CN100446772C - Treatment of diabetes - Google Patents

Abstract

The invention provides methods and compounds for regulating glucose metabolism, achieving glucose homoeostasis in a subject and reducing sugar contents of blood. The invention also provides methods and compounds for treating or preventing sugar diabetes and hyperglycemia and diseases and symptoms related to the change of the glucose metabolism or damage of the glucose metabolism.

Description

The application of the preparation of a kind of stable HIF α in the medicine of preparation treatment diabetes

The application requires the priority of U.S. Provisional Application series number No.60/476331 that submits in the U.S. Provisional Application series number No.60/431351 of December in 2002 submission on the 6th, on June 6th, 2003 and the U.S. Provisional Application series number No.60/476726 that submitted on June 6th, 2003, and it is for referencial use that the content of these applications is included this paper separately in.

Invention field

The present invention relates to the adjusting and the homoiostasis of glucose, relate to the treatment or the prevention of glucose adjusting damaged relevant diseases such as diabetes.

Invention back of the body border

Diabetes are that a kind of what take place that defective causes owing to insulin secretion, insulin active or the two is the disease of feature with the hyperglycemia.Type i diabetes (being called insulin-dependent diabetes (IDDM) in the past) is that a kind of Langerhans cell acts on islets of langerhans, destroyed that body produces the insulin ability and the autoimmune disease that causes.Type i diabetes accounts for 10% of all glycosuria cases, has influence on nearly 1,000,000 people of the U.S..Type ii diabetes (being called insulin dependent/non-dependent diabetes (NIDDM) in the past) is a kind of metabolic disease that can not produce enough insulins or can not suitably utilize insulin to cause owing to body.About 90% suffers from type ii diabetes among all diabetes patient of the U.S..I type and type ii diabetes all are that what to take place that defective causes owing to insulin secretion, insulin active or the two is the metabolic disease of feature with the hyperglycemia.

The popular of diabetes increases with alarm speed.Between the 1976-1994 among the U.S. adult diabetic population increase to 12.3% from 8.9%.U.S.'s at present nearly 1,600 ten thousand (account for population 6%) people suffers from diabetes, annual new diagnosing diabetes people 800,000 people.(Harris etc., Diabetes Care, 21:518-5241,1998; Nathan:NEnglJ Med., 347:1342-1349,2002).Diabetes are before generation, between the emergence period and disease and the And morbidity of back with various organs in the extensive influence body take place; For example retinopathy, nephropathy, neuropathy etc. cause losing one's sight, renal failure etc.Diabetes may have a strong impact on quality of life, even can cause death and die.Therefore the effective ways that disease is taken place and developed need treatment be sent out with prevent diabetes and relevant And thereof in this field.

With diabetes, usually with type ii diabetes relevant several risk factors take place, specifically be diabetes family history, some ethnic group or race, pregnant glycosuria medical history, obesity, the motionless life type of particularly high-caliber internal organs and stomach fat, sitting, age, hypertension, schizophrenia etc.; And the change of glucose metabolism, comprise glucose tolerance impaired (IGT) or prediabetes.Therefore the effective ways that take place and develop with prevent diabetes hazard factor need be treated in this field.

Diseases such as diabetes are regulated out of control relevant with glucose.Diabetes and hyperglycemia can cause producing or produce various diseases and disease in reaction, and relevant disease and disease comprise: atherosclerosis, angiopathy such as apoplexy etc.; Obesity, cardiovascular disease such as congestive heart failure (CHF), myocardial infarction (MI) and downstream influences etc.; Or the risk factor relevant with disease with these diseases.Therefore this field need be treated and prevent, or at utmost reduces the effective ways that diabetes or hyperglycemia relevant disease risk factor take place.The invention provides a kind of drug treatment and answered this needs, this method is with the different aspect employing multiple therapy methods for various disease and various disease is different at present, but give a kind of can targeting certain family (member) of relevant physiological process, and realize to obtain required therapeutic effect by synergistic chemical compound.

The present treatment of diabetes is the glucose levels (as realizing glycemic control) in the control blood, to scheme the natural physiological glucose homeostasis of regeneration.Because the variation of life type keeps on a diet and increase motion as recommending, so the method possibility effect is limited.The variation of this life type can not prevent or defeat the generation of relevant physiologic factor, might delay but can not prevent the progress of this disease.In addition, patient may limit its effect to this method shortage compliance.

Therapeutic Method commonly used comprises insulinize, for example by the time mode with careful design, usually needs once a day or even the insulin that need give of time injection more than a day.Need this treatment of insulin injection may be with the danger of hypoglycemia and hyperinsulinemia.In addition the treatment of this class whether success often due to illness the people lack compliance and lost efficacy, promptly can not be obedient to the therapeutic scheme of recommendation and fail.Other is based on the treatment of insulin, as gives insulin the short element that oozes (chemical combination of the insulin that can the stimulating pancreas branch oozes) that divides, and also has the similar danger that induces hypoglycemia etc.These therapies and existing therapy, as PPAR-γ antagonist therapy etc. with other effect, for example diabetes with self a kind of risk factor: weight increase.Therefore need effectively treatment or prevent diabetes, hyperglycemia and diabetes hazard factor, as weight increase and fat method and chemical compound, these methods and chemical compound usually can improve the easiness of administration, can't be with other diabetes correlative factor, as the generation or the danger of weight increase etc.For diabetes and relevant disease, need more approaching simulation to reach the Therapeutic Method of body self physiological mechanism of glucose homeostasis.Certainly this class treatment may need to improve the easiness of administration, raising patient's comfort level and patient's compliance.In addition, the treatment of diabetes or relevant disease needs this treatment not have the effect that increases the weight of or worsen the disease of controlling.

Glucose metabolism, for example synthetic, the processing of glucose and utilization etc., be keep the normal glucose balance and homoiostasis necessary.The destruction of glucose metabolism or adjusting can cause the destruction of glucose homeostasis, causes the unsuitable high level of blood glucose (being hyperglycemia) or low-level (being hypoglycemia).Hyperglycemia and hypoglycemia have influence on quality of life for a long time or seriously, produce nerve and blood vessel injury.Therefore need blood sugar regulation metabolism and homoiostasis (reaching Blood glucose control), change or impaired relevant disease and disease with glucose metabolism and homoiostasis with treatment or prevention, as the effective ways of diabetes, hyperglycemia etc.

Summary of the invention

The method and the chemical compound that the present invention relates to regulate glucose metabolism and realize glucose homeostasis.The method that makes experimenter's blood sugar lowering level, reduction insulin resistant, reduction glycated hemoglobin level and improve glycemic control also is provided.The method of treatment or prevent diabetes, hyperglycemia and other blood sugar level rising relevant disease is provided, and for example treatment or prevent diabetes relevant disease as become diabetic risk factors, or take place simultaneously with diabetes or the method for the disease that diabetes caused.

In various embodiments, described experimenter is cell, tissue or organ.In other embodiments, described experimenter is an animal, preferred mammal, more preferably people.When the experimenter was cell, the present invention considered that specifically this cell can be isolated cells, protokaryon or eukaryotic cell.When the experimenter is when organizing, the present invention is concrete to consider it is endogenous tissue and vitro tissue, as the tissue of cultivating.In preferred embodiments, described experimenter is an animal, specifically is the mammal animal, comprises rat, rabbit, cattle, sheep, pig, mice, horse and primate.In the most preferred embodiment, described experimenter is the people.

The invention provides the method for regulating glucose metabolism.On the one hand, the inventive method comprises the carbohydrate metabolism of regulating the experimenter, is to regulate its carbohydrate metabolism by the HIF α that stablizes the experimenter.On the content, HIF α is HIF1 α, HIF2 α or HIF3 α in every respect.One preferred aspect, stablize the chemical compound that HIF α comprises the inhibition HIF hydroxylase activity that gives experimenter's effective dose.

Stablize HIF α can be with those skilled in the art existing and known method carry out, can comprise that employing can react to each other with HIF α, maybe can modify HIF α or any preparation of the factor that reacts to each other with HIF α, as being the enzyme of substrate with HIF α.In some aspects, the present invention considers to provide constitutionally stable HIF α variant, as stable HIF mutain etc., or the polynucleotide of this variant of encoding.In others, the present invention considers to stablize HIF α, comprises any preparation that gives to stablize HIF α.Said preparation can comprise polynucleotide, as antisense sequences; Polypeptide; Antibody; Other protein; Carbohydrate; Fat; Lipid; With organic and inorganic substances, as micromolecule etc.In a preferred embodiment, the present invention considers, for example stablizes this experimenter's HIF α by giving any preparation that the experimenter can stablize HIF α, and wherein said preparation is the chemical compound that can stablize HIF α, as micromolecular compound.

The invention still further relates to the method for regulating experimenter's glucose metabolism, this method is regulated this experimenter's glucose metabolism by the The compounds of this invention that gives experimenter's effective dose.One preferred aspect, chemical compound of the present invention is the chemical compound that can suppress the HIF hydroxylase activity.Aspect most preferred, chemical compound of the present invention is to suppress the active chemical compound of HIF prolyl hydroxylase.Another preferred aspect, the HIF hydroxylase is selected from EGLN1, EGLN2 and EGLN3.

The present invention also passes through to stablize experimenter's HIF α, or gives the The compounds of this invention that can regulate this experimenter's glucose metabolism process of experimenter's effective dose, and the method for regulating experimenter's glucose metabolism process is provided.In various embodiments, it is synthetic etc. that described glucose metabolism process is selected from glucose uptake, glucose transport, glucose storage, glucose processing, glucose utilization and glucose.

In specific embodiments, method of the present invention is by stablizing experimenter's HIF α, or the chemical compound of the expression that can change this experimenter's glucose regulatory factor by giving experimenter's effective dose, changes the expression of this experimenter's glucose regulatory factor.

In one embodiment, method provided by the invention, by stablizing experimenter's HIF α, or the chemical compound of the expression that can increase this experimenter's glucose regulatory factor by giving experimenter's effective dose, increase the expression of this experimenter's glucose regulatory factor.In other embodiments, described glucose regulatory factor is selected from: PFK-P, PFK-L, Enolase-1, GluT-1, lactic acid dehydrogenase, aldolase-1, hexokinase-1, IGFBP-1 and IGF.One concrete aspect, the increase of glucose regulatory factor is that persistence increases.On the one hand, this glucose regulatory factor is a kind of glycolysis factor.On the other hand, this glycolysis factor is selected from: PFK-P, PFK-L, Enolase-1, lactic acid dehydrogenase, aldolase-1 and hexokinase-1.

The invention provides the method that realizes experimenter's glucose homeostasis.On the one hand, method of the present invention comprises realization experimenter glucose homeostasis, thereby this is the glucose homeostasis that reaches this experimenter by the HIF α that stablizes the experimenter.On the other hand, method of the present invention comprises realization experimenter glucose homeostasis, thereby this is the glucose homeostasis that reaches this experimenter by the The compounds of this invention that gives experimenter's effective dose.

The invention provides and reduce experimenter's method of glucose level.On the one hand, method of the present invention comprises the blood sugar level that reduces the experimenter, thereby this is the blood glucose body level that reduces this experimenter by the HIF α that stablizes the experimenter.On the other hand, method of the present invention comprises the glycated hemoglobin level that reduces the experimenter, thereby this is the glycated hemoglobin level that reduces this experimenter by the The compounds of this invention that gives experimenter's effective dose.

This paper relates to the method for the treatment of or preventing to have the generation diabetes or have the diabetes that the risk of diabetes experimenter is taken place.In one embodiment, this method comprises that treatment or prevention have the diabetes that diabetes take place or have generation risk of diabetes experimenter, thereby this is HIF α prevention or treatment diabetes by stablizing this experimenter.On the other hand, method of the present invention comprises treatment or prevention experimenter's diabetes, thereby this is by The compounds of this invention treatment that gives experimenter's effective dose or the diabetes of preventing this experimenter.

The present invention also provides the method for treatment or prevention experimenter's blood sugar level rising relevant disease.In one embodiment, this method comprises treatment or prevention experimenter's blood sugar level rising relevant disease, thereby this is HIF α prevention or treatment blood sugar level rising relevant disease by stablizing this experimenter.On the other hand, method of the present invention comprises treatment or prevention experimenter's blood sugar level rising relevant disease, thereby this is the The compounds of this invention treatment by giving experimenter's effective dose or prevents this experimenter's blood glucose to increase relevant disease.In various embodiments, described disease is selected from: diabetes, hyperglycemia, obesity, sugar tolerance are impaired, hypertension, retinopathy, neuropathy, nephropathy, hyperlipemia and angiopathy.

The invention still further relates to the method for treatment or prevention experimenter diabetes relevant disease.In one embodiment, this method comprises treatment or prevent diabetes relevant disease, thereby this is to prevent or treat its diabetes relevant disease by the HIF α that stablizes this experimenter.On the other hand, method of the present invention comprises treatment or prevention experimenter's diabetes relevant disease, thereby this is by The compounds of this invention treatment that gives experimenter's effective dose or the diabetes relevant disease that prevents this experimenter.In various embodiments, described disease is selected from: hypertension, obesity, hyperglycemia, glucose tolerance are impaired, hyperlipemia, nephropathy, neuropathy, retinopathy, atherosclerosis and angiopathy.In one embodiment, described experimenter is the experimenter who suffers from diabetes.In another embodiment, described experimenter has the experimenter who suffers from risk of diabetes.

The invention provides the method that reduces experimenter's blood triglyceride level.On the one hand, method of the present invention can reduce experimenter's blood triglyceride level, thereby this is the blood triglyceride level that reduces this experimenter by the HIF α that stablizes this experimenter.On the other hand, method of the present invention can reduce experimenter's blood triglyceride level, thereby this is the blood triglyceride level that reduces this experimenter by the The compounds of this invention that gives this experimenter's effective dose.

The invention provides the method that reduces experimenter's insulin resistant.On the one hand, method of the present invention can reduce experimenter's insulin resistant, thereby this is to reduce this experimenter's insulin resistant by the HIF α that stablizes this experimenter.On the other hand, method of the present invention can reduce experimenter's insulin resistant, thereby this is the insulin resistant that reduces this experimenter by the The compounds of this invention that gives this experimenter's effective dose.

The invention provides the method that improves experimenter's glycemic control ability.On the one hand, but method interests experimenter's of the present invention glycemic control, thus this is to improve this experimenter's glycemic control by the HIF α that stablizes this experimenter.On the other hand, method of the present invention can improve experimenter's glycemic control, thereby this is the glycemic control that improves this experimenter by the The compounds of this invention that gives this experimenter's effective dose.Also have on the one hand, described experimenter is the experimenter who suffers from hyperglycemia.

In various embodiments, the invention provides the prescription or medicine or the pharmaceutical composition that contain The compounds of this invention, and the method for making and use these prescriptions or medicine or pharmaceutical composition.

The accompanying drawing summary

Figure 1A and 1B show with The compounds of this invention handle induce in the cell aldolase and Glut1 (GluT-1).

Fig. 2 A, 2B and 2C show with participating in the glycoregulatory expression of gene of Fructus Vitis viniferae in kidney, liver and the lung respectively in the The compounds of this invention processing animal.

Fig. 3 A and 3B show dosage and the thermotonus of handling the gene of encode respectively in the kidney regulating liver-QI of animal GluT-1 and IGFBP-1 with The compounds of this invention.

Fig. 4 shows the reduction of blood sugar level in the animal of handling with The compounds of this invention.

Fig. 5 A and 5B show with after the The compounds of this invention treatment, the raising of sugar tolerance in the diet induced type 2 diabetes mellitus animal model.

Fig. 6 shows the reduction with haemachrome saccharifying in the db/db mice of The compounds of this invention treatment.

Fig. 7 A and 7B show with the body weight of The compounds of this invention treatment animal and the variation of cardiac weight.

Fig. 8 shows the minimizing with interior fat in the The compounds of this invention treatment animal.

Fig. 9 A, 9B and 9C show that weight gain and stomach fat pad weight are all reduced in the diet induced fat animal model with after the The compounds of this invention treatment.

Figure 10 A and 10B show with after the The compounds of this invention treatment, encoded derivable nitricoxide synthase (iNOS) and adrenomedullin expression of gene.

Figure 11 shows with the blood triglyceride level in the The compounds of this invention treatment animal.

Figure 12 A and 12B show the stability of handling HIF-1 α in the cell with The compounds of this invention.

