CN100427591C - Method for screening and establishing mouse-development-related gene mutation ES cell bank - Google Patents

Abstract

The present invention provides a method which utilizes a gene trapping technology to establish a large-scale mutation mouse embryo stem cell base with definite sites and a method for screening and identifying the relation between the mutant gene and the development of the mouse embryo. The present invention leads a gene trapping carrier system to be optimized, a new gene trapping carrier is built, and the mutation stem cell clone is established. A method for identifying a mutant gene site, a method for identifying the expression and the space-time specificity of the mutant gene in the development of the mouse embryo, and a method that the mutant stem cell is changed into a mouse are combined. The stem cell base of the present invention can be used for discovering a new gene, establishing a gene mutation mouse model and researching the relation between the gene and the individual development of the mouse and the function.

Description

A kind of method of screening and setting up mice develop associated gene mutation ES cell bank

Technical field

The present invention relates to biological technical field, relate more specifically to a kind of method of screening and setting up mice develop associated gene mutation ES cell bank.

Background technology

Extensive examination development related gene sudden change has been proved to be the important means of announcement such as organism fetal development basic genetic rules such as fruit bat and nematodes.And this examination need be finished the very difficulty that becomes owing to genome is huge with fetal development in parent in Mammals.And owing to need to raise a large amount of animals and the relative long enforcement that has limited extensive examination breeding time.

Mouse is at present adopted near the model animal of anthropobiology function, the research of carrying out gene knockout in the mouse genome is the important means that discloses the mouse gene function, and this class research simultaneously provides very directly clue for understanding human homologous gene.

The ES cell technology makes mammiferous most of genetic manipulation in external realization.Present this technology is most commonly used to by producing transgenation in ES cell homologous recombination.This method can be used for functional analysis after known prediction and the sudden change of growing relevant gene.Usually, these genes are by analysis with other species development related gene homologies or contain conservative protein function zone.Although this method is very effective for the mutation research of growing relevant candidate gene, does not carry out mass-producing and study inapplicable for having the gene of function information indicating and unknown gene at molecular level in a large number.

Insert the site and produce that to insert inactivation " gene trap " (gene trapping) technology finding new gene and disclose its function of suddenling change be a kind of technique means easily of setting up the high-throughput of embryonic stem cell level, extensive transgenation and producing the genetic modification mouse model to genome, label by the report carrier random integration.In extensive development related gene mutation research, have bright prospects.

At present existing several different carriers are applied to produce sudden change ES cell bank, and for example enhanser is caught (enhancer trap), promoted son to catch (promoter trap), gene trap (gene trap) technology etc.But these technology have certain limitation in application process.At first, reporter gene or selection expression of gene depend on the regulating and controlling sequence of the endogenous gene of expressing in embryonic stem cell, thereby can not " catch " to the endogenous regulating and controlling sequence or the gene of not expressing at embryonic stem cell; Secondly, the reading frame frameshit might take place and can not be identified in the reporter gene of Cha Ruing after transcribing shearing at random, causes some functional gene to become " fish that has escape the net ".Designing novel capturing carrier and strategy is that the applying gene technology of " catching " is understood pressing for of gene function.

Therefore, this area press for set up a kind of utilize method that gene trapping sets up clear and definite mutant mice embryonic stem cell (ES) storehouse, extensive site and Screening and Identification mutator gene and mice embryonic grow between the method for relation.

Summary of the invention

Purpose of the present invention just provides a kind of method of setting up clear and definite mutant mice embryonic stem cell (ES) storehouse, extensive site.

Another object of the present invention provides with the ES cell bank of this method preparation and the purposes of this cell bank, grows relevant development related gene in particular for screening with mice embryonic.

In a first aspect of the present invention, a kind of method of setting up mutated embryonic stem cell bank is provided, comprise step:

(a) gene capturing carrier is imported embryonic stem cell, described gene capturing carrier from 5 ' to 3 ' structure be:

SA-ST-IRES-EGFP-pA-Prom-Anti-SD

In the formula,

SA is the receptor sequence of RNA montage;

ST is the series connection terminator codon;

IRES is an internal ribosome entry site;

EGFP is the enhanced green fluorescence protein gene;

PA is the polyA sequence;

Prom is the promotor that is selected from down group: CMV, PGK, LTP;

Anti is the resistant gene that is selected from down group: Neo, Puro, Hygro, Pac;

SD is the donor sequences of RNA montage;

(b) screening embryonic stem cell survival, that have screening-gene;

(c) merge the embryonic stem cell of surviving, obtain mutated embryonic stem cell bank.

In another preference, in the described gene capturing carrier, Prom is promotor PGK; Anti is resistant gene Neo.

In another preference, also comprise step in step (b) with (c):

(b ') to its dna sample of every kind of embryo stem cell extracting and RNA sample that step (b) obtains, preserve.

In another preference, in step (b '), also comprise: for extractive dna sample and RNA sample, measure genomic dna sequence and cDNA sequence that carrier inserts the both sides, site, and set up the information database of sudden change ES cell.

