CN100441683C - Low molecular-weight urokinase mutant and its expression vector - Google Patents

Abstract

The present invention discloses a low molecular weight urokinase mutant and an expression carrier thereof, which belongs to the field of gene engineering. The low molecular weight urokinase mutant has amino acid sequence as a sequence list SEQ ID No. 1 displayed. Compared with natural HMW-uPA, the low molecular weight urokinase mutant has the advantages that (1) the stability of a product is improved to make the products uniform and to control the quality of the product; (2) the inactivation effect of thrombase in vivo to pro-UK can be avoided, blood concentration is improved to improve thrombolytic efficiency and prolong the half-life of a medicine in vivo; (3) the specific activity of protein can be improved, and the dosage of the medicine is reduced. LMW-UK with low molecular weight not only is easy to express, but also can reduce clinical dosage. The low molecular weight urokinase mutant is very favourable for the industrial production of mammalian cell expressed biological technological medicines.

Description

Low molecular-weight urokinase mutant and expression vector thereof

Technical field

The present invention relates to low molecular-weight urokinase mutant and expression vector thereof, belong to field of biological pharmacy.

Background technology

Thrombus diseases such as myocardial infarction, cerebral thrombosis and pulmonary infarction are a kind of common diseases of serious harm human health, become the maximum disease of death toll at developed country's cardiovascular and cerebrovascular diseases, the number that China dies from cardiovascular and cerebrovascular diseases every year is only second to cancer, second of row.Urokinase (UK) is the most frequently used thrombolytic drug of China, but the whole world does not also have gene recombination human urokinase product approval listing at present, the urokinase product of China's approval listing mainly is to extract from human urine, the low molecular weight urokinase that Abbott (Abbott Laboratories) company of U.S. FDA approval listing in 2002 produces

It is people's tire nephrocyte cultured products, these products exist that the source is limited, the quality control that may pollute pathogenic agent such as hepatitis B virus, hepatitis C virus, product difficult (usually being the mixture of high molecular and lower molecular weight UK) wait deficiency, especially the tire nephrocyte is from the aborted fetus primary cell, can not infinitely go down to posterity, it is extremely limited to originate, in fact

Though the approved listing, and have thrombolysis effect preferably, in the thrombolysis clinical treatment, almost do not have

Product is available.Therefore developing the genetically engineered urokinase is that a kind of ideal is selected with the urokinase that substitutes urine source or tire nephrocyte cultivation source.

Urokinase (also claims double chain urokinase type plasminogen activator, tcu-PA) be uPA (pro-UK, also claim Single-chain Urokinase-type Plasminogen Activator, scu-PA) at plasmin, effect such as trypsinase and kallikrein down, the enzyme that the plasminogen activation function is arranged that forms after the peptide bond rupture between Lys158-Ile159, because the A chain that forms after the peptide bond rupture between Lys158-Ile159 still is connected by disulfide linkage Cys148-Cys279 with the B chain, molecular weight is identical with pro-UK, so be called polymer urokinase (HMW-UK), the glycoprotein that the polymer urokinase is made up of 411 amino acid, 12 pairs of disulfide linkage are arranged, a N-glycosylation site (Asn302) and an O-glycosylation site (Thr18), have three protein structure districts: (EGF-like district, (1) skins somatomedin district, 5-49 amino acids residue is formed), main being responsible for combines with uPA acceptor (uPAR); (2) Kringle district (50-136aa); (3) serine protease position district, wherein His204, Asp255 and Ser356 constitute the active centre of enzyme.Plasmin continues hydrolysis HMW-UK, lose EGF-like district and Kringle district in the Lys135-Lys136 fracture, become low molecular weight urokinase (LMW-UK), perhaps under the effect of metalloprotease (metalloproteinase pump-1), lose EGF-like district and Kringle district in the Glu143-Leu144 fracture, form the another kind of LMW-UK that forms by HMW-UK 144-411 amino acids residue.In addition, the Arg 156-Phe157 peptide bond of pro-UK can be produced the duplex molecule that is linked to each other by disulfide linkage by the zymoplasm hydrolysis, and its activity has only double-stranded UK active 1/500, and the substrate and the Profibrinolysin of synthetic almost do not had enzymatic activity.High molecular weight urokinase and low molecular weight urokinase, thrombolysis effect identical (www.abbott.com) in clinical treatment, and the transformation period in vivo is also very approximate, and the glycosyl of urokinase is very little to its activity and transformation period influence.

Summary of the invention

First technical problem that the present invention will solve provides a kind of low molecular-weight urokinase mutant.

Second problem that the present invention will solve provides the expression vector of this low molecular-weight urokinase mutant.

For achieving the above object, the present invention is by the following technical solutions:

Low molecular-weight urokinase mutant has the aminoacid sequence shown in the sequence table SEQ ID No.1.

Coding has the gene of the low molecular-weight urokinase mutant of aminoacid sequence shown in the sequence table SEQ ID No.1.The utilization techniques well known, the coding nucleotide sequence that can design its preference according to the expression system that is adopted for example can adopt the preference codon of yeast expression system or escherichia expression system etc. to improve expression efficiency.All can expressed sequence table SEQ ID No.1 shown in the coding nucleotide sequence of aminoacid sequence all belong to and be equal to replacement of the present invention.

In the present invention, the gene of coding with low molecular-weight urokinase mutant of aminoacid sequence shown in the sequence table SEQ ID No.1 is to have the nucleotide sequence shown in the sequence table SEQ ID No.2.

The low molecular-weight urokinase mutant that the present invention makes up has lacked the 1-143 amino acids residue of high molecular pro-UK to remove plasmin action site Lys ¹³⁵-Lys ¹³⁶Action site Glu with metalloprotease ¹⁴³-Leu ¹⁴⁴, and with Arg ¹⁵⁶Sport Lys to eliminate the zymoplasm restriction enzyme site, in addition with Asn ³⁰²Sport Ala to remove glycosylation site.

The dhfr bicistronic mRNA carrier for expression of eukaryon pIRES-dhfr of reduction, preserving number is CGMCC No.1623.