The description of invention

Before describing the compositions and methods of the invention, must understanding the invention is not restricted to described concrete grammar, journey Order, clone, test and reagent are because they can change. Also should understand term purpose used herein Be to describe specific embodiments of the present invention, do not mean that to limit the scope of the invention that scope of the present invention is by attached Claims limit.

Must be pointed out, as used in this paper and claims, " " of singulative, " a kind of " and " this " Comprise plural reference substance, unless otherwise indicated herein. Therefore, known to as described herein and those skilled in the art, For example reference " fragment " comprises a plurality of these class fragments; Reference " compound " refers to the one or more chemical combination of reference Thing and its equivalent.

Except as otherwise noted, all technology used herein and scientific terminology have any common skill in the affiliated field of the present invention Art personnel the common identical meanings of understanding. Although being similar to or being equivalent to any method as herein described and material can Be used for implementing or test the present invention, but describe now preferred method, device and material. All that this paper quotes It is for referencial use that publication fits into this paper in it, purpose be describe and disclose report in these publications may with this Bright relevant methodology, reagent and instrument. Consisting of without any thing herein allows the present invention to have the right to rely on previous Disclosure of invention is antedated.

Except as otherwise noted, implement the present invention and can adopt chemistry, biochemistry, the molecular biosciences that belongs to art technology , cell biology, science of heredity, immunology and pharmacological conventional method. These technology have in the literature comprehensively Explain. See for example Gennaro, and A.R chief editor's Lei Mingdun pharmaceutical science (Remington ' s Pharmaceutical Sciences), the 18th edition, 1990, Mack Publishing Co.; Hardman, J.G., Limbird, L.E and Gilman, A.G. compiles, the pharmacological basis for the treatment of (The Pharmacological Basis of Therapeutics), the 10 editions, 2001; McGraw-Hill Co; Colowick, the volumes such as S, Methods In Enzymology, Academic Press, Inc.; Weir, D.M and Blackwell, the experiment immunization that C.C compiles learn to do volume (Handbook of Experimental Immunology), I-IV volume, 1986, Blackwell Scientific Publications; Maniatis, the molecular cloning laboratory manual (Molecular Cloning:A Laboratory Manual) that T etc. compile, second Version, I-III volume, 1989, Cold Spring Harbor Laboratory Press; Ausubel, the volumes such as F.M, molecule Biology techniques: detailed lab process (Molecular Biology Techniques:An Intensive Laboratory Course), 1998, Academic Press; Newton, C.R., and Graham, A. compiles, biotechnology series Introduce (Introduction to Biotechniques Series) second edition, 1997, Springer Verlag.

Definition

Term " glucose adjusting " or " adjusting of glucose metabolism " this paper are used in reference to cell, tissue, organ, device Official system or whole organism are kept the Portugal by increase or the minimizing of Change Example such as the processing of glucose metabolism specificity The homeostatic process of grape sugar. Glucose metabolism or glucose metabolism process comprise relate to that glucose is synthetic, processing, Transhipment, picked-up, utilize or the process that stores and comprise gluconeogenesis and glycolysis. Glucose metabolism and adjusting Concrete aspect comprise and can promote glucose to pass that cell membrane and cell keep or the glucose transport protein of secretion glucose The expression of white or enzyme; Participate in the enzyme of glucose utilization and formation, such as glycolytic ferment and gluconeogenesis enzyme, expression And/or active change; And in the body or culture medium, for example comprise between (being the extracellular) and intracellular fluid, blood in the matter The change that glucose distributes in liquid, the urine etc.

Term " homeostasis of glucose " refers to keep, recovers or reaches normal or near normal blood sugar level. Blood The control of sugar also can be described as the normalization of glycated hemoglobin level in certain body.

Term " metabolic disease " and " metabolic imbalance " are used interchangeably, and refer to regulate or glycemic control with glucose Impaired or change is relevant or deterioration is relevant (for example insulin resistance) any disease. This class disease includes but not limited to Diabetes, hyperglycemia, obesity etc.

Term " hyperglycemia " this paper is used for referring generally to be higher than normal blood glucose levels. Hyperglycemia can be passed through These those skilled in the art have accepted to measure with used any method. People's euglycemia level is thought about at present Between the 70-120mg/dl, but depend on fasting state and difference. Range of blood sugar can be at about 80-120mg/dl before the meal, and Two hours blood glucoses can be at about 180mg/dl or lower after the meal. In addition, the individual euglycemia of fasting is lower than approximately 110mg/dl. The about 126mg/dl of blood sugar level or higher person are by thinking hyperglycemia, and blood sugar is higher than about 200mg/dl The person generally is considered as diabetes.

Term " obesity " refers to that body fat is too much. Fat can acceptance with used any by these those skilled in the art Method is measured. Present accepted fat balancing method is body mass index (BMI), for kilogram number and the height of body weight Several squares of measured values of comparing of meter. The common BMI that is grown up more than 20 years old thinks normal between 18.5-24.9; It is overweight that BMI thinks between 25.0-29.9; BMI surpasses 30.0 and thinks obesity, and BMI is 40 or surpass 40 Think morbid obesity (seeing such as (2000) Am J Clin Nurt 72:694-701 such as Gallagher). These BMI models Enclose according to body weight the increasing action of disease danger is decided. Comprise with overweight and fat some relevant common diseases Angiocardiopathy, hypertension, osteoarthritis, cancer and diabetes. Although BMI is relevant with body fat, BMI From relation between the definite body fat with age and sex and different. The women's body that for example has identical BMI The fat percentage may be higher than the male sex.

Fat another kind of balancing method is the body fat percentage. the method for existing various indirect measurement poplar body fats Comprise: skin wrinkle mensuration, water density mensuration, biologic resistance analysis (BIA), dual energy X-line absorption mensuration, machine The total potassium of body is measured and the interior nitrogen activation determination of body. Water density is measured, or water (in) static measurement (HW) is tested by measuring The person in water and in the air difference between the weight measure the body cumulative volume. Similarly, air displacement plethysmography The chamber volume that figure (AP) causes when being placed on the experimenter in the fixing chamber of one volume of air by measuring reduces, and measures The body cumulative volume. Calculate body gross density and composition with the predictor formula through checking then. BIA is with little electric current Estimate resistance or current impedance by the voltage drop that causes between two electrodes. It is a kind of that body power and water solution matter forms Index, the level of resistance can be used for from the regression formula Gu Ji Of-thin meat tissue content of exploitation and the water volume of body. During the aqueous components of degree of hypothesis meat tissue, available other regression formula is estimated body degree meat amount and fat mass. The women The percentage of body fat is about 17-27% usually, although think up to 31% and also can accept. Male sex's Rate of body lipid generally should For 0-20%, although think up to 25% and also can accept.

Term " HIF α " but refer to the α subunit of anoxic inducible factor albumen. HIF α can be people or other mammal Protein, or its fragment comprise people HIF-1 α (Genbank accession number No.Q16665), HIF-2 α (Genbank Accession number No.AAB41495) and HIF-3 α (Genbank accession number No.AAD22668); Mouse HIF-1 α (Genbank accession number No.Q61221), HIF-2 α (Genbank accession number No.BAA20130 and AAB41496) With HIF-3 α (Genbank accession number No.AAC72734); Rat HIF-1 α (Genbank accession number No.CAA70701), HIF-2 α (Genbank accession number No.CAB96612) and HIF-3 α (Genbank accession number No.CAB96611); With ox HIF-1 α (Genbank accession number No.BAA78675). HIF α also can be any Nonmammalian protein or its fragment comprise HIF-1 α (the Genbank accession number of Africa xenopus laevis No.CAB96628), Drosophila melanogaster HIF-1 α (Genbank accession number No.JC4851) and chicken HIF-1 α (Genbank Accession number NoBAA34234). The gene order of HIF α also available conventional clone technology obtains, and for example uses above-mentioned HIF All or part of of α gene order found HIF α gene order in other species as probe.

The fragment of HIF α comprises amino acid 401-603 zone (Huang etc., the same), the amino acid of people HIF-1 α 531-575 zone (Jiang etc., J Bio Chem.272:19253-260,1997), amino acid 556-575 zone (Tanimoto etc., the same), amino acid 557-571 zone (Srinivas etc., Biochem Biophys Res Commun.260:557-561,1999), amino acid 556-575 zone (Ivan and Kaelin, Science.292:464-468,2001). In addition, HIF α fragment comprises and contains appointing of at least one LXXLAP motif What fragment is as seen in the L in the HIF α native sequences₃₉₇TLLAP and L₅₅₉EMLAP. In addition, the fragment of HIF α Any fragment that comprises at least a characteristic function and structure that has kept HIF α. For example, be used for embodiment 14 The HIF peptide of screening test can contain DLDLEMLAPYIPMDDDFQL (SEQ ID NO:5).

Term " HIF hydroxylase " refers to the amino acid residue in energy hydroxylation the HIF alpha protein, particularly HIF α subunit Any enzyme. The preferred proline of described residue and/or asparagine residue.

Term " HIF asparaginyl group hydroxylase " refers to any enzyme of any asparagine residue in the energy hydroxylation HIF albumen, Preferably comprised by the asparagine residue of HIF asparagyl hydroxylase hydroxylation: for example the N803 residue of HIF-1 α or Homology asparagine in other HIF α isoform is residual. HIF asparaginyl group hydroxylase comprises the inhibition HIF factor (FIH), be responsible for regulating HIF asparagyl hydroxylase (the Genbank accession number of HIF α trans-activation NoAAL27308; The .Gene Dev.15:2675-2686 such as Mahon, 2001; The .Science 295:858-861 such as Lando, 2002; With the .Gene Dev 16:1446-1471 such as Lando, 2002. Also referring to .J Bio such as Elkins Chem.C200644200,2002).

Term " HIF prolyl hydroxylase " and " HIF PH " refer to can hydroxylation proline residue any in the HIF albumen Enzyme. Preferably comprised proline among the motif LXXLAP by the proline residue of HIF PH hydroxylation, such as people HIF-1 L in the α native sequences₃₉₇TLLAP and L₅₅₉The proline of EMLAP. HIF PH comprises Taylor (Gene 275:125-132,2001) described and Aravind and Koonin (Genome Biol 2:RESEARCH0007, 2001), Epstein etc. (Cell.107:43-54,2001) and Bruick and McKnight (Science 294:1337-1340, 2001) Egl-Nine (EGLN) the gene family member of institute's characterization. The example of HIF PH enzyme comprises the people SM-20 (EGLN1) (Genbank accession number No.AAG33965; Dupuy etc. Genomics 69:348-54, 2000), EGLN2 isoform 1 (Genbank accession number No.CAC42510; Taylor, the same), EGLN2 (Genbank accession number NP_060025) and EGLN3 (Genbank accession number No.CAC42511; Taylor, the same); Mouse EGLN1H (Genbank accession number No.CAC42515), (Genbank steps on EGLN2 Record No.CAC42511) and EGLN3 (SM-20) (Genbank accession number No.CAC42517) and rat SM-20 (Genbank accession number No.AAA19321). In addition, HIF PH can comprise Caenorhabditis elegans (Caenorhabditis elegans) EGL-9 (Genbank, accession number No.AAD56365) and Drosophila melanogaster (Drosophila melanogaster) CG1114 gene outcome (Genbank accession number No.AAF52050). HIF PH Any active fragment that also comprises above-mentioned full length protein.

" sample " used herein can produce from any source, for example body fluid, divide ooze thing, tissue, cell or cultivation Cell, include but not limited to: saliva, blood, urine, serum, blood plasma, vitreous humor, synovial fluid, brain Spinal fluid, amniotic fluid and organ-tissue (such as biopsy); Chromosome, organelle or other film from cell separation; Gene Group DNA, cDNA, RNA, mRNA etc.; With the cell or tissue of removing, or the seal of this class cell or tissue Dye thing or printing product. Sample can produce from any source, such as human body merit non-human mammal experimenter. Also consider sample Product are from any infected animal model. Sample can be that a matrix can be fixed or be incorporated into to liquid maybe. Sample can Be to be suitable for measuring transcript or the protein relevant with the metabolism adjusting whether to exist, or measure fat and G/W Flat any material. The method that obtains this class sample is the thing within this art level.

" experimenter " isolating protokaryon or eukaryotic cell of comprising as used herein, or the tissue of cultivating.The described experimenter of preference comprises animal, particularly mammal, and it comprises rat, rabbit, cattle, sheep, pig, horse and Primate, particularly people.

Summary of the invention

The invention provides treatment or prevent diabetes, hyperglycemia with glucose metabolism and/or body in stable the change or the method and the chemical compound of impaired relevant other disease.Also be provided for treating, prevent and delay with diabetes and with glucose metabolism and/or body in stable the change or the generation of impaired relevant other disease and/or the method and the chemical compound of development because these methods and chemical compound or regulate glucose metabolism and realize in the body of glucose stable.

The present invention relates to following discovery, but the α subunit (HIF α) of promptly stablizing the anoxia inducible factor can cause the blood sugar lowering level.The invention still further relates to following discovery, promptly stablize the glucose metabolism of HIF α scalable.In addition, the invention still further relates to following discovery, chemical compound promptly of the present invention can be used to the blood sugar lowering level, regulates glucose metabolism and realizes glucose homeostasis.

But anoxia inducible factor (HIF) the many and active physiological factor of biological approach that is a kind of participation.HIF α degrades under normal oxygen environment.Under anoxia or hypoxia condition, HIF α is stable and bring into play some downstream effects.Determine that recently the specific residue in the hydroxylation HIF α subunit can make the directed degraded of HIF α, thereby prevented under normal oxygen environment, to form stable HIF complex, determined that this hydroxylation is owing to (see for example Ivan and Kaelin.Science 292:464-468,2001 due to some HIF hydroxylase activation; Jaakkola etc., Science 292:468-472,2001; Epstein etc.,, Cell 107:43-54,2001; Bruick and McKnight Sciene 294:1337-1340,2001).These HIF hydroxylases belong to 2-oxoglutaric acid dioxygenase family.These enzymes are oxygen dependences, and under hypoxia or anoxia condition, the hydroxylation of HIF α residue is suppressed.Having described treatability stablizes HIF α and stablizes HIF α (see international publication WO 03/049686, fit in it this paper for referencial use) by suppressing HIF α hydroxylation.

Method

On the one hand, but the invention provides the method that the α subunit (HIF α) by the anoxia inducible factor of stablizing the experimenter comes the blood sugar lowering level or regulates glucose metabolism.On the other hand, this method is come the blood sugar lowering level or is regulated glucose metabolism by the HIF α hydroxylation that suppresses the experimenter.Aspect a preference, method of the present invention comprises the method for coming the blood sugar lowering level or regulating glucose metabolism by the HIF hydroxylase activity that suppresses the experimenter.Aspect optimum option, this method comprises by the activity that suppresses the HIF prolyl hydroxylase coming the blood sugar lowering level or regulating glucose metabolism.

Stablizing HIF α can existingly with these those skilled in the art implement with one of method of knowing, may comprise that employing can react to each other with HIF α or combines or modify any preparation of HIF α, or the factor that can react to each other with HIF α, for example comprise, with the enzyme of HIF α as substrate.In some aspects, the invention provides constitutionally stable HIF α variant, as stable HIF mutain etc., or the polynucleotide of certain variant of encoding (seeing for example U.S. Patent No. 6,562,799 and 6,124,131 and 6,432,927).In others, the present invention considers to stablize HIF α and comprises the preparation that gives to stablize HIF α.Said preparation can be made up of polynucleotide, as antisense sequences (seeing international publication WO03/045440); Polypeptide; Antibody; Other protein; Carbohydrate; Fat; Lipid; With organic and inorganic substances, as micromolecule etc.In a preference embodiment, the present invention stablizes HIF α by the preparation that gives the experimenter and can stablize HIF α, and wherein said preparation is a kind of chemical compound, for example can stablize the micromolecular compound of HIF α etc.

In other embodiments, method of the present invention comprises by suppressing at least a enzymatic activity that is selected from 2-oxoglutaric acid dioxygenase family and stablizes HIF α.In a preference embodiment, described enzyme is the HIF hydroxylase, (sees Taylor.Gene 275:125-132,2001 as EGLN-1, EGLN-2, EGLN-3; Epstein etc., Cell107:43-54,2001; Bruick and McKnight Sciene 294:1337-1340,2001).Yet consider that especially described enzyme is selected from the enzyme of 2-oxoglutaric acid dioxygenase family, for example comprises: virgin rubber unit lysyl hydroxylase, the prolyl 3-of virgin rubber unit hydroxylase, the virgin rubber prolyl 4-hydroxylase α (I) of unit and α (II), Thymine 7-hydroxylase, agedoite B-hydroxylase, ε-N-trimethyl lysine hydroxylase and γ-Ding Suan betanin hydroxylase etc.(see for example Majamaa etc.Biochem J.229:127-133,1985; Myllyharju and Kivirikko.EMBO J.16:1173-1180,1997; .32:14023-14033 such as Thomburg, 1993 and .Proc Natl Acad Sci USA91:7227-7231 such as Jia, 1994).