In a second aspect of the present invention, a kind of mutated embryonic stem cell bank is provided, the embryonic stem cell that described embryonic stem cell bank contains is the cell of transgenation, and described cell bank prepares in order to the below method:

(a) gene capturing carrier is imported embryonic stem cell, described gene capturing carrier from 5 ' to 3 ' structure be:

SA-ST-IRES-EGFP-pA-Prom-Anti-SD

In the formula,

SA is the receptor sequence of RNA montage;

ST is the series connection terminator codon;

IRES is an internal ribosome entry site;

EGFP is the enhanced green fluorescence protein gene;

PA is the polyA sequence;

Prom is the promotor that is selected from down group: CMV, PGK, LTP;

Anti is the resistant gene that is selected from down group: Neo, Puro, Hygro, Pac;

SD is the donor sequences of RNA montage;

(b) screening embryonic stem cell survival, that have screening-gene;

(c), obtain mutated embryonic in cell bank with the embryonic stem cell of survival.

In another preference, Prom is promotor PGK; Anti is resistant gene Neo.

In a third aspect of the present invention, provide the purposes of said mutation embryonic stem cell bank of the present invention.A kind of purposes is genomic dna and the cDNA that is used to prepare mutated embryonic stem cell bank.In another preference, the stem cell clone in the described embryonic stem cell bank is used to produce transgenation genetic modification mouse.

Another purposes of mutated embryonic stem cell bank of the present invention is the embryonic stem cell clone who is used to screen the development related gene sudden change.

In another preference, described screening is to carry out in the following manner:

(a) relatively whether the ES cell clone expresses in the embryonic stem cell level at the cultivation stage mutator gene,

(b) measure the proteic Subcellular Localization of EGFP; And/or

(c) determine the ES cell clone after the blastaea injection, tissue specificity that mutator gene is expressed and temporal in embryo development procedure.

Embodiment

Optimize the gene capturing carrier system by extensive studies through going deep into for the inventor, made up new gene capturing carrier, set up sudden change ES cell clone.In conjunction with identification method for mutant gene locus, identify that mutator gene is in developmental expression of mice embryonic and the specific method of space-time, and sudden change ES cell changes the method for mouse into, and ES cell bank of the present invention can be used for finding new gene, sets up mutant mouse model and research gene and ontogenetic relation of mouse and function thereof.

Particularly, the principle that the inventive method adopts polyA to catch, used gene capturing carrier from 5 ' to 3 ' structure as follows:

SA-ST-IRES-EGFP-pA-Prom-Anti-SD

In the formula,

SA is the receptor sequence of RNA montage;

ST is the series connection terminator codon;

IRES is an internal ribosome entry site;

EGFP is enhanced green fluorescent protein (enhanced green fluorescent protein) gene (reporter gene);

PA is the polyA sequence;

Prom is a promotor, as CMV, PGK, LTP etc.;

Anti is a resistant gene, as Neo, Puro, Hygro, the Pac resistant gene, they in construction as screening-gene;

SD is the donor sequences of RNA montage.

Plasmid construction of the present invention can carry out with ordinary method.Representational maternal plasmid comprises cloning vectors commonly used such as pBluescript, puc18/19.

Each screening-gene can be used in the embryonic stem cell the active promotor of gene promoter and transcribe, as promotors such as CMV, PGK, LTP.

Carrier 5 ' end is connected with the receptor sequence (SA) of RNA montage, and 3 of carrier ' end is connected with the donor sequences (SD) of RNA montage.Be applicable to that SA of the present invention and SD element are not particularly limited, and can select various SA known in the art and SD element for use.

Gene capturing carrier imports to and can utilize ordinary method to carry out in the embryonic stem cell, infects method or electrotransfer method as pseudovirus.

After importing embryonic stem cell, gene capturing carrier of the present invention is inserted into 4 kinds of situations in the gene karyomit(e), be respectively:

1) is inserted into 5 ' control region of gene, causes gene control region to destroy and can not the normal transcription downstream gene;

2) be inserted in the gene extron subregion,, then cause protein-coding region to be interrupted and EGFP may express if this exon is the encoding histone zone;

3) be inserted in the gene intron, in RNA montage process, the EGFP gene will be fused into a mRNA molecule with the upstream and downstream exon of this intron, if the exon in this intron downstream is an albumen coded sequence, then cause protein-coding region to be interrupted and EGFP may express;

4) be inserted into gene not in the exon of proteins encoded, if be inserted in the non-coding region exon of gene 5 ' end, then the RNA that produces will only may translate the frame of EGFP gene, the gene that is inserted into can not be translated, if be inserted in the non-coding region of gene 3 ' end, then the function to gene may not influence.

Because the function sequence that is had in the capturing carrier, can make the external source fragment insert native gene and the function of destroying native gene, utilize a native gene expression regulation of being caught simultaneously but be not subjected to reading frame impact statement gene prompting to catch the space-time specificity of genetic expression, can obtain to contain the sudden change ES cell clone of a certain gene function inactivation in a large number efficiently and study mutator gene with the mice embryonic growth between relation.

Utilize the DNA and the cDNA of each ES cell clone correspondence, can adopt the method for PCR and RACE to determine that carrier inserts the mutator gene of genomic site and each ES cell clone correspondence, set up development related gene embryonic stem cell mutant cell storehouse.In addition, according to the research needs, also mutant clon is carried out microinjection and can obtain the mouse species that this gene inserts sudden change.

