CN100422325C - Germ-responsive promoter - Google Patents

Germ-responsive promoter Download PDF

Info

Publication number
CN100422325C
CN100422325C CNB2003801092960A CN200380109296A CN100422325C CN 100422325 C CN100422325 C CN 100422325C CN B2003801092960 A CNB2003801092960 A CN B2003801092960A CN 200380109296 A CN200380109296 A CN 200380109296A CN 100422325 C CN100422325 C CN 100422325C
Authority
CN
China
Prior art keywords
dna
plant
gene
potato
promotor
Prior art date
Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
Expired - Fee Related
Application number
CNB2003801092960A
Other languages
Chinese (zh)
Other versions
CN1745171A (en
Inventor
吉冈博文
Current Assignee (The listed assignees may be inaccurate. Google has not performed a legal analysis and makes no representation or warranty as to the accuracy of the list.)
Nagoya Industrial Science Research Institute
Original Assignee
Nagoya Industrial Science Research Institute
Priority date (The priority date is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the date listed.)
Filing date
Publication date
Application filed by Nagoya Industrial Science Research Institute filed Critical Nagoya Industrial Science Research Institute
Publication of CN1745171A publication Critical patent/CN1745171A/en
Application granted granted Critical
Publication of CN100422325C publication Critical patent/CN100422325C/en
Anticipated expiration legal-status Critical
Expired - Fee Related legal-status Critical Current

Links

Images

Landscapes

  • Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
  • Micro-Organisms Or Cultivation Processes Thereof (AREA)

Abstract

It is intended to provide a promoter responding specifically to germ infection (i.e., a germ-responsive promoter). Namely, a germ-responsive promoter containing DNA comprising the PVS3 promoter region (SEQ ID NO:1) of potato plant. A region (SEQ ID NO:23) being important in the promoter activity.