In certain embodiments, described method comprises by suppressing some residue of HIF α, comes the blood sugar lowering level or regulates glucose metabolism as the hydroxylation of proline residue, asparagicacid residue etc.In a preferred embodiment, described residue is a proline residue.In specific embodiments, described residue is the P among the HIF-1 α ₅₆₄Homology proline in residue or other HIF α isoform, or the P among the HIF-1 α ₄₀₂Homology proline in residue or other HIF α isoform etc.In other embodiments, the inventive method can comprise the asparagine residue that suppresses HIF α, as the N of HIF-1 α ₈₀₃The hydroxylation of the homology asparagine residue in residue or other HIF α isoform.

Chemical compound

On the one hand, the invention provides by giving the method that experimenter's chemical compound of the present invention comes the blood sugar lowering level or regulates glucose metabolism.Chemical compound of the present invention can be to suppress or to regulate the active any chemical compound of 2-oxoglutaric acid dioxygenase.The 2-oxoglutaric acid dioxygenase includes but not limited to hydroxylase.But the hydroxylase of hydroxylation target substrate residue for example comprises: prolyl, lysyl, aspartoyl (agedoite) hydroxylase etc.Hydroxylase can be described by substrate sometimes, as HIF hydroxylase, virgin rubber unit hydroxylase etc.; And/or describe by the target residue in the substrate, as prolyl hydroxylase, lysyl hydroxylase etc.; Or describe by the two, as HIF prolyl hydroxylase, virgin rubber unit prolyl hydroxylase etc.Representational 2-oxoglutaric acid dioxygenase includes but not limited to the HIF hydroxylase, comprises the HIF prolyl hydroxylase, as EGLN1, EGLN2 and EGLN3, HIF agedoite hydroxylase, as HIF inhibitive factor (FIH) etc.; Virgin rubber unit's hydroxylase such as virgin rubber unit lysyl hydroxylase, virgin rubber unit's prolyl hydroxylase such as the prolyl 3-of virgin rubber unit hydroxylase, the virgin rubber prolyl 4-hydroxylase α (I) of unit and α (II) etc.; Thymine 7-hydroxylase; The agedoite B-hydroxylase; ε-N-trimethyl lysine hydroxylase; γ-Ding Suan betanin hydroxylase etc.Though enzymatic activity can comprise and the relevant activity of any 2-oxoglutaric acid dioxygenase, the special amino acid residue of considering in the energy hydroxylation substrate.Though proline and/or asparagicacid residue in the hydroxylation substrate are also considered other aminoacid of hydroxylation.

In certain embodiments, chemical compound of the present invention is the chemical compound that can suppress hydroxylase activity.In preferred embodiments, chemical compound of the present invention is the chemical compound that can suppress the HIF hydroxylase.In different embodiments, described activity is owing to the HIF prolyl hydroxylase, for example due to EGLN1, EGLN2 or the EGLN3 etc.In other embodiments, described activity is because HIF agedoite hydroxylase, for example but be limited to due to the FIH.

On the one hand, demonstration has the active The compounds of this invention of inhibition to one or more 2-oxoglutaric acid dioxygenases, also may show has the activity of inhibition to one or more other 2-oxoglutaric acid dioxygenases, and certain chemical compound that if can suppress the HIF hydroxylase activity also may suppress glue unit prolyl hydroxylase; Certain chemical compound that can suppress the HIF prolyl hydroxylase also may suppress the activity of HIF agedoite hydroxylase.

On the one hand, the invention provides by giving the method that experimenter's chemical compound of the present invention comes the blood sugar lowering level or regulates glucose metabolism.Chemical compound of the present invention is the micromolecular compound that can suppress the HIF hydroxylase activity.Preferred compounds of the invention are and to suppress the active chemical compound of HIF prolyl hydroxylase.Can directly or indirectly suppress, can be competitiveness or noncompetitive inhibition etc.The method of chemical compound of the present invention and other chemical compound of evaluation the present invention is provided especially.

Glucose

Under normal circumstances, glucose is the main energy sources of body supply peripheral tissues.Brain and other nervous tissue under normal circumstances need glucose as unique energy, even under stress state, during as long-term fasting, need a large amount of glucoses.Liver is to synthesize by the glycogen that decompose to store or from precursor substance such as lactic acid, acetone acid, glycerol and aminoacid to produce glucose, blood sugar regulation level, the major organs that blood sugar level descends when preventing fasting.The body of keeping glucose is interior stable, as the internal balance of glucose, need keep balance between liver has the picked-up of glucose generation and periphery glucose and utilizes.

Stable in the body of blood glucose, the glucose internal balance keep close control and the influence that is subjected to many biochemical factors, comprise various physiological process.For reaching the homoiostasis of glucose, body is from several horizontal adjusted glucoses, comprises the picked-up, transhipment, storage, processing of glucose, synthetic, utilization etc.Therefore the homoiostasis of glucose is subjected to all multifactor influences, for example comprises: extrinsic factor such as physiological need, food intake etc.; Recirculated water equality with intrinsic factor such as insulin, glycogen.

Glucose level raises

The destruction of glucose normal regulating can cause blood sugar level to change, and promptly compares with the euglycemia level to raise or reduction.For example, it is the feature of hyperglycemia, diabetes etc. that chronic blood sugar level raises, and can produce multiple ill effect to various organs, tissue and the system of body.Diabetes, hyperglycemia or blood sugar level rising are relevant with numerous disease and disease, and peripheral blood vessel, the trunk And that comprise atherosclerosis acceleration, morbus cardiacus increase, myocardial infarction, apoplexy, microangiopathies, blood vessel injury, causes the circulation of arm and shank to reduce sends out that disease, ophthalmic diseases such as diabetic retinopathy are pretty, macula lutea regression, cataract etc.; Nephropathy comprises diabetic nephropathy, injury of kidney etc.; Nerve injury and other neuropathy comprise the damage of diabetic neuropathy, peripheral nervous pathological changes, autonomy nervous system nerve etc., hyperinsulinemia, hyperlipemia, insulin resistant, glucose metabolism damage, glucose tolerance damage, skin and connective tissue disease, foot wound and ulcer, diabetes ketoacidosis etc.

Can be by measuring circulating-glucose levels or measuring the blood/plasma glucose level and identify the glycoregulatory variation of Fructus Vitis viniferae or impaired and whether have or have the danger of diseases such as diabetes, hyperglycemia take place.The most normal blood sugar detection, random blood sugar during by fasting measures or oral glucose tolerance test is measured blood sugar level.

Blood sugar test is measured blood sugar level during by fasting.In this kind analysis, the measurement numerical value of (food or liquid beyond not absorbing water) blood sugar level is maintained at about between the 70mg/dL-110mg/dL usually during the reflection fasting state.For example arrive 126mg/dL level or higher if blood glucose level rises is high during fasting state above this demoncal ration, can make diabetes diagnosis.In one embodiment, the invention provides can be with fasting state the time that blood sugar level remains on or blood sugar level, i.e. Compounds and methods between the 70mg/dL-110mg/dL when reaching normal fasting state.In another embodiment, the invention provides hypoglycemia level (blood sugar level when being lower than normal fasting state) can be with fasting state the time raises or returns to Compounds and methods between the 70mg/dL-110mg/dL.In another embodiment, the invention provides the blood sugar level (blood sugar level is higher than the fasting state normal level) that raises can be with fasting state the time reduces (minimizing) or returns to below about 126mg/dL, with about 70mg/dL, more preferably from about 120-70mg/dL, the most preferably from about Compounds and methods for of 110-70mg/dL.

The assay method of another kind of blood sugar level is the random blood sugar test.The common value that shows of the blood sugar level of Ce Dinging is being low to moderate medium 100 seconds (mg/dL) by this way.About 180mg/dL or higher random blood sugar level are hyperglycemias, and about 180mg/dL or higher level show the danger that has generation impaired relevant disease of blood glucose regulation such as diabetes.Therefore, on the one hand, method provided by the invention and chemical compound can make the blood sugar level of random blood sugar test determination keep or reach normal level, promptly are low to moderate medium 100 seconds (mg/dL).Method of the present invention on the other hand and chemical compound can be used for making the following blood sugar level of normal level that is reduced to of random blood sugar test determination to recover to reach normal level, promptly are low to moderate medium 100 seconds (mg/dL).Also have on the one hand, method of the present invention and chemical compound can be used for reduction/minimizing and are higher than normally, promptly are higher than the blood sugar level that is low to moderate medium 100 seconds (mg/dL).Aspect various, this method and chemical compound can be reduced to about 200-100mg/dL horizontal plane with the blood sugar level that raises, more preferably to the 180-100mg/dL level, most preferably to the 150-100mg/dL level.

Also available oral glucose tolerance test identifies whether the experimenter suffers from or have the danger of suffering from glucose adjusting damage, hyperglycemia, diabetes.In this test, allow the individuality sucrose solution liquid overnight fasting of having a drink, measure blood sugar level after several hours.People with normal glucose tolerance/adjusting, as persons such as non-diabetics, the blood sugar level of measuring after drinking sucrose solution raises and descends rapidly then.Drink the euglycemia level that read in two hours behind the sucrose solution and be lower than about 140mg/dL, all values that read between 0 o'clock and 2 hours all is lower than 200mg/dL.If the blood sugar level of measuring in oral glucose tolerance test is in about 140-199mg/dL scope, general diagnostic is that the glucose tolerance is impaired.If the blood sugar level of measuring is about 200mg/dL or higher, general diagnostic is diabetes.Method of the present invention and chemical compound keep, recover or reach the euglycemia level after being used in oral glucose tolerance test.

The expression of glucose regulatory factor

In one embodiment, the invention provides and to improve the Compounds and methods for that product participates in the expression of gene of grape cell Sugar intake and utilization.This gene includes but not limited to: glucose transporter, as glucose transporter (GluT)-1 and GluT-3; Fructus Vitis viniferae glycolytic ferment such as aldolase-A, Enolase-1, hexokinase-1, hexanone kinases-2, phosphofructokinase-L and phosphofructokinase-P.The therapeutic of glucose transporter and utilization thereof raises tolerance, the blood sugar lowering level that will effectively reduce insulin, thereby the metabolic disease patient, as producing favourable effect among type 2 diabetes mellitus, hyperglycemia, glucose control is impaired, the glucose tolerance is impaired etc. the patient.

On the one hand, the invention provides the Compounds and methods for of treatment or prevention hyperglycemia.This Compounds and methods for is fit to treatment or prevention hyperglycemia relevant disease, as since glucose discharge increase, glucose utilization reduces and/or the blood sugar level of glucose uptake due to impaired raises.These diseases also tolerate impaired, type 2 diabetes mellitus and/or fat relevant with insulin resistant, glucose.

On the one hand, method of the present invention provides activation energy to regulate the instrument of glucose and glucose metabolism (comprising whole body processing and utilization) level and active gene expression library.This method can compensate body and regulate the defective of the natural mechanism of this processing (for example can not produce insulin can react it).Method provided by the invention can be treated with glucose and be controlled impaired relevant metabolic disease or disease.These diseases include but not limited to: glucose tolerance impaired (IGT) or preceding diabetes, diabetes, hyperglycemia etc.

The present invention considers the preceding drug compound that the selectivity design can be activated when being taken in by certain organs especially.For example, participate in fatty homeostatic numerous protein because liver can produce, the present invention considers in the method for the invention optionally targeting liver.Selectivity raises some genes in the liver, as aldolase gene, can adopt can be transformed into active chemical compound from non-activity by the liver specificity enzyme and realize.For example, the carboxylic acid alcohol replacement accordingly that certain reactive compound is worked.Alcoholdehydrogenase in the liver (ADH) activity can be transformed into activity form with this compounds.Because other organ lacks the ADH activity, this chemical compound can only be activated by selectivity in liver.Similarly, can make other organ of targeting compounds used in the inventive method, as fatty tissue, kidney, skeletal muscle, heart etc.

Insulin

Insulin is to regulate body most cells metabolic balance, stimulates the key hormone of glucose uptake.When having insulin, most cells adopts the metabolism fuel of glucose as them, and adipose cell utilizes the glucose synthctic fat, and hepatocyte is transformed into glycogen and fat with glucose.The blood insulin blood sugar increasing immediately that raises, several activities relevant with glucose uptake have stimulated insulin secretion.When blood sugar level reduced subsequently, insulin discharged rapidly and reduces, and the cell that glucose enters beyond the nervous system is suppressed.Cell utilizes glycogen and fat as metabolism fuel when not supplying glucose.Liver and adipose cell begin to decompose the glycogen and the fat of storage.Liver provides glucose rather than from the blood ingestion of glucose, liver and fatty tissue all provide fatty acid to blood to blood as a result.Therefore, insulin level has reduced the glucose uptake of insulin sensitivity tissue when low, promoted gluconeogenesis and the glycogenolysis (glycogen destruction) in the liver, and it is synthetic to have reduced glycogen, and has promoted to store the metabolism of glycogen and fat.

Body can not produce insulin, or reactionless to insulin, for example insulin sensitivity is reduced, and promptly insulin resistant etc. can cause various diseases, comprises diabetes and hyperglycemia.

The impaired reason of glucose transport is relevant with insulin resistant.Method of the present invention can reduce insulin resistant to recover impaired glucose transport or to improve glucose transport.The invention provides the method that reduces or reduce insulin resistant.In some aspects, reduce insulin resistant by stablizing HIF α.In others, provide by suppressing the active method that reduces insulin resistant of HIFPH.

Insulin sensitivity improves the high blood plasma level positive correlation with insulin-like growth factor binding protein-1 (IGFBP-1).The IGFBP-1 blood plasma level also with teen-age Body Mass Index negative correlation (Travers etc., J Clin EndocrinolMetab.83:1935-1939,1998).In addition, low IGFBP-1 level relevant with the increase of type 2 diabetes mellitus cardiovascular danger .J Clin Endocrinol Metab 81:860-863 such as (, 1996) Gibson.Therefore,, promptly treat in the insulin resistant, need to improve the level of IGFBP-1 recovering or keeping insulin sensitivity.

In addition, the genetic flaw that influences fructose phosphoric acid-1-kinases (PFK) can cause insulin resistant and type 2 diabetes mellitus.Because PFK is the speed Restriction Enzyme in the glycolysis cascade reaction, the reduction of this enzymatic activity is obviously relevant with insulin resistant and type 2 diabetes mellitus usually in the glycolysis cascade reaction.Therefore, improving PFK and other glycolysis factor, is to recover or keep insulin sensitivity as the level of aldolase, Enolase, hexokinase etc., needed as reducing insulin resistant.

Compound exhibits of the present invention can improve the expression (seeing embodiment 4) of IGFBP-1, PFK and other glycolytic ferment.Therefore, in one embodiment, the invention provides the method and the chemical compound of some gene of coordinate expression (its product such as IGFBP-1, PFK etc. participate in glucose processing and utilization).In another embodiment, the present invention provides and can improve insulin sensitivity by this genoid of coordinate expression formula, as reducing the method and the chemical compound of insulin resistant etc.On the one hand, this method comprises the HIF α that for example stablizes the experimenter.The present invention also by giving the experimenter chemical compound of the present invention, if can suppress the preparation of HIF hydroxylase activity, and the method that increases insulin sensitivity is provided.

Glycated hemoglobin

The result that diabetes control and And send out disease test (DCCT) proves that the improvement of glycemic control has reduced And and sent out disease, comprise non-proliferative and proliferative retinopathy (reducing by 47%), little albuminemia (reducing by 39%), clinical nephropathy (reducing by 54%) and neuropathy (reducing by 60%) (DCCT research group, N Engl J Med 329:977-986,1993).In addition, it is relevant that Britain's diabetes prognosis research (UKPDS) proves that glycemic control and blood capillary And send out the disease minimizing, and strict controlling of blood pressure has significantly reduced trunk and little blood vessel And sends out disease (UKPDS group, Lancet 352:837-853,1998).

