>PatentIn?version?3.2
<210>1
<211>1005
<212>DNA
<213>chicken
<400>1
<210>2
<211>335
<212>PRT
<213>chicken
<400>2
Sequence table 4
＜110〉Institute of Microorganism, Academia Sinica
＜120〉immunological adjuvant and the application in antiviral vaccine or medication preparation thereof
<130>
<160>8
<170>PatentIn?version?3.1
<210>1
<211>10
<212>PRT
<213>HBV
<400>1
<210>2
<211>9
<212>PRT
<213>HBV
<400>2
<210>3
<211>9
<212>PRT
<213>HBV
<400>3
<210>4
<211>9
<212>PRT
<213>HBV
<400>4
<210>5
<211>8
<212>PRT
<213>HBV
<400>5
<210>6
<211>9
<212>PRT
<213>HBV
<400>6
<210>7
<211>9
<212>PRT
<213>HBV
<400>7
<210>8
<211>11
<212>PRT
<213>HBV
<400>8
Claims (8)
1. immunological adjuvant, it is characterized in that it being by the N of gp96 end recombinant fragment, be that aminoterminal has the albumen that the immune-enhancing activity fragment is formed, the N end recombinant fragment of described gp96 is selected from albumen, the albumen of 333 aminoacid sequences compositions shown in the sequence table 1No.6 and the albumen that 349 aminoacid sequences shown in sequence table 1 No.8 are formed that 267 aminoacid sequences shown in the sequence table 1No.2 are formed.
2. a compositions comprises immunological adjuvant according to claim 1.
3. the described compositions of claim 2, described compositions also comprises antigenic substance, described antigenic substance is selected from the epitope peptide of hepatitis B virus (HBV), HIV (human immunodeficiency virus) HIV-1 and sars coronavirus (SARS-CoV), covalently bound multi-epitope recombinant protein and antigen.
4. compositions according to claim 3, wherein said hepatitis B virus HHBV epitope peptide comprises: STLPETTVVRR, FLPSDFFPSV, IPIPSSWAF, WLSLLVPFV and FLLSLGIHL; The epitope peptide of described HIV-1 comprises: SILDIRQGPK and CQGVGGPGHK; The epitope peptide of described SARS-CoV comprises: LLLDRLNQL and WFLHVTYV.
5. the application of the described immunological adjuvant of claim 1 in the described compositions of preparation claim 2.
6. the described application of claim 5, wherein said compositions also comprises antigenic substance, described antigenic substance is selected from the epitope peptide of hepatitis B virus (HBV), HIV (human immunodeficiency virus) HIV-1 and sars coronavirus (SARS-CoV), covalently bound multi-epitope recombinant protein and antigen.
7. claim 2,3, or the vaccine of the disease that causes by virus in preparation prevention and treatment of 4 described compositionss or the application in the medicine.
8. the described application of claim 7, wherein said virus comprises following: hepatitis B virus (HBV), HIV (human immunodeficiency virus) HIV-1 or sars coronavirus (SARS-CoV).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100691928A CN100467063C (en) | 2004-07-07 | 2004-07-07 | Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100691928A CN100467063C (en) | 2004-07-07 | 2004-07-07 | Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1718243A CN1718243A (en) | 2006-01-11 |
| CN100467063C true CN100467063C (en) | 2009-03-11 |
Family
ID=35930271
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100691928A Expired - Fee Related CN100467063C (en) | 2004-07-07 | 2004-07-07 | Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100467063C (en) |
Families Citing this family (13)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1865281B (en) * | 2006-06-02 | 2012-08-22 | 北京大学人民医院 | Specific antibody GB11 T cell epitope peptide for resisting oophoroma and its uses |
| KR20110017356A (en) * | 2008-03-20 | 2011-02-21 | 유니버시티 오브 마이애미 | Heat shock protein gp96 vaccination and methods of using same |
| CN102462840B (en) * | 2010-11-09 | 2014-03-19 | 南通生物科技园开发投资有限公司 | Therapeutic hepatitis B vaccine |
| CN102462841A (en) * | 2010-11-09 | 2012-05-23 | 中国科学院微生物研究所 | Method for promoting immunological activity of gp96 protein and application thereof |
| CN102166349A (en) * | 2010-12-31 | 2011-08-31 | 中国人民解放军第三军医大学 | Malaria infrared stage DNA vaccine and preparing method thereof |
| CN102199204B (en) * | 2011-03-15 | 2014-03-19 | 中国科学院微生物研究所 | Chicken-origin heat shock protein, and encoding gene and application thereof |
| CN103405763A (en) * | 2013-07-15 | 2013-11-27 | 中国科学院海洋研究所 | Application of heat shock protein 70 as immunoadjuvant |
| CN103505725B (en) * | 2013-09-30 | 2015-06-24 | 中科微生物免疫制剂工程中心南通有限公司 | Universal influenza vaccine with broad-spectrum cross protection capability and preparation method thereof |
| CN103724414B (en) * | 2014-01-09 | 2016-08-17 | 江苏省血吸虫病防治研究所 | A kind of SjHSP90 recombiant protein and the application in schistosomiasis diagnosis and efficacy assessment thereof |