Description

Germ-responsive promoter
Technical field
The present invention relates to anti-microbial pathogen plant that pathogenic bacteria is had the promotor of responsiveness and utilizes this promotor.
Background technology
Exist clear and definite microspecies-interracial specificity parasitism between phytophthora infestans (Phytophthora infestans) and the potato plants, the combination of the true resistance gene that avirulence gene that this narrow spectrum host-pathogenic bacteria mutual relationship is possessed by pathogenic bacteria mostly and host are had decides.When attempt infecting non-affinity microspecies, induced the dynamic resistance reaction among the host.Promptly, express the resistance of anaphylaxiss such as the generation follow active oxygen generations, supersensitized cell death, phytoalexin (being Rishitin in the potato), the proteic expression of PR (pathology is relevant), papilla formation, lignifying in the infected tissue and react, the development of pathogenic bacteria stops ( reference literature 15,32,44,45 and 47).On the other hand, when infecting the affinity microspecies, can not induce these resistance reactions, the intrusion of pathogenic bacteria is developed, causes that the whole strain of mortality of potato plants is infected sick---the late blight of potato.
Can think that one of most important local resistance reaction is accumulating of phytoalexin in these dynamic resistance reactions.Phytoalexin is induced the small-molecule substance of accumulating with anti-microbial effect when infection pathogen, have document to show that it has brought into play important effect ( reference literature 12,13,21,28 and 46) when whether decision is infected.Phytoalexin in the potato is a sesquiterpenoid, by isoprenoid metabolic system synthetic (Fig. 1).
In the potato, knownly handle or inoculate non-affinity microspecies by releaser, isoprenoid is synthetic to be converted to the synthetic of sesquiterpene phytoalexin sharp by the sterol glycoalkaloid is synthetic.This phenomenon may be since in the rate-limiting step of isoprenoid synthesis system synergistic squalene synthase and sesquiterpene cyclase regulate, these two kinds of enzymes make this system's deflection sterol glycoalkaloid route of synthesis or isoprenoid phytoalexin route of synthesis (reference literature 8) respectively.The sesquiterpene cyclase of potato is the vetispiradiene synthase, and it is named as potato vetispiradiene synthase (reference literature 53).There is report to point out: to handle active significantly increase (reference literature 54) of the PVS of potato tuber tissue by the inoculation pathogenic bacteria with through releaser HWC from the phytophthora infestans cell walls.In the also known tobacco plant, handle by releaser, the sesquiterpene route of synthesis activates, and has synthesized a kind of phytoalexin---capsicum glycol ( reference literature 42 and 48).Recently, these phenomenons are illustrated at gene expression dose.Separate the PVS of potato and the cDNA of squalene synthase, clone as probe with these, when the RNA that use is extracted by potato tuber carries out the Nortern engram analysis, confirm in affinity and non-affinity microspecies inoculation district, to have induced the instantaneous of PVS mRNA to accumulate.Also show on the other hand: observe site of injury squalene synthase inductive mRNA and accumulate, be suppressed (reference literature 53) because of inoculating affinity and non-affinity microspecies.But, this report and only phytoalexin biosynthesizing when the non-affinity microspecies of inoculation, the situation that the pathogenic bacteria development stops is contradiction (reference literature 40).