Glycated hemoglobin (being also referred to as glycohemoglobin, glycosylation haemachrome, HbA1c or HbA1) can form in conjunction with haemachrome molecule by making various glycan molecules (the most frequently used glucose), and the speed of its formation is directly proportional with blood sugar concentration.The mensuration of glycated hemoglobin level provides the index of precision of preceding 2-3 month average blood sugar concentration.The glycated hemoglobin level provides the evaluation measures to diabetes patient blood sugar's control clinically.Normally the glycated hemoglobin horizontal extent of (non-diabetic) is 4-6%.In the research of diabetic individual, DCCT finds to compare with the diabetic individual with higher level HbA1c, the HbA1c level is reduced or be maintained to 7.2% to cause retinopathy minimizing 76%, neuropathy minimizing 60%, nephropathy minimizing 50%, cardiovascular disease to reduce 35%.

The invention provides the Compounds and methods for that reduces the glycated hemoglobin level.In one embodiment, adopt the inventive method and chemical compound is kept, recovered or make the glycated hemoglobin level reach about 4-6%.In another embodiment, method of the present invention and chemical compound can reduce the glycated hemoglobin level and be lower than approximately 9%, more preferably less than about 8%, most preferably are lower than about 7%.

Diabetes and obesity

Obesity is a kind of risk factor, is a kind of pernicious side effect of diabetes sometimes.Fat feature is that the fat savings is excessive, specifically is that internal organs or maincenter fat level are too high.Therefore treatment or prevention of obesity can at utmost reduce the danger that diabetes take place, and in fact have the individuality of diabetes risk often to leave slimming prescription to diabetic or diagnosis.

During studying in vivo, chemical compound of the present invention shown the increase (seeing embodiment 9 and 10) of the body weight that can prevent or slow down.Therefore, on the one hand, the invention provides by reducing or prevention of obesity is treated or the method for prevent diabetes.On the one hand, this method comprises the HIF α that for example stablizes the experimenter.The present invention also provides by giving the experimenter chemical compound of the present invention, if can suppress the preparation of HIF hydroxylase activity, treats or prevent the method for this experimenter's obesity.

As mentioned above, diabetes are relevant with multiple disease and disease.For example.Cardiovascular disease (CVD) is the main cause of type 2 diabetes mellitus patient death.The type 2 diabetes mellitus patient dies from the high 2-6 of CVD doubly than non-diabetic patient.The remarkable quantity of these patients is died from morbus cardiacus (CHD).Hyperlipemia is common and cause CHD in the type 2 diabetes mellitus patient.Type 2 diabetes mellitus patient's common lipid profile is, compare triglyceride with the non-diabetic individuality higher and the HDL cholesterol is lower.Similarly triglyceride and HDL cholesterol see the non-diabetic individuality of obesity (particularly having the individuality that interior fat increases), hypertension and insulin resistant (as metabolism syndrome) unusually.Triglyceride level raises to have shown it is a kind of risk factor of cardiovascular disease.The triglyceride that raises is a kind of important component of metabolism syndrome.

Diabetes and hypertension

Hypertension, or hypertension is a kind of risk factor of diabetes.In addition, the effect of hypertension and relevant disease thereof can be supervened diabetes or cause diabetes.Therefore, treatment or prophylaxis of hypertension can reduce diabetes as far as possible or the danger of diabetes takes place, and the Therapeutic Method of emphasizing the diabetes this respect should be valuable.

The invention provides a kind of like this method.Specifically, method of the present invention can be used for treating the relevant hypertension of diabetes with chemical compound.For example, chemical compound of the present invention can improve the expression (see and expect to execute example 12) of the blood pressure regulating factor such as adrenal medullary hormone and nitric oxide synthetase.Therefore, on the one hand, the present invention provides the method for treatment or prevent diabetes by reducing or prophylaxis of hypertension.On the one hand, this method comprises the HIF α that for example stablizes the experimenter.The present invention also provides by giving the experimenter chemical compound of the present invention, if can suppress the preparation of HIF hydroxylase activity, treats or prevent the hypertensive method of this experimenter.

The Synergistic treatment method

Diabetes and multiple deleterious generation simultaneously or development, disease association eclipsed and/or that take place in succession.For example, hypertension, blood vessel and circulation damage, obesity can cause the increase of diabetes generation dangerous development.Therefore, the Therapeutic Method that can reduce this class risk factor and symptom simultaneously is valuable.

The invention provides this class methods.This theory of tool, method of the present invention and chemical compound can be used for realizing multiple effect.For example as mentioned above, obesity is the pathogenetic a kind of risk factor of glycosuria.In addition, obesity can be because of diabetes, for example owing to special Therapeutic Method takes place.This theory of tool, insulin-mediated lipid take in fatty tissue, increased the weight of obesity, and then increased the weight of insulin resistant.Therefore on the one hand the present invention provides treatment or prevention of obesity and improves insulin sensitivity with cooperative mode, treats or the method for prevent diabetes.

Chemical compound of the present invention can blood sugar lowering level (seeing embodiment 6), reduce internal organs and stomach fat (seeing embodiment 9) thereby, improve the expression (seeing embodiment 12) that the expression of saccharifying enzyme improves the insulin sensitivity (seeing embodiment 4) and the raising blood pressure regulating factor, thereby the antiotasis that can regulate body, keep the variation of normal arterial pressure level or antagonism antiotasis, as hypertensive effect etc.Therefore on the one hand, the invention provides the method for treatment or prevent diabetes, this method comprises the HIF α that stablizes the experimenter.Come the blood sugar lowering horizontal plane and reduce interior fat.Other method also comprises the diabetes that the experimenter was treated or prevented to the raising insulin sensitivity.Other method also comprises the diabetes that the experimenter was treated or prevented in the expression of the raising blood pressure regulating factor.

Metabolic disease

The invention provides the chemical compound that to regulate metabolic activity and utilize the method for this compounds for treating Metabolic disorder relevant disease or disease.This class disease includes but not limited to: diabetes, hyperglycemia and obesity.

On the one hand, the invention provides the method for utilizing described chemical compound prevention or treatment diabetes, this method comprises this chemical compound or its pharmaceutically acceptable salt of the patient effective dose that needs, and gives separately or gives with pharmaceutically acceptable excipient.Situations such as in one embodiment, according to the situation of prediction,, glucose impaired as glucose homeostasis tolerance is impaired, hyperglycemia, diabetes or obesity give this chemical compound.

On the other hand, the invention provides the method for utilizing this compounds for treating hyperglycemia, this method comprises this chemical compound or its pharmaceutically acceptable salt of the patient effective dose that needs, and gives separately or gives with pharmaceutically acceptable excipient.In one embodiment, be diagnosed as with this chemical compound of patient that hyperglycemia relevant disease such as diabetes take place.

Can unite with various other Therapeutic Method and give this chemical compound.In one embodiment, this chemical compound and exogenous insulin such as synthetic insulin human coupling.

Glucose is regulated

Method of the present invention and chemical compound can improve the expression of Enolase.These results show that method of the present invention and chemical compound can be used for regulating the glucolytic expression of gene of participation.Also provide by improving sugared hydroxylation and regulated the method and the chemical compound of glucose metabolism.

The invention provides and improve method and the chemical compound that GluT-1 expresses.On the one hand, method of the present invention can be regulated the expression of the factor that participates in glucose uptake.Method of the present invention and chemical compound provide increases the Therapeutic Method that glucose transport is gone into cell.Therapeutic raises the glucose transport factor will effectively reduce insulin resistant, improve insulin sensitivity, the blood sugar lowering level, thus hyperglycemia or diabetic are produced advantageous effect.

Method of the present invention and chemical compound can improve the glucose regulatory factor in kidney, liver and the lung, comprise the expression of phosphofructokinase-P, phosphofructokinase-L, aldolase-1, GluT-1, lactic acid dehydrogenase, Enolase-1 and hexokinase-1.In one embodiment, method of the present invention can be worked in coordination with and be regulated the expression of gene that its product participates in glucose uptake and utilization, thus the scalable glucose metabolism.Therapeutic raises the transhipment of glucose and utilizes and will reduce insulin resistant, improves insulin sensitivity, the blood sugar lowering level, thus the method for the treatment of hyperglycemia or diabetes is provided.

Utilize method of the present invention and chemical compound can improve encoding insulin like growth factor conjugated protein-1 (IGFBP-1) expression of gene in the kidney regulating liver-QI.IGFBP-1 blood plasma high level improves positive correlation with insulin sensitivity.Therefore method of the present invention and chemical compound can be used for improving insulin sensitivity and increase glucose transport, thereby regulate glucose metabolism.Therapeutic improves insulin sensitivity and glucose transport with the blood sugar lowering level, thereby the method for treatment hyperglycemia or diabetes is provided.

Method provided by the invention and chemical compound can improve the glucose uptake of cell.Method of the present invention and chemical compound can improve glucose uptake in the presence of insulin, show that method of the present invention and chemical compound can improve the insulin sensitivity of cell, cause the increase and the glycoregulatory change of Fructus Vitis viniferae of glucose uptake.Therapeutic improves insulin sensitivity and glucose uptake can be used for treating all that the trouble insulin sensitivity reduces or pancreas tolerates, thereby the method for treatment hyperglycemia or diabetes is provided.

Method of the present invention and chemical compound also can be used for improving the glucose absorption tissue that insulin excites.Method of the present invention and chemical compound can be used for improving the glucose absorption of tissue, improve its sensitivity to insulin.Glucose take in to increase the individuality that blood sugar level is raise, and as hyperglycemia or diabetic individual, or realizes or keeps the defective individuality of glucose homeostasis, provides and has reduced its method of glucose level.Therefore, method of the present invention and chemical compound can be treated hyperglycemia and diabetes by improving pancreas sensitivity, the absorption of raising glucose and blood sugar lowering level.

Show that with compounds for treating animal of the present invention blood sugar level is dose dependent and reduces.Blood sugar level can be remained on desired level by the dosage that changes this chemical compound.Therefore on the one hand, method of the present invention and chemical compound can be used for the blood sugar regulation level.On the other hand, method of the present invention and chemical compound can be used for the blood sugar lowering level.Therefore method of the present invention and chemical compound can be used for therapeutic blood sugar lowering level.By the blood sugar lowering level, the invention provides the method for treatment hyperglycemia and diabetes.Giving chemical compound of the present invention has improved the fat and glucose of diet induced and has tolerated glucose cleaning up from circulate in the impaired animal model.The raising glucose is cleaned up and has been reduced blood sugar level.Therefore on the one hand, clean up or the blood sugar lowering level can be used for regulating the glucose metabolism of glucose tolerance injured individual by glucose by improving for method of the present invention.Therapeutic raising glucose is cleaned up with the blood sugar lowering level and be can be used for treating patient, comprises diabetic or the patient that risk of diabetes takes place is arranged.

Treatment of diabetes

Method of the present invention and chemical compound can reduce the blood sugar level of diabetes animal model.In addition, method of the present invention and chemical compound can recover and realize that diabetes and glucose tolerate the glucose homeostasis of impaired animal model.The glycated hemoglobin level has reflected keeping of glycemic control in diabetic or the hyperglycemia individuality and glucose homeostasis.Reduce the glycated hemoglobin level and show that method of the present invention and chemical compound can be used for changing individual glucose and regulate, thereby recover, reach or keep glucose homeostasis.Therefore, method of the present invention and chemical compound can be used for treating hyperglycemia and diabetes by regulating glucose metabolism and recovery, reach or keeping glucose homeostasis.

Reduced the accumulation of glycated hemoglobin in the diabetes animal model with Compounds and methods for treatment animal of the present invention.The glycated hemoglobin level has been reacted diabetics or hyperglycemia patient to the control of blood sugar level and keeping of glucose homeostasis.The level of glycated hemoglobin reduces explanation Compounds and methods for of the present invention and can be used for changing individual glucose adjusting, thereby recovers, realizes or keep glucose homeostasis.Therefore, but chemical compound method of the present invention can be by regulating glucose metabolism and recovering, realize or keep glucose homeostasis and treat hyperglycemia and obesity.

Animal with the The compounds of this invention treatment shows that its weight increase is dose dependent and delays.Especially, observing the interior fat pad with the animal of this compounds for treating is dose dependent and reduces.Therefore, method of the present invention and chemical compound can be used for reducing fat stores and reduce interior fat.Obesity is particularly with internal organs, abdominal part or the excessive obesity of maincenter fat, relevant with hyperglycemia and diabetes.Specifically, the obesity with insulin sensitivity reduction, insulin resistant raising etc. will cause hyperglycemia and diabetes will take place.On the one hand, method of the present invention and chemical compound can reduce the danger that hyperglycemia or diabetes take place by the fat that reduces internal organs.On the other hand, method of the present invention and chemical compound can reduce the danger that hyperglycemia or diabetes take place by reducing obesity.

Pharmaceutical preparation and route of administration

Know as this field, compositions of the present invention can directly carry or be placed in the pharmaceutical composition that contains excipient and carry.Therapeutic Method of the present invention can comprise suffering from metabolic disease, specifically is that glucose is regulated relevant disease, as diabetes, hyperglycemia etc., or the experimenter who suffers from this class disease danger is arranged, the The compounds of this invention of treatment effective dose.In a preferred embodiment, described experimenter is a mammal, and in the most preferred embodiment, described experimenter is the people.

Chemical compound or effective amount of drug as dosage, are not difficult to determine with normal experiment, can be by effectively having and conventional approach and appropriate formulations administration.Existing various preparations in this field and delivery system (are seen the Gennaro chief editor, 2000, the Lei Mingdun pharmaceutical science (Remington ' s Pharmaceutical Sciences), the same and Hardman, the pharmacological basis (The Pharmacological Basis of Therapeutics) of the treatment that Limbird and Gilman compile, the same).

Suitable route of administration can comprise, in for example oral, rectum, part, intranasal, the lung, in the ophthalmic, intestinal and the intestines and stomach external administration.Main intestines and stomach external administration approach comprises intravenous, intramuscular and subcutaneous administration.Second kind of route of administration comprises in intraperitoneal, intra-arterial, intraarticular, intracardiac, the brain pond, in the Intradermal, intralesional, ophthalmic, pleura, in the trachea, in the urethra and administration in the ventricle.The indication that should preferably will treat and the physics of medicine, chemistry and biology performance show preparation type and used route of administration, and part or whole body are carried.

The release of the available once property of the pharmaceutical dosage forms of The compounds of this invention, controlled release, slow release or targeted drug induction system.Dosage form commonly used for example comprises, solution, suspension, (little) emulsion, ointment, gel and paster, liposome, tablet, dragee, soft or hard capsule, lozenge, ovulum (ovule), implant, amorphous or crystalline powder, aerosol and lyophilized formulations.The route of administration that depends on use may need special device to apply or give medicine, for example, and syringe and syringe needle, inhaler, pump, injection pen, applicator or special-purpose bottle.Pharmaceutical dosage forms often comprises medicine, excipient and container/sealing system.Can in chemical compound of the present invention, add one or more and be called the excipient of non-activity composition, with improve or help making, the administration and the safety of stability, medicine, a kind of instrument of realizing the required delivery mode of medicine can be provided.Therefore, the type that adds the excipient in this medicine depends on multiple factor, for example the physicochemical property of medicine, route of administration and manufacture method.This field of pharmaceutically acceptable excipient has, comprise listed those in the various pharmacopeia (see USP, JP, EP and BP, FDAweb page or leaf ( Www.fda.gov), inert fraction guide (Inactive Ingredient Guide) 1996 and medicated premix handbook (Handbook of Pharmaceutical Additives), Ash compiles; Synapse Information ResourcesInc.2002).

Any method that available this field is known prepares the pharmaceutical dosage forms of The compounds of this invention, as the mixing method of routine, sieve, dissolve, thawing, granulation, dragee preparation, film-making, suspension, extruding, spray drying, grinding, emulsifying, (Nano/micron) parcel, fall into folder or lyophilizing processing.Compositions of the present invention as mentioned above can comprise one or more physiologically acceptable non-activity compositions, bioactive molecule is worked in the goods with medicinal usage helping.

Appropriate formulations depends on required route of administration.For intravenous injection, for example, said composition can be mixed with aqueous solution, if desired, can adopt the physiological compatibility buffer agent, for example comprises, phosphoric acid, histidine or citric acid are regulated the pH of preparation and adopted tension regulator such as sodium chloride or glucose.For through mucous membrane or intranasal administration, preferred semisolid, liquid preparation or paster can contain penetration enhancers, and this class penetration enhancers is that this field is known usually.For oral administration, this chemical compound can be mixed with liquid or solid dosage form and disposable release or controlled release/slow releasing preparation.Be fit to the oral dosage form of experimenter and comprise tablet, pill, sugar pill, hard and soft shell capsule, liquid, gel, syrup, sucrose solution, suspension and emulsion.This chemical compound also can be formulated in the rectal compositions, in lozenge or enema,retention, as contains in the enema of conventional lozenge substrate such as cupu oil or other glycerol substrate.