| CN111197057B (en) * | 2018-11-19 | 2024-04-19 | 中国科学院分子细胞科学卓越创新中心 | Compositions and methods for modulating immune cell migration |
| CN111548396B (en) * | 2020-04-17 | 2021-07-20 | 暨南大学 | Novel coronavirus T cell epitope peptide, pMHC, preparation and application thereof |
| CN111548395A (en) * | 2020-05-25 | 2020-08-18 | 中国农业科学院兰州兽医研究所 | Bivalent multi-epitope recombinant virus-like particle of foot-and-mouth disease virus and application thereof |
| CN111533812B (en) * | 2020-06-22 | 2020-10-27 | 艾立克(北京)生物科技有限公司 | DNA vaccine for SARS-COV-2 virus and its use |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1316431A (en) * | 2000-08-11 | 2001-10-10 | 中国科学院微生物研究所 | Compound of polypeptide as antigen of hepatitis B virus and heat shock protein and its application |
-
2004
- 2004-07-07 CN CNB2004100691928A patent/CN100467063C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1316431A (en) * | 2000-08-11 | 2001-10-10 | 中国科学院微生物研究所 | Compound of polypeptide as antigen of hepatitis B virus and heat shock protein and its application |
Non-Patent Citations (5)
| Title |
|---|
| . TALI GIDALEVITZ IDENTIFICATION OF THE TERMINAL PEPTIDEBINDINGSITEOFGLUCOSE-REGULATED PROTEIN 94.THE JOURNAL OF BIOLOGICAL CHEMISTRY,Vol.279 No.16. 2004 * |
| GRP94(gp96) and GRP94 N-Terminal Geldanamycin BindingDomain Elicit Tissue Nonrestricted Tumor Suppression. Julie C.Baker-LePain.J.Exp.Med.,Vol.196 No.11. 2002 * |
| Identification of the N-terminal PeptideBindingSiteofGlucose-regulated Protein 94. Tali Gidalevitz.The Journal of Biological Chemistry,Vol.279 No.16. 2004 * |
| 热休克蛋白及其研究概况. 梁雪松.辽宁中医学院学报，第6卷第1期. 2004 * |
| 鸡热应激蛋白108特性与功能初步研究. 李燕.南京农业大学学位论文. 2002 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1718243A (en) | 2006-01-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100467063C (en) | Immunological adjuvant, and its application in preparing vaccine and medicine for anti-virus | |
| Heffernan et al. | In vivo efficacy of a chitosan/IL-12 adjuvant system for protein-based vaccines | |
| Lillehoj et al. | Resistance to intestinal coccidiosis following DNA immunization with the cloned 3-1E Eimeria gene plus IL-2, IL-15, and IFN-γ | |
| US8101189B2 (en) | Vaccines and immunopotentiating compositions and methods for making and using them | |
| PT2685995T (en) | Yeast-brachyury immunotherapeutic compositions | |
| US10238747B2 (en) | Method for inducing an immune response against avian, swine, spanish, H1N1, H5N9 influenza viruses and formulations thereof | |
| TW201420114A (en) | Synthetic peptide-based emergency vaccine against foot and mouth disease (FMD) | |
| Qing et al. | Construction of an HBV DNA vaccine by fusion of the GM-CSF gene to the HBV-S gene and examination of its immune effects in normal and HBV-transgenic mice | |
| Pacífico et al. | Immunization with Schistosoma mansoni 22.6 kDa antigen induces partial protection against experimental infection in a recombinant protein form but not as DNA vaccine | |
| CN104168912A (en) | Facilitator-DNA combination vaccine | |
| CN109134613B (en) | It is a kind of promote vaccine immunity reaction bursa of Fabricius heptapeptide and its application | |
| KR20170129804A (en) | A vaccine having CD40 ligand as adjuvant | |
| WO2017177907A1 (en) | Anti-immune checkpoint pd-l1 and pd-l2 tumor vaccines | |
| CN101643497A (en) | HLA-A2 restrictive epitope polypeptide of LMP2A protein source and purpose thereof | |
| Shi et al. | The expression of membrane protein augments the specific responses induced by SARS-CoV nucleocapsid DNA immunization | |
| EP2464379B1 (en) | Vaccine having a peptide adjuvant for eliciting a specific immune response to treat influenza viral infection | |
| CN107073086A (en) | Immunity LHRH compositions and its application in pig | |
| JP5901084B2 (en) | Peptide adjuvant | |
| Mansilla et al. | Immunization against hepatitis C virus with a fusion protein containing the extra domain A from fibronectin and the hepatitis C virus NS3 protein | |
| AU2019262609A1 (en) | Artificial promiscuous T helper cell epitopes that facilitate targeted antibody production with limited T cell inflammatory response | |
| CN109675018A (en) | A kind of drug and its application for coating skin surface | |
| CN106317216B (en) | It is a kind of promote H9N2 avian influenza vaccine immune effect active peptide and application | |
| AU675703B2 (en) | Stimulation of immune response by viral protein | |
| US11191828B2 (en) | MHC class I associated hepatitis B peptides | |
| CN102018964A (en) | Three-plasmid co-immune vaccine system capable of breaking immune tolerance and preparation method thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20090311 Termination date: 20170707 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |