CN100436482C - Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods - Google Patents

Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods Download PDF

Info

Publication number
CN100436482C
CN100436482C CNB2006100722291A CN200610072229A CN100436482C CN 100436482 C CN100436482 C CN 100436482C CN B2006100722291 A CNB2006100722291 A CN B2006100722291A CN 200610072229 A CN200610072229 A CN 200610072229A CN 100436482 C CN100436482 C CN 100436482C
Authority
CN
China
Prior art keywords
fusion rotein
fusion protein
leu
val
epo
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Active
Application number
CNB2006100722291A
Other languages
Chinese (zh)
Other versions
CN1872881A (en
Inventor
刘劲玮
韩为跃
何凯
刘德林
杨立明
阳勇
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Guangzhou Taili Biomedical Technology Co., Ltd.
Original Assignee
DONGGUAN TAILI BIOTECH Co Ltd
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by DONGGUAN TAILI BIOTECH Co Ltd filed Critical DONGGUAN TAILI BIOTECH Co Ltd
Priority to CNB2006100722291A priority Critical patent/CN100436482C/en
Publication of CN1872881A publication Critical patent/CN1872881A/en
Priority to PCT/CN2007/001209 priority patent/WO2007118423A1/en
Priority to HK07105675.4A priority patent/HK1098165A1/en
Application granted granted Critical
Publication of CN100436482C publication Critical patent/CN100436482C/en
Active legal-status Critical Current
Anticipated expiration legal-status Critical

Links

Images

Classifications

    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K14/00—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof
    • C07K14/435—Peptides having more than 20 amino acids; Gastrins; Somatostatins; Melanotropins; Derivatives thereof from animals; from humans
    • C07K14/475—Growth factors; Growth regulators
    • C07K14/505—Erythropoietin [EPO]
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
    • A61P7/00—Drugs for disorders of the blood or the extracellular fluid
    • A61P7/06—Antianaemics
    • A—HUMAN NECESSITIES
    • A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
    • A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
    • A61K38/00—Medicinal preparations containing peptides
    • C—CHEMISTRY; METALLURGY
    • C07—ORGANIC CHEMISTRY
    • C07K—PEPTIDES
    • C07K2319/00—Fusion polypeptide
    • C07K2319/31—Fusion polypeptide fusions, other than Fc, for prolonged plasma life, e.g. albumin

Abstract

The present invention discloses recombinant human erythropoietin (rhEPO)-Fc fusion protein produced by using a genetic engineering method, polyribonucleotide for encoding the fusion protein and a method for preparing and purifying the fusion protein, wherein the fusion protein is composed of human erythropoietin and the Fc fragment of human IgG2. The fusion protein can be effectively expressed in mammalian cells. The fusion protein has a simple purification process and is favorable for further large-scale preparation. Compared with natural EPO, the rhEPO-Fc fusion protein obtained by the present invention has the characteristic of long serum half life. Meanwhile, the bioactivity of the fusion protein, which is similar to the natural EPO, is still kept on the basis of the same molecule number. The fusion protein can be used for treating anemia caused by various reasons, such as anemia caused by chronic renal failure, induction anemia after the AZT treatment of AIDS patients, anemia caused by tumor, anemia caused by tumor chemotherapy, prematurity anemia, anemia caused by rheumatoid arthritis, etc.