Excipient be can adopt, filler, disintegrating agent, binding agent (dried or wet), dissolving delayer, lubricant, short lubrication prescription, antitack agent, cation exchange resin, humidizer, antioxidant, antiseptic, coloring agent and aromatic comprised.These excipient can derive from synthetic or natural.The example of this class excipient comprises cellulose derivative, citric acid, dicalcium phosphate, gelatin, magnesium carbonate, lauric acid magnesium sulfate/sodium, mannitol, Polyethylene Glycol, polyvinylpyrrolidone, silicate, silicon dioxide, sodium benzoate, sorbitol, starch, stearic acid and salt thereof, sugar (being glucose, sucrose, lactose etc.), Pulvis Talci, tragakanta mucilage, vegetable oil (hydrogenation) and wax.The second alcohol and water can be used as the granulation adjuvant.In some cases, may need the film with odour masking, anti-gastric acid film or delayed discharge film to wrap up tablet.Usually the natural and synthetic polymer of coupling and coloring agent, sugar, organic solvent and water wrap up tablet, produce sugar pill.When parcel tablet, medicated powder, suspension or solution were preferably used capsule, hard or soft shell capsule that can be compatible was carried.

In one embodiment, can be local, for example open liquid preparation by transdermal patches, semisolid, give chemical compound of the present invention as gel, (little) floating agent, ointment, solution, (Nano/micron) suspension or foam formulations.For example can adopt penetration enhancer; Suitably select and combination lipotropy, hydrophilic and both sexes excipient, comprise water, organic solvent, wax, oil, synthetic and natural polymer, surfactant, short emulsifying agent, by regulating pH, adopting short intermixture, regulate the infiltration of medicine to skin and its undertissue.Can adopt other technology,, regulate the infiltration of The compounds of this invention skin as ionotherapy.Preferred transdermal or topical, for example local medicine of carrying under the situation that needs the contact of bottom line whole body.

For inhalation or intranasal administration, chemical compound of the present invention can solution, the semi-solid aerosol form of suspension, emulsion or pressurized package or adopt the propulsive aerosol apparatus of propeller, the conventional conveying of halocarbon that produces as methane and ethane, carbon dioxide or any other suitable gas.Apply aerosol for the part, can adopt butane, iso-butane and pentane hydrocarbon.With regard to pressurized aerosol, can carry the aerocolloidal valve of definite amount to determine suitable dosage unit by providing one.Can prepare the capsule and the gelatin bolt that are used for inhaler or insufflator.These capsules or bolt contain the mixed-powder of chemical compound and the powder substrate that is fit to usually, as lactose and starch.

Usually with unit dosage form,, provide the bacteria composition that removes that is used for the outer injection of gastrointestinal tract of preparation as in ampoule, syringe, injection pen or multi-dose container (often containing antiseptic).This compositions can be taked suspension, solution or oiliness or aqueous emulsion form, can contain reagent preparation, as buffer agent, hardening agent, viscosity-increasing agent, surfactant, undecided floating and dispersant, antioxidant, biocompatible polymer, chelating agen and antiseptic.Depend on the injection site, the carrier of getting home can moisture, synthetic oil or vegetable oil and/or organic chaotropic agent.Under some situation, during as freeze-drying prods or concentrated product, can before administration, rebuild or dilute gastrointestinal tract external administration preparation.The storage preparation of The compounds of this invention controlled release or slow release can be provided, can comprise Nano/micron grade particles or Nano/micron level or the crystalline injectable suspensions of non-littleization.Polymer, those that know except that this field, as poly-(lactic acid) poly-(glycolic), or its copolymer or as controlled release/sustained-release matrix.Can implant provide other to store induction system with the pump form that needs cutting.

The carrier of well known suitable intravenous injection molecule of the present invention, it comprise can form the ionizing chemical compound contain alkali such as sodium hydroxide and as the sucrose of reinforcing agent or the alkaline solution of sodium chloride, for example, the buffer of phosphoric acid or histidine.Can add cosolvent, as Polyethylene Glycol.These water systems can effectively dissolve chemical compound of the present invention, and the whole body administration is only produced hypotoxicity.Each component ratio of solution system is can be quite different and do not destroy its dissolubility and toxic characteristic.In addition, the status of all components can change.For example, can adopt the surfactant of low toxicity, as Polysorbate or poloxamer, can add Polyethylene Glycol or other cosolvent, biocompatible polymer such as polyvinylpyrrolidone, other sugar and polyalcohols replace glucose.

For present Therapeutic Method compositions for use, originally available various technology well known in the art are estimated the treatment effective dose.The used initial dosage of zooscopy can be decided according to the valid density that cell culture test is determined.The dosage range that is fit to human can be determined with the data that zooscopy and cell culture obtained.

The treatment effective dose or the dosage of chemical compound of the present invention or medicine refer to that this chemical compound or medicine can cause experimenter's remission or amount or the dosage that existence prolongs.The toxicity of this quasi-molecule and therapeutic effect can be determined by the pharmacy program of carrying out standard in cell culture or laboratory animal, for example, determine by measuring LD50 (dosage that causes the death of 50% colony) and ED50 (the effective dosage of 50% mass treatment).The dose ratio of toxicity and curative effect is a therapeutic index, and available LD50/ED50 compares value representation.The preferred preparation that shows high therapeutic index.

Effective dose or treatment effective dose are that tissue, system, the animal or human that described chemical compound or pharmaceutical composition can induce researcher, veterinary, doctor or other clinical staff to think produces the amount of biology or doctor's reaction, for example can regulate glucose metabolism, reduce the amount that the blood sugar level, treatment or the prevention glucose metabolism that raise or increase change relevant disease such as diabetes.

The dosage of preference should drop on and comprise ED50 and have minimum or do not have in the toxic circulation composition scope.Dosage can change according to used dosage form and/or route of administration in this scope.Should be according to means known in the art according to the accurate preparation of the feature selection of experimenter's situation, route of administration, dosage and spacing of doses.

Can adjust dosage individually and at interval can fully obtain required effect to provide, the active component as the blood plasma level of regulating glucose metabolism, blood sugar lowering level etc. promptly reduces valid density (MEC) as far as possible.The MEC of each chemical compound is different but can estimate from for example external data and zoopery.The dosage that needs to obtain MEC depends on individual feature and route of administration.With regard to topical or selectivity absorption, effective local concentration of medicine may be irrelevant with plasma concentration.

Can be according to multiple factor, the preparation that gives or the amount of compositions are determined in the order of severity, administering mode and doctor's the judgement that comprises experimenter's to be treated sex, age and body weight, disease.

If desired, compositions of the present invention can be contained in the filling or dispersal device that contains one or more unit dosage forms (containing active component).For example, this filling or device can comprise metal or plastics pool, load in thing or glass and rubber closure such as the bottle as bubbling.This filling or dispersal device can be equipped with the administration description.Also can prepare the compositions that contains The compounds of this invention with the preparation of compatibility pharmaceutical carriers, adorn it and be placed in the proper container, certain indicates the label of disease to stick treatment.

Chemical compound and screening technique thereof

Chemical compound of the present invention is the chemical compound that can suppress hydroxylase activity, and specifically, hydroxylase activity wherein is a 2-oxoglutaric acid dioxygenase activity.More preferably hydroxylase activity is the activity of HIF hydroxylase.Most preferably hydroxylase activity is the activity of HIF prolyl hydroxylase.

Method of the present invention is to rely on to stablize the method for HIF α with realization experimenter's special-effect.Can stablize HIF α and finish method of the present invention by giving the experimenter with the chemical compound of the special-effect that realizes the experimenter.Most preferably implement this method by giving chemical compound of the present invention.

Chemical compound of the present invention exemplarily is used for the present invention and the relevant method of stable HIF α.Specifically, the invention provides and to suppress hydroxylase activity and/or HIF α hydroxylation, stablize chemical compound and the screening of HIF α etc. and identify the method for other chemical compound.Chemical compound of the present invention comprises the chemical compound that can suppress hydroxylase activity, and wherein preferred hydroxylation activity is the activity of 2-oxoglutaric acid dioxygenase.More preferably hydroxylase activity is the activity of HIF hydroxylase.But HIF hydroxylase hydroxylation HIF albumen, any aminoacid in the preferred HIF α subunit for example comprises proline or asparagicacid residue etc.In a particularly preferred embodiment, described hydroxylase activity is the activity of HIF prolyl hydroxylase and/or HIF agedoite hydroxylase.

The inhibitor of 2-oxoglutaric acid dioxygenase is known in this area.For example, several micromolecular inhibitors that identified precollagen prolyl 4-hydroxylase (are seen Majamaa etc., Eur J Biochem 138:239-245,1984; Majamaa etc., Biochem J 229:127-133,1985; Kivirikko and Myllyharju, Matrix Biol 16:357-368,1998; Bickel etc., Hepatology 28:404-411,1998; Friedman etc., Proc Natl Acad Sci USA97:4736-4741,2000; Franklin etc., Biochem J 353:333-338,2001; It is for referencial use that the content of all documents is all included this paper in).Also identified the micromolecular inhibitor (see international publication number WO02/074981, WO 03/049686 and WO 03/080566, it is for referencial use to fit into this paper in all documents) of HIF hydroxylase.The present invention considers to adopt these and other the chemical compound that can identify with means known in the art especially.

All enzymes in the 2-oxoglutaric acid dioxygenase family all need oxygen, Fe2+, 2-oxoglutaric acid and ascorbic acid (to see Majamaa etc., Biochem J 229:127-133,1985 for their hydroxylase activity; Myllyharju and Kivirikko EMBO J 16:1173-1180,1997; Thomburg etc., 32:14023-14033,1993; With Jia etc., Proc Natl Acad Sci USA 91:7227-7231).Therefore, chemical compound of the present invention includes but not limited to: the aminoacid of iron chelating agent, 2-oxoglutaric acid analogies and modification such as proline or aspartic acid congener.

In specific embodiment, the invention provides the structural simulation thing that uses 2-oxoglutaric acid.But the reaction of this chemical compound competitive inhibition target 2-oxoglutaric acid dioxygenase and 2-oxoglutaric acid, and the reaction of noncompetitive itself and ferrum (Majamaa etc. 1984, and are the same; Majamaa etc., 1985, the same).Special for example consider to adopt Majamaa etc., the same; Kivirikko and Myllyharju, Matrix Biol 16:357-368,1998; Bickel etc., Hepatology28:404-411,1998; Friedman etc., Proc Natl Acad Sci USA 97:4736-4741,2000; Franklin, Biochem Soc Trans 19:812-815,1991; Franklin etc., Biochem J 353:333-338,2001 and international publication number WO 03/049686 described in chemical compound, more than all documents in to fit into this paper for referencial use.

Exemplary compound comprises phenanthroline, and it includes but not limited to United States Patent (USP) 5,916,898 and 6,200,974; Described in the international publication WO 99/21860 those; Heterocycle carbonyl glycerol includes but not limited to United States Patent (USP) 5,719,164 and 5,726, and quinoline-2-amide and the ester thereof that replaces described in 305; United States Patent (USP) 6,093, isoquinolin-3-amide and the ester thereof that replaces described in 730; European patent EP 0650961 and United States Patent (USP) 5,658,3-Methoxy Pyridine carbonyl glycerol and the ester thereof described in 933; United States Patent (USP) 5,620,995 and 6,020,3-pyridone carbonyl glycerol and the ester thereof described in 350; United States Patent (USP) 5,607,954,5,610,5-sulfonamido carbonyl pyridine carboxylate and the ester thereof described in 1725 and 620,996.In all chemical compounds of listing in these patents, particularly claim chemical compound and those chemical compounds of listing among the embodiment of work all include in the application's book for referencial use.

Therefore, preferred compound of the present invention comprises, for example heterocycleamide.Particularly preferred heterocycleamide comprises, for example isoquinolin, quinoline, pyridine, cinnolines, carboline etc.In addition, the structure type of preferred compound comprises anthraquinone, the azepine fluorenes, the azepine phenanthroline, benzimidazoline, benzofuran, .alpha.-5:6-benzopyran, benzothiophene, catechol, chromanone, α-diketone, furan, the N-hydroxy amide, the N-hydroxyurea, imidazoles, indazole, indole, different thiadiazoles, isothiazole Yi oxadiazole isoxazole, 2-ketoacid, alpha-keto amide, α-ketone ester, α-ketimide oxadiazole, oxalyl amide oxazole oxazoline, purine, pyrans, pyrazine, pyrazoles, pyrazoline, pyridazine, pyridine, quinazoline, phenanthroline, tetrazolium, thiadiazoles, thiazole, thiazoline, thiophene and triazole.

The exemplary chemical compound that below is used for the embodiment of the invention has shown method of the present invention described herein: [(7-chloro-3-hydroxyl-quinolyl-2-carbonyl)-amino]-acetic acid (compd A), [(1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-acetic acid (compd B), [(4-hydroxyl-7-phenoxy group-isoquinolyl-3-carbonyl)-amino]-acetic acid (Compound C), 4-oxygen-1,4-dihydro-[1,10] phenanthroline base-3-carboxylic acid (Compound D), [(1-chloro-4-hydroxyl-7-methoxyl group-isoquinolyl-3-carbonyl)-amino]-acetic acid (compd E), [(3-hydroxyl-6-isopropoxy-quinolyl-2-carbonyl)-amino]-acetic acid (compound F 17-hydroxy-corticosterone), [(3-hydroxyl-pyridine radicals-2-carbonyl)-amino]-acetic acid (chemical compound G) and [(7-benzyloxy-1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-methyl acetate (compound H).

Can adopt various tests and triage techniques, comprise following those, identify chemical compound of the present invention, can make the chemical compound of hydroxylase activity.These chemical compounds are suitable in the inventive method.Be suitable for other chemical compound in the inventive method, can stablize the chemical compound of HIF α and can identify with existing test and screening technique by these those skilled in the art.

Test can provide the consumption with reaction substrate usually, or the detectable signal relevant with the generation of product.Test example is as comprising: fluorogen, radiosiotope, enzyme conjugates and other detectable label well known in the art.The result can be quantitatively or qualitatively.Label can help the separation of product, can product purification from other reacted constituent be come out by precipitation or affinity chromatograph as biotin or histidine tail.

This area standardization measure the test of hydroxylase activity.The activity of hydroxylase can be directly or indirectly measured in this class test.For example, certain test can be measured zymolyte, as the hydroxylation residue that exists in target protein, synthetic peptide mimics or its fragment, as (seeing Palmerini etc., J Chromatogr 339:285-292,1985) such as proline, aspartic acids.Hydroxylation proline or the aspartic acid that exists in certain chemical compound that reduce shows that this chemical compound can suppress hydroxylase activity.Perhaps described test can be measured other product of hydroxylation reaction, as the succinic acid (seeing Cunliffe etc., Biochem J 240:617-619) of 2-oxoglutaric acid formation.Kaule and Gunxler (Anal Biochem 184:291-297,1990) have described a kind of exemplary method that 2-oxoglutaric acid produces succinic acid of measuring.

Above-mentioned these methods can be used for identifying the chemical compound that can regulate the HIF hydroxylase activity.Exemplary method (on seeing) has been described among the embodiment 14.Target protein can comprise HIF α or its fragment, as HIF (556-575); The typical substrate that example is tested usefulness as described in example 14 above is: DLDLEMLAPYIPMDDDFQL (SEQ ID NO:5).Described enzyme comprises, for example available from HIF prolyl hydroxylase (seeing GenBank accession number No.AAG33965 etc.), the HIF aspartoyl hydroxylase (seeing GenBank accession number No.AAL27308 etc.) in any source.Described enzyme can be present in the rough lysate of cell, or partially purified form.For example, at (Science 292:464-468 such as Ivan, 2001 and ProcNatl Acad Sci USA99:13459-13464,2002) and described the method for direct or indirect mensuration HIF hydroxylase activity among the Hirsila etc. (J Bio Chem 278:30772-30780,2003); Other method has been described among the international publication number WO 03/049686.Measure and relatively lack and the enzymatic activity when having described chemical compound, will identify the chemical compound that can suppress HIF α hydroxylation.

The activated test of HIF α stability and/or HIF can comprise that the HIF α in the direct working sample (sees embodiment 14, the same), (see U.S. Patent No. 5 by the activation of measuring HIF α minimizing (seeing international publication number WO00/69908) relevant or HIF responsiveness target gene or reporting construction with von Hippel Lindau protein, 942,434) come indirect determination HIF α.Measure and relatively lack and the level of HIF and/or HIF-responsiveness target protein when having described chemical compound, will identify the chemical compound that can stablize HIF α and/or activate HIF α.

Can adopt based on 2-oxidation [1- ¹⁴C] 1,3-propanedicarboxylic acid hydroxylation-coupling decarboxylation test, evaluation can be regulated the active chemical compound of HIF specificity prolyl hydroxylase (seeing Hirsila etc., J Bio Chem 278:30772-30780,2003).This reaction is carried out in the reaction volume of 1.0ml for 25 ℃, wherein contains 10-100 microlitre detergent such as Triton-X-100, available from the cell lysis extracting solution, 0.05 μ M DLDLEMLAPYIPMDDDFQL (SEQ ID NO:5), the 0.005 μ M FeSO that express endogenous HIF prolyl hydroxylase or reorganization HIF prolyl hydroxylase ₄0.16 μ M2-oxidation [1- ¹⁴C] 1,3-propanedicarboxylic acid, 2 μ M ascorbic acid, 60 μ g catalases, 0.1 μ M dithiothreitol, DTT and 50 μ M Tris-hydrochloride buffers, transfer pH to 7.8.37 ℃ were reacted 20 minutes.This reaction produces ¹⁴CO ₂Be trapped in to hang in the atmosphere of reactant mixture top and soak on the filter paper of alkali liquor, and in the liquid flashing counting device, count.

Be not difficult to implement these and other embodiment of the present invention by reading this paper content those of ordinary skills.

Embodiment

Referring to following purpose is that the explanation embodiments of the invention can further be understood the present invention purely.Provide these embodiment just for claim of the present invention is described.The invention is not restricted to purpose is the described scope of one exemplary embodiment of explanation one aspect of the invention.Any method that equates on the function all within the scope of the invention.Those skilled in the art understand as described above and can make various modifications in addition described herein to the present invention with reference to the accompanying drawings that this class is revised the scope that all belongs to claim of the present invention.

Embodiment 1: experiment material

Usually, being used for the prolyl hydroxylase inhibitors chemical compound that the inventive method uses is to adopt standard chemical process well known by persons skilled in the art synthetic.With the purity of efficient this chromatography of liquid chemical compound, room temperature keeps in Dark Place.When the preparation of the different purposes of preparation, (Fritsh GMBH Germany) makes chemical compound suspend super efflorescence 20 minutes to form the granule of even size with 750rpm to adopt PULVERISETTE 7 planetary supermicro mills.

The suspension for preparing the superfine powder chemical compound of per os tube feed before use immediately.During administration chemical compound is suspended in and contains 0.5% carboxymethyl cellulose (CMC; Spectrum Chemical Gardena CA), in the aqueous solution of 0.1% polyoxyethylene sorbitan monoleate (Mallinckrodt Baker, Inc., Phillipsburg NJ), shake lasting the stirring with magnetic stirrer or rotation.The concentration of calculating suspension reaches given volume and required dosage level.In the other method, weighing chemical compound and to place the gelatine capsule of suitable size to be used for oral, the capsulae vacuus that control animals received is onesize; Or chemical compound arbitrarily is dissolved in histidine (Mallinckrodt Baker) solution of the 100mM that replaces water.

For drug administration by injection, earlier the sodium hydroxide of chemical compound and equimolar amounts is mixed in 10% glucose (Spectrum) or 25mM histidine and adds in the aqueous solution of isotonic sodium chloride (Mallinckrodt Baker).

Embodiment 2: the vivoexpression of glucose regulatory factor increases

The compounds of this invention is as follows to the effect that participates in glucose adjusting and metabolic protein and expression of gene.People 293A cell (adenovirus transform tire renal epithelial cell) is paved with is seeded in the 35mm culture dish that the DMEM culture medium that contains 5%FBS and 1% penicillin-streptomycin is housed, 37 ℃, 10%CO ₂Cultivated 1 day under the condition.Change culture medium into Opti-MemI, continued 18-24 hour.In culture medium, go into vehicle Control or compd B in addition, cultivated again 24,48 or 72 hours.Flat board placed discard culture supernatant on ice, add lysis buffer-1 (LB-1:10Mm TrispH7.4, lm MEDTA, 150mM sodium chloride, 0.5%IGEPAL).Scrape the collecting cell lysate, it was cultivated on ice 15 minutes, 4 ℃ of centrifugal 3000xg classification in 5 minutes then.Collect the supernatant of representing the kytoplasm component, separate cytoplasmic protein with the poly-propionic acid amide. gel electrophoresis (SDS-PAGE) of SDS-under reducing condition, every swimming lane adds the protein of the amount of waiting until.

Under 150V, carried out SDS-PAGE 2 hours, protein transduction moved on on the pvdf membrane, 4 ℃ 400mA1.5 hour.Wash once with T-TBS, add the antizymohexase antibody that is diluted to working concentration with the sealing buffer.4 ℃ of jogs are cultivated and are spent the night.Wash film 4 times with T-TBS, cultivated 1 hour then with the coupling second antibody room temperature of sealing buffer dilution.Wash film 4 times with T-TBA, use x-ray film and ECL SUPERSIGNAL WESTFEMTO or PICO chemical luminous substrate (Pierce Vhemical Co.Rockford IL) to develop and observation then according to manufacturer specification.

Shown in Figure 1A, the expression of handling aldolase in 24,48 and 72 hours the cell with compd B increases in time, but aldolase is expressed and loseed increase in the cell of handling with vehicle Control.Compd B is handled culture and is not shown that the 'beta '-tubulin expression increases, and the increase that shows aldolase is specific, and is irrelevant with the overall increase of protein expression.

These results show that Compounds and methods for of the present invention can be used for regulating involved in sugar zymolysis expression of gene, and prompting can be by strengthening utilization rate and the metabolism that glycolysis improves glucose with the The compounds of this invention treatment.

Embodiment 3: the vivoexpression of glucose transporter (GluT)-1 increases

In the 100mm culture dish, 37 ℃, 10%CO ₂In containing the DMEM culture medium of 10% hyclone, cultivate people SSC-25 (squamous cell cancer) or rat H9c2 (myocardium of ventricle cell) under the condition to being paved with.Wash cell 2 times with PBS, cultivated 16 hours with vehicle Control, Compound D (10 and 25 μ M) or Compound C (5,10 and 20 μ M).Flat board is placed on ice, discard culture supernatant, and adding lysis buffer-1 (LB-1:10mM Tris pH7.4,1mM EDTA, 150mM sodium chloride, 0.5%IGEPAL).Scrape the collecting cell lysate, cultivated on ice 15 minutes, 4 ℃ of centrifugal 3000xg 5 minutes then.Collect the supernatant of representing the kytoplasm component, separate cytoplasmic protein with the poly-propionic acid amide. gel electrophoresis (SDS-PAGE) of SDS-under reducing condition, every swimming lane adds the protein of the amount of waiting until.

Carried out SDS-PAGE 2 hours under 150V, 4 ℃ of 400mA 1.5 hours or spend the night move on to protein transduction on the pvdf membrane then, wash once with T-TBS, add with the sealing buffer to be diluted to resisting-GluT-1 antibody (Alpha Diagnostics) of working concentration.4 ℃ of jogs are washed film 4 times with T-TBS after cultivating and spending the night, and cultivate 1 hour then with the coupling second antibody room temperature of sealing buffer dilution.Wash film 4 times with T-TBA, use x-ray film and ECL SUPERSIGNAL WEST FEMTO or PICO chemical luminous substrate (Pierce VhemicalCo.Rockford IL) to develop and observation then according to manufacturer specification.

What data shown in Figure 1B showed that Compound D and Compound C improved respectively that the mediation glucose of SSC-25 and H9c2 cell takes in mainly can induce glucose transporter, the proteic level of GluT-1.The GluT-1 that Compounds and methods for of the present invention can improve cell is provided by the instrument of research chemical compound to the external picked-up effect of glucose that provide.These results show that Compounds and methods for of the present invention can be used for improving the protein expression that participates in the glucose absorption, thereby be that hyperglycemia, diabetes or glucose homeostasis are regulated defective other disease patient, the Therapeutic Method that strengthens glucose absorption and blood sugar lowering level is provided.

Embodiment 4: the vivoexpression of glucose regulatory factor increases

For the mode of inducing of determining that gene passes in time, obtain 24 of male Swiss Webster mices (30-32 gram) and use mouthful 0.5% carboxymethyl cellulose (CMC:Sigma-Aldrich, St.Louis MO) (0mg/kg/ days) or 1.25% compd B (25mg/ml0.5%CMC) of the oral 4ml/kg volume of feeding tube (100mg/kg) to treat from Simonsen.Inc.Took medicine the last time back 4,8,16,24,48 and 72 hours, and used isoflurane anesthesia.Put to death mice then, separate the tissue sample obtain kidney, liver, brain, lung and heart, be stored in-80 ℃ the RNALATER liquid (Ambion).

In order to study the dose response of The compounds of this invention, with 12 male Swiss Webster mices (30-32 gram, available from Simonsen, Inc., Gilroy CA) uses 0.5% carboxymethyl cellulose (CMC:Sigma-Aldrich of the oral 4ml/kg volume of mouthful feeding tube once a day, St.Louis MO), Compound D (25mg/ml joins with 0.5%CMC) (100mg/kg/ days) or compd B (7.5 and 25mg/ml, join with 0.5%CMC) (respectively 30 and 100mg/kg/ days) treatment is 4 days.Took medicine the last time back 4 hours, mice is also put to death in anesthesia, separates obtaining liver and every kidney of about 150mg, and is stored in-20 ℃ the RNALATER solution liquid (Ambion).

The RNA that separates above-mentioned experiment gained tissue in order to following method: each organ is made the blockage of 50mg, add 875 microlitre RLT buffer (RNEARY test kits: Qiagen Inc., Valencia CA), with rotary POLYTRON homogenizer (Kinematica, Inc., Cincinnati OH) the homogenization section is 20 seconds.3 minutes sedimentation insoluble substances of little centrifugal homogenate are transferred to supernatant in the one new test tube, separate obtaining RNA by manufacturer specification with RNEASY test kit (Qiagen).This RNA is eluted in 80 microliters of water, and is quantitative with RIBOGREEN reagent (Molecular Probes, Eugene OR).(Ambion Inc. AustinTX) removes genomic DNA among the RNA by manufacturer specification to use the DNA-FREE test kit then.Measure 260 and 280 light absorption values and determine purity and the concentration of RNA.

Perhaps tissue sample is diced TRIZOL reagent (Invitrogen Life Technologies, CarlsbadCA) in rotary POLYTRON homogenizer (Kinematica) homogenization.Homogenate is put the chloroform strong agitation sample that room temperature is gone into 0.2 volume in addition.Room temperature is cultivated mixture a few minutes, and 4 ℃ 12 then, centrifugal 15 minutes of 000g.Collect the isopropyl alcohol that water adds 0.5 volume.Mixed at room temperature sample 10 minutes, 4 ℃ 12, centrifugal 10 minutes of 000g.Supernatant discarded, precipitation is washed with 75%EtOH, and 4 ℃ 7, centrifugal 5 minutes of 500g.Remove genomic DNA among the RNA with DNA-FREE test kit (Ambion Inc., Austin TX) by manufacturer specification.Measure 260 and 280 light absorption values and determine purity and the concentration of RNA.

With 0.3M sodium acetate (pH5.2), 50ng/ml glycogen and 2.5 volume of ethanol ,-20 ℃ of precipitated rnas one hour.Centrifugal sample precipitates with 80% cold washing with alcohol, and drying is resuspended in the water.With T7-(dT) 24 first strand primers (Affymetrix, Inc., Santa Vlara CA) and SUPERSCRIPT CHOICE system (Invitrogen) according to the manufacturer specification synthetic double chain cDNA.With waiting until 25: 14: 1 phenol of volume: chloroform: isoamyl alcohol and PHASE LOCKGEL insert (brinkman, Inc., Westbury NY) the final cDNA of extracting.Collect 7.5M ammonium acetate and the 2.5 volume of ethanol precipitation cDNA of water with 0.5 volume.Perhaps, remove module (Affymetrix) with the GENECHIP sample and meet manufacturer specification purification cDNA.

(Enzo Diagnostics, Inc., Farmingdale NY) presses manufacturer specification cRNA from cDNA synthesizing biotinylated labelling in external translation reaction with BIOARRAY HIGHYIELD rna transcription labelling kit.Remove product and the fragmentation that module (Affymetrix) connects the last labelling of manufacturer specification purification with the GENECHIP sample.

At 1 * hybridization buffer (100mM MES; 1M[Na+]; 20mM EDTA; 0.01%Tween 20) the middle 5 μ g probes that add; 100 μ g/ml herring sperm dnas; 500 μ g/ml acetylation BSA, 0.03nM contrast few B2 (Affymetrix) and 1 * GENECHIP eucaryon hybridization tester (Affymetrix), preparation hybridization mixture.This hybridization mixture was cultivated centrifugal then 5 minutes 5 minutes at 99 ℃ and 45 ℃ successively.With musculus cdna group U74AV2 array (MG-U74AV2; Affymetrix) place room temperature, shook prehybridization 10 minutes with 45 ℃ of 1 * hybridization solutions then.This buffering is with 80 microlitre hybridization mixtures displacements, with 45 ℃ of 60rpm this array and metering balance liquid hybridized 16 hours.Hybridization back 6xSSPE, 0.1%Tween 20 washing arrays once, wash then and with the link coupled Streptavidin of R-phycoerythrin (Molecular Probes, Eugene OR), biotinylation goat-anti Streptavidin antibody (VectorLaboratories, Burlingame CA) and GENECHIP Fluidics Station 400 instruments (Affymetrix) are according to micro_lvl program (Affymetrix) dyeing of manufacturer.Analyze this array with GENEARRAY scanner (Affymetrix) and microarray group software (Affymetrix).

Musculus cdna group U74AV2 array (MG-U74AV2; Affymetrix) provide Mouse UniGene Databasebuild 74 (biotechnology infonation center (National Center for Biotechnology Information, Bethesda MD)) all sequences in (about 6000), the functional characteristic analysis of this sequence and 6000 the not expressed sequence tag of note (EST) bunch of having an appointment.

Shown in Fig. 2 A, 2B and 2C, coding participates in the expression of gene of glucose regulatory enzyme, increases with cooperative mode after handling with compd B.The transcriptional profile that Fig. 2 A, 2B and 2C provide comprises phosphofructokinase (the PFK)-P (A) of platelet type, PFK-L (B), Enolase-1 (C), glucose transporter (GluT)-1 (D), lactic acid dehydrogenase-1 (E), aldolase-1 (F) and the hexokinase-1 (G) of liver type.In time graph, most of mRNA levels reach peak value in early days after giving chemical compound, get back to control level after 24-48 hour.In addition, between the Different Organs gene expression of coding glycolytic ferment similar, but that kidney (Fig. 2 A) liver (Fig. 2 B) and lung (Fig. 2 C) showed on the time of the increase of specific mRNA relative expression level and increase is different.These different pieces with provide important energy source to each tissue, especially stress the time provide the glycolysis active level of the energy different relevant.But these results show chemical compound specificity of the present invention and induce glycolysis that these effects can be different because of tissue.

As shown in Figure 3A, low dosage (30mg/ml) or high dose (100mg/ml) compound treatment can cause the dose dependent that the GluT-1 encoding gene is expressed in the kidney to change.The increase that GluT-1 expresses in this example provides by promoting the cellular uptake glucose to come the mechanism of blood sugar regulation level.Shown in Fig. 3 B, handle with compd B and to cause instantaneous the inducing much at one that IGFBP-1 expresses in the kidney regulating liver-QI, but a kind of tissue is compared expression with the another kind tissue different on measuring.IGFBP-1 promotes the transhipment of insulin like growth factor, improved the cyclical level of IGFBP-1, and the effect of utilizing that has improved insulin sensitivity and glucose, this (sees Manetta etc. with for example persistent training is relevant, Metabolism 52:821-826,2003).Therefore, but chemical compound specificity of the present invention is induced the direct mediation agent of blood glucose picked-up, and indirect action is in blood glucose and the glycoregulatory body fluid regulator of Fructus Vitis viniferae.