Usually the gene of known a lot of plants constitutes multigene family, and each homologous gene has the Different Organs specificity, the different effect of performance in the metabotic change that stimulation responses is produced.Have report to point out: the PVS gene in the potato plants forms multigene family, has PVS1～4 members (reference literature 53).But the detailed content of relevant these each member's expressions does not have argumentation.
(document 1)
Altschul，S.F.，Gish，W.，Miller，W.，Myers，E.W.and?Lipman，D.J.(1990)Basic?local?alignment?search?tool.J.Mol.Biol.215，403-410.
(document 2)
Arumuganathan，K.?and?Earle，E.D.(1991)Nuclear?DNA?content?ofsome?important?plant?species.Plant?Mol.?Biol.Reporter?9，208-218.
(document 3)
Back，K.and?Chappel，J.(1995)Cloning?and?bacterial?expression?of?asesquiterpene?cyclase?from?Hyoscyamus?muticus?and?its?molecularcomparison?to?rerated?terpene?cyclases.J.Biol.Chem.270，7375-7381.
(document 4)
Back，K.and?Chappel，J.(1996)Identtifying?functional?domainswithin?terpene?cyclase?using?domain-swapping?strategy.Proc.Natl.Acad.Sci.USA?93，6841-6845.
(document 5)
Back，K.and?Chappel，J.(1998)Cloning?and?bacterial?expression?of?asesquiterpene?cyclase，a?key?branch?point?enzme?for?the?snthesis?ofsesquiterpenoid?phytoalexn?capsidiol?in?UV-changed?leaves?of?Capsiumannum.Plant?Cell?Physiol.39，899-904.
(document 6)
Bradford，M.M.(1976)A?rapid?and?sensitive?method?for?thequantitation?of?microgram?quantities?of?protein?utilizing?the?principle?ofprotein-dye?binding.Anal.Biochem.72，248-254.
(document 7)
Chang，J.H.，Tai，Y.-S.，Bernal，A.J.，Lavelle，D.T.，Staskawicz，B.J.and?Michelmore，R.W.(2002)Functional?analyses?of?the?Pto?resistancegene?family?in?tomato?and?the?identification?of?a?minor?resistancedeterminant?in?a?susceptible?haplotype.Mol.Plant-Microbe?Interact.15，281-291.
(document 8)
Chappell，J.(1995)The?biochemistry?and molecular?biology?ofisoprenoid?metabolism.Plant?Physiol.107，1-6.
(document 9)
Choi，D.，Ward，B.L.and?Bostock，R.M.(1992)Differential?inductionand?suppression?of?potato?3-hydroxy-3-methylglutaryl?coenzyme?Areductase?genes?in?elicitor?arachidonic?acid.Plant?Cell?4，1333-1344.
(document 10)
Chomczynski，P.and?Sacchi，N.(1987)Single-step?method?of?RNAisolation?by?acid?guanidium?hiocyanate-phenol-chloroform?extraction.Anal.Biochem.162，156-159.
(document 11)
Cruickshark，I.A.M.and?Perrin，D.R.(1960)The?isolation?andparticular?characterization?of?monilicolin?A，a?polypeptide?withphaseollin-inducing?activity?from?Monilinia?fructicola.Life?Sci.7，449-458.
(document 12)
Darvill，A.G.and?Albersheim，P.(1984)Phytoalexins?and?theirelicitors?a?defense?against?microbial?infection?in?plants.Annu.Rev.Plant?Physiol.35，243-275.
(document 13)
Dixon，R.A.and?Harrison，M.J.(1990)Activation，structure?andorganization?of?genes?involved?in?microbial?defence?in?plants.Adv.Genet.28，165-234。