Dihydrofolate reductase gene (dhfr) is cloned into the downstream of encephalomyocarditis virus (ECMV) internal ribosome entry site (IRES) that weakens in the pIRES carrier, made up the bicistronic mRNA carrier for expression of eukaryon pIRES-dhfr that contains reduction dhfr selection markers and available ammonia first purine (MTX) pressurization raising expression level, this expression vector is preserved (No. 13, North No.1 Row, Zhongguancun, Haidian District, Beijing City at China Committee for Culture Collection of Microorganisms common micro-organisms center, 100080, phone: 010-62542758), preservation day is on February 24th, 2006, preserving number is CGMCC No.1623, the microbial strain of ginseng certificate is pIRES-dhfr/HMW-ProUK, the classification called after colon bacillus Escherichia coli of suggestion).PIRES-dhfr can be used for any proteic expression in theory, as requested, we are when preserving this carrier (plasmid), a kind of sugar basedization of will encoding, the gene of the high molecular urokinase zymogen mutant of zymoplasm resistance (nucleotide sequence of aminoacid sequence and proteins encoded is respectively shown in sequence SEQ ID No.3 and sequence SEQ ID No.4) utilizes Nhe I/Xho I double digestion to be inserted into multiple clone site (the Multiple Cloning Site of this carrier, MCS), make up pIRES-dhfr/HMW-ProUK carrier (Fig. 2 (b)), and be converted into preservation this plasmid (preserving number is CGMCC No.1623) in the intestinal bacteria.

The low molecular-weight urokinase mutant that expression vector CGMCC No.1623 is expressed.

Utilize the pIRES-dhfr expression vector expressed a kind of sugar basedization, have the zymoplasm resistance low molecular weight urokinase (LMW-UK) mutant (disappearance uPA the 1-143 amino acids, Arg156 → Lys, Asn302 → Ala), has the aminoacid sequence shown in the sequence table SEQ ID No.1, its coding gene sequence has the nucleotide sequence shown in the sequence table SEQ ID No.2, its prlmary structure of protein synoptic diagram as shown in Figure 1, the carrier for expression of eukaryon pIRES-dhfr/LMW-UK that expresses low molecular weight urokinase is shown in Fig. 2 (c).

The cell that contains the expression vector of low molecular-weight urokinase mutant shown in the sequence table SEQ ID No.1 is the strain of dhfr defective type Chinese hamster ovary celI, behind transfection pIRES-dhfr/LMW-UK (Fig. 2 (the c)) carrier, the dhfr gene has been brought among the dhfr defective type CHO, therefore transfection the Chinese hamster ovary celI of pIRES-dhfr/LMW-UK can in containing the DMEM/F12 substratum (Hyclone) of MTX, survive, and the Chinese hamster ovary celI of untransfected can't be survived at the DMEM/F12 substratum that contains MTX, is eliminated gradually.

The cell that contains the expression vector of low molecular-weight urokinase mutant shown in the sequence table SEQ IDNo.1.

Described cell is the strain of dhfr defective type Chinese hamster ovary celI.

Utilize the pIRES-dhfr/LMW-UK carrier for expression of eukaryon that makes up voluntarily, in Chinese hamster ovary celI, stablize this low molecular-weight urokinase mutant of high expression level.With the liposome transfection method with expression vector pIRES-dhfr/LMW-UK transfection CHO-dhfr ^-Take turns ammonia first dish purine (MTX) screening through one behind the cell, LMW-UK is all expressed in the monoclonal cell strain of nearly all acquisition, and wherein about 50% is that expression level is near (500-5000IU/10 ⁶Cells/d) high expression level positive colony.Be about 17.5 μ g/10 with rolling bottle serum-free culture expression level ⁶The rCHO clone LB2-UK of cells/d, behind the supernatant process cationic exchange coloum and gel permeation chromatography two-step purifying of collection, the purity of the recombinant protein of acquisition can reach 99%.Detect with S-2444 chromophoric substrate method, the double-stranded UK ratio of the mutant that is obtained accounts for the double-stranded ratio of 98% mutant of expressing and reaches 98% in this research, mainly with enzyme but not the form of proenzyme exist.

Result of study of the present invention shows: through a mono-clonal screening, the expression level of target protein reaches about 3-22 μ g/10 in the cell strain supernatant of acquisition ⁶Cells/d, and the positive rate of monoclonal cell reaches 95%, proves that this carrier has the potentiality of cance high-expression gene recombinant protein.If do not need the mass production recombinant protein, can just can rapidly and efficiently obtain the needs that recombinant protein satisfies this proteic property research without the mono-clonal screening and culturing with this vector expression albumen.In addition, the dhfr both wings gene that can increase because MTX pressurizes through too much taking turns the pressurization screening concentration of MTX pressurization and raising MTX, can further improve the expression amount of goal gene.

Advantage of the present invention is: compare with natural HMW-uPA, the LMW-uPA of zymoplasm resistance sugar basedization has following characteristics: (1) eliminates the zymoplasm restriction enzyme site, one can improve the stability of product, make more homogeneous of product, help the quality control of product, two can avoid the deactivation of body intravascular coagulation enzyme to pro-UK.The difficult point that HMW-pro-UK produces is its unstable, and restriction enzyme site is many, can cause the internal peptide bond rupture of HMW-pro-UK many places and influences the homogeneity of product; (2) no N-sugar chain structure, one does not influence activity, helps the homogeneity of product yet, and whether glycosylation, do not influence UK stability in vivo, in non-glycosylated pro-UK and the natural pro-UK body transformation period closely similar, about 8-12min prolongs its transformation period; (3) 1-143aa of disappearance HMW-pro-UK, the one, eliminated pro-UK in vivo with cytolemma on the combining of uPAR, with low molecule t-PA mutant rPA the same, can improve Plasma Concentration to improve thrombolysis efficient; The 2nd, the transformation period in the body of possible prolong drug, bibliographical information is arranged, the pro-UK mutant of disappearance EGF-domain is 3 times of HMW-pro-UK in the intravital transformation period of rat; (4) can improve proteinic specific activity, reduce dosage.The present invention shows, the LMW-UK mutant has kept the enzymatic activity position of HMW-UK, the specific activity of its plasminogen activation (about 160000IU/mg) is high by 60% than HMW-UK (about 104000IU/mg), because general thromboembolism treatment dosage all is to calculate according to the activity of plasminogen activation, therefore, during clinical treatment, under the identical situation of administration gross activity, dosage (mg) that can bigger minimizing urokinase, for example, the clinical consumption of urokinase treatment myocardial infarction is 1,500,000 IU/ person-times at present, if HMW-UK, the dosage that needs is 15mg, and uses LMW-UK instead, then only needs 9.4mg.The less LMW-UK of molecular weight not only expresses easily, and clinical dosage also can reduce, and is very beneficial for the industrialization of the biotech drug of mammalian cell expression.

The invention will be further described below in conjunction with embodiment, all any this areas of having done according to the disclosure of invention be equal to replacement, all belong to protection scope of the present invention.

Description of drawings

Fig. 1 is the LMW-UK mutein primary structure synoptic diagram of zymoplasm resistance, sugar basedization.

Fig. 2 (a) is the synoptic diagram of carrier for expression of eukaryon pIRES-dhfr.

Fig. 2 (b) is the synoptic diagram of carrier for expression of eukaryon pIRES-dhfr/HMW-proUK (CGMCC No.1623).

Fig. 2 (c) is the synoptic diagram of carrier for expression of eukaryon pIRES-dhfr/LMW-UK.

Fig. 3 is the building process of carrier for expression of eukaryon pIRES-dhfr/LMW-UK.

Fig. 4 (a) is that carrier for expression of eukaryon pIRES-dhfr/LMW-UK identifies figure, lane 1:genemarker through Nhe I/Xho I double digestion; Lane 2:Nhe I/Xho I double digestion.

Fig. 4 (b) is for inserting the zymoplasm resistance between the pIRES-dhfr carrier multiple clone site Nhe I/Xho I, the LMW-UK mutant gene sequence of sugar basedization.Insert the LMW-UK mutant gene sequence between the pIRES-dhfr carrier multiple clone site Nhe I/Xho I; The restriction enzyme site of italics base difference Nhe I and Xho I; Base is the Kozak sequence in the square frame: underscore partly is the pro-UK signal peptide; The shadow character part is respectively sudden change thrombin restriction enzyme site and glycosylation site.

Fig. 5 expresses the The selection result of the gene recombination Chinese hamster ovary celI positive colony of LMW-UK mutant.

Fig. 6 (a) is the purifying of recombinant L MW-UK mutant, SDS-PAGE result behind the positively charged ion chromatography.

Fig. 6 (b) is the purifying of recombinant L MW-UK mutant, SDS-PAGE result behind the gel chromatography.

Fig. 6 (c) is the non-reduced electrophoresis scanning result of protein sample behind the two-step purifying.

Fig. 7 is for measuring the typical curve of UK concentration with the S-2444 method.

Embodiment

Test materials and source:

The competence bacillus coli DH 5 alpha is a Time Inc. available from the sky, dhfr defective type Chinese hamster ovary celI strain (ATCC No.CRL9096), dhfr gene, this research department of pro-UK gene preserve (Chinese patent CN96119836.2), plasmid pUC19 (TakaraBiotechnology Co., production number No.D3219), the pIRES carrier for expression of eukaryon is available from Biosciences Clontech company.

Restriction enzyme Nhe I, Xho I, Xma I and Not I etc. are available from NEB company, and T4DNA ligase enzyme and high-fidelity Taq enzyme Pyrobest are available from precious biotechnology company limited (TaKaRa).Plasmid extracts, the PCR product reclaims and enzyme is cut product recovery test kit all available from Promega company.DNA Marker is a Time Inc. available from the sky.

DMEM substratum, DMEM/F12 substratum and reinforced calf serum are available from Hyclone company; The serum free medium additive is this chamber preparation (Chinese patent CN200310124257.X); G418 is available from Sigma company; Lipofectamine ^TM2000 available from Invitrogen company; Ammonia first dish purine (MTX), xanthoglobulin (Hypoxanthine), thymus pyrimidine (Thymidine), thermophilic bacteria proteolytic enzyme (Thermolysin) and chromophoric substrate S-2444 are all available from Sigma.Urokinase standard substance (National Institute for Biological Standards and Control, Britain); Enzyme connection detector is Bio-Rad550; SP Sepharose Fast Flow cation exchange medium and Sephacryl S-200 gel filter medium are all available from Amersham Bioscience.

The primer of all oligonucleotide is synthetic to be finished by Shanghai Bo Ya biotech company.

Embodiment 1.pIRES-dhfr Construction of eukaryotic

With the pUC19/dhfr plasmid is template, with primer dhfr1 and primer dhfr2 is the upstream and downstream primer, pcr amplification dhfr gene, the PCR reaction system is: 8 μ LdNTP (2.5mmol/L), 0.5 μ LPyrobest polysaccharase, 10 μ LATR (1-18) templates, 10 μ L, 10 * Buffer, 2 μ L dhfr1 upstream primers (10 μ mol/L), 2 μ L dhfr2 downstream primers (10 μ mol/L), 67.5 μ L water, the total reaction system is 100 μ L, PCR reaction conditions: 94 ℃, 2min (pre-sex change) → [94 ℃, 30s → 60 ℃, 60s → 72 ℃, 1min] * → 72 ℃ of 25 circulations, 5min → 4 ℃, 5min.Reclaim PCR product (Promega, Agarose LMP) with 0.8%-1% low melting-point agarose glue.

The PCR product reclaims dhfr gene Xma I and the Not I double digestion that test kit reclaims, while pIRES carrier XmaI and Not I double digestion, under the effect of T4 ligase enzyme, above-mentioned two segment DNAs are connected into the pIRES-dhfr expression vector, transformed into escherichia coli DH5 α, the clone who chooses is through shake-flask culture, do the PCR evaluation with primer dhfr1 and dhfr2 after extracting plasmid, carry out the gene complete sequence determination through confirming the plasmid that has inserted the dhfr gene.The recombinant plasmid called after pIRES-dhfr that checks order correct (Fig. 2 (a)).

Primer dhfr1:5 '-CTACCCGGG CCACCATGGTTCGACCGCTGAA CTG-3 '

Primer dhfr2:5 '-CGATGCGGCCGCTTAGCCTTTCTTCTCATAGACT-3 '

Embodiment 2. low molecular weight urokinase Construction of eukaryotic

One. method:

Utilize site-directed mutagenesis technique, Arg156 in the natural polymer low-dose urokinase original molecule is sported Lys to eliminate the zymoplasm restriction enzyme site, in addition Asn302 is sported Ala with the removal glycosylation site, and this HMW-proUK mutant gene is inserted the carrier pIRES-dhfr/HMW-proUK (CGMCC No.1623) that the pIRES-dhfr carrier obtains to express the nonglycosylated HMW-proUK mutant of zymoplasm resistance.

For making the LMW-UK secreting, expressing, introduce the signal peptide of pro-UK in the upstream of its encoding gene, concrete grammar is: (1) PCR overlapping extension primer HMW1 and primer SIG generate pro-UK signal peptide sequence LMWfrag1, overlapping extension PCR reaction system is: 2 μ L dNTP (2.5mmol/L), 0.125 μ L Pyrobest polysaccharase, 2.5 μ L, 10 * Buffer, oligonucleotide fragment HMW1 and SIG each 5 μ L (5 μ mol/L), pure water 10.375 μ L, the total reaction system is 25 μ L.The PCR reaction conditions: 94 ℃, → 72 ℃ of pre-sex change 2min → [94 ℃, 30s → 60 ℃, 30s → 72 ℃, 50s] * 20 circulations, 5min → 4 ℃, 5min; (2) be template with pIRES-dhfr/HMW-proUK carrier (CGMCC No.1623), be the gene LMWfrag2 of upstream and downstream primer PCR amplification coding 144-411aa LMW-UK with primer LMW1 and primer HMW6, PCR reaction conditions: 94 ℃, 2min (pre-sex change) → [94 ℃, 30s → 60 ℃, 60s → 72 ℃, 1min] * → 72 ℃ of 25 circulations, 5min → 4 ℃, 5min.Reclaim PCR product (Promega, Agarose LMP) with 0.8%-1% low melting-point agarose glue; (3) with LMWfrag1 and the overlapping extension of LMWfrag2, overlapping extension PCR reaction system is: 2 μ L dNTP (2.5mmol/L), 0.125 μ L Pyrobest polysaccharase, 2.5 μ L, 10 * Buffer, oligonucleotide fragment LMWfrag1 and LMWfrag2 each 5 μ L (5 μ mol/L), pure water 10.375 μ L, the total reaction system is 25 μ L.The PCR reaction conditions: 94 ℃, → 72 ℃ of pre-sex change 2min → [94 ℃, 30s → 60 ℃, 30s → 72 ℃, 50s] * 20 circulations, 5min → 4 ℃, 5min; And be template with this overlapping extension products, do the upstream and downstream primer with primer HMW1 and primer HMW6, the pcr amplification gene reclaims acquisition and contains secreting signal peptide, Kozak sequence, and the LMW-UK mutant gene of Nhe I (being positioned at upstream region of gene) and Xho I (being positioned at the gene downstream) restriction enzyme site.(4) the LMW-UK mutant gene (SEQ ID No.2) and the pIRES-dhfr carrier of the recovery of Nhe I and Xho I difference double digestion, and under the effect of T4 ligase enzyme, above-mentioned two segment DNAs are connected into the pIRES-dhfr/LMW-UK expression vector, transformed into escherichia coli, extraction plasmid Nhe I/Xho I enzyme are cut evaluation (Fig. 4 (a)), and are sent the order-checking of Bo Ya company.

Primer HMW1:

5’-TGCGCTAGCCCACCATGAGAGCCCTGCTG?GCGCGCCTGCTTCTCTGCGTCCTGG-3’

Primer SIG:5 '-GCCTTTGGAGTCGCTCACGACCAGGACGCAGAGAAGCA GG-3 '

Primer LMW1:5 '-TCGTGAGCGACTCCAAAGGCTTAAAATTTCAGTGTGGCCAAAAG-3 '

Primer HMW6:5 '-CTACTCGAGTCAGAGGGCCAGGCCATTCTCTTC-3 '

Two. the result:

The carrier pIRES-dhfr/LMW-UK of the expression LMW-UK mutant that we make up contains G418 (Neo ^rGene) and the dual selection markers of MTX (dhfr gene) (Fig. 2 (c)), the IRES of this carrier utilization reduction connects goal gene and screening/amplification label gene dhfr gene, make the shared promotor of two fragment genes, two fragment genes under promotor obtain translation simultaneously, and can be by improving the expression level of MTX concentration pressurization with the raising target protein.The vector construction process is seen Fig. 3, insert the LMW-UK mutant gene at the multiple clone site A of pIRES-dhfr carrier (MCS A), carrier is identified (Fig. 4 (a)) through Nhe I/XhoI double digestion, as seen size has obvious band for 900bp and 6700bp place, with the LMW-UK mutant gene with inserted pIRES-dhfr carrier big or small consistent of dhfr gene, show that goal gene LMW-UK has correctly inserted in the pIRES-dhfr carrier for expression of eukaryon respectively.

With the carrier that contains the natural pro-UK gene of coding people is template, zymoplasm restriction enzyme site and the glycosylation site among the pro-UK that utilized the PCR method rite-directed mutagenesis, be about to Arg156 (CGC) and sport Lys156 (AAG), Asn302 (AAT) → Ala302 (GCT), and the HMW-proUK mutant gene is cloned into the pIRES-dhfr expression vector connects into pIRES-dhfr/HMW-proUK (Fig. 2 (b)), transformed into escherichia coli, extracting the plasmid sequencing result proves, the sequence of HMW-proUK mutant gene and the gene of design are in full accord, and the pIRES-dhfr/HMW-proUK carrier that the pIRES-dhfr carrier is formed together with the HMW-pro-UK mutant gene is preserved (CGMCC No.1623) at China Committee for Culture Collection of Microorganisms common micro-organisms center.The aminoacid sequence of HMW-pro-UK mutant is shown in SEQ ID No.3, and its coding gene sequence has the nucleotide sequence shown in the sequence table SEQ ID No.4.

With pIRES-dhfr/HMW-proUK is template, utilize the gene (being the LMW-UK gene) of PCR method amplification coding pro-UK 144-411aa, and connecting the signal peptide of pro-UK at its upstream, Nhe I/Xho I double digestion LMW-UK mutant gene also connects into pIRES-dhfr/LMW-UK with the pIRES-dhfr expression vector.Order-checking shows: the LMW-UK gene in the insertion pIRES-dhfr carrier between the Nhe I/Xho I and (Fig. 4 (b)) in full accord of expection, this gene contains restriction enzyme site (italic), Kozak sequence (in the square frame), pro-UK signal peptide sequence (two line) and coding zymoplasm resistance, the LMW-UK mutant gene of sugar basedization, its prlmary structure of protein as shown in Figure 1,20 amino acid (aa) residue in the imaginary circle frame is a signal peptide, cut after translation, sophisticated LMW-UK mutant is made up of 268aa, wherein Arg13 sports Lys, eliminated the restriction enzyme site of zymoplasm, and Asn159 has been eliminated glycosylation site (dash area among Fig. 1) by the Ala replacement.The molecular weight of this LMW-UK mutant is about 31kD.

Embodiment 3. liposome transfections and cell cultures

One. method:

Adopt Lipofectamine ^TM2000 cationic-liposome transfection reagent boxes are operated according to the test kit specification sheets.The CHO-dhfr of transfection ^-Cell cultures is in 5%CO ₂, 37 ℃ of incubators.Behind the transfection 12h, change the DMEM/F12 substratum that contains 10% reinforced calf serum.Behind the 48h, adopt the DMEM screening culture medium pressurization screening contain 3% calf serum, 200nmol/L MTX (Sigma), every 2d changes liquid once, behind about 10d that pressurize, the concentration of MTX is increased to 1000nmol/L, and cultivation 7-10d continues to pressurize.Afterwards, continue to cultivate with the DMEM/F12 substratum (Hyclone) that contains 5% reinforced calf serum, wait to grow behind the cell clone of MTX resistance trysinization with 0.25%, in 96 hole micropore Tissue Culture Plates (NUNC company), carry out the mono-clonal cultivation with limiting dilution assay, cell clone occurs after 2 weeks.Get cells and supernatant with improved agarose-scleroproein-flat band method (Gao Lihua, in virtue, Xiao Chengzu. the improvement of uPA measuring method reaches expresses the observation of uPA horizontal stability to the GL-11G engineering cell. biotechnology, 1999,9 (4): 42) the UK activity in the mensuration supernatant, with the higher clone of screening expression level.

Selecting the highest gene recombination CHO engineering cell of expression level is that LMWUK-LB2 uses the DMEM/F12 culture medium culturing that contains 2% calf serum earlier in the 1000mL rolling bottle, culture temperature is 37 ℃, when treating that cell covers with bottle wall (about 3 days), be changed to serum free medium (Chinese patent CN200310124257.X), receive liquid every other day, (cultural method please refer to: Gao Lihua can to receive liquid continuously 3-4 time, Hu Xianwen, Chen Wei etc. anthrax toxin acceptor and human IgG1's the expression of Fc section fusion rotein in Chinese hamster ovary celI. the biotechnology journal, 2005,21 (5): 826), collect supernatant purifying target protein.

Two. the result:

Carrier for expression of eukaryon pIRES-dhfr/LMW-UK Lipofectamine ^TMBehind the 2000 cationic-liposome transfection CHO-dhfr-cells, with MTX pressurization screening, to not express or hang down the cell of expressing Tetrahydrofolate dehydrogenase and eliminate, the concentration of MTX is increased to 1000nmol/L gradually from 100nmol/L, after taking turns the MTX pressurization screening of about 20d through one, dispersive cell resistance clone occurs, resistance clone digestion and diluting cells are inoculated in the 96 hole micropore Tissue Culture Plates, carry out mono-clonal and cultivate.Cultivate the cell colony that the back appearance of 2 weeks is formed by a cell amplification, collect culture supernatant and measure UK activity (Fig. 5) with fibrinolytic plate method.Experimental result shows, IRES sequence with reduction is connected goal gene LMW-UK with screening marker gene dhfr, the two shared promotor, the whole positive clones of 24 strain monoclonal cells that screening obtains, and have the cell clone expression level about 50% more approaching approximately, at 500-3500IU/10 ⁶About cells/d, be about 160000IU/mg by the specific activity of LMW-UK and calculate the about 3-22 μ of the expression level of these cells g/10 ⁶Cells/d.Take turns the MTX pressurization through one and screen, just can obtain expression level greater than 20 μ g/10 ⁶Cells/d high expression level rCHO clone illustrates that this carrier has the characteristic of express recombinant protein matter preferably.

The purifying of embodiment 4. recombinant proteins

One. method:

The serum-free culture supernatant of rCHO clone LMWUK-LB2 is regulated pH to 5.8-6.0 with HCl, behind the membrane filtration of 0.45 μ m, with SP Sepharose Fast Flow cationic exchange column purification, level pad is pH6.0,0.01mol/L phosphoric acid buffer (PBS), elution buffer is pH=7.0,0.5mol/LNaCl, 0.01mol/L PBS, eluted protein is concentrated into 10ml through polyoxyethylene glycol (PEG), behind the membrane filtration of 0.45 μ m, last Sephacryl S-200 gel chromatography, last sample and elution buffer are pH=7.0,0.4mol/L NaCl, 0.05mol/L PBS, the purity of purified product determines that with SDS-PAGE running gel thin layer scanning Lowry ' s method is measured protein concentration.

Two. the result:

Fig. 6 (a) is the result with positively charged ion chromatography method purifying cells culture supernatant, and SDS-PAGE result shows, except that target protein, remains at more foreign protein.Fig. 6 (b) is the SDS-PAGE result behind second step of gel-filtration purifying, all foreign proteins all are removed, and electrophoresis result proves that through thin layer scanning the purity of sample can reach 99.10% (Fig. 6 (c)) behind the process two-step purifying, the about 31kD of its molecular weight, consistent with theoretical value.The LMW-UK mutant rate of recovery about 50% of two-step purifying.

The check of embodiment 5. biological activitys

One. method:

Adopt the ratio of gross activity and single double-stranded proenzyme thereof of lower molecular weight UK mutant in chromophoric substrate enzyme hydrolysis method (S-2444 method) quantitative analysis purifying protein and the culture supernatant, experimental technique document (the Hu Xianwen that sees reference, Gao Lihua, Li Shichong etc. the chromophoric substrate standard measure is measured the gross activity and the strand ratio of reorganization u-PA product. institute of Military Medical Science Institute periodical, 2003,27 (5): 349).

Two. the result:

Chromophoric substrate S-2444 (pGlu-Gly-Arg-pNA) (Sigma company product) is the specific substrate of UK, hydrolyzable generates p-Nitroaniline (pNA) and produces faint yellow under the UK katalysis, under the excessive situation of substrate, the activity of urokinase is directly proportional with the velocity of variation of the absorbancy OD value that records at the 405nm place in the finite concentration scope.Do not have an enzymatic activity and single chain urokinase type plasminogen activator is former, can not generate p-Nitroaniline by catalytic hydrolysis S-2444.Thermophilic bacteria metalloprotease (thermolysin, Sigma company product) can activate strand pro-UK and change double-stranded UK into, by relatively activate with non-activation condition under the albumen product water activity of separating S-2444, can measure strand ratio and gross activity among the u-PA.With the active typical curve of the mensuration UK of S-2444 method is (Fig. 7): y=0.0002539x+0.0005857, coefficient R ²=0.9967, in the formula: y=d (OD _405nm)/dt, the speed that promptly develops the color (Δ OD _405nm/ min), x is a UK concentration (IU/ml) in the sample.

Measured purity greater than the specific activity of 99% LMW-UK mutant and the ratio of strand proenzyme with the S-2444 method, and measured the expression level (table 1) of rCHO clone LMWUK-LB2, the result shows, protein concentration is that 1.021mg/ml (Lowry ' s method) LMW-proUK mutant is after thermolysin activates, its activity is 162200IU/ml, calculating its specific activity is 158864IU/mg, natural HMW-UK, its protein molecular weight is 46368.2, specific activity is 104000IU/ml, the LMW-UK mutein molecular weight that the present invention makes up is 30185.5, its specific activity is 159753IU/mg in theory, result and theoretical value that actual measurement obtains are suitable, show that the glycosylation site of the UK that suddenlys change does not influence its fibrinolytic substantially.It should be noted that, activity under non-activation of this mutant and the activation condition is very approaching, the ratio of strand proenzyme has only 1.8%, and the LMW-uPA that we obtain is most of to be activated enzyme, and this also is the reason that this LMW-uPA mutant of name is the LMW-UK mutant.

Because the gene of coding LMW-uPA mutant protein when translation should be the strand proenzyme, it is the not fracture of peptide bond between the Lys15-Ile16, but the albumen that purifying obtains shows, peptide bond between this mutant Lys15-Ile16 ruptures, change into the double-stranded UK of catalytic activity, for the reason of confirming the bond rupture of Lys15-Ile16 peptide causes owing to cell cultures still is that condition is improper in purge process, measured the strand ratio of LMW-uPA in the cells and supernatant, discharge of the influence of some endogenous protease for reduce necrocytosis as far as possible to product degradation, shorten the residence time of LMW-uPA in 37 ℃ of environment secrete to the supernatant with reduce its change into double-stranded may, keep the density of the LB2 cell cultivated in the square vase lower by (0.79 * 10 during mensuration ⁶Cells/ml) to keep cell viability, and in 1 day, take out culture supernatant, the result shows, the activity that LMW-uPA measures under activation and non-activation condition in the cells and supernatant is also very near (table 1), the pure product LMW-UK that obtains with purifying is the same, the ratio of strand proenzyme also has only about 1.8%, points out this mutant translation back in cell or be secreted into the Lys15-Ile16 peptide bond that ruptures soon outside the born of the same parents, is converted into the form (low molecular weight urokinase) of streptokinase-streptodornase.Infer that from the activity of LB2 clone culture supernatant the expression level of this clone is about 17.5 μ g/10 ⁶Cell/sky.

Table 1 S-2444 method is measured LMW-UK mutant biologic activity

Sequence table

＜110〉Academy of Military Medicine, PLA's dirt thing Graduate School of Engineering

＜120〉low molecular-weight urokinase mutant and expression vector thereof

<130>

<160>4

<170>PatentIn?version?3.3

<210>1

<211>288

<212>PRT

＜213〉Genus Homo, ethnic group

<220>

＜221〉signal peptide

<222>(1)..(20)

<400>1

Met?Arg?Ala?Leu?Leu?Ala?Arg?Leu?Leu?Leu?Cys?Val?Leu?Val?Val?Ser

1 5 10 15

Asp?Ser?Lys?Gly?Leu?Lys?Phe?Gln?Cys?Gly?Gln?Lys?Thr?Leu?Arg?Pro

20 25 30

Lys?Phe?Lys?Ile?Ile?Gly?Gly?Glu?Phe?Thr?Thr?Ile?Glu?Asn?Gln?Pro

35 40 45

Trp?Phe?Ala?Ala?Ile?Tyr?Arg?Arg?His?Arg?Gly?Gly?Ser?Val?Thr?Tyr

50 55 60

Val?Cys?Gly?Gly?Ser?Leu?Ile?Ser?Pro?Cys?Trp?Val?Ile?Ser?Ala?Thr

65 70 75 80

His?Cys?Phe?Ile?Asp?Tyr?Pro?Lys?Lys?Glu?Asp?Tyr?Ile?Val?Tyr?Leu

85 90 95

Gly?Arg?Ser?Arg?Leu?Asn?Ser?Asn?Thr?Gln?Gly?Glu?Met?Lys?Phe?Glu

100 105 110

Val?Glu?Asn?Leu?Ile?Leu?His?Lys?Asp?Tyr?Ser?Ala?Asp?Thr?Leu?Ala

115 120 125

His?His?Asn?Asp?Ile?Ala?Leu?Leu?Lys?Ile?Arg?Ser?Lys?Glu?Gly?Arg

130 135 140

Cys?Ala?Gln?Pro?Ser?Arg?Thr?Ile?Gln?Thr?Ile?Cys?Leu?Pro?Ser?Met

145 150 155 160

Tyr?Asn?Asp?Pro?Gln?Phe?Gly?Thr?Ser?Cys?Glu?Ile?Thr?Gly?Phe?Gly

165 170 175

Lys?Glu?Ala?Ser?Thr?Asp?Tyr?Leu?Tyr?Pro?Glu?Gln?Leu?Lys?Met?Thr

180 185 190

Val?Val?Lys?Leu?Ile?Ser?His?Arg?Glu?Cys?Gln?Gln?Pro?His?Tyr?Tyr

195 200 205

Gly?Ser?Glu?Val?Thr?Thr?Lys?Met?Leu?Cys?Ala?Ala?Asp?Pro?Gln?Trp

210 215 220

Lys?Thr?Asp?Ser?Cys?Gln?Gly?Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Ser

225 230 235 240

Leu?Gln?Gly?Arg?Met?Thr?Leu?Thr?Gly?Ile?Val?Ser?Trp?Gly?Arg?Gly

245 250 255

Cys?Ala?Leu?Lys?Asp?Lys?Pro?Gly?Val?Tyr?Thr?Arg?Val?Ser?His?Phe

260 265 270

Leu?Pro?Trp?Ile?Arg?Ser?His?Thr?Lys?Glu?Glu?Asn?Gly?Leu?Ala?Leu

275 280 285

<210>2

<211>867

<212>DNA

＜213〉Genus Homo, ethnic group

<220>

＜221〉signal coding sequence

<222>(1)..(60)

<400>2

atgagagccc?tgctggcgcg?cctgcttctc?tgcgtcctgg?tcgtgagcga?ctccaaaggc 60

ttaaaatttc?agtgtggcca?aaagactctg?aggcccaagt?ttaagattat?tgggggagaa 120

ttcaccacca?tcgagaacca?gccctggttt?gcggccatct?acaggaggca?ccgggggggc 180

tctgtcacct?acgtgtgtgg?aggcagcctc?atcagccctt?gctgggtgat?cagcgccaca 240

cactgcttca?ttgattaccc?aaagaaggag?gactacatcg?tctacctggg?tcgctcaagg 300

cttaactcca?acacgcaagg?ggagatgaag?tttgaggtgg?aaaacctcat?cctacacaag 360

gactacagcg?ctgacacgct?tgctcaccac?aacgacattg?ccttgctgaa?gatccgttcc 420

aaggagggca?ggtgtgcgca?gccatcccgg?actatacaga?ccatctgcct?gccctcgatg 480

tataacgatc?cccagtttgg?cacaagctgc?gagatcactg?gctttggaaa?agaggcttct 540

accgactatc?tctatccgga?gcagctgaaa?atgactgttg?tgaagctgat?ttcccaccgg 600

gagtgtcagc?agccccacta?ctacggctct?gaagtcacca?ccaaaatgct?gtgtgctgct 660

gacccacagt?ggaaaacaga?ttcctgccag?ggagactcag?ggggacccct?cgtctgttcc 720

ctccaaggcc?gcatgacttt?gactggaatt?gtgagctggg?gccgtggatg?tgccctgaag 780

gacaagccag?gcgtctacac?gagagtctca?cacttcttac?cctggatccg?cagtcacacc 840

aaggaagaga?atggcctggc?cctctga 867

<210>3

<211>431

<212>PRT

＜213〉Genus Homo, ethnic group

<220>

＜221〉signal peptide

<222>(1)..(20)