Description

Long effective amalgamation protein of erythropoietin of human and preparation thereof and purification process
Technical field
The present invention relates to field of biological pharmacy, be specifically related to a kind of exsanguine recombinant human erythropoietin (rhEPO) fusion rotein rhEPO-Fc that is used for the treatment of, the method for preparation and this fusion rotein of purifying, and the purposes of this fusion rotein in medicine.
Background technology
Erythropoietin (EPO) is the main regulatory factors that the regulation and control HRBC forms.EPO is a kind of glycoprotein, is produced by kidney and liver in the fetus body, and is mainly produced by kidney in becoming human body.Renal function suffers damage, and as in the patient of chronic renal failure, the generation of erythropoietin is hindered, and can cause the generation of anaemia.The content of erythropoietin is 10～18 milliunit/milliliters in normal human's inner blood.When in the body during anoxic, the content of erythropoietin can be brought up to more than 1000 times.Specific site on erythropoietin and target cell such as medullary cell, splenocyte, the fetal liver cells combines, thereby promotes that propagation, differentiation and maturation of red corpuscle precursor cell are red corpuscle, increase marrow erythrocytic burst size in circulation blood.This shows that erythropoietin is a kind of important hemopoieticgrowth factor, and erythrocytic generation in the body is played indispensable regulating and controlling effect.
Epo is a single chain polypeptide, comprises 166 amino acid, contains two couples of disulfide linkage (Cys 7-161And Cys 29-33) and four potential glycosylation sites, three N-connection site (Asn are wherein arranged 24, Asn 38, Asn 83) and an O-connection site (Ser 126).The molecular weight of Epo is 30-34kDa, and wherein polypeptide only is 18kDa.The main sugar chain structure of 40% glycosylated Epo is the compound polysaccharide that N-connects, and plays a significant role in the biologic activity of Epo.
Ca in the tenuigenin before this after target cell is stimulated by EPO 2+Gathering.The FVA cell is subjected to high density EPO stimulation after 1 minute at 4 ℃, and Ca is promptly arranged in its tenuigenin 2+Assemble.Single red be that precursor cell is subjected to EPO to stimulate Ca in the tenuigenin of back 2+Concentration raises, and this is because the interior Ca of cell 2+Redistribution, rather than because extracellular Ca 2+Entered cell.Another effect that EPO acts on behind the target cell is to make the synthetic increase of DNA in the cell.As do not have the EPO existence, even increase Ca in the tenuigenin 2+Concentration, can not make red is that precursor cell breaks up to erythroid cells, and Ca is described 2+In the propagation of erythroid cells and differentiation, help out probably.
In addition, behind the anoxic injected in mice EPO 0.5-2.0 hour, erythroid hematopoiesis precursor cell rna plymerase ii increased activity in its spleen, rna plymerase i increased activity after 3 one 12 hours, nonhistones synthetic enhancing.RNA enzyme II activity strengthens once more after 12-14 hour, and the archaeal dna polymerase alpha active strengthens simultaneously, and histone is synthetic to be increased.After 48 hours, the DNA resultant quantity reaches maximum value.
The synthetic influence that also is subjected to EPO of oxyphorase, marrow are suppressed and the rat bone marrow cell that stimulates added in vitro culture behind the EPO 2 hours, and difference promptly appears in its sphaeroprotein mRNA level.The FAV cell had beta Globulin mRNA to generate after EPO stimulates in 6 hours external, and the CFU-E of purifying had sphaeroprotein mRNA to transcribe less than 1 hour after the EPO effect.Above result shows that transcribing of globulin gene may be the earliest effect of EPO to hematopoietic cell.
The rat of hypercythemia, the marrow erythropoiesis is subjected to severe inhibition.This cell has the enzyme of the synthetic hemoglobin of capacity, but can not synthetic hemoglobin.After EPO stimulates, there is porphobilinogen deaminase to occur, is used for protoheme synthetic enzyme and do not change.Synthesizing at EPO of this rate-limiting enzyme stimulates the back to occur in 20～24 hours.
In addition, FAV cell after EPO stimulates 6 hours, Transferrins,iron complexes binding site begin to increase, and increase by 1 times after 24 hours.Myelosuppressive rat bone marrow cell vitro culture shows that EPO can promote medullary cell to express some erythrocyte membrane compositions and some compositions of expressing in the erythroid cells atomization with crossing property, illustrates that EPO has many-sided effect to hematopoietic cell.
At present, EPO has been widely used in the anaemia that the treatment chronic kidney hypofunction causes.In addition, EPO has obvious effect to inductive anemia state after improving AZT treatment patient AIDS.EPO also is used for the treatment of the anaemia that anaemia, treatment anemia of prematurity, treatment rheumatoid arthritis that anaemia that tumour causes and chemotherapy of tumors cause cause.Giving EPO before operation can increase the amount that patient's autoblood feeds back, and it is compensatory faster to stimulate medullary cell that losing blood in the operation obtained at perioperatively application EPO.
The IgG immunoglobulin like protein is an albumen the abundantest in the blood of human body, and its transformation period can reach 21 days.Existing report shows the Fc fragment of IgG and the fusion of other albumen, can significantly increase this albumen biological activity and transformation period in vivo.This method has been applied to some very important cytokine and soluble receptorss clinically, and has obtained success, as sTNF-α R, LFA3, IL-2, INF-α or the like.
The EPO transformation period in vivo only is 4 to 11.2 hours, just need accept 2～3 times injection in a week to patient.Applicant of the present invention selects the most weak human IgG2's of lytic activity Fc fragment to be connected to the C-end of Epo, make up the rhEpo-Fc fusion rotein, improved the EPO transformation period in vivo greatly, on same molecular base plinth, keep the biologic activity similar simultaneously to natural Epo, and realized fusion rotein efficiently expressing in mammalian cell CHO, and purifying process is simple, is beneficial to further mass preparation.
Summary of the invention
One aspect of the present invention provides a kind of exsanguine recombinant human erythropoietin (rhEPO) fusion rotein rhEPO-Fc that is used for the treatment of, this polypeptide is the polypeptide that comprises aminoacid sequence shown in the SEQ ID NO:6, or its fragment, homologue, analogue or derivative.In an embodiment preferred, rhEPO-Fc is made of aminoacid sequence shown in the SEQ ID NO:6.
Another aspect of the present invention provides the polynucleotide molecule of a kind of recombinant human erythropoietin fusion rotein rhEPO-Fc that encodes, it is characterized in that it is with the protein of SEQ ID NO:6 coding same acid sequence but because of the degeneracy of genetic code different nucleotide sequence on sequence.
Preferably, polynucleotide molecule of the present invention comprises the nucleotide sequence shown in the SEQ ID NO:5; More preferably, polynucleotide molecule of the present invention is the nucleotide sequence shown in the SEQ ID NO:5.
The present invention further provides the recombinant expression vector that contains code book invention polynucleotide, by this recombinant expression vector transformed host cells, and by new strain system or the clone of this host cell institute deutero-.In a preferred embodiment, the invention provides a kind of recombinant eukaryon expression vector pEPO-Fc that comprises polynucleotide molecule of the present invention, and the genetically engineered host cell pEPO-Fc/CHO that contains this recombinant expression vector.
The present invention further provides the method for preparing the rhEPO-Fc fusion rotein, it is included under the condition that is suitable for this fusion rotein to cultivate use the recombinant expression vector transformed host cells, and from cell culture the step of recovery and this recombination fusion protein of purifying.In a preferred embodiment, host cell through cell cultures, centrifugal after, supernatant liquor is used affinity chromatography and sieve chromatography purifying respectively.In a preferred embodiment, affinity chromatography is the affine layer of a rProtein ASepharose FF post, and molecular sieve is Superdex 200 prep grade posts.
The present invention further provides and contain the pharmaceutical composition of rhEPO-Fc fusion rotein of the present invention as activeconstituents and pharmaceutically acceptable carrier, and this pharmaceutical composition is in the purposes of treatment in the exsanguine medicine, comprises the anaemia that inductive anaemia behind anaemia that chronic kidney hypofunction causes, AZT treatment patient AIDS, anaemia that tumour causes, the reasons such as anaemia, anemia of prematurity and rheumatoid arthritis that chemotherapy of tumors causes cause.