In the present invention, term " merging " refers to the embryonic stem cell of each survival is put together, and constitutes mutated embryonic stem cell bank.Can to be (1) mix the embryonic stem cell of a plurality of survivals in this placement, constitutes inferior storehouse; (2) genomic dna and/or the cDNA data with the embryonic stem cell of each survival are placed on information database together, and embryonic stem cell of each survival remains and deposits separately; (3) combination of above-mentioned laying method.

Utilize the present invention, will greatly improve gene recognition and gene knockout mice Study of model efficient, reduce research cost, easily form " industrialization " research general layout.This method is compared with the method that traditional usefulness homologous recombination mode is carried out gene knockout, has efficient, economic characteristics, and particularly having exempted need be at the complicated processes of each gene constructed gene targeting carrier.

Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to normal condition, people such as Sambrook for example, molecular cloning: laboratory manual (New York:Cold Spring Harbor Laboratory Press, 1989) condition described in, or the condition of advising according to manufacturer.

Embodiment 1: the structure of gene capturing carrier and function thereof

The used gene capturing carrier structure of present embodiment is as follows:

SA-ST-IRES-EGFP-pA-PGK-Neo-SD

The screening-gene of Shi Yonging is the Neo gene that does not have the PolyA signal in the present embodiment; With the promotor of PGK as Neo.3 ' end of carrier is connected with the donor sequences (SD) of RNA montage, and 5 ' end is connected with receptor sequence (SA) and series connection termination codon (ST) and the internal ribosome entry site (IRES) and the reporter gene EGFP of RNA montage.

The plasmid construction method is carried out routinely.If (do not provide concrete sequence, need the process of replenishing a little.) sequence of the whole gene capturing carrier that obtains is shown in SEQ ID NO:1.