Embodiment 5: the picked-up of glucose increases

Insulin resistant makes body reduce the ability of insulin response.Insulin resistant or insulin sensitivity reduce, normal and hyperglycemia, diabetes and hyperinsulinemia associated.Insulin resistant reduces or the insulin sensitivity increase can give behind the The compounds of this invention absorption of glucose by following mensuration and measures.

In order to measure the influence that The compounds of this invention is taken in glucose in the body, feed 4 weeks of food rich in fat with inducing obesity and insulin resistant for DIO (obesity of diet induced) rat (Charles River).Perhaps, can adopt any other hereditary animal model of ZDF rat or type 2 diabetes mellitus.Animal is divided into treatment and matched group.Treatment animals received described chemical compound 10 days and all the other accept high lipid food.Make quiet carotid artery of neck and femoral arteriography under general anesthesia, for after 10 days the fasting animal.With a kind of reference method of quantitative assay insulin resistant, promptly hyperinsulinemia-euglycemia is kept program and is carried out the perfusion of insulin continous pouring and 10% glucose, and speed is enough to plasma glucose levels is maintained base concentration.Collect blood sample monitoring blood sugar level and suitably regulate the glucose rate of flooding.

Under euglycemia limit, body glucose rate of flooding in a organized way equal glucose and take in speed, be a kind of measurement index of organizing insulin sensitivity therefore.Dabbling [3-before this keeps program and during stable state ³H] glucose can estimate the whole body glucose circulation that excites with insulin on basis.In case reach stable state glucose level (about 60-75 minute), add 2-deoxidation-D-[1-as medicine group ¹⁴C] glucose estimates the glucose uptake that excites of insulin in each tissue.The back was injected 1,3,5,10,20,30 and 45 minute by group at medicine, measured the glucose of blood sample and the concentration of tracer.The concrete tissue picked-up of collection organization's sample determination glucose after 120 minutes euthanasia.Those skilled in the art do not tie up these methods of understanding.

With the animal of The compounds of this invention treatment, its tissue such as muscle and liver, by to the raising of insulin sensitivity and the picked-up that the reduction of insulin resistant has been improved glucose.Give the increase of glucose uptake behind the chemical compound of the present invention, show that chemical compound of the present invention can be used for the patient of insulin resistant, but insulin sensitivity reduces or impaired patient comes therapeutic to reduce its insulin resistant and improve its insulin sensitivity.Therefore, method of the present invention and chemical compound are regulated the defective patient to hyperglycemia, diabetic or other glucose homeostasis, can improve glucose uptake and its blood sugar level of reduction in its body.

Embodiment 6: the dose dependent of blood sugar level reduces

Followingly studied the effect of chemical compound that give to blood sugar level.Give from Simonsen, the compd B of 50 male Spraque Dawley rats that Inc. obtains (6-7 age in week) 0.5%CMC (Sigma-Aldrich) or 20,60,100,200mg/kg body weight, the through port feeding tube is once a day oral, continuous 14 days.Body weight change and observable toxicity and the dead signal of monitoring animal.The 15th day, allow animal overnight fasting but can freely drink water, use the isoflurane anesthesia animal, open the abdominal cavity, collect postcava blood.The a sample collection of about 1ml is made analysis of Hematology Changes in the test tube that contains EDTA, second duplicate samples of about 1ml is not collected done the serum chemistry analysis in the anticoagulant test tube.(West Sacramento CA) carries out blood sample analysis by IDEXX.

As shown in Figure 4, the experiment of opening in twice minute shows, has shown the dose dependent reduction of blood sugar level with the animal of The compounds of this invention treatment.Relation prompting between chemical compound dosage and the blood sugar level adopts the inventive method and chemical compound blood glucose can be maintained desirable level with suitable dosage.Therefore, method of the present invention and chemical compound can be used for regulating, specifically the blood sugar lowering level.Therefore, method of the present invention and chemical compound can be used for the blood sugar level that therapeutic reduces the experimenter, for example reduce and suffer from the blood sugar level that glucose is regulated disease such as hyperglycemia or diabetic subjects.

Embodiment 7: the glucose tolerance of the type 2 diabetes mellitus animal model of diet induced strengthens

Adopt the C57BL/6J mice of feeding the serious obesity of high fat diet generation, hyperglycemia and hyperinsulinemia as the anti-model of diet induced obesity, type 2 diabetes mellitus and glucose.To be divided into following experimental group available from 40 male C 57 BL/6 J mouses of Jackson Laboratory (BarHarbor ME): group 1: vehicle Control animal, the mice grain ration (n=10) of feeding standard; Group 2: the mice grain ration parallel port feeding tube of feeding standard gives 75mg/kg/ days compd E (n=10); Group 3: vehicle Control.Animal is fed high fat mice grain ration (research diet 45% fat) (n=10); Group 4: feed high fat mice grain ration and a mouthful feeding tube of animal gives 75mg/kg/ days compd E (n=10).The raising scheme continued to carry out 14 days, measured body weight and food consumption every day.The preceding animal fasting of intraperitoneal glucose tolerance test (IPGTT) 4 hours, adopt kg body weight 2 gram glucose load amounts.0,15,30,60 and 90 minute blood sampling is made determination of blood glucose level after giving glucose.

Shown in Fig. 5 A, take standard grain and (RxChow) chemical compound that gives or mice that need not (VeChow) chemical compound, and take the mice of high fat diet with chemical compound (RxHF) treatment, glucose clearance speed is much at one with substantially the same.Yet high fat diet is low without other group mice of mice glucose clearance speed ratio of chemical compound (VeHF).Calculate the difference in glucose zone under each animal IPGTT curve (AUC), standard of comparison grain adds chemical compound (RxChow) and without the animal difference that the animal of chemical compound (VeChow) treatment and high fat diet need not (VeHF) statistical significance (t checks, P＜0.001) is arranged.In addition, when comparing the glucose AUC that high fat diet is used the animal of chemical compound (RxHF) treatment without the animal and the high fat diet of chemical compound (VeHF), find that blood sugar level difference has statistical significance (t check, P＜0.05).(seeing Fig. 5 B).Yet shown in Fig. 5 B, standard diet (RxChow) or high fat diet (RxHF) treatment mice and standard diet are without the glucose AUC no difference of science of statistics between chemical compound (VeChow) mice.

These data show, tolerate in the impaired animal model at the obesity and the glucose of diet induced, with glucose clearance in the animal blood of The compounds of this invention treatment improve, blood sugar level reduces, glucose machine tolerance normalization and glucose homeostasis are restored.Glucose utilization and adjusting that these results suggest are treated animal improve.The compounds of this invention has recovered the normal glucose tolerance of the glucose utilization and the impaired animal model of adjusting (impaired as the glucose tolerance) of diet induced, shows that method of the present invention and chemical compound can be used for therapeutic and recover the glucose homeostasis that glucose tolerates impaired patient.

Give glucose utilization and the improvement of adjusting and the recovery of glucose homeostasis behind the The compounds of this invention, also available oral glucose tolerance test (OGTT) is measured.Carry out the similar experiment described in the foregoing description 7 and measure the effect of administered compound blood sugar level.40 C57BL/6J mices are divided into following experimental group: group 1: vehicle Control animal, the mice grain ration (n=10) of feeding standard; Group 2: the vehicle Control animal, the high fat mice grain ration of feeding (research diet 45% fat) is (n=10); Group 3: the animal high fat mice grain ration parallel port feeding tube of feeding gives 75mg/kg/ days compd E (n=10); Group 4: feed high fat mice grain ration and a mouthful feeding tube of animal gives 75mg/kg/ days compd A (n=10).The raising scheme continued to carry out 28 days, measured body weight weekly.Animal overnight fasting before OGTT adopts kg body weight 1 gram glucose load amount.0,30,60,9,120 and 180 minute blood sampling glucose level is measured after giving glucose.

Embodiment 8: the saccharifying of haemachrome reduces

Various sugar (the most common glucose) form glycated hemoglobin by being incorporated into haemachrome molecule, and the speed of its formation is directly proportional with the affair concentration of glucose.Measuring the glycated hemoglobin level provides the index of precision of preceding 2-3 monthly average blood sugar concentration.The glycated hemoglobin level can be estimated diabetic or hyperglycemia patient's glycemic control situation clinically.

Following with the diabetic mice scale-model investigation give the effect of chemical compound to the glycated hemoglobin level.Make 20 male db/db mices (Harlan) accept to contain 8 weeks of drinking water of carrier (100 μ M histidine) or compd A (0.5mg/ml).With treatment 4 and 8 weeks of back, collect the tail vein sample before the research beginning, with HbA1cNOW test kit (MetrikaInc., Sunnyvale CA) mensuration HbA1c level.

Matched group 8 during week the horizontal y of HbA1c from baseline significantly rise (P＜0.05).When 7.5% when as shown in Figure 6, HbA1c is from 0 week was elevated to for 8 weeks 10%.The HbA1c of compounds for treating group does not raise in time, significantly is lower than non-treatment group during 8 weeks.The HbA1c level of animal during 8 weeks with the The compounds of this invention treatment is about 7.5%.

These data show, the The compounds of this invention treatment has reduced the accumulation of glycated hemoglobin in the type 2 diabetes mellitus animal model.HbA1c has reflected the whole glycemic control of diabetic.Chemical compound reduces this model HbA1c and shows that chemical compound of the present invention can be used for the glycemic control that therapeutic is improved diabetes or hyperglycemia patient.

Embodiment 9: the increase of body weight and reduction fat stores reduce

The following effect of having studied The compounds of this invention to the weight of animals loss and fat stores.The male Spraque Dawley rat of Inc. gives the compd B of 0.5%CMC (Sigma-Aldrich) or 20,60,100,200mg/kg body weight in (6-7 age in week) to 40 of through port feeding tube orally gives available from Simonsen, once a day, and continuous 14 days.Body weight change and observable toxicity and the dead signal of monitoring animal.The 15th day, allow animal overnight fasting but can freely drink water, use the isoflurane anesthesia animal.The a whole blood sample of about 1ml collected in the test tube that contains EDTA make analysis of Hematology Changes, second duplicate samples of about 1ml is not collected done the serum chemistry analysis in the anticoagulant test tube.(West Sacramento CA) carries out blood sample analysis by IDEXX.After collecting blood sample, cut barrier film and put to death animal.Write down the microscopic examination result of each animal, and collect liver, kidney, heart, spleen, lung, stomach, small intestinal and large intestine and do Histological assessment.

Shown in Fig. 7 A, the weight of animals increase for the treatment of with The compounds of this invention is the dose dependent minimizing.Animal checks and shows that growth does not delay generally, because most of organ absolute weights of treatment animal are compared with each organ weight of not treatment animal of contrast, does not have significant difference.For example, the cardiac weight of compounds for treating animal compared with the control, no statistically-significant difference (Fig. 7 B).Yet the organ relative weight of treatment animal has remarkable increase than not treating contrast.For example be expressed as the fractional heart relative weight of body gross weight, compared with the control, significantly increase (p=0.036, unidirectional Tu Shi variation analysis (one-way ANOVA/Tukey ' stest)) with the animal of 100mg/kg compounds for treating.

Because the absolute weight of organ, the not significantly minimizing of weight as heart is not delayed so treat the overall growth process of animal.In addition, owing to significantly increase, exist the selectivity loss of other tissue with respect to the organ weight of body gross weight.When using compounds for treating, show that interior fat is dose dependent and reduces as shown in Figure 8.The arrow of last figure shows the interior fat pad that exists with in the low dose compounds treatment animal, and figure below shows that the animal with the high doses of compounds treatment lacks fat pad fully.

These results show, method of the present invention and chemical compound can be used for loss or the minimizing regulating body weight, induce body weight, and can be with the loss of muscle, and can reduce interior fat.Combine, these results show that method of the present invention and chemical compound can be used for effective controlling body weight to be increased, and particularly reduces interior fat.These methods and chemical compound have superiority to treatment or prevention of obesity, therefore can be used for the relevant diabetes of treatment or prevention of obesity.

Embodiment 10: the weight increase of diet induced fat animal model reduces

The C57BL/6J mice that serious obesity, hyperglycemia and hyperinsulinemia take place the high lipid food of feeding is diet induced obesity, type 2 diabetes mellitus and the impaired a kind of model of glucose tolerance.To be divided into following experimental group available from 40 male C 57 BL/6 J mouses of Jackson Laboratory (BarHarbor ME): group 1: vehicle Control animal, the mice grain ration (n=10) of feeding standard; Group 2: the vehicle Control animal, the high fat mice grain ration of feeding (research diet 45% fat) is (n=10); Group 3: the animal high fat mice grain ration parallel port feeding tube of feeding gives 75mg/kg/ days compd E (n=10); Group 4: feed high fat mice grain ration and a mouthful feeding tube of animal gives 75mg/kg/ days compd A (n=10).This raising scheme continued to carry out 28 days, measured body weight weekly.Put to death animal and collect their organ and fat pad and weighing.

Shown in Fig. 9 A, the weight of animals of the high fat diet of feeding (group 2) is significantly higher than the animal (P＜0.05) of feeding standard grain ration (group 1).Yet, the high fat diet but show that with the animal (being respectively group 3 and group 4) of compd E or compd A treatment weight increase is evident as few (P＜0.05) of feeding.In fact, although high fat diet, substantially the same with the body weight and the normal diet animal of feeding of compounds for treating animal (group 3 and group 4 with group 1 relatively).Similarly, shown in Fig. 9 B, the animal of the high lipid food of feeding (group 2) stomach fat pad is than the animal (group 1) of feeding standard grain ration and the significantly increase of animal (group 3 and group 4) of feeding high lipid food and treating with The compounds of this invention.Shown in Fig. 9 B, feed high lipid food and basic identical with the fat pad weight of the animal of compounds for treating and normal diet animal.

Study the weight of also having measured each organ of animal after 28 days.Shown in Fig. 9 C, weight zero difference between experimental group of kidney, liver heart.These results show that observed body weight difference is owing to the minimizing of fat stores, rather than the minimizing of the speed of growth.These data show with compounds for treating animal of the present invention, have been eliminated the weight increase relevant with high fat diet.This effect that prevents weight increase of The compounds of this invention shows that The compounds of this invention is used in even bad diet absorbs fashionable therapeutic minimizing weight increase.In addition, method of the present invention and chemical compound can be used for the change to weight increase, point out losing weight that this compounds may being used for the treatment of property adjusting adiposis patient.

Embodiment 11: obesity mice loses weight

Studied the effect of The compounds of this invention that give by the following method to losing weight.Obtain the C57BL/6J mice from Jackson Laboratory (Bar Harbor ME).The C57BL/6J mice that serious obesity, hyperglycemia and hyperinsulinemia take place the high lipid food of feeding is diet induced obesity, type 2 diabetes mellitus and the impaired a kind of model of glucose tolerance.Become obesity to the mice high lipid food of feeding after 8 weeks.Obesity mice is divided into two experimental grouies: organize the obesity mice of 1 animal, organize 2 animals and be obesity mice with the The compounds of this invention treatment for contrast.This is extremely puzzled and 3 comprises that also another organizes agematched non-obesity mice.Treat animal with The compounds of this invention or with vehicle Control every day.In 21 days weekly secondary measure the mice body weight.The 21st day weighing mice also put to death.Separating stomach fat pad, liver, kidney and heart and weighing performs an analysis.

Give to lose weight behind the chemical compound and show that chemical compound of the present invention can be used for the body weight that therapeutic reduces adiposis patient.