(document 14)
Doke，N.and?Tomiyama，K.(1980)Effect?of?hypal?wall?componentsfrom?Phythophthora?infestans?on?protoplasts?of?potato?tuber?tissue.Physiol.Plant?Pathol.16，169-176.
(document 15)
Doke，N.(1983)Involvement?of?superoxide?anion?generation?in?thehypersensitive?response?of?potato?tuber?tissues?to?infection?with?anincompatible?race?of?Phythophthora?infestans?and?to?the?hyphal?wallcomponents.Physiol.?Plant?Pathol.23，345-357.
(document 16)
Facchini，P.J.and?Chappel，J.(1992)Gene?fmily?for?an?elicitor-indused?sesquiterpene?cyclase?in?tabacco.Proc.Natl.Acad.Sci.USA?89，11088-11092.
(document 17)
Feinberg，A.P.?and?Vogelstein，B.(1983)A?technique?forradiolabelling?DNA?reaction?endoncrease?fragments?to?high?specificactivity.Anal.Biochem.136，6-13.
(document 18)
Hashimoto，T.，Yamada，T.，Tada，A.，Kawamata，S.，Tanaka，Y.，Sriprasertsak，P.，Ichinose，Y.，Kato，H.，Izutsu，S.，Shiraishi，T.，Oku，H.and?Ohtsuki，Y.(1992)Transient?expression?of?a?phenylalanine?ammonia-lyase?promoter.?Plant?Cell?Reports，11，183-187.
(document 19)
Jefferson，R.A.(1987)Assaying?chimeric?genes?in?plants：The?GUSgene?fusion?system.Plant?Mol.?Biol.Rep.5，387-405.
(document 20)
Katou，S.，Senda，K.，Yoshioka，H.，Doke，N.and?Kawakita，K.(1999)A?51?kDa?protein?kinase?of?potato?activated?with?hyphal?wall?componentsfrom?Phytophthora?infestans.Plant?Cell?Physiol.40，825-831.
(document 21)
Kuc，J.and?Rush，R.J.(1985)Phytoalexins.Arch.Biochem.Biophys.236，455-472.
(document 22)
Laemmli，U.K.(1970)Cleavage?of?structural?proteins?during?theassembly?of?the?head?of?bacteriophage?T4.Nature?277，680-685.
(document 23)
Leader，P.，Tiemerier，D.and?Enguist，L.(1977)EK2?derivatives?ofbacterio-phage?lambda?useful?in?the?cloning?of?DNA?from?higherorganisms.Science?196，175-177.
(document 24)
Maniaitis，T.，Frritsch，E，F.and?Sambrock，J.(1982)MolecularCloning：A?Laboratory?Manual.(Cold?Spring?Harbor，NY：Cold?SpringLaboratry)
(document 25)
McNeil，J.B.(1988)Functional?Characterization?of?a?Pyrimidine-Rich?Element?in?the?5’-Noncoding?Region?of?the?Yeast?Iso-1-Cytochromec?Gene.Mol.?Cel.?Biol.8，1045-1054.
(document 26)
Metlitsky，L.V.，Ozeretskovskaya，O.L.，Vasyukova，N.J.，Davydova，M.A.，Dorozhkin，N.A.，Remneva，Z.J.and?Ivanyuk，V.G.(1970)Potatoresistance?to?Phytophthora?infestans?as?related?to?leaf?phytoalexin?activity.Prikl.Biokhim.Mikrobiol.5，568-573.
(document 27)
Tian Long (1984) DNA Jinization ,=ダ イ Na ミ Star Network To Jinization The Ru eukaryote send Den=, divide sub-Jin chemistry to go into Door, Motoo Kimura's spoke, training Wind Museum, card capital, pp.56-90.
(document 28)
Moesta，P.and Grisebach，H.(1982)L-O-Aminooxy-3-phenylpropionic?acid?inhibits?phytoalexin?accumulation?in?soybean?withconcominant?loss?of?resistance?against?Phythophthora?megasperma?f.sp.glycinea.Physiol.Plant?Pathol.21，65-70.
(document 29)
Murai，A.，Sato，S.，Osada，A.，Katsui，N.and?Masamune，T.(1982)Biosynthesis?from?solavetivone?of?the?phytoalxin?risitin?in?potato.J.Chem.Soc.Chem.Commun.，32
(document 30)
Murray.M.G.and?Thompsin，W.F.(1980)Rapid?isolationh?of?high-molecular-weight?plant?DNA.Nucleic?Acids.Res.8，4321-4325
(document 31)
Narita，J.O.and?Gruissem，W.(1989)Tomato?hydroxy-methylglutaryl-CoA?reductase?is?required?early?in?fruit?development?butnot?during?ripening.Plant?Cell?1，181-190.
(document 32)