ccgcggttta?aggagaccaa?tagaaactgg?gcttgtcgag?acagagaaga?ctcttgcgtt 60

tctgataggc?acctattggt?cttactgaca?tccactttgc?ctttctctcc?acaggatagc 120

taactgagat?cccccgggat?ccgcccctct?ccctcccccc?cccctaacgt?tactggccga 180

agccgcttgg?aataaggccg?gtgtgcgttt?gtctatatgt?tattttccac?catattgccg 240

tcttttggca?atgtgagggc?ccggaaacct?ggccctgtct?tcttgacgag?cattcctagg 300

ggtctttccc?ctctcgccaa?aggaatgcaa?ggtctgttga?atgtcgtgaa?ggaagcagtt 360

cctctggaag?cttcttgaag?acaaacaacg?tctgtagcga?ccctttgcag?gcagcggaac 420

cccccacctg?gcgacaggtg?cctctgcggc?caaaagccac?gtgtataaga?tacacctgca 480

aaggcggcac?aaccccagtg?ccacgttgtg?agttggatag?ttgtggaaag?agtcaaatgg 540

ctctcctcaa?gcgtattcaa?caaggggctg?aaggatgccc?agaaggtacc?ccattgtatg 600

ggatctgatc?tggggcctcg?gtgcacatgc?tttacatgtg?tttagtcgag?gttaaaaaaa 660

cgtctaggcc?ccccgaaccacggggacgtg?gttttccttt?gaaaaacacg?atgataatat 720

ggccacaacc?atggtgagca?agggcgagga?gctgttcacc?ggggtggtgc?ccatcctggt 780

cgagctggac?ggcgacgtaa?acggccacaa?gttcagcgtg?tccggcgagg?gcgagggcga 840

tgccacctac?ggcaagctga?ccctgaagtt?catctgcacc?accggcaagc?tgcccgtgcc 900

ctggcccacc?ctcgtgacca?ccctgaccta?cggcgtgcag?tgcttcagcc?gctaccccga 960

ccacatgaag?cagcacgact?tcttcaagtc?cgccatgccc?gaaggctacg?tccaggagcg 1020

caccatcttc?ttcaaggacg?acggcaacta?caagacccgc?gccgaggtga?agttcgaggg 1080

cgacaccctg?gtgaaccgca?tcgagctgaa?gggcatcgac?ttcaaggagg?acggcaacat 1140

cctggggcac?aagctggagt?acaactacaa?cagccacaac?gtctatatca?tggccgacaa 1200

gcagaagaac?ggcatcaagg?tgaacttcaa?gatccgccac?aacatcgagg?acggcagcgt 1260

gcagctcgcc?gaccactacc?agcagaacac?ccccatcggc?gacggccccg?tgctgctgcc 1320

cgacaaccac?tacctgagca?cccagtccgc?cctgagcaaa?gaccccaacg?agaagcgcga 1380

tcacatggtc?ctgctggagt?tcgtgaccgc?cgccgggatc?actctcggca?tggacgagct 1440

gtacaagtaa?agcggccgcg?actctagatc?ataatcagcc?ataccacatt?tgtagaggtt 1500

ttacttgctt?taaaaaacct?cccacacctc?cccctgaacc?tgaaacataa?aatgaatgca 1560

attgttgttg?ttaacttgtt?tattgcagct?tataatggtt?acaaataaag?caatagcatc 1620

acaaatttca?caaataaagc?atttttttca?ctgcattcta?gttgtggttt?gtccaaactc 1680

atcaatgtat?cttaaggcgt?aaattgtaag?cgttaatcta?gaggtcaatt?ctaccgggta 1740

ggggaggcgc?ttttcccaag?gcagtctgga?gcatgcgctt?tagcagcccc?gctgggcact 1800

tggcgctaca?caagtggcct?ctggcctcgc?acacattcca?catccaccgg?taggcgccaa 1860

ccggctccgt?tctttggtgg?ccccttcgcg?ccaccttcta?ctcctcccct?agtcaggaag 1920

ttcccccccg?ccccgcagct?cgcgtcgtgc?aggacgtgac?aaatggaagt?agcacgtctc 1980

actagtctcg?tgcagatgga?cagcaccgct?gagcaatgga?agcgggtagg?cctttggggc 2040

agcggccaat?agcagctttg?ctccttcgct?ttctgggctc?agaggctggg?aaggggtggg 2100

tccgggggcg?ggctcagggg?cgggctcagg?ggcggggcgg?gcgcccgaag?gtcctccgga 2160

ggcccggcat?tctgcacgct?tcaaaagcgc?acgtctgccg?cgctgttctc?ctcttcctca 2220

tctccgggcc?tttcgacctg?cagccaatat?gggatcggcc?attgaacaag?atggattgca 2280

cgcaggttct?ccggccgctt?gggtggagag?gctattcggc?tatgactggg?cacaacagac 2340

aatcggctgc?tctgatgccg?ccgtgttccg?gctgtcagcg?caggggcgcc?cggttctttt 2400

tgtcaagacc?gacctgtccg?gtgccctgaa?tgaactgcag?gacgaggcag?cgcggctatc 2460

gtggctggcc?acgacgggcg?ttccttgcgc?agctgtgctc?gacgttgtca?ctgaagcggg 2520

aagggactgg?ctgctattgg?gcgaagtgcc?ggggcaggat?ctcctgtcat?ctcaccttgc 2580

tcctgccgag?aaagtatcca?tcatggctga?tgcaatgcgg?cggctgcata?cgcttgatcc 2640

ggctacctgc?ccattcgacc?accaagcgaa?acatcgcatc?gagcgagcac?gtactcggat 2700

ggaagccggt?cttgtcgatc?aggatgatct?ggacgaagag?catcaggggc?tcgcgccagc 2760

cgaactgttc?gccaggctca?aggcgcgcat?gcccgacggc?gatgatctcg?tcgtgaccca 2820

tggcgatgcc?tgcttgccga?atatcatggt?ggaaaatggc?cgcttttctg?gattcatcga 2880

ctgtggccgg?ctgggtgtgg?cggaccgcta?tcaggacata?gcgttggcta?cccgtgatat 2940

tgctgaagag?cttggcggcg?aatgggctga?ccgcttcctc?gtgctttacg?gtatcgccgc 3000

tcccgattcg?cagcgcatcg?ccttctatcg?ccttcttgac?gagttcttct?gaggtaagta 3060

gaagctt 3067

Each position of components is as follows in the sequence:

SA：100-115

ST：116-132

IRES：143-728

EGFP：731-1457

pA：1611-1661

PGK：1722-2249

Neo：2250-3053

SD：3054-3067

Embodiment 2: the foundation of sudden change ES cell bank

In the present embodiment, adopt the method for plasmid electrotransfer, the gene capturing carrier that embodiment 1 is made up imports in the ES cell, and method is as follows:

Adopt Bio-Rad electricity conversion instrument 500 μ F/240V, 1.2 * 10 ⁷Cell transfecting 30-40ug linearizing gene capturing carrier plasmid, after 24-36 hour, with the substratum that contains G418 (0.3mg/ml) above-mentioned transfectional cell is cultivated with mono-clonal and to be screened, choose G418 opposing clone after 6-7 days and by whether green-emitting fluorescence is divided into two classes, frozen after the enlarged culturing, cracking prepares DNA, RNA.

The ES cell cultures is undertaken by standard method, and the trophocyte is the mouse embryo fibroblasts that the Neo gene is arranged with the former foster commentaries on classics of being commissioned to train that mitomycin was handled, and takes out a frozen ES cell from liquid nitrogen container, drops into 37 ℃ of water-baths rapidly; Put into the 15mlFalcon centrifuge tube of being with 10ml ES nutrient solution with aseptic pasteur pipe sucking-off cell, 1000rpm is centrifugal 5 minutes under the room temperature; Abandon supernatant, cell washs once with 10ml 1xPBS, the same centrifugal removal supernatant; With an amount of nutrient solution suspension cell again, seed cells in the trophocyte's who is covered with the mitomycin processing the 100mm culture dish.Cell places 37 ℃, 5%CO ₂Cell culture incubator in, keep enough humidity, renew bright nutrient solution every day, long to proper density until the ES cell, this process needs 2-3 days usually; The ES cell that is in logarithmic phase is changed nutrient solution at results precontract 4h, with PBS rinsing twice, add 2ml 0.05% trypsinase/EDTA solution, digest 3-5min under the room temperature, add 10ml ES cell culture fluid and stop digestion, blow and beat into single cell suspension with suction pipe, move in the 15ml centrifuge tube the centrifugal 5min collecting cell of 1000rpm, with 10ml PBS re-suspended cell and counting, collecting cell after centrifugal removes supernatant, adds an amount of PBS and makes cell density reach about 1.2 * 107/ml.Get in the above-mentioned ES cell suspension of 0.8ml and to add 0.1ml and contain Ca ²⁺And Mg ²⁺PBS (containing about 40 μ g) through linearizing gene trap plasmid, be added to behind the mixing in the aseptic electroporation cup, under the condition of normal temperature, with 240V, after the electrical parameter of 500 μ F carries out monopulse percussion, be suspended in again in the plate of 3.0ml ES inoculation of medium to 2 100mm and cultivate.Carry out G418 (0.3mg/ml) drug screening behind the 24-36h, change nutrient solution every day, after 5 days, change liquid every other day, the ES cell clone grows up to macroscopic cell colony behind the ES cell positive clonal growth 6-7d, can observe resistance clone and whether send the green fluorescence and the picking of classifying.Method is as follows: inverted fluorescence microscope excites light field to observe resistance clone in the plate, has the clone of green fluorescence to mark.Then with mark and unmarked clone difference picking.Method is as follows: inhale and remove nutrient solution, with 10ml PBS rinsing one time, add 5ml PBS again; At microscopically, Tip with 0.2ml draws positive colony, put into the about 5min of 96 orifice plates (concave bottom) digestion that contains 20 μ l, 0.1% trypsinase/0.04%EDTA, piping and druming gently, cell is disperseed, being transferred to collagenzation has also added in 96 orifice plates of ES cell culture medium, put in the incubator and cultivate, changed liquid in second day, treat that cell covers with 60%-80% after, reach 48 orifice plates and cultivate, after treating that cell covers with 60%-80%, get wherein 3/4 cell cryopreservation, remaining 1/4 is seeded to two only in 48 orifice plates (non-trophoblast) of collagenzation, is used for extracting genomic dna and RNA after cell 100% covers with.

Embodiment 3: the preparation of sudden change ES cell clone genomic dna and RNA

For each the sudden change ES cell clone among the embodiment 2, from 48 orifice plates that cover with the ES cell, inhale and remove nutrient solution, once with the PBS washing, every hole adds 500 μ l cell pyrolysis liquids (1mg/ml Proteinase K), 56 ℃ of digested overnight, ethanol sedimentation obtains the genomic dna sample.

The a RNA of corresponding preparation, every hole covers with in 48 orifice plates of ES cell and adds 500 μ lTrizol, and piping and druming is collected preparation RNA in the back several times repeatedly, and method is carried out according to Trizol (invitrogen) specification sheets, thereby obtains the RNA sample.

Embodiment 4: the evaluation in sudden change ES cell clone gene trap site

For the sudden change ES cell clone genomic dna among the embodiment 3, can adopt inverse PCR or joint method PCR to obtain the genome sequence that carrier inserts the both sides, site, determine that carrier inserts the position in the genome.After adopting Sau3AI or MspI digestion ES cell clone genomic dna in the present embodiment, add joint at its two ends

5’HO?GTACATATTGTCGTTAGAACGCGTAATACGACTCACTATAGGGA(SEQ?ID?NO：2)

3’CATGTATAACAGCAATCTTGCGCATTATGCTGAGTGATATCCCTCTAG?OH

After connecting, dna ligase utilizes two couples of primer (primer sequence antisense:CTG TGG AGA GAA AGG CAA AG (SEQ ID NO:3) according to the design of carrier two ends known array; Sense:cga tgc ctgctt gcc gaa ta (SEQ ID NO:4)) with primer (the primer sequence 1:GTA CAT ATT GTC GTT AGA ACG CGTA (SEQ ID NO:5) that designs according to the two ends joint sequence; 2:CGT AAT ACG ACT CACTAT AGG GAGA (SEQ ID NO:6)) PCR acquisition carrier two terminal sequences native gene group sequence is in addition carried out in pairing respectively.

For the sudden change ES cell clone RNA among the embodiment 3, the method for available 3 '-RACE and 5 '-RACE obtains the cDNA sequence that carrier inserts the both sides, site.Carry out 3 '-RACE according to Neo3 ' terminal sequence design primer (primer sequence agc aag att ctg gat tca tcg act gtg g (SEQ ID NO:7)) in the present embodiment.According to IRES 5 ' terminal sequence design primer, primer sequence is as follows:

gsp1：gca?aag?ggt?cgc?tac?aga?cgt(SEQ?ID?NO：8)

gsp2s：gcc?ctg?tct?tct?tga?cga?gca(SEQ?ID?NO：9)

gsp2as：cct?cac?att?gcc?aaa?aga?cgg(SEQ?ID?NO：10)

Carry out 5 '-RACE with above-mentioned primer.3 '-RACE and 5 '-RACE all carries out according to TaKaRa test kit specification sheets.

Embodiment 5: the analysis of sudden change ES cell clone sequence information

For the sudden change ES cell clone gene capturing carrier both sides genomic dna and the cDNA sequence that obtain among the embodiment 4, carry out bioinformatic analysis, determine the gene that is hunted down, its gene function of analyses and prediction and whether influenced, find its sino-singaporean gene, above information classification is gathered, set up database, and corresponding with sudden change ES cell bank classifying and numbering.