Embodiment 12: participating in the blood pressure regulating expression of gene increases

Hypertension is the risk factor of diabetes and diabetes relevant disease and disease.Followingly studied the effect of The compounds of this invention to blood pressure regulation.Hair compd B or Compound D treatment animal prepare the RNA sample as described in embodiment 4.Measure iNOS mRNA level in order to following method.With 1 μ m at random six poly-primers, the total RNA of 1 μ g and OMNISCRIPT reverse transcriptase (Qiagen) to carry out cDNA by manufacturer specification synthetic.The 5 times of cDNA to 100 that dilution obtains μ of water L final volume.With FASTSTART DNAMASTER SYBR GREENI test kit (Roche) and gene-specific primer,,, carry out the gene expression analysis of level relatively with quantitative PCR according to manufacturer specification with LIGHTCYCLER system (Roche).Sample be heated to 90 ℃ 6 minutes, 42 take turns circulation altogether then: 95 ℃ 15 seconds, 60 ℃ of 5 seconds and 72 ℃ 10 seconds.Derivable nitricoxide synthase (iNOS)-Auele Specific Primer is as follows:

m-iNOS-F2 CCCAGGAGGAGAGAGATCCGATT(SEQ?ID?NO：1)

m-iNOS-R2 AGGTCCCTGGCTAGTGCTTCAGA(SEQ?ID?NO：2)

Measured level relatively that the 18S ribosomal RNA gene expresses in contrast.With QUANTITECT SYBRGREEN PCR test kit (Qiagen) and gene-specific primer,, with LIGHTCYCLER system (Roche),, carry out quantitative PCR according to manufacturer specification.Sample be heated to 90 ℃ 15 minutes, 42 take turns circulation altogether then: 95 ℃ 15 seconds, 60 ℃ of 20 seconds and 72 ℃ 10 seconds.Ribosomal RNA-Auele Specific Primer is as follows:

18S-rat-2B?TAGGCACGGCGACTACCATCGA(SEQ?ID?NO：3)

18s-rat-2A?CGGCGGCTTTGGTGACTCTAGAT(SEQ?ID?NO：4)

Each PCR operation comprises standard curve shape and water blank.In addition, after finishing each PCR operation, run the cup that unwinds to estimate the specificity of amplification.The iNOS gene expression of sample is done standardization with respect to the ribosomal rna expression level of 18S.

Shown in Figure 10 A, coding iNOS expression of gene raises after handling 8 hours with The compounds of this invention, after this falls back to control level.In addition, inducing of iNOS is dose-dependent, all can obtain with two kinds of chemical compounds of the present invention (compd B and D).These two kinds of chemical compounds are two kinds of different pharmacophoric groups, and a kind of is phenanthroline derivative, and a kind of is heterocycleamide, can be used in the inventive method.These results show, with the expression of The compounds of this invention treatment can raising iNOS (a kind of protein that participates in the vasodilation adjusting).Therefore, method of the present invention and chemical compound can be used for the induction of vascular diastole and bring high blood pressure down.

In order to measure the expression of adrenomedullin mRNA, as preparation sample and hybridization analysis as described in the above embodiment 4.Shown in Figure 10 B, increase with adrenomedullin (representative participates in the proteinic encoding gene of vasodilation) in the various tissues of The compounds of this invention B treatment animal.In with the time after the compd B treatment, the adrenal medullary hormone mRNA level in heart, kidney and the lung shows expresses fast rise, falls back to control level then in 16-24 hour.

Combine, these results show that method of the present invention and chemical compound can be used for providing the instrument that activates the gene expression of participation blood pressure regulation by diastole mechanism.This genoid includes but not limited to: derivable nitricoxide synthase and the tight gland medullarin of going up.Therapeutic raises vascular relaxing factor the effective ways that bring high blood pressure down is provided, thereby provides benefit to Metabolic disorder disease such as diabetic.By bringing high blood pressure down, method of the present invention and chemical compound can be used for providing method for treatment or prevent diabetes, hyperglycemia and other diabetes associated metabolic disease etc.

Embodiment 13: serum levels of triglyceride reduces

Studied the effect of chemical compound that give with the diabetic mice model is following to triglyceride level: this research adopt 20 male db/db mices in the leptin receptor, containing homozygous afunction sudden change (Harlan, Indianapolis, Indiana).Compare with normal mouse, the common high 1.5-2 of the triglyceride level of db/db mice is (Nishina etc., Metabolism 43:549-553,1994) doubly.Increase carrying out property of the triglyceride level increase (Tuman and Doisy.Diabetologia 13:7-11,1977) of db/db mice with the age.Mice accepts to contain 8 weeks of drinking-water of carrier (100 μ M histidine) or compd A (0.5mg/ml joins with 100 μ M histidine).The research end, the animal overnight fasting, the blood sampling product place serum to separate test tube from the tail venous cannulation under general anesthesia.Blood sample is delivered to Quqlity ClinicalLabs, and (Mountain View CA) performs an analysis.

As shown in figure 11, the level of the db/db mice triglyceride of experiment foot couple photograph is approximately 120mg/dL.Yet, be about 85mg/dL with the animal triglyceride level of The compounds of this invention treatment, significantly be lower than contrast.It is relevant with the dangerous rising of cardiovascular disease that triglyceride level raises, and the triglyceride of rising is a kind of composition of metabolism syndrome.Because method of the present invention and chemical compound can effectively reduce or keep common triglyceride rising relevant disease, as the triglyceride level in diabetes, syndrome X, trunk disease or other lipidosis mass formed by blood stasis,, method of the present invention has or has the individuality of suffering from this class disease danger so can be used for treating.

Embodiment 14: chemical compound and the stable evaluation of HIF α

Can adopt based on 2-oxidation [1- ¹⁴C] 1,3-propanedicarboxylic acid hydroxylation-coupling decarboxylation test, evaluation can be regulated the active chemical compound of HIF specificity prolyl hydroxylase (seeing Hirsila etc., J Bio Chem 278:30772-30780,2003).This reaction is carried out in the reaction volume of 1.0ml for 25 ℃, wherein contains 10-100 microlitre detergent such as Triton-X-100, available from the cell lysis extracting solution, 0.05 μ M DLDLEMLAPYIPMDDDFQL (SEQ ID NO:5), the 0.005 μ M FeSO that express endogenous HIF prolyl hydroxylase or reorganization HIF prolyl hydroxylase ₄0.16 μ M2-oxidation [1- ¹⁴C] 1,3-propanedicarboxylic acid, 2 μ M ascorbic acid, 60 μ g catalases, 0.1 μ M dithiothreitol, DTT and 50 μ MTris-hydrochloride buffers, transfer pH to 7.8.37 ℃ were carried out enzyme reaction 20 minutes.This reaction produces ¹⁴CO ₂Be trapped in to hang in the atmosphere of reactant mixture top and soak on the filter paper of alkali liquor, and in the liquid flashing counting device, count.

The following detection with stable to HIF α of method of the present invention and chemical compound.People's cell of the tire kidney epithelium (239A) that will transform derived from adenovirus, epithelium of cervix uteri adenocarcinoma (Hela), hepatocarcinoma (Hep3B), squamous cell carcinoma (SSC-25) and lung fibroblast (HLF) (see that U.S.'s typical case's culture preserves the center, Manassas VA and Qbiogene, Carlsbad CA) is seeded in respectively in the 100mm culture dish, at 37 ℃, 20%O ₂, 10%CO ₂Following cultivation, culture medium is: the HeLa cell is the improved Eagle culture medium of Dulbecco (DMEM), 2% hyclone (FBS); The HLF cell is DMEM, 10%FBS; 293 cells are DMEM, 5%FBS; The Hep3B cell is minimum essential medium (MEM), Earle ' s BSS (Mediatech Inc.Herndon VA), 2mM L-glutaminate, the nonessential aminoacid of 0.1mM, 1mM Sodium Pyruvate, 10%FBS.When cellular layer reaches when being paved with, replace former culture medium with OPTI-MEM culture medium (Invitrogen Life Technologies, Carlsbad CA), at 37 ℃, 20%O ₂, 10%CO ₂About 24 hours of following cultured cell layer.In current culture medium, add The compounds of this invention (one of compd B, F, G and H) or DMSO (0.5-1.0%) then, continue overnight incubation.

Cultivate the back and take out culture medium, centrifugal and preserve to be analyzed.With cold phosphate-buffered saline (PBS) washed cell secondary, use the 10mM Tris (pH7.4) of 1.0ml then, 1mM EDTA, 150mM NaCl, 0.5%IGEPAL (Sigma-Aldrich, St.Louis MO) and protease inhibitor cocktail (Roche Molecular Biochemicals) be cell lysis 15 minutes on ice.4 ℃ 3,000xg centrifuge cell lysate 5 minutes is collected kytoplasm component (supernatant).Re-suspended cell is examined with 100 μ l 20mM HEPES (pH7.2), 400mM NaCl, 1mM EDTA, 1mM dithiothreitol, DTT and proteinase mixture (Roche Molecular Biochemcals) cracking, centrifugal 5 minutes of 4 ℃ of 13000xg collect nucleoprotein component (supernatant).

According to protein concentration standardization nuclear consitution, be added on the 4-12%TG gel classification under reducing condition.Under 500mA 1.5 hours, protein transduction is moved on on the pvdf membrane (Invitrogen Corp., Carlsbad CA).Use T-TBS, 2% milk room temperature was sealed this film 1 hour, and used T-TBS, and the mouse anti HIF-1 Alpha antibodies (BD Biosciences, Bedford MA) of 2% milk dilution in 1: 250 is cultivated and spent the night.With SUPERSIGNAL WEST chemical luminous substrate (Pierce, Rockford IL) colour developing trace.Shown in Figure 12 A, representative compounds of the present invention (Compound D) has been stablized HIF α in all kinds cell in dosage dependence mode, makes and has accumulated HIF α in the cell.

Perhaps, prepare nuclear consitution with nuclear extraction agent box, and analyze HIF-1 α according to manufacturer specification with TRANSAM HIF-1ELISA reagent box (Active Motif).Shown in Figure 12 B, the Hep3B cell has shown that dose dependent stablizes HIF α when handling with The compounds of this invention.Figure 12 B compares with the control cells of vehicle treated after showing that also epithelial cell (293A) and hepatocarcinoma (Hep3B) are handled with all cpds of the present invention (compd B, F, G and H), has shown the stable and accumulation of HIF α.

Except shown in this paper and describe, those skilled in the art understand and can do various modifications to the present invention according to above-mentioned description.These modifications all drop in the scope of claim of the present invention.

It is for referencial use to fit into this paper in all lists of references that this paper quotes.

Sequence table

＜110〉Fibrogen, INC. (FibroGen, Inc.)

V. Jing Ceer-Pu Kaer (Guenzler-Pukall, Volkmar)

S.J. Crouse (Klaus, Stephen J.)

I. the special nurse Paro of Lance Bock (Langsetmo Parobok, Ingrid)

T.W. Seeley (Seeley, Todd W.)

＜120〉treatment of diabetes etc.

<130>FP0602.1?PCT

<150>60/431,351

<151>2002-12-06

<150>60/476,331

<151>2003-06-06

<150>60/476,726

<151>2003-06-06

＜150〉the unknown

<151>2003-12-04

<160>5

<170>PatentIn?version?3.2

<210>1

<211>23

<212>DNA

＜213〉house mouse (Mus musculus)

<400>1

cccaggagga?gagagatccg?att 23

<210>2

<211>23

<212>DNA

＜213〉house mouse (Mus musculus)

<400>2

aggtccctgg?ctagtgcttc?aga 23

<210>3

<211>22

<212>DNA

＜213〉black Mus (Rattus rattus)

<400>3

taggcacggc?gactaccatc?ga 22

<210>4

<211>23

<212>DNA

＜213〉black Mus (Rattus rattus)

<400>4

cggcggcttt?ggtgactcta?gat 23

<210>5

<211>19

<212>PRT

＜213〉homo sapiens (Homo sapiens)

<400>5

Asp?Leu?Asp?Leu?Glu?Met?Leu?Ala?Pro?Tyr?Ile?Pro?Met?Asp?Asp?Asp

1 5 10 15

Phe?Gln?Leu

Claims (16)

1. the preparation of stablizing HIF α is used to make treatment or prevents the purposes of the medicine of the relevant disease of blood sugar level rising, wherein said preparation is selected from [(7-chloro-3-hydroxyl-quinolyl-2-carbonyl)-amino]-acetic acid, [(1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-acetic acid, [(4-hydroxyl-7-phenoxy group-isoquinolyl-3-carbonyl)-amino]-acetic acid, 4-oxygen-1,4-dihydro-[1,10] phenanthroline base-3-carboxylic acid, [(1-chloro-4-hydroxyl-7-methoxyl group-isoquinolyl-3-carbonyl)-amino]-acetic acid, [(3-hydroxyl-6-isopropoxy-quinolyl-2-carbonyl)-amino]-acetic acid, [(3-hydroxyl-pyridine radicals-2-carbonyl)-amino]-acetic acid and [(7-benzyloxy-1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-methyl acetate.

2. the preparation of stablizing HIF α is used to make the purposes of the medicine that is used to have the individual treatment of suffering from risk of diabetes or prevent diabetes, wherein said preparation is selected from [(7-chloro-3-hydroxyl-quinolyl-2-carbonyl)-amino]-acetic acid, [(1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-acetic acid, [(4-hydroxyl-7-phenoxy group-isoquinolyl-3-carbonyl)-amino]-acetic acid, 4-oxygen-1,4-dihydro-[1,10] phenanthroline base-3-carboxylic acid, [(1-chloro-4-hydroxyl-7-methoxyl group-isoquinolyl-3-carbonyl)-amino]-acetic acid, [(3-hydroxyl-6-isopropoxy-quinolyl-2-carbonyl)-amino]-acetic acid, [(3-hydroxyl-pyridine radicals-2-carbonyl)-amino]-acetic acid and [(7-benzyloxy-1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-methyl acetate.

3. purposes as claimed in claim 1, wherein, described blood sugar level rising relevant disease is selected from hyperglycemia, obesity, hypertension, hyperlipemia, nephropathy, retinopathy, the impaired and angiopathy of glucose tolerance.

4. purposes as claimed in claim 3, wherein, described angiopathy is the auspicious sclerosis of tremulous pulse medicated porridge.

5. the preparation of stablizing HIF α is used to make the purposes of medicine, and described medicine is used for:

A. regulate glucose metabolism or glucose metabolism process;

B. realize glucose homeostasis;

C. blood sugar lowering level;

D. reduce the glycated hemoglobin level;

E. improve the expression of glucose regulatory factor;

F. change the expression of the glycolysis factor;

G. reduce experimenter's insulin resistant; Or

H. strengthen the control of experimenter's blood sugar level;

Wherein said preparation is selected from [(7-chloro-3-hydroxyl-quinolyl-2-carbonyl)-amino]-acetic acid, [(1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-acetic acid, [(4-hydroxyl-7-phenoxy group-isoquinolyl-3-carbonyl)-amino]-acetic acid, 4-oxygen-1,4-dihydro-[1,10] phenanthroline base-3-carboxylic acid, [(1-chloro-4-hydroxyl-7-methoxyl group-isoquinolyl-3-carbonyl)-amino]-acetic acid, [(3-hydroxyl-6-isopropoxy-quinolyl-2-carbonyl)-amino]-acetic acid, [(3-hydroxyl-pyridine radicals-2-carbonyl)-amino]-acetic acid and [(7-benzyloxy-1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-methyl acetate.

6. purposes as claimed in claim 5, wherein, described glucose metabolism process is selected from glucose uptake, glucose transport, glucose storage, glucose processing and glucose utilization.

7. purposes as claimed in claim 5, wherein, described glucose regulatory factor is selected from phosphofructokinase-P, phosphofructokinase-L, Enolase, Glut1, lactic acid dehydrogenase, aldolase-1, hexokinase-1, insulin-like growth factor binding protein-1 and the auspicious somatomedin of insulin.

8. purposes as claimed in claim 5, wherein, the described glycolysis factor is selected from phosphofructokinase-P, phosphofructokinase-L, Enolase-1, lactic acid dehydrogenase, aldolase-1, hexokinase-1.

9. as claim 1,2 or 5 described purposes, wherein said preparation is [(7-chloro-3-hydroxyl-quinolyl-2-carbonyl)-amino]-acetic acid.

10. as claim 1,2 or 5 described purposes, wherein said preparation is [(1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-acetic acid.

11. as claim 1,2 or 5 described purposes, wherein said preparation is [(4-hydroxyl-7-phenoxy group-isoquinolyl-3-carbonyl)-amino]-acetic acid.

12. as claim 1,2 or 5 described purposes, wherein said preparation is a 4-oxygen-1,4-dihydro-[1,10] phenanthroline base-3-carboxylic acid.

13. as claim 1,2 or 5 described purposes, wherein said preparation is [(1-chloro-4-hydroxyl-7-methoxyl group-isoquinolyl-3-carbonyl)-amino]-acetic acid.

14. as claim 1,2 or 5 described purposes, wherein said preparation is [(3-hydroxyl-6-isopropoxy-quinolyl-2-carbonyl)-amino]-acetic acid.

15. as claim 1,2 or 5 described purposes, wherein said preparation is [(3-hydroxyl-pyridine radicals-2-carbonyl)-amino]-acetic acid.

16. as claim 1,2 or 5 described purposes, wherein said preparation is [(7-benzyloxy-1-chloro-4-hydroxyl-isoquinolyl-3-carbonyl)-amino]-methyl acetate.

Images