Oba，K.，Kondo，K.，Doke，N.and?Uritani，I.(1985)Induction?of?3-hydroxy-3-methylglutaryl?CoA?reductase?in?potato?tubers?after?slicing，fungal?infection?or?chemical?treatment，and?some?properties?of?the?enzyme.Plant?Cell?Physiol.26，873-880.
(document 33)
Ren，D.，Yang，H.and?Zhang，S.(2002)Cell?death?mediated?by?MAPKis?associated?with?hydrogen?peroxide?production?in?Arabidopsis.J.Biol.Chem.277，559-565.
(document 34)
Rohwer，F.，Fritzemeier，K.H.，Scheel，D.，and?Hahlbrock，K.(1987)Biochemical?reactions?of?different?tissues?of?potato(solanum?tuberosum)to?zoospores?or?elicitors?from?Phytophthora?infestans.Planta?170，556-561.
(document 35)
Romeis，T.，Piedras，P.，Zhang，S.，Klessig，D.F.，Hirt，H.and?Jones，J.D.G.(1999)Rapid?Avr9-and?Cf-9-dependent?activation?of?MAP?kinasesin?tobacco?cell?cultures?and?leaves：convergence?of?resistance?gene，elicitor，wound，and?salicylate?responses.Plant?Cell?11，237-287.
(document 36)
Reed，K.C.and?Mann，D.A.(1985)Rapid?transfer?of?DNA?fromagarose?gel?to?nylon?membranes.Nucleic?Acids?Res.13，7207-7221.
(document 37)
Sambrook，J.，Fritsch，E.F.and?Maniatis，T.(1989)MolecularCloning：A?Laboratory?Mannual，2nd?ed.Cold?Spring?Harbor，NY：ColdSpring?Harbor?Laboratory.
(document 38)
Sanger，F.，Nicklen，S.and?Coulson，A.R.(1977)DNA?sequencingchain-terminating?inhibitors.Proc.Natl.Acad.Sci.USA?74，5463-5467.
(document 39)
Starks，C.M.，Back，K.，Chappel，J.and?Noel，J.P.(1997)Structurebasis?for?cyclic?terpene?biosynthesis?by?tabacco?5-epi?aristolochenesynthase.Science?277，1815-1820.
(document 40)
Stermer，B.A.and?Bostock，R.M.(1987)Involvement?of?3-hydroxy-3-methylglutaryl?coenzyme?A?reductase?in?regulation?of?sesquiterpenoidphytoalexin?synthesis?in?potato.Plant?Physiol.84，404-408.
(document 41)
Thomas，C.M.，Tang，S.，Hammond-Kosack，K.E.and?Jones，J.D.G.(2000)Comparison?of?the?hypersensitive?response?induced?by?the?tomatoCf-4?and?Cf-9?genes?in?Nicotiana?spp.Mol.Plant-Microbe?Interact.13，465-469.
(document 42)
Threfall，D.R.and?Whitehead，I.M.(1988)Co-ordinated?inhibition?ofsqualene?synthetase?and?induction?of?enzymes?of?sesquiterpenoidphytoalexin?biosynthesis?in?cultures?of?Nicotiana?tabacum.Phytochemistry?27，2567-2580.
(document 43)
Thompson，J.D.，Higgins，D.G.and?Gibson，T.J.(1994)CLUSTALW：improving?the?sensitivity?of?progressive?multiple?sequence?alignmentthrough?sequence?weighting，positions-specific?gap?penalties?and?weightmatrix?choice.Nncleic?Acids?Res.22，4673-4680.
(document 44)
Tomiyama，K.(1968)Further?observation?on?the?time?requirement?forhypersensitive?cell?death?of?potatoes?infected?by?Phytophthora?infestansand?its?reaction?to?metabolic?activity.Phytopathology?58，367-378.
(document 45)
Vance，C.P.?and?Sherwood，R.T.(1977)Lignified?papilla?formation?asa?mechanism?for?protection?in?reed?canarygrass.Physiol.?Plant?Pathol.10，247-256.
(document 46)
VanEtten，H.D.，Matthews，D.E.and?Matthews，P.S.(1989)Phytoalexin?detoxyfication：Importance?for?pathogenicity?and?practicalimplications.Annu.Rev.Phytopathol.?27，143-164
(document 47)
Van?Loon，L.C.and?Van?Kammen，A.(1970)Polyacrylamide?discelectrophoresis?of?the?soluble?leaf?proteins?from?Nicotiana?tabacum?var.‘Samsun’and‘Samsun?NN’.Virology?40，199-211.
(document 48)
Figure C20038010929600111
U.and?Chappel，J.(1988)Induction?of?sesquiterpene?cyclaseand?suppression?of?squalene?synthase?activities?in?plant?cell?culturestreated?with?fungal?elicitor.Plant?Physiol.88，1291-1296.
(document 49)