Embodiment 6: the Subcellular Localization of catching genetic expression

The Subcellular Localization that has expressing gene sudden change ES cell clone (green-emitting fluorescence clone is for there being expression) can carry out genetic expression for the impaired embryonic stem cell of analyses and prediction gene function among the embodiment 5.Method is as follows:

Cultivate after the recovery of frozen sudden change ES cell clone in 6 orifice plates that are placed with a sterility cover slide bottom reaching and cultivate, when cell length arrives logarithmic phase, take out slide and fix with 10% neutral formalin, laser confocal microscope is observed the green fluorescence subcellsular level location situation and the book of final entry down.

Embodiment 7: the foundation of allophenic mice and catch the evaluation of gene at the allophenic mice expression pattern

The sudden change ES cell clone impaired for analyses and prediction gene function among the embodiment 5 has or not expression (green-emitting fluorescence is cloned to expression is arranged) to divide two classes to carry out the blastaea injection by gene at embryonic stem cell.The blastaea injecting method is identical, and step is as follows:

Week post injection C57 mouse blastaea is cultivated in frozen sudden change ES cell clone recovery back.12-15 ES cell of every 30-40 blastaea injection is transplanted to the female mouse of the 3rd day acceptor of four false pregnancys then.Two acceptors of each sudden change ES cell clone are put to death at 8.5dpc (embryo is in the early stage 4-15 body segment stage) and are taken out the embryo, detect the distribution situation and the book of final entry of embryo's green fluorescence, the 3rd acceptor put to death up to 12.5 dpc and taken out the embryo, the distribution situation and the book of final entry of detection embryo green fluorescence, the normal pregnancy of the 4th the female mouse of acceptor is judged chimeric rate until mouse birth and observation allophenic mice hair color; Analysis gathers several time period records, to present same distribution person effective for three the above mosaic embryos that surpass of identical mutation ES cell clone origin, and the allophenic mice of selecting wherein important development related gene sudden change ES cell clone origin continues to breed treats phenotype analytical.

Embodiment 8: the foundation of mice develop associated gene mutation ES cell database

Analyze to sum up above development related gene sudden change ES cell clone information, comprise the sequence site, catch genetic expression Subcellular Localization, catch gene in information such as allophenic mice expression patterns, set up database and frozen ES cell database and unify.Wait to observe meaningful phenotype and can add database.

Discuss

The invention provides a kind of method of setting up extensive sudden change ES cell bank and obtaining the ES cell clone of specific gene sudden change, be characterized in utilizing gene trap and polyA to catch the method that combines and set up mouse sudden change ES cell clone storehouse.

All ES cell clones of the present invention cultivation stage can point out mutator gene the embryonic stem cell level whether express and Subcellular Localization and ES cell clone through the blastaea injection after certain method detects tissue specificity and the temporal that can point out mutator gene to express in embryo development procedure.

In addition, all ES cell clones all should have a cell DNA sample and RNA sample mutually, for these samples, can obtain the genomic dna sequence that carrier inserts the both sides, site with PCR method according to the carrier sequence; Method with 3 '-RACE and 5 '-RACE obtains the cDNA sequence that carrier inserts the both sides, site.

Insert the cDNA sequence of both sides, site according to genomic dna sequence that inserts the both sides, site and carrier, can judge that carrier inserts mouse genomic locus and function vector district and native gene splicing fusion situation, and through bioinformatic analysis prediction catch gene function and with the relation of growing, find new gene, thereby set up development related gene sudden change ES cell clone information database.According to the information data library information, by judging each ES cell clone native gene functionally inactive situation, can determine wherein significant sudden change ES cell clone quickly and easily, to set up its function of development related gene mutant mice model research.

For sudden change ES cell clone of the present invention, because the undifferentiated state when keeping its vitro culture, therefore can be through the microinjection of mouse blastaea with its genetic modification mouse model that change the specific gene sudden change into, be used for fetal development mechanism, gene function, disease incidence mechanism, drug screening etc. in body research etc.

All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.

Sequence table

＜110〉Shanghai Nanfangmoshi Biological Sci-Tech Dev Co., Ltd.

Ruijin Hospital Attached to Shanghai Medical Univ No.2

Shanghai Second Emdical University of Shanghai life science institute of Chinese Academy of Sciences health science center

Shanghai Second Emdical University

＜120〉a kind of method of screening and setting up mice develop associated gene mutation ES cell bank

<130>033915

<160>10

<170>PatentIn?version?3.1

<210>1

<211>3067

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(3067)