" homology " polypeptide of the rhEPO-Fc fusion rotein of mentioning herein is meant, polypeptide had the aminoacid sequence of rhEPO-Fc fusion rotein originally, but wherein one or more amino-acid residues are conservatively replaced by different amino-acid residues, and resulting polypeptide can be used for implementing the present invention.It is known in the art that conserved amino acid replaces.Cause the rule of such replacement to comprise, M.D. described replacement rules such as (1978, national biomedical research fund, Washington, D.C., the 5th volume, supplementary issue 3) by Dayhof.More particularly, the conserved amino acid replacement occurs in the amino acid family that is associated with its acidity, polarity or side chain size.Generally the amino acid of genetic coding can be divided into four groups: (1) acidic amino acid: aspartic acid, L-glutamic acid; (2) basic aminoacids: Methionin, arginine, Histidine; (3) nonpolar amino acid: L-Ala, Xie Ansuan, leucine, Isoleucine, proline(Pro), phenylalanine, methionine(Met), tryptophane; (4) uncharged polare Aminosaeren: glycine, l-asparagine, glutamine, halfcystine, Serine, Threonine, tyrosine.Phenylalanine, tryptophane and tyrosine also common category are aromatic amino acid.One or more replacements in any particular group, for example replace leucine or replace aspartic acid or replace Threonine with Serine with L-glutamic acid with Isoleucine or Xie Ansuan, or the amino-acid residue of being correlated with on any other amino-acid residue structure, similar acidity, polarity, side chain size are for example arranged, or have the amino-acid residue of similarity to replace in its some combined aspects, generally function or the immunogenicity to polypeptide do not have too big influence.
In the present invention, " analogue of aminoacid sequence shown in the SEQ ID NO:6 " is defined as, and compares with SEQ ID NO:6, has one or several aminoacid replacement, deletion, conversion or the molecule that increases." derivative of aminoacid sequence shown in the SEQ ID NO:6 " is defined as following a kind of molecule, it has SEQ ID NO:6 or SEQ ID NO:6 analogue aminoacid sequence, but one or several amino acid side chain group that also has chemically modified in addition, alpha-carbon atom, terminal amino group, perhaps terminal carboxylic acid group.Chemically modified comprises increases the part chemical structure, generates new key and removes the part chemical structure.The modification of amino acid side chain group is comprised the acylations of Methionin epsilon-amino, arginine, the N-alkylation of Histidine or Methionin, L-glutamic acid or aspartic acid carboxylic acid group's alkylation, and the deamidizate of glutamine or l-asparagine.The modification of terminal amino group comprises deaminizating, and the N-low alkyl group is modified, and N-two low alkyl groups are modified and the N-acyl group is modified.Modification to terminal carboxyl(group) comprises the acid amides modification, and the low alkyl group acid amides is modified, and dialkyl amide is modified and lower alkyl esters is modified.Low alkyl group is C 1-C 4Alkyl.And the protecting group that can also know with the those of ordinary skill of protein chemistry is protected one or several side-chain radical or end group.Can also make amino acid whose alpha-carbon atom monomethylation or dimethylization.
Term used herein " polynucleotide molecule " is meant strand or double-stranded DNA and RNA molecule, can comprise one or more protokaryon sequences, the cDNA sequence comprises the genomic dna sequence of exon and intron, the DNA of chemosynthesis and RNA sequence, and justice and corresponding antisense strand are arranged.
The method of producing and operating polynucleotide molecule disclosed herein is well known by persons skilled in the art, and can finish according to the recombinant technology of having described (referring to Maniatis etc., 1989, The molecular cloning laboratory manual, press of cold spring harbor laboratory, cold spring port, New York; Ausubel etc., 1989, The molecular biology current techniques, Greene PublishingAssociates ﹠amp; Wiley Interscience, NY; Sambrook etc., 1989, The molecular cloning laboratory manual, the 2nd edition, press of cold spring harbor laboratory, cold spring port, New York; Innis etc. (volume), 1995, The PCR strategy, AcademicPress, Inc., San Diego; And Erlich (volume), 1992, round pcr, Oxford University Press, New York).
The invention provides a kind of polynucleotide molecule that comprises coding rhEPO-Fc fusion rotein, in further preferred embodiment, the polynucleotide molecule of coding rhEPO-Fc fusion rotein of the present invention comprises the nucleotide sequence that is selected from the following member: (1) comprises the nucleotide sequence of SEQ ID NO:5; (2) at least 70% identical with nucleotide sequence shown in the SEQ ID NO:5, preferred at least 80% identical, more preferably at least 90% identical, at least 95% identical nucleotide sequence most preferably; (3) under medium rigorous hybridization conditions (promptly at 0.5M NaHPO 4, in 7% sodium lauryl sulphate (SDS), 1mM EDTA in 65 ℃ with the DNA hybridization that is incorporated into filter membrane, and in 0.2xSSC/0.1%SDS in the condition of 42 ℃ of washings; Referring to (volumes) such as Ausubel, 1989, The molecular biology current techniques, the 1st volume, Green Publishing Associntes, Inc., and John Wiley ﹠amp; Sons, Inc., NY, P.2.10.3), the rigorous hybridization conditions of preferred heights is (promptly at 0.5M NaHPO 4, among 7%SDS, the 1mM EDTA in 65 ℃ with the DNA hybridization that is incorporated into filter membrane, and in 0.1x SSC/0.1%SDS in 68 ℃ of wash conditions; Consult Ausubel etc., 1989, above-mentioned document) the following nucleotide sequence that can hybridize with polynucleotide molecule with SEQ ID NO:5 or its complementary sequence; The perhaps protein of (4) and SEQ ID NO:6 coding same acid sequence but because of the degeneracy of genetic code different nucleotide sequence on sequence.
The various expression vectors that can be used for expressing rhEPO-Fc fusion rotein sequence of the present invention are known in the art, comprising the recombinant phage dna that contains the specific coding sequence, plasmid DNA and cosmid DNA expression vector.The typical prokaryotic expression carrier plasmid that can contain polynucleotide molecule of the present invention through processing comprises pUC8, pUC9, pBR322 and pBR329 (Biorad Laboratories, Richmond, CA), pPL and pKK223 (Pharmacia, Piscataway, NJ), pQE50 (Qiagen, Chatsworth, CA) and pGEM-T EASY (Promega, Madison, WI) etc.The typical carrier for expression of eukaryon that can contain polynucleotide molecule of the present invention through processing comprises moulting hormone induction type mammalian expression system (Invitrogen, Carlsbad, CA), based on system (Promega, Madison, the WI of cytomegalovirus promoter-enhanser; Stratagene, La Jolla, CA; Invitrogen) with based on expression system (Promega) of baculovirus etc.
Can be used for implementing host cell of the present invention can be eucaryon or prokaryotic cell prokaryocyte.Such host cell comprises but is not only limited to microorganism, for example use the bacterium of recombinant phage dna, plasmid DNA or the conversion of cosmid DNA carrier, the perhaps yeast that transforms with recombinant vectors, or zooblast, as insect cell with recombinant viral vector such as baculovirus infection, or with the mammalian cell of recombinant viral vector such as adenovirus or vaccinia virus infection etc.For example, can use coli strain, as DH5 α bacterial strain.Eukaryotic host cell comprises yeast cell, but also can effectively utilize mouse, mammalian cell such as hamster, ox, monkey or human cell line.The eukaryotic host cell that can be used for expressing recombinant protein of the present invention comprises Chinese hamster ovary (CHO) cell, NIH/3T3 etc.
The pharmaceutical composition that contains polypeptide of the present invention can be used for multiple therapeutic purpose, pharmaceutical composition of the present invention not only is used for the treatment of the anaemia that chronic kidney hypofunction causes, can also be used for the treatment of the anaemia that anaemia, anemia of prematurity, rheumatoid arthritis that anaemia that inductive anaemia behind AZT treatment patient AIDS, tumour cause and chemotherapy of tumors cause cause and increase the amount that patient's autoblood feeds back before operation, it is compensatory faster at perioperatively application of stimulus medullary cell losing blood in the operation to be obtained.
It will be understood by those skilled in the art that pharmaceutical composition of the present invention is applicable to various administering modes, for example oral administration, percutaneous dosing, intravenous administration, intramuscular administration, topical, nose administration etc.According to the administering mode that is adopted, polypeptide drug composition of the present invention can be made various suitable formulations, wherein comprise the polypeptide of the present invention and at least a pharmaceutically acceptable pharmaceutical carrier of at least a effective dose.
The example of appropriate dosage forms is a tablet, capsule, and sugar coated tablet, granula, oral liquid and syrup, the ointment and the medicine that are used for skin surface paste, aerosol glue, nasal spray, and the sterile solution that can be used for injecting etc.
The pharmaceutical composition that contains polypeptide of the present invention can be made solution or lyophilized powder to be used for parenteral admin.Can add appropriate solvent before use or other pharmaceutically useful carrier is prepared powder again.Liquid formulations generally is damping fluid, isotonic solution and the aqueous solution.
Also can contain other conventional component in the formulation, as the salt of sanitas, stablizer, tensio-active agent, damping fluid, adjusting osmotic pressure, emulsifying agent, sweetener, tinting material, seasonings or the like.The stablizer optimization citric acid sodium that uses in the pharmaceutical composition of the present invention, glycine, N.F,USP MANNITOL, ganglioside etc.The injection liquid drugs injection or the preferred prescription of freeze-dried powder that contain pharmaceutical composition of the present invention comprise, rhEPO-Fc 25-500 μ g, NaCl 4mg, phosphoric acid salt 3.02mg, glycine 5.0-20mg or N.F,USP MANNITOL 10-30mg, water for injection 0.5ml.
If the special treatment requirement is arranged, pharmaceutical composition of the present invention also can comprise other active pharmaceutical components, and this use together helps treatment.
In the pharmaceutical composition of the present invention the consumption of polypeptide can one in a big way in the change, those skilled in the art can be according to some known factors, such as being determined easily according to factors such as the kind of disease, the degree that is in a bad way, patient body weight, formulation, route of administration.
Advantage of the present invention:
1. when molecule number is identical, compare, have similar biological activity with natural EPO.
2. demonstrate the transformation period of significant prolongation in for test at the medicine of animal.
3. the Fc fragment of selecting IgG2 is avoided the generation of side effect as merging fragment.
4. expression amount height, good stability is easy to amplify and produces, and is with low cost.
After 103 generations of engineering cell continuous passage of the present invention, still can express the rhEPO-Fc fusion rotein by stably excreting.Cultivate by rolling the flask culture mode, with the expression amount in the ELISA method detection culture supernatant, add up data inferior surplus in the of 30, expression amount is all at 40～65mg/L/3d.The scale of each cell cultures is all about 30～40L.Roll characteristics of flask culture mode, be convenient to exactly under certain scale, amplify and produce, can be amplified to 350～400L easily usually.Aspect purifying, because fusion rotein content height in cells and supernatant, and the rProteinA Sepharose FF affinity chromatography step in the purifying process has very high purification efficiency, and every milliliter of gel can be easier to amplify and produce in conjunction with the fusion rotein about 50mg.The clinical using dosage of EPO-Fc fusion rotein is very little, is Gamma Magnitude dosage.Estimate that each dosage is less than 100 μ g.Therefore, its production cost is more cheap.
Brief Description Of Drawings
Fig. 1. show the building process of recombinant plasmid pEPO-Fc.
Fig. 2. show RT-PCR result's (1%Agarose electrophoresis) of Epo, wherein swimming lane M is dna molecular amount standard (Roche DNA M.W.Marker VIII), the negative contrast of swimming lane C, swimming lane 1 and 2 is the RT-PCR product.
Fig. 3. show RT-PCR result's (1%Agarose electrophoresis) of IgG2 Fc, wherein swimming lane M is dna molecular amount standard (Roche DNA M.W.Marker VIII), and swimming lane 1 and 2 is the RT-PCR product.
Fig. 4. the enzyme that shows recombinant plasmid pUC18-Epo is cut qualification result (1%Agarose electrophoresis), and wherein swimming lane M is a molecular weight standard, and 3,4,6 and 9 represent the clone respectively 3,4,6 and No. 9.
Fig. 5. the enzyme that shows recombinant plasmid pUC18-Epo-Fc is cut qualification result (1%Agarose electrophoresis), and wherein swimming lane M is a molecular weight standard, and 1,5,6,7,8,9 and 12 represent the clone respectively 1,5,6,7,8,9 and No. 12.
Fig. 6. the enzyme that shows recombinant plasmid pEpo-Fc is cut qualification result (1%Agarose electrophoresis).
Fig. 7. show the pcr amplification result (1%Agarose electrophoresis) of different cloned genes group DNA, the wherein positive contrast of swimming lane C1 (is template with pEpo-Fc), swimming lane 1 is the B4-3 clone, swimming lane 2 is the A1-6 clone, swimming lane 3 is the C1-5 clone, and swimming lane 4 is A6-5 clone, the negative contrast of swimming lane C2.
Fig. 8. show the RT-PCR amplification (1%Agarose electrophoresis) of total RNA of different clones, wherein swimming lane M is dna molecular amount standard (1kb DNA ladder), the negative contrast of swimming lane C1, the positive contrast of swimming lane C2 (is template with pEpo-Fc), swimming lane 1 is the B4-3 clone, swimming lane 2 is the A1-6 clone, and swimming lane 3 is the C1-5 clone.
Fig. 9. proteic electrophoretogram (12%SDS-PAGE) behind the demonstration purifying, wherein swimming lane M is protein molecular weight standard (Promega), swimming lane S is the sample behind the purifying.
Figure 10. show rhEPO-Fc and natural rhEPO median effective dose relatively (cell relies on the strain detection method).
Embodiment
The acquisition of embodiment one Epo goal gene and human IgG2 Fc fragment gene
We adopt the cDNA fragment of RT-PCR method amplification Epo from total RNA that normal human blood extracts.Primer according to the design of Epo gene order is:
5 ' primer: 5 ' CTC CAA GCT TGC TAG CAT GGG GGT GCA CGA ATG TCC TG 3 ' (SEQID NO:7)
3 ' primer: 5 ' GC G GAT CCT CTG TCC CCT GTC CTG CAG GCC TC 3 ' (SEQ ID NO:8)
For the PCR product directly being inserted cloning vector, we have introduced Hind III and NheI restriction enzyme site in 5 ' primer, have introduced BamH I restriction enzyme site in 3 ' primer.
The RT-PCR reaction conditions is as follows:
The RT-PCR reaction mixture, reacts by following condition after 30 minutes 50 ℃ of sex change:
Reverse transcription reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 55 ℃; 68 ℃ were extended 45 seconds, and reacted 10 circulations.
PCR reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 60 ℃; 68 ℃ were extended 45 seconds, and reacted 25 circulations.68 ℃ were extended 12 minutes more then.
After reaction was finished, 1% agarose gel electrophoresis detected the RT-PCR product.As shown in Figure 2, we have obtained estimating the dna fragmentation (about 590bp) of size.Through order-checking, the segmental nucleotides sequence of Epo cDNA of amplification is classified SEQ IDNO:1 as, and its aminoacid sequence is SEQ ID NO:2.
Simultaneously, we design following primer amplification IgG2 Fc segment cDNA:
5 ' primer: 5 ' CG G GAT CCG AGC GCA AAT GTT GTG TCG AGT GC 3 ' (SEQ ID NO:9)
3 ' primer: 5 ' GGA ATT CAT TTA CCC GGA GAC AGG GAG AGG, 3 ' (SEQ ID NO:10)
For the PCR product being inserted cloning vector, we have introduced BamH I site in 5 ' primer, introduced EcoR I site in 3 ' primer.
With the total RNA of normal people's lymphocyte is template, RT-PCR amplification IgG2 Fc fragment, and reaction conditions is as follows:
The RT-PCR reaction mixture, reacts by following condition after 30 minutes 50 ℃ of sex change:
Reverse transcription reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 55 ℃; 68 ℃ were extended 1 minute, and reacted 10 circulations.
PCR reaction: 94 ℃ of sex change 30 seconds; Annealed 30 seconds for 60 ℃; 68 ℃ were extended 1 minute, and reacted 25 circulations.68 ℃ were extended 12 minutes more then.
After reaction was finished, 1% agarose gel electrophoresis detected the RT-PCR product.As shown in Figure 3, we have obtained estimating the dna fragmentation (about 700bp) of size.Through order-checking, the segmental nucleotides sequence of IgG2 Fc cDNA of amplification is classified SEQ ID NO:3 as, and its aminoacid sequence is SEQ ID NO:4.
Embodiment two construction of recombinant plasmid
As mentioned above, we have introduced Hind III restriction enzyme site at the 5 ' primer of the Epo cDNA that is used for increasing, in 3 ' primer, introduced BamH I restriction enzyme site, the cDNA fragment of Epo directly can be inserted among the multiple clone site Hind III/BamH I of cloning vector pUC18 like this, IgG2 Fc fragment is inserted among the multiple clone site BamH I/EcoRI of pUC18, can obtain Epo-Fc and merge fragment.After order-checking is identified, return with Nhe I and EcoR I again and cut among the multiple clone site Nhe I/EcoR I that inserts expression vector pcDNA3.1, can obtain eukaryon expression plasmid pEpo-Fc.Its building process sees Fig. 1 for details.
1. the structure of recombinant plasmid pUC18-Epo
The Epo cDNA fragment that will increase in embodiment 1 is inserted the Hind III/BamH I site of pUC18 (commercially available), will connect product pUC18-Epo transformed into escherichia coli JM109, and random choose 12 clones screen.The enzyme of recombinant plasmid pUC18-Epo is cut qualification result and is seen Fig. 4.3,4, No. 6 clones all return with BamH I/Hind III and cut out the purpose fragment, select to clone the evaluation of checking order No. 3, and are used for next step structure.
2. the structure of recombinant plasmid pUC18-Epo-Fc
Based on No. 3 clones of pUC18-Epo, the IgG2 Fc cDNA fragment that will increase in embodiment 1 is inserted BamH I/EcoR I site.To connect product pUC18-Epo-Fc transformed into escherichia coli JM109, random choose 12 clones screen.The enzyme of recombinant plasmid pUC18-Epo-Fc is cut qualification result and is seen Fig. 5.1, No. 5 clones all return with BamHI/EcoR I and cut out the purpose fragment, select No. 1 clone to send to order-checking and identify.
3. the sequencing of insertion gene fragment---Epo and IgG2Fc
No. 1 clone of selection recombinant plasmid pUC18-Epo-Fc checks order with 377 full-automatic sequenators of PE company, and through order-checking, the segmental nucleotides sequence of fusion rotein Epo-Fc of insertion is classified SEQ ID NO:5 as, and its aminoacid sequence is SEQ ID NO:6.Sequencing result shows that the goal gene in our the resulting recombinant plasmid is consistent with Epo gene of delivering and IgG2 Fc gene order.
4. the structure of carrier for expression of eukaryon pEpo-Fc
No. 1 clone from pUC18-Epo-Fc scales off with Epo-IgG2 Fc fragment, is inserted into the Nhe I/EcoR I site of pcDNA3.1 (commercially available), obtains recombinant plasmid pEpo-Fc.With pEpo-Fc transformed into escherichia coli JM109, random choose 12 clones screen.The enzyme of recombinant plasmid pEpo-Fc is cut qualification result and is seen Fig. 6.2,3,4,5,9,10, No. 12 clones all return with Nhe I/EcoR I and cut out the purpose fragment, select the screening of cloning the CHO stably express strain of carrying out next step for No. 10.
Embodiment three CHO stable statement strains (CHO-EF cell) screening and evaluation
Get the pEpo-Fc plasmid among a large amount of embodiment 2 that prepare of 10 μ g, utilize liposome Lipofectin transfection CHO cell.Go down to posterity in 1: 5 ratio two days later, add the G418 screening of 0.4mg/ml, visible clone formed in 10 days.Digest the mono-clonal that 144 edges obviously separate, cell state is good at random and be inoculated in 6 24 orifice plates cultivations (first round screening).
The culture supernatant of getting after three days detects the Expression of Fusion Protein situation with ELISA, therefrom select 39 clones of expression male and be inoculated in 2 24 orifice plates (second takes turns screening) and 16 orifice plate (be used for protecting and plant) respectively, cultivate after 4 days, get supernatant and detect the Expression of Fusion Protein situation, therefrom choose 6 higher clone: A1-6, C1-5, B4-3, B5-5, A6-4, A6-5 of expression and further screen with limiting dilution assay with ELISA.
Inoculate 96 orifice plates (5 cells/well/200 μ l) (third round screening) respectively, treat that cell covers with back (after about 13 days), get culture supernatant and detect the Expression of Fusion Protein situation with ELISA, B4-3, A6-4, C1-5 are the clone of homogeneous, picking is expressed 6 higher clone's inoculation 24 orifice plates, each parallel 2 hole that connect respectively.After treating that cell covers with, wherein a hole is used for protecting kind, and 6 orifice plates are inoculated in another hole.After treating that the interior cell of 6 orifice plates covers with, extracting genomic dna and total RNA identify the segmental situation that exists of genomic insertion that is integrated into PCR, identify segmental the transcribing of insertion (promptly expressing) situation with RT-PCR.The result is shown in Fig. 7 and 8, and B4-3, A6-4, C1-5 are correct clone.
Get B4-3 (C3), A6-4 (B4) respectively, C1-5 (D8) inoculates 96 orifice plates (1 cells/well/200 μ l) (four-wheel screening), treat that cell covers with back (after about 15 days), get culture supernatant and detect the Expression of Fusion Protein situation with ELISA, three clones are the clone of homogeneous, with wherein expressing the highest amplification respectively, protecting and plant, carry out next step expression and purifying.After pEpo-Fc transforms Chinese hamster ovary celI, with the cell called after CHO-EF cell of stably express.
Embodiment four preparation rhEPO-Fc fusion roteins
Large scale culturing CHO-EF cell, supernatant liquor is regulated pH to 7.3 with the NaOH of 1M after centrifugal, adsorb in order to 10mMPB (pH7.3) equilibrated rProtein A-Sepharose F.F. (Parmacia) affinity column, again with same damping fluid washing affinity column to the OD value of 280nm less than 0.01.Citrate buffer solution with 0.05～0.1M washes fusion rotein, collects elution peak and uses 200mM Na immediately 2HPO 4Regulate pH to 7.0.After the sample concentration, last molecular sieve Superdex 200 prep grade posts are used 20mMPBS in advance, and (contain 150mMNaCl, pH7.2) damping fluid balance is with sample purifying on the sample after concentrating.Protein electrophoresis collection of illustrative plates behind the purifying is seen Fig. 9, and purity can reach more than 98%.
Embodiment five preparation is the injection/freeze-dried of active constituent with rhEPO-Fc
Prescription: rhEPO-Fc 100mg
NaCl 8g
Na 2HPO 4·12H 2O 5.16g
NaH 2PO 4·2H 2O 0.874g
Glycine 15g
N.F,USP MANNITOL 30g
Water for injection 1000ml
PH value 7.2
Be distributed into injection water injection or freeze-drying that 0.5ml/ props up after the sterile filtration, make freeze-dried powder.
Embodiment six: rhEPO-Fc is in the intravital pharmacokinetics of macaque
RhEPO-Fc concentration in the ELISA kit measurement serum of macaque is adopted in this research, and draws corresponding pharmacokinetic parameter.Also carry out the methodology conclusive evidence simultaneously, comprise the method rate of recovery, precision, accuracy and sensitivity etc.
1, grouping and dosage
This test is divided into 2 groups, is respectively positive EPO control group, rhEPO-Fc dosage group, every group of 3 macaques.Concrete grouping is arranged as follows:
(1) EPO control group-subcutaneous administration (waiting molar dose), i.e. 2.5ug/kg
(2) dosage single-dose group among the rhEPO-Fc-subcutaneous single-dose 10ug/kg
2, blood sampling point design
RhEPO-Fc organizes the concentration that rhEPO-Fc in the serum is measured in behind subcutaneous administration 4h, 8h, 12h, 24h, 36h, 48h, 72h, 96h, 120h, 168h, 216h blood sampling; The concentration of rhEPO-Fc in the serum is measured in positive EPO control group 15min, 30min, 45min, 1h, 1.5h, 2h, 3h, 4h, 8h, 12h, 24h blood sampling behind subcutaneous administration.
Simultaneously, every group also will be carried out the detection of hematological indices, and detection time, point was 48h, 120h, 216h, 312h, 384h, 480h, 552h and 648h, and the hematology specific targets of detection are Reticulocyte counting (RTC), RBC and HB.
3, pharmacokinetics result
Subcutaneous give positive EPO after, 2h reaches peak concentration, concentration is 30.4 ± 1.8ng/ml; AUC 0-24221.6 ± 45.7ng.Equ.hmL -1MRT is 6.9 ± 0.4h; CL is 10.2 ± 2.0mLh -1Kg -1Vss is 70.4 ± 10.1mLkg -1The elimination transformation period is 7.4 ± 0.3h.
Subcutaneous give rhEPO-Fc after, peak time is 8h, reaching peak concentration is 76.6 ± 2.4ng/ml; AUC 0-216Be 2715.1 ± 289.0ng.Equ.hmL -1MRT is 42.7 ± 1.0h; CL is 3.7 ± 0.4mLh -1Kg -1Vss is 156.9 ± 15.6mLkg -1The elimination transformation period is 33.2 ± 4.5h.
Embodiment seven: recombinant human long acting erythropoietin (rhEPO-Fc) pharmacodynamics
One, the rhEPO-Fc dosage is set
We compare investigational agent rhEPO-Fc and positive control drug EPO in this test.According to bibliographical information and in conjunction with the clinical administration scheme, select an effective dose for use, positive EPO fixes tentatively 500U/kg.day, is administered three times weekly, around the continuous use.The dosage range of rhEPO-Fc is set the equimolar amount 15 μ g/kg of positive drug EPO group.As prolonged action preparation, the administration cycle of rhEPO-Fc and frequency are decided to be once in a week, around the successive administration.Detection time of this experiment point for detect once weekly, week before the administration and after the last administration, carry out the detection of dynamic of biochemistry and hematological indices, to carry out the judgement of time-effect relationship.
Two, body weight change and figure change before and after the rat treatment
The test rat is after giving the VITAMIN B4 gastric infusion every day, and the first seven day, so weight increase is very big, the back function influence that was subjected to VITAMIN B4 in seven days, weight increase were seldom even reduce because drug effect also embodies.Administration beginning in the 7th day, rat amount of drinking water, urine amount all increase, and with being stranded doze, dispirited, vigor descends simultaneously; Chaeta is withered gradually, stiff to be become, and depilation phenomenon also appears in part.Behind the administration rhEPO-Fc ten days, the rat mental status, mobility are obviously improved, and chaeta begins Smooth and moist, and body weight obviously increases very fast.
Three, rat blood, biochemical indexes change before and after the renal failure model
After 7 days, all rat serum creatinines (Cr) and serum urea nitrogen (BUN) all rise gradually in the administration VITAMIN B4, and RBC, Hb, Hct and reticulocyte count (RTC) etc. descend gradually.After model built up in 20 days, with the test before compare, Cr, BUN value have remarkable increase, RBC, Hb value are remarkable decline, the Hct value also reduces, the RTC value is reduced near 0.Show that VITAMIN B4 has made renal function damage, and causes anaemia.
Four, rhEPO-Fc is to the influence of kidney of rats function
After the renal failure modelling, creatinine and the serum urea nitrogen value of rat see Table 1 before the rhEPO-Fc treatment, see Table 2 and table 3 after the treatment.After the rhEPO-Fc treatment, Cr and the BUN of administration group rat fall after rise gradually, but still apparently higher than the normal rat control group, show that renal function still is in the decline state, and rhEPO-Fc can not correct the renal failure performance.
Five, to the therapeutic action of renal failure rat anaemia
After positive control EPO and rhEPO-Fc treatment, compare before red corpuscle, hemoglobin and hematocrit and the treatment, raising is in various degree all arranged, rhEPO-Fc is with to contrast the medicine result of treatment consistent.
The hematology and the biochemical indexes (n=10) of each group before table 1 medication
Table 2 medication is hematology and biochemical indexes (n=10) after 15 days
Table 3 medication is hematology and biochemical indexes (n=10) after 30 days
Figure C20061007222900163
Embodiment eight rhEPO-Fc fusion roteins and EPO external activity are relatively
Collect the UT-7 cell, with perfect medium washing 1 time, counting, adjust density to 1.5 * 105/ml, rhEPO-Fc and EPO are diluted to about 2 μ M, 10 concentration gradients of 4 times of dilutions in 96 well culture plates, each extent of dilution retention volume 100 μ l, inoculate 100 μ l cell suspensions then to each extent of dilution, cultivate after 48 hours, add 5mg/ml MTT (tetrazolium bromide) 20 μ l, continue to cultivate 4.5 hours, add the DMSO (dimethyl sulfoxide (DMSO)) of equal volume behind the careful removal 150 μ l supernatants, abundant cracking mixing, microplate reader is measured OD490/655.Its median effective dose (EC50) basically identical (see figure 10).
Should be understood that,, be more readily understood the present invention by above-mentioned specific embodiment.The foregoing description is just described for example, but does not plan the present invention is limited to concrete embodiment.After having read foregoing of the present invention, those skilled in the art are under the prerequisite that does not deviate from the spirit and scope of the present invention, can make various modifications and improvement to the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Reference
1.Zheng?X.X.，Steele?A.W.，Hancock?W.W.et?al.，IL-2?receptor-targetedcytolytic?IL-2/Fc?fusion?protein?treatment?blocks?diabetogenic?autoimmunityin?nonobese?diabetic?mice.J.Immunol.，1999，163：4041-4048.
2.Zheng?X.X.，Steele?A.W.，Nickerson?P.W.，et?al.，Administration?ofnoncytolytic?IL-10/Fc?in?murine?models?of?lipopolysaccharide-induced?septicshock?and?allogeneic?islet?transplantation.J.Immunol.，1995，154：5590-5600.
3.Barouch?D.H.，Crain?A.，Kuroda?M.J.，et?al.，Augmentation?of?immune?responsesto?HIV-1?and?simian?immunodeficiency?virus?DNA?vaccines?by?IL-2/Ig?plasmidadministration?in?rhesus?monkeys.PNAS，2000，97(8)：4192-4197.
4.Sturmhoefel?K.，Lee?K.，Gray?G.S.，et?al.，Potent?activity?of?soluble?B7-IgGfusion?proteins?in?therapy?of?established?tumors?and?as?vaccine?adjuvant.Camcer?Res.，1999，59：4964-4972.
5.Ferrari-Lacraz?S.，Zheng?X.X.，Kim?Y.S.，et?al.，An?antagonist?IL-15/Fcprotein?prevents?costimulation?blockade-resistant?rejection.J.Immunol.，2001，167：3478-3485.
6.Kendall?R.G.，Erythropoietin.Clin.Lab.Haem.2001，23：71-80.
7.Sytkowaki?A.J.，Lunn?E.D.，Davis?K.L.，et?al.，Human?erythropoietin?dimerswith?markedly?enhanced?in?vivo?activity.PNAS，1998，95：1184-1188.
8.Dalle?B.，Henri?A.，Rouyer-Fessard?P.，et?al.，Dimeric?erythropoietin?fusionprotein?with?enhanced?erythropoietic?activity?in?vitro?and?in?vivo.Blood.2001，97：3776-3782.
Sequence table
＜110〉Beijing Bokangjian Gene Technology Co.,Ltd
＜120〉long effective amalgamation protein of erythropoietin of human and preparation thereof and purification process
<160>10
<170>Patent?In?Version?3.0
<210>1
<211>582
<212>DNA
＜213〉people
<400>1
atgggggtgc?acgaatgtcc?tgcctggctg?tggcttctcc?tgtccctgct?gtcgctccct 60
ctgggcctcc?cagtcctggg?cgccccacca?cgcctcatct?gtgacagccg?agtcctggag 120
aggtacctct?tggaggccaa?ggaggccgag?aatatcacga?cgggctgtgc?tgaacactgc 180
agcttgaatg?agaatatcac?tgtcccagac?accaaagtta?atttctatgc?ctggaagagg 240
atggaggtcg?ggcagcaggc?cgtagaagtc?tggcagggcc?tggccctgct?gtcggaagct 300
gtcctgcggg?gccaggccct?gttggtcaac?tcttcccagc?cgtgggagcc?cctgcagctg 360
catgtggata?aagccgtcag?tggccttcgc?agcctcacca?ctctgcttcg?ggctctgcga 420
gcccagaagg?aagccatctc?ccctccagat?gcggcctcag?ctgctccact?ccgaacaatc 480
actgctgaca?ctttccgcaa?actcttccga?gtctactcca?atttcctccg?gggaaagctg 540
aagctgtaca?caggggaggc?ctgcaggaca?ggggacagat?ga 582
<210>2
<211>166
<212>PRT
＜213〉people
<400>2
Ala?Pro?Pro?Arg?Leu?Ile?Cys?Asp?Ser?Arg?Val?Leu?Glu?Arg?Tyr?Leu 16
Leu?Glu?Ala?Lys?Glu?Ala?Glu?Asn?Ile?Thr?Thr?Gly?Cys?Ala?Glu?His 32
Cys?Ser?Leu?Asn?Glu?Asn?Ile?Thr?Val?Pro?Asp?Thr?Lys?Val?Asn?Phe 48
Tyr?Ala?Trp?Lys?Arg?Met?Glu?Val?Gly?Gln?Gln?Ala?Val?Glu?Val?Trp 64
Gln?Gly?Leu?Ala?Leu?Leu?Ser?Glu?Ala?Val?Leu?Arg?Gly?Gln?Ala?Leu 80
Leu?Val?Asn?Ser?Ser?Gln?Pro?Trp?Glu?Pro?Leu?Gln?Leu?His?Val?Asp 96
Lys?Ala?Val?Ser?Gly?Leu?Arg?Ser?Leu?Thr?Thr?Leu?Leu?Arg?Ala?Leu 112
Arg?Ala?Gln?Lys?Glu?Ala?Ile?Ser?Pro?Pro?Asp?Ala?Ala?Ser?Ala?Aal 128
Pro?Leu?Arg?Thr?Ile?Thr?Ala?Asp?Thr?Phe?Arg?Lys?Leu?Phe?Arg?Val 144
Tyr?Ser?Asn?Phe?Leu?Arg?Gly?Lys?Leu?Lys?Leu?Tyr?Thr?Gly?Glu?Ala 160
Cys?Arg?Thr?Gly?Asp?Arg 166
<210>3
<211>687
<212>DNA
＜213〉people
<400>3
gagcgcaaat?gttgtgtcga?gtgcccaccg?tgcccagcac?cacctgtggc?aggaccgtca 60
gtcttcctct?tccccccaaa?acccaaggac?accctcatga?tctcccggac?ccctgaggtc 120
acgtgcgtgg?tggtggacgt?gagccacgaa?gaccccgagg?tccagttcaa?ctggtacgtg 180
gacggcgtgg?aggtgcataa?tgccaagaca?aagccacggg?aggagcagtt?caacagcacg 240
ttccgtgtgg?tcagcgtcct?caccgttgtg?caccaggact?ggctgaacgg?caaggagtac 300
aagtgcaagg?tctccaacaa?aggcctccca?gcccccatcg?agaaaaccat?ctccaaaacc 360
aaagggcagc?cccgagaacc?acaggtgtac?accctgcccc?catcccggga?ggagatgacc 420
aagaaccagg?tcagcctgac?ctgcctggtc?aaaggcttct?accccagcga?catcgccgtg 480
gagtgggaga?gcaatgggca?gccggagaac?aactacaaga?ccacacctcc?catgctggac 540
tccgacggct?ccttcttcct?ctacagcaag?ctcaccgtgg?acaagagcag?gtggcagcag 600
gggaacgtct?tctcatgctc?cgtgatgcat?gaggctctgc?acaaccacta?cacgcagaag 660
agcctctccc?tgtctccggg?taaatga 687
<210>4
<211>228
<212>PRT
＜213〉people
<400>4
Glu?Arg?Lys?Cys?Cys?Val?Glu?Cys?Pro?Pro?Cys?Pro?Ala?Pro?Pro?Val 16
Ala?Gly?Pro?Ser?Val?Phe?Leu?Phe?Pro?Pro?Lys?Pro?Lys?Asp?Thr?Leu 32
Met?Ile?Ser?Arg?Thr?Pro?Glu?Val?Thr?Cys?Val?Val?Val?Asp?Val?Ser 48
His?Glu?Asp?Pro?Glu?Val?Gln?Phe?Asn?Trp?Tyr?Val?Asp?Gly?Val?Glu 64
Val?His?Asn?Ala?Lys?Thr?Lys?Pro?Arg?Glu?Glu?Gln?Phe?Asn?Ser?Thr 80
Phe?Arg?Val?Val?Ser?Val?Leu?Thr?Val?Val?His?Gln?Asp?Trp?Leu?Asn 96
Gly?Lys?Glu?Tyr?Lys?Cys?Lys?Val?Ser?Asn?Lys?Gly?Leu?Pro?Ala?Pro 112
Ile?Glu?Lys?Thr?Ile?Ser?Lys?Thr?Lys?Gly?Gln?Pro?Arg?Glu?Pro?Gln 128
Val?Tyr?Thr?Leu?Pro?Pro?Ser?Arg?Glu?Glu?Met?Thr?Lys?Asn?Gln?Val 144
Ser?Leu?Thr?Cys?Leu?Val?Lys?Gly?Phe?Tyr?Pro?Ser?Asp?Ile?Ala?Val 160
Glu?Trp?Glu?Ser?Asn?Gly?Gln?Pro?Glu?Asn?Asn?Tyr?Lys?Thr?Thr?Pro 176
Pro?Met?Leu?Asp?Ser?Asp?Gly?Ser?Phe?Phe?Leu?Tyr?Ser?Lys?Leu?Thr 192
Val?Asp?Lys?Ser?Arg?Trp?Gln?Gln?Gly?Asn?Val?Phe?Ser?Cys?Ser?Val 208
Met?His?Glu?Ala?Leu?His?Asn?His?Tyr?Thr?Gln?Lys?Ser?Leu?Ser?Leu 224
Ser?Pro?Gly?Lys 228
<210>5
<211>
<212>DNA
＜213〉people
<400>5
atgggggtgcacgaatgtcctgcctggctgtggcttctcctgtccctgctgtcgctccctctgggcctcccagtcctgggcgccc
caccacgcctcatctgtgacagccgagtcctggagaggtacctcttggaggccaaggaggccgagaatatcacgacgggctgtgc
tgaacactgcagcttgaatgagaatatcactgtcccagacaccaaagttaatttctatgcctggaagaggatggaggtcgggcag
caggccgtagaagtctggcagggcctggccctgctgtcggaagctgtcctgcggggccaggccctgttggtcaactcttcccagc
cgtgggagcccctgcagctgcatgtggataaagccgtcagtggccttcgcagcctcaccactctgcttcgggctctgcgagccca
gaaggaagccatctcccctccagatgcggcctcagctgctccactccgaacaatcactgctgacactttccgcaaactcttccga
gtctactccaatttcctccggggaaagctgaagctgtacacaggggaggcctgcaggacaggggacagaggatccgagcgcaaat
gttgtgtcgagtgcccaccgtgcccagcaccacctgtggcaggaccgtcagtcttcctcttccccccaaaacccaaggacaccct
catgatctcccggacccctgaggtcacgtgcgtggtggtggacgtgagccacgaagaccccgaggtccagttcaactggtacgtg
gacggcgtggaggtgcataatgccaagacaaagccacgggaggagcagttcaacagcacgttccgtgtggtcagcgtcctcaccg
ttgtgcaccaggactggctgaacggcaaggagtacaagtgcaaggtctccaacaaaggcctcccagcccccatcgagaaaaccat
ctccaaaaccaaagggcagccccgagaaccacaggtgtacaccctgcccccatcccgggaggagatgaccaagaaccaggtcagc
ctgacctgcctggtcaaaggcttctaccccagcgacatcgccgtggagtgggagagcaatgggcagccggagaacaactacaaga
ccacacctcccatgctggactccgacggctccttcttcctctacagcaagctcaccgtggacaagagcaggtggcagcaggggaa
cgtcttctcatgctccgtgatgcatgaggctctgcacaaccactacacgcagaagagcctctccctgtctccgggtaaatga
<210>6
<211>396
<212>PRT
＜213〉people
<400>6
Ala?Pro?Pro?Arg?Leu?Ile?Cys?Asp?Ser?Arg?Val?Leu?Glu?Arg?Tyr?Leu 16
Leu?Glu?Ala?Lys?Glu?Ala?Glu?Asn?Ile?Thr?Thr?Gly?Cys?Ala?Glu?His 32
Cys?Ser?Leu?Asn?Glu?Asn?Ile?Thr?Val?Pro?Asp?Thr?lys?Val?Asn?Phe 48
Tyr?Ala?Trp?Lys?Arg?Met?Glu?Val?Gly?Gln?Gln?Ala?Val?Glu?Val?Trp 64
Gln?Gly?Leu?Ala?Leu?Leu?Ser?Glu?Ala?Val?Leu?Arg?Gly?Gln?Ala?Leu 80
Leu?Val?Asn?Ser?Ser?Gln?Pro?Trp?Glu?Pro?Leu?Gln?Leu?His?Val?Asp 96
Lys?Ala?Val?Ser?Gly?Leu?Arg?Ser?Leu?Thr?Thr?Leu?Leu?Arg?Ala?Leu 112
Arg?Ala?Gln?Lys?Glu?Ala?Ile?Ser?Pro?Pro?Asp?Ala?Ala?Ser?Ala?Ala 128
Pro?Leu?Arg?Thr?Ile?Thr?Ala?Asp?Thr?Phe?Arg?Lys?Leu?Phe?Arg?Val 144
Tyr?Ser?Asn?Phe?Leu?Arg?Gly?Lys?Leu?Lys?Leu?Tyr?Thr?Gly?Glu?Ala 160
Cys?Arg?Thr?Gly?Asp?Arg?Gly?Ser?Glu?Arg?Lys?Cys?Cys?Val?Glu?Cys 176
Pro?Pro?Cys?Pro?Ala?Pro?Pro?Val?Ala?Gly?Pro?Ser?Val?Phe?Leu?Phe 192
Pro?Pro?Lys?Pro?Lys?Asp?Thr?Leu?Met?Ile?Ser?Arg?Thr?Pro?Glu?Val 208
Thr?Cys?Val?Val?Val?Asp?Val?Ser?His?Glu?Asp?Pro?Glu?Val?Gln?Phe 224
Asn?Trp?Tyr?Val?Asn?Gly?Val?Glu?Val?His?Asn?Ala?Lys?Thr?Lys?Pro 240
Arg?Glu?Glu?Gln?Phe?Asn?Ser?Thr?Phe?Arg?Val?Val?Ser?Val?Leu?Thr 256
Val?Val?His?Gln?Asp?Trp?Leu?Asn?Gly?Lys?Glu?Tyr?Lys?Cys?Lys?Val 272
Ser?Asn?Lys?Gly?Leu?Pro?Ala?Pro?Ile?Glu?Lys?Thr?Ile?Ser?Lys?Thr 288
Lys?Gly?Gln?Pro?Arg?Glu?Pro?Gln?Val?Tyr?Thr?Leu?Pro?Pro?Ser?Arg 304
Glu?Glu?Met?Thr?Lys?Asn?Gln?Val?Ser?Leu?Thr?Cys?Leu?Val?Lys?Gly 320
Phe?Tyr?Pro?Ser?Asp?Ile?Ala?Val?Glu?Trp?Glu?Ser?Asn?Gly?Gln?Pro 336
Glu?Asn?Asn?Tyr?Lys?Thr?Thr?Pro?Pro?Met?Leu?Asp?Ser?Asp?Gly?Ser 352
Phe?Phe?Leu?Tyr?Ser?Lys?Leu?Thr?Val?Asp?Lys?Ser?Arg?Trp?Gln?Gln 368
Gly?Asn?Val?Phe?Ser?Cys?Ser?Val?Met?His?Glu?Ala?Leu?His?Asn?His 384
Tyr?Thr?Gln?Lys?Ser?Leu?Ser?Leu?Ser?Pro?Gly?Lys 396
<210>7
<211>38
<212>DNA
＜213〉artificial sequence
<220>
<400>7
ctccaagctt?gctagcatgg?gggtgcacga?atgtcctg 38
<210>8
<211>32
<212>DNA
＜213〉artificial sequence
<220>
<400>8
gcggatcctc?tgtcccctgt?cctgcaggcc?tc 32
<210>9
<211>32
<212>DNA
＜213〉artificial sequence
<220>
<400>9
cgggatccga?gcgcaaatgt?tgtgtcgagt?gc 32
<210>10
<211>32
<212>DNA
＜213〉artificial sequence
<220>
<400>10
cgggatccga?gcgcaaatgt?tgtgtcgagt?gc 32

Claims (15)

1. a recombinant human erythropoietin (rhEPO)-Fc fusion rotein is characterized in that this fusion rotein is the polypeptide of aminoacid sequence shown in the SEQ ID NO:6.
2. the polynucleotide molecule of the described fusion rotein of claim 1 of encoding is characterized in that its sequence is the nucleotide sequence shown in the SEQ ID NO:5.
3. the recombinant expression vector that contains the described polynucleotide molecule of claim 2.
4. recombinant expression vector according to claim 3 is characterized in that described recombinant expression vector is a carrier for expression of eukaryon.
5. according to claim 3 or 4 described recombinant expression vectors, it is characterized in that described carrier for expression of eukaryon is pEpo-Fc.
6. host cell that contains each described recombinant expression vector among the claim 3-5.
7. host cell according to claim 6 is characterized in that described host cell is a Chinese hamster ovary celI.
8. one kind prepares the method for fusion rotein according to claim 1, it is characterized in that being included under the condition that is suitable for expressing this fusion rotein and cultivate as claim 6 or 7 described host cells, and from cell culture the step of recovery and this fusion rotein of purifying.
9. the purifying method of fusion rotein according to claim 1, it is characterized in that with claim 6 or 7 described host cells through cell cultures, centrifugal after, supernatant liquor is used affinity chromatography and sieve chromatography purifying respectively.
10. method according to claim 9, what it is characterized in that using in affinity chromatography is the affine layer of rProtein A Sepharose FF post.
11. method according to claim 9, what it is characterized in that using in the sieve chromatography is Superdex 200 prep grade posts.
12. a pharmaceutical composition is characterized in that this pharmaceutical composition contains as described fusion rotein of the claim 1 of activeconstituents and pharmaceutically acceptable carrier.
13. according to the pharmaceutical composition of claim 12, it is characterized in that this pharmaceutical composition be suitable for by in intravenously, subcutaneous, muscle, the sheath, the formulation of nasal membrane, oral mucosa administration.
14. the purposes of the described fusion rotein of claim 1 in the exsanguine medicine of preparation treatment.
15. purposes according to claim 14 is characterized in that the anaemia that described anemia is an inductive anaemia behind the anemia that causes of chronic kidney hypofunction, AZT treatment patient AIDS, tumour causes anaemia, anaemia, anemia of prematurity and rheumatoid arthritis that chemotherapy of tumors causes cause.
CNB2006100722291A 2006-04-14 2006-04-14 Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods Active CN100436482C (en)

Priority Applications (3)

Application Number Priority Date Filing Date Title
CNB2006100722291A CN100436482C (en) 2006-04-14 2006-04-14 Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods
PCT/CN2007/001209 WO2007118423A1 (en) 2006-04-14 2007-04-13 Human recombinant erytheropoietin fusion proteins, preparing methods and uses thereof
HK07105675.4A HK1098165A1 (en) 2006-04-14 2007-05-29 Long acting human erythropoietin fusion protein and method for preparing and purifying the same

Applications Claiming Priority (1)

Application Number Priority Date Filing Date Title
CNB2006100722291A CN100436482C (en) 2006-04-14 2006-04-14 Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods

Publications (2)

Publication Number Publication Date
CN1872881A CN1872881A (en) 2006-12-06
CN100436482C true CN100436482C (en) 2008-11-26

Family

ID=37483498

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2006100722291A Active CN100436482C (en) 2006-04-14 2006-04-14 Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods

Country Status (3)

Country Link
CN (1) CN100436482C (en)
HK (1) HK1098165A1 (en)
WO (1) WO2007118423A1 (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN101870735B (en) * 2010-06-02 2013-06-12 北京精益泰翔技术发展有限公司 High-glycosylation erythropoietin immune fusion protein
CN105884906B (en) * 2016-05-27 2021-11-19 广州太力生物医药科技有限公司 Purification method of long-acting human erythropoietin fusion protein
CN107937425A (en) * 2017-12-27 2018-04-20 北京四环生物制药有限公司 The production method of long-acting recombinant human erythropoietin
CN114921443B (en) * 2022-05-05 2023-07-07 重庆医科大学 Application of streptococcus pneumoniae endopeptidase O in preparation of antitumor drugs

Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5614184A (en) * 1992-07-28 1997-03-25 New England Deaconess Hospital Recombinant human erythropoietin mutants and therapeutic methods employing them
CN1251192A (en) * 1997-11-22 2000-04-19 皇家菲利浦电子有限公司 Audio processing arrangement with multiple sources
US6187564B1 (en) * 1997-07-10 2001-02-13 Beth Israel Deaconess Medical Center DNA encoding erythropoietin multimers having modified 5′ and 3′ sequences and its use to prepare EPO therapeutics
CN1305003A (en) * 2001-02-27 2001-07-25 李欣越 Gene engineering process for preparing died/tried fusion protein of erythrocyte growth factor with improved bioactivity
CN1422870A (en) * 2001-12-03 2003-06-11 第一制糖株式会社 Fusional protein with intensified activity of internal red-blood-cell formation element

Family Cites Families (3)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
WO2001036489A2 (en) * 1999-11-12 2001-05-25 Merck Patent Gmbh Erythropoietin forms with improved properties
US6900292B2 (en) * 2001-08-17 2005-05-31 Lee-Hwei K. Sun Fc fusion proteins of human erythropoietin with increased biological activities
CN1234731C (en) * 2003-01-30 2006-01-04 旭华（上海）生物研发中心有限公司 Human erythropoietin Fc fusion protein with high bioactivity

Patent Citations (5)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
US5614184A (en) * 1992-07-28 1997-03-25 New England Deaconess Hospital Recombinant human erythropoietin mutants and therapeutic methods employing them
US6187564B1 (en) * 1997-07-10 2001-02-13 Beth Israel Deaconess Medical Center DNA encoding erythropoietin multimers having modified 5′ and 3′ sequences and its use to prepare EPO therapeutics
CN1251192A (en) * 1997-11-22 2000-04-19 皇家菲利浦电子有限公司 Audio processing arrangement with multiple sources
CN1305003A (en) * 2001-02-27 2001-07-25 李欣越 Gene engineering process for preparing died/tried fusion protein of erythrocyte growth factor with improved bioactivity
CN1422870A (en) * 2001-12-03 2003-06-11 第一制糖株式会社 Fusional protein with intensified activity of internal red-blood-cell formation element

Also Published As

Publication number Publication date
WO2007118423A1 (en) 2007-10-25
CN1872881A (en) 2006-12-06
HK1098165A1 (en) 2007-07-13

Similar Documents

Publication Publication Date Title
CN100400548C (en) Fusional protein with intensified activity of internal red-blood-cell formation element
KR101801506B1 (en) Variants derived from actriib and uses therefor
ES2333385T3 (en) PROTEIN OF THE INTERLEUQUINE TYPE-17.
US6835809B1 (en) Thrombopoietic compounds
CN103168048B (en) dimeric VSTM3 fusion proteins and related compositions and methods
KR100545720B1 (en) Glycosylated Immunoglobulin and Immunoadhesin comprising the same
CN101141975A (en) Vegf antagonist formulations
IL172404A (en) Vegf mini traps, pharmaceutical compositions comprising the same and use of the pharmaceutical compositions for preparing medicaments
CN109355269B (en) Sphingosine kinase 1, fusion protein thereof and application thereof
DK2576624T3 (en) Recombinant human G-CSF dimer and their use for the treatment of neurological disorders
AU2002300359B2 (en) Fusion Protein Having Enhanced in vivo Activity of Erythropoietin
KR19990022141A (en) CD40L mutant protein
CN100436482C (en) Long effective amalgamation protein of erythropoietin of human, preparing and purifying methods
WO2016205370A1 (en) Methods of using activin receptor iib-based proteins
US6187564B1 (en) DNA encoding erythropoietin multimers having modified 5′ and 3′ sequences and its use to prepare EPO therapeutics
CN102070717B (en) Fusion protein, preparation method thereof, DNA sequence for coding protein, expression vector, host cell and protein-containing medicinal compoisition
WO1998012344A1 (en) Human tumor necrosis factor receptor-like genes
CN109206522A (en) A kind of long-acting anticoagulant fusion protein and its application
KR100331977B1 (en) A novel human thrombopoietin mutein
CN101870735B (en) High-glycosylation erythropoietin immune fusion protein
KR20230042263A (en) Soluble ENPP1 or ENPP3 Proteins and Uses Thereof
CN101311192A (en) Process for high-efficiency expressing sTNFR/Fc fusion protein in yeast and uses thereof
CN107619442B (en) Recombinant anti-TNF-alpha fully human monoclonal antibody preparation
KR20120135865A (en) CONJUGATE COMPRISING SOLUBLE FRAGMENT OF FcεRI AND COMPOSITION FOR TREATING ALLERGY DISEASES MEDIATED BY IGE COMPRISING THE CONJUGATE
US7037491B2 (en) Human thrombopoietin comprising glycosylation sited at residues 157 and 164

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
REG Reference to a national code

Ref country code: HK

Ref legal event code: DE

Ref document number: 1098165

Country of ref document: HK

C14 Grant of patent or utility model
GR01 Patent grant
REG Reference to a national code

Ref country code: HK

Ref legal event code: GR

Ref document number: 1098165

Country of ref document: HK

ASS Succession or assignment of patent right

Owner name: BOKANGJIAN GENE TECH CO., LTD., BEIJING

Free format text: FORMER OWNER: DONGGUAN TAILI BIOTECH CO., LTD.

Effective date: 20120427

C41 Transfer of patent application or patent right or utility model
COR Change of bibliographic data

Free format text: CORRECT: ADDRESS; FROM: 523581 DONGGUAN, GUANGDONG PROVINCE TO: 102200 CHANGPING, BEIJING

TR01 Transfer of patent right

Effective date of registration: 20120427

Address after: 102200 Changping District Spark Street, Beijing, No. 7

Patentee after: Bokangjian Gene Tech Co., Ltd., Beijing

Address before: 523581 KBA green science and Technology City, Changping Town, Dongguan City, Guangdong Province

Patentee before: Dongguan Taili Biotech Co., Ltd.

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20170417

Address after: 523581 Dongguan, Changping Town, Tong Tong Industrial Park, KBA green science and Technology City, building 3, building 4, No.

Patentee after: Dongguan Taili Biotech Co., Ltd.

Address before: 102200 Changping District Spark Street, Beijing, No. 7

Patentee before: Bokangjian Gene Tech Co., Ltd., Beijing

TR01 Transfer of patent right
TR01 Transfer of patent right

Effective date of registration: 20190724

Address after: 511300 No. 3 Founding Road, Yongning Street, Zengcheng District, Guangzhou City, Guangdong Province

Patentee after: Guangzhou Taili Biomedical Technology Co., Ltd.

Address before: 523581 Dongguan, Changping Town, Tong Tong Industrial Park, KBA green science and Technology City, building 3, building 4, No.

Patentee before: Dongguan Taili Biotech Co., Ltd.