<400>3

Met?Arg?Ala?Leu?Leu?Ala?Arg?Leu?Leu?Leu?Cys?Val?Leu?Val?Val?Ser

1 5 10 15

Asp?Ser?Lys?Gly?Ser?Asn?Glu?Leu?His?Gln?Val?Pro?Ser?Asn?Cys?Asp

20 25 30

Cys?Leu?Asn?Gly?Gly?Thr?Cys?Val?Ser?Asn?Lys?Tyr?Phe?Ser?Asn?Ile

35 40 45

His?Trp?Cys?Asn?Cys?Pro?Lys?Lys?Phe?Gly?Gly?Gln?His?Cys?Glu?Ile

50 55 60

Asp?Lys?Ser?Lys?Thr?Cys?Tyr?Glu?Gly?Asn?Gly?His?Phe?Tyr?Arg?Gly

65 70 75 80

Lys?Ala?Ser?Thr?Asp?Thr?Met?Gly?Arg?Pro?Cys?Leu?Pro?Trp?Asn?Ser

85 90 95

Ala?Thr?Val?Leu?Gln?Gln?Thr?Tyr?His?Ala?His?Arg?Ser?Asp?Ala?Leu

100 105 110

Gln?Leu?Gly?Leu?Gly?Lys?His?Asn?Tyr?Cys?Arg?Asn?Pro?Asp?Asn?Arg

115 120 125

Arg?Arg?Pro?Trp?Cys?Tyr?Val?Gln?Val?Gly?Leu?Lys?Pro?Leu?Val?Gln

130 135 140

Glu?Cys?Met?Val?His?Asp?Cys?Ala?Asp?Gly?Lys?Lys?Pro?Ser?Ser?Pro

145 150 155 160

Pro?Glu?Glu?Leu?Lys?Phe?Gln?Cys?Gly?Gln?Lys?Thr?Leu?Arg?Pro?Lys

165 170 175

Phe?Lys?Ile?Ile?Gly?Gly?Glu?Phe?Thr?Thr?Ile?Glu?Asn?Gln?Pro?Trp

180 185 190

Phe?Ala?Ala?Ile?Tyr?Arg?Arg?His?Arg?Gly?Gly?Ser?Val?Thr?Tyr?Val

195 200 205

Cys?Gly?Gly?Ser?Leu?Ile?Ser?Pro?Cys?Trp?Val?Ile?Ser?Ala?Thr?His

210 215 220

Cys?Phe?Ile?Asp?Tyr?Pro?Lys?Lys?Glu?Asp?Tyr?Ile?Val?Tyr?Leu?Gly

225 230 235 240

Arg?Ser?Arg?Leu?Asn?Ser?Asn?Thr?Gln?Gly?Glu?Met?Lys?Phe?Glu?Val

245 250 255

Glu?Asn?Leu?Ile?Leu?His?Lys?Asp?Tyr?Ser?Ala?Asp?Thr?Leu?Ala?His

260 265 270

His?Asn?Asp?Ile?Ala?Leu?Leu?Lys?Ile?Arg?Ser?Lys?Glu?Gly?Arg?Cys

275 280 285

Ala?Gln?Pro?Ser?Arg?Thr?Ile?Gln?Thr?Ile?Cys?Leu?Pro?Ser?Met?Tyr

290 295 300

Asn?Asp?Pro?Gln?Phe?Gly?Thr?Ser?Cys?Glu?Ile?Thr?Gly?Phe?Gly?Lys

305 310 315 320

Glu?Ala?Ser?Thr?Asp?Tyr?Leu?Tyr?Pro?Glu?Gln?Leu?Lys?Met?Thr?Val

325 330 335

Val?Lys?Leu?Ile?Ser?His?Arg?Glu?Cys?Gln?Gln?Pro?His?Tyr?Tyr?Gly

340 345 350

Ser?Glu?Val?Thr?Thr?Lys?Met?Leu?Cys?Ala?Ala?Asp?Pro?Gln?Trp?Lys

355 360 365

Thr?Asp?Ser?Cys?Gln?Gly?Asp?Ser?Gly?Gly?Pro?Leu?Val?Cys?Ser?Leu

370 375 380

Gln?Gly?Arg?Met?Thr?Leu?Thr?Gly?Ile?Val?Ser?Trp?Gly?Arg?Gly?Cys

385 390 395 400

Ala?Leu?Lys?Asp?Lys?Pro?Gly?Val?Tyr?Thr?Arg?Val?Ser?His?Phe?Leu

405 410 415

Pro?Trp?Ile?Arg?Ser?His?Thr?Lys?Glu?Glu?Asn?Gly?Leu?Ala?Leu

420 425 430

<210>4

<211>1296

<212>DNA

＜213〉Genus Homo, ethnic group

<220>

＜221〉signal coding sequence

<222>(1)..(60)

<400>4

atgagagccc?tgctggcgcg?cctgcttctc?tgcgtcctgg?tcgtgagcga?ctccaaaggc 60

agcaatgaac?ttcatcaagt?tccatcgaac?tgtgactgtc?taaatggagg?aacatgtgtg 120

tccaacaagt?acttctccaa?cattcactgg?tgcaagtgcc?caaagaaatt?cggagggcag 180

cactgtgaaa?tagataagtc?aaaaacctgc?tatgagggga?atggtcactt?ttaccgagga 240

aaggccagca?ctgacaccat?gggccggccc?tgcctgccct?ggaactctgc?cactgtcctt 300

cagcaaacgt?accatgccca?cagatctgat?gctcttcagc?tgggcctggg?gaaacataat 360

tactgcagga?acccagacaa?ccggaggcga?ccctggtgct?atgtgcaggt?gggcctaaag 420

ccgcttgtcc?aagagtgcat?ggtgcatgac?tgcgcagatg?gaaaaaagcc?ctcctctcct 480

ccagaagaat?taaaatttca?gtgtggccaa?aagactctga?ggcccaagtt?taagattatt 540

gggggagaat?tcaccaccat?cgagaaccag?ccctggtttg?cggccatcta?caggaggcac 600

cgggggggct?ctgtcaccta?cgtgtgtgga?ggcagcctca?tcagcccttg?ctgggtgatc 660

agcgccacac?actgcttcat?tgattaccca?aagaaggagg?actacatcgt?ctacctgggt 720

cgctcaaggc?ttaactccaa?cacgcaaggg?gagatgaagt?ttgaggtgga?aaacctcatc 780

ctacacaagg?actacagcgc?tgacacgctt?gctcaccaca?acgacattgc?cttgctgaag 840

atccgttcca?aggagggcag?gtgtgcgcag?ccatcccgga?ctatacagac?catctgcctg 900

ccctcgatgt?ataacgatcc?ccagtttggc?acaagctgcg?agatcactgg?ctttggaaaa 960

gaggcttcta?ccgactatct?ctatccggag?cagctgaaaa?tgactgttgt?gaagctgatt?1020

tcccaccggg?agtgtcagca?gccccactac?tacggctctg?aagtcaccac?caaaatgctg?1080

tgtgctgctg?acccacagtg?gaaaacagat?tcctgccagg?gagactcagg?gggacccctc?1140

gtctgttccc?tccaaggccg?catgactttg?actggaattg?tgagctgggg?ccgtggatgt 1200

gccctgaagg?acaagccagg?cgtctacacg?agagtctcac?acttcttacc?ctggatccgc 1260

agtcacacca?aggaagagaa?tggcctggcc?ctctga 1296

Claims (3)

1. low molecular-weight urokinase mutant is the aminoacid sequence shown in the sequence table SEQ ID No.1.

2. the gene of the low molecular-weight urokinase mutant of aminoacid sequence shown in the code sequence tabulation SEQ ID No.1.

3. the gene of the low molecular-weight urokinase mutant of aminoacid sequence is the nucleotide sequence shown in the sequence table SEQ ID No.2 shown in the code sequence tabulation SEQ ID No.1 according to claim 2.

Images