＜223〉gene capturing carrier

<400>1

ccgcggttta?aggagaccaa?tagaaactgg?gcttgtcgag?acagagaaga?ctcttgcgtt 60

tctgataggc?acctattggt?cttactgaca?tccactttgc?ctttctctcc?acaggatagc 120

taactgagat?cccccgggat?ccgcccctct?ccctcccccc?cccctaacgt?tactggccga 180

agccgcttgg?aataaggccg?gtgtgcgttt?gtctatatgt?tattttccac?catattgccg 240

tcttttggca?atgtgagggc?ccggaaacct?ggccctgtct?tcttgacgag?cattcctagg 300

ggtctttccc?ctctcgccaa?aggaatgcaa?ggtctgttga?atgtcgtgaa?ggaagcagtt 360

cctctggaag?cttcttgaag?acaaacaacg?tctgtagcga?ccctttgcag?gcagcggaac 420

cccccacctg?gcgacaggtg?cctctgcggc?caaaagccac?gtgtataaga?tacacctgca 480

aaggcggcac?aaccccagtg?ccacgttgtg?agttggatag?ttgtggaaag?agtcaaatgg 540

ctctcctcaa?gcgtattcaa?caaggggctg?aaggatgccc?agaaggtacc?ccattgtatg 600

ggatctgatc?tggggcctcg?gtgcacatgc?tttacatgtg?tttagtcgag?gttaaaaaaa 660

cgtctaggcc?ccccgaacca?cggggacgtg?gttttccttt?gaaaaacacg?atgataatat 720

ggccacaacc?atggtgagca?agggcgagga?gctgttcacc?ggggtggtgc?ccatcctggt 780

cgagctggac?ggcgacgtaa?acggccacaa?gttcagcgtg?tccggcgagg?gcgagggcga 840

tgccacctac?ggcaagctga?ccctgaagtt?catctgcacc?accggcaagc?tgcccgtgcc 900

ctggcccacc?ctcgtgacca?ccctgaccta?cggcgtgcag?tgcttcagcc?gctaccccga 960

ccacatgaag?cagcacgact?tcttcaagtc?cgccatgccc?gaaggctacg?tccaggagcg 1020

caccatcttc?ttcaaggacg?acggcaacta?caagacccgc?gccgaggtga?agttcgaggg 1080

cgacaccctg?gtgaaccgca?tcgagctgaa?gggcatcgac?ttcaaggagg?acggcaacat 1140

cctggggcac?aagctggagt?acaactacaa?cagccacaac?gtctatatca?tggccgacaa 1200

gcagaagaac?ggcatcaagg?tgaacttcaa?gatccgccac?aacatcgagg?acggcagcgt 1260

gcagctcgcc?gaccactacc?agcagaacac?ccccatcggc?gacggccccg?tgctgctgcc 1320

cgacaaccac?tacctgagca?cccagtccgc?cctgagcaaa?gaccccaacg?agaagcgcga 1380

tcacatggtc?ctgctggagt?tcgtgaccgc?cgccgggatc?actctcggca?tggacgagct 1440

gtacaagtaa?agcggccgcg?actctagatc?ataatcagcc?ataccacatt?tgtagaggtt 1500

ttacttgctt?taaaaaacct?cccacacctc?cccctgaacc?tgaaacataa?aatgaatgca 1560

attgttgttg?ttaacttgtt?tattgcagct?tataatggtt?acaaataaag?caatagcatc 1620

acaaatttca?caaataaagc?atttttttca?ctgcattcta?gttgtggttt?gtccaaactc 1680

atcaatgtat?cttaaggcgt?aaattgtaag?cgttaatcta?gaggtcaatt?ctaccgggta 1740

ggggaggcgc?ttttcccaag?gcagtctgga?gcatgcgctt?tagcagcccc?gctgggcact 1800

tggcgctaca?caagtggcct?ctggcctcgc?acacattcca?catccaccgg?taggcgccaa 1860

ccggctccgt?tctttggtgg?ccccttcgcg?ccaccttcta?ctcctcccct?agtcaggaag 1920

ttcccccccg?ccccgcagct?cgcgtcgtgc?aggacgtgac?aaatggaagt?agcacgtctc 1980

actagtctcg?tgcagatgga?cagcaccgct?gagcaatgga?agcgggtagg?cctttggggc 2040

agcggccaat?agcagctttg?ctccttcgct?ttctgggctc?agaggctggg?aaggggtggg 2100

tccgggggcg?ggctcagggg?cgggctcagg?ggcggggcgg?gcgcccgaag?gtcctccgga 2160

ggcccggcat?tctgcacgct?tcaaaagcgc?acgtctgccg?cgctgttctc?ctcttcctca 2220

tctccgggcc?tttcgacctg?cagccaatat?gggatcggcc?attgaacaag?atggattgca 2280

cgcaggttct?ccggccgctt?gggtggagag?gctattcggc?tatgactggg?cacaacagac 2340

aatcggctgc?tctgatgccg?ccgtgttccg?gctgtcagcg?caggggcgcc?cggttctttt 2400

tgtcaagacc?gacctgtccg?gtgccctgaa?tgaactgcag?gacgaggcag?cgcggctatc 2460

gtggctggcc?acgacgggcg?ttccttgcgc?agctgtgctc?gacgttgtca?ctgaagcggg 2520

aagggactgg?ctgctattgg?gcgaagtgcc?ggggcaggat?ctcctgtcat?ctcaccttgc 2580

tcctgccgag?aaagtatcca?tcatggctga?tgcaatgcgg?cggctgcata?cgcttgatcc 2640

ggctacctgc?ccattcgacc?accaagcgaa?acatcgcatc?gagcgagcac?gtactcggat 2700

ggaagccggt?cttgtcgatc?aggatgatct?ggacgaagag?catcaggggc?tcgcgccagc 2760

cgaactgttc?gccaggctca?aggcgcgcat?gcccgacggc?gatgatctcg?tcgtgaccca 2820

tggcgatgcc?tgcttgccga?atatcatggt?ggaaaatggc?cgcttttctg?gattcatcga 2880

ctgtggccgg?ctgggtgtgg?cggaccgcta?tcaggacata?gcgttggcta?cccgtgatat 2940

tgctgaagag?cttggcggcg?aatgggctga?ccgcttcctc?gtgctttacg?gtatcgccgc 3000

tcccgattcg?cagcgcatcg?ccttctatcg?ccttcttgac?gagttcttct?gaggtaagta 3060

gaagctt 3067

<210>2

<211>44

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉joint

<400>2

gtacatattg?tcgttagaac?gcgtaatacg?actcactata?ggga 44

<210>3

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>3

ctgtggagag?aaaggcaaag 20

<210>4

<211>20

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>4

cgatgcctgc?ttgccgaata 20

<210>5

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>5

gtacatattg?tcgttagaac?gcgta 25

<210>6

<211>25

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>6

cgtaatacga?ctcactatag?ggaga 25

<210>7

<211>28

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>7

agcaagattc?tggattcatc?gactgtgg 28

<210>8

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>8

gcaaagggtc?gctacagacg?t 21

<210>9

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

＜223〉primer

<400>9

gccctgtctt?cttgacgagc?a 21

<210>10

<211>21

<212>DNA

＜213〉artificial sequence

<220>

<221>misc_feature

<222>(1)..(21)

＜223〉primer

<400>10

cctcacattg?ccaaaagacg?g 21

Claims (10)

1. a method of setting up mutated embryonic stem cell bank is characterized in that, comprises step:

(a) gene capturing carrier is imported embryonic stem cell, described embryonic stem cell is a mouse embryo stem cell, and described gene capturing carrier from 5 ' to 3 ' structure be:

SA-ST-IRES-EGFP-pA-Prom-Anti-SD

In the formula,

SA is the receptor sequence of RNA montage;

ST is the series connection terminator codon;

IRES is an internal ribosome entry site;

EGFP is the enhanced green fluorescence protein gene;

PA is the polyA sequence;

Prom is the promotor that is selected from down group: cytomegalovirus is early promoter CMV or phosphoglycerokinase promotor PGK at once;

Anti is the resistant gene that is selected from down group: neomycin resistance gene Neo, puromycin resistance gene Puro or hygromycin B resistant gene Hygro;

SD is the donor sequences of RNA montage;

(b) screening embryonic stem cell survival, that have screening-gene;

(c) merge the embryonic stem cell of surviving, obtain mutated embryonic stem cell bank.

2. the method for claim 1 is characterized in that, in the described gene capturing carrier, Prom is phosphoglycerokinase promotor PGK; Anti is neomycin resistance gene Neo.

3. the method for claim 1 is characterized in that, also comprises step in step (b) with (c):

(b ') to its dna sample of every kind of embryo stem cell extracting and RNA sample that step (b) obtains, preserve.

4. method as claimed in claim 3, it is characterized in that, in step (b '), also comprise: for extractive dna sample and RNA sample, measure genomic dna sequence and cDNA sequence that carrier inserts the both sides, site, and set up the information database of sudden change ES cell.

5. a mutated embryonic stem cell bank is characterized in that, the embryonic stem cell that described embryonic stem cell bank contains is the cell of transgenation, and described embryonic stem cell is a mouse embryo stem cell, and described cell bank prepares in order to the below method:

(a) gene capturing carrier is imported embryonic stem cell, described gene capturing carrier from 5 ' to 3 ' structure be:

SA-ST-IRES-EGFP-pA-Prom-Anti-SD

In the formula,

SA is the receptor sequence of RNA montage;

ST is the series connection terminator codon;

IRES is an internal ribosome entry site;

EGFP is the enhanced green fluorescence protein gene;

PA is the polyA sequence;

Prom is the promotor that is selected from down group: cytomegalovirus is early promoter CMV or phosphoglycerokinase promotor PGK at once;

Anti is the resistant gene that is selected from down group: neomycin resistance gene Neo, puromycin resistance gene Puro or hygromycin B resistant gene Hygro;

SD is the donor sequences of RNA montage;

(b) screening embryonic stem cell survival, that have screening-gene;

(c) with the embryonic stem cell of survival, obtain mutated embryonic stem cell bank.

6. cell bank as claimed in claim 5 is characterized in that, Prom is phosphoglycerokinase promotor PGK; Anti is neomycin resistance gene Neo.

7. the purposes of mutated embryonic stem cell bank as claimed in claim 5 is characterized in that, is used to prepare the genomic dna and the cDNA of mutated embryonic stem cell bank.

8. purposes as claimed in claim 7 is characterized in that, the stem cell clone in the described embryonic stem cell bank is used to produce transgenation genetic modification mouse.

9. the purposes of mutated embryonic stem cell bank as claimed in claim 5 is characterized in that, is used to screen the embryonic stem cell clone of development related gene sudden change.

10. purposes as claimed in claim 9 is characterized in that, described screening is to carry out in the following manner:

(a) relatively embryonic stem cell is whether the ES cell clone expresses in the embryonic stem cell level at the cultivation stage mutator gene,

(b) measuring green fluorescent protein is the proteic Subcellular Localization of EGFP; And/or

(c) determine the ES cell clone after the blastaea injection, tissue specificity that mutator gene is expressed and temporal in embryo development procedure.