Wilson，U.E.and?Coffey，M.D.(1980)Cytological?evaluation?ofgeneral?resistance?to?Phytophthora?infestans?in?potato?foliage.Ann.Bot.45，81-90.
(document 50)
Yang，K.-Y.，Liu，Y.and?Zhang，S.(2001)Activation?of?a?mitogen-activated?protein?kinase?pathway?is?involved?in?disease?resistance?intobacco.Proc.Natl.Acad.Sci.USA?98，741-746.
(document 51)
Yin，S.，Mei，L.，Newman，J.，Back，K.，and?Chappell，J.(1997)Regulation?of?sesquiterpene?cyclase?gene?expression：characterization?ofan?elicitor-and?pathogen-inducible?promoter.Plant?Physiol.115，437-451.
(document 52)
Yoshioka，H.，Miyabe，M.，Hayakawa，Y.and?Doke，N.(1996)Expression?of?genes?for?phenylalanine?ammonia-lyase?and?3-hydroxy-3-methylglutaryl?CoA?reductase?in?aged?potato?tubers?infected?withPhytophthora?infestans.Plant?Cell?Physiol.37，81-90.
(document 53)
Yoshioka，H.，Yamada，N.and?Doke，N.(1999)cDNA?cloning?ofsesquiterpene?cyclase?and?squalene?synthase，and?expression?of?the?genesin?potato?tuber?infected?with?Phytophthora?infestans.Plant?Cell?Physiol.40，993-998.
(document 54)
Zook，M.N.and?Kuc，J.A.(1991)Induction?of?sesquiterpene?cyclaseand?supression?of?squalene?synthetase?activity?in?elicitor?treated?or?fungalinfected?potato?tuber?tissue.Physiol.Mol.?Plant?Pathol.39，377-390.
(document 55)
Towbin，H.，Staehelin，T.and?Gordon，J.(1979)Electrophoretictransfer?of?proteins?from?polyacrylamide?gels?to?nitrocellulose?sheets：procedure?and?some?applications.Proc.Natl.Acad.Sci.USA?76，4350-4354.
(document 56)
Bhattacharyya，M.K.，Paiva，N.L.，Dixon，R.A.，Korth，K.?L.andStermer，B.A.(1995)Features?of?the?hmg1?subfamily?of?genes?encodingHMG-CoA?reductase?in?potato.Plant?Mol.Biol.?28，1-15.
(document 57)
Asai，T.，Tena，G.，Plotnikova，J.，Willmann，M.R.Chiu，W.-L.，Gomez-Gomez，L.，Boller，T.，Ausubel，F.M.，and?Sheen，J.(2002)MAPkinase?signalling?cascade?in?Arabidopsis?innate?immunity.Nature?415，977-983.
(document 58)
Cardinale，F.，Jonak，C.，Ligterink，W.，Niehausi，K.，Boller，T.andHirt，H.(2000)Differential?activation?of?four?specific?MAPK?pathways?bydistinct?elicitors.J.Biol.Chem.275，36734-36740.
(document 59)
Banlcombe，D.C.(1999)Fast?forward?genetics?based?on?virus-inducedgene?silencing.Curr.Opin.Plant?Biol.?2：109-113.
(document 60)
Gallagher，S.R.(1992)GUS?Protocols：Using?the?GUS?Gene?as?aReporter?of?Gene?Expression.3.Quantitation?of?GUS?activity?byfluorometry.Gallagher，ed.San?Diego，CA，Academic?Press.pp.47-59.
(document 61)
Hellens，R.P.，Edwards，A.E.，Leyland，N.R.，Bean，S.，and?Mullineaux，P.M.(2000)pGreen：A?versatile?and?flexible?binary?Ti?vector?forAgrobacterium-mediated?plant?transformation.Plant?Mol.?Biol.?42：819-832.
(document 62)
Kamoun，S.，van?West，P.?V.，Jung，A.J.，Vleeshouwers，V.G.A.A.，Groot，K.E.and?Govers，F.(1997)A?gene?encoding?a?protein?elicitorPhytophthora?infestans?is?down-regulated?during?infection?of?tomato.Mol.Plant-Microbe?Interact?10：13-20.
(document 63)
Kamoun，S.，West，P.V.，Vleeshouwers，V.G.A.A.，Groot，K.E.andGovers，F.(1998)Resistance?of?Nicotiana?benthamiana?to?Phytophthorainfestans?is?mediated?by?the?recognition?of?the?elicitor?protein?INF1.PlantCell?10：1413-1425.
(document 64)
Katou，S.，Yamamoto，A.，Yoshioka，H.，Kawakita.，K.and?Doke，N.(2003)Functional?analysis?of?potato?mitogen-activated?protein?kinasekinase，StMPK1.J.Gen.Plant?Pathol.?69：161-168.
(document 65)
MAPK?group(2002)Mitogen-activated?protein?kinase?cascades?inplants：a?new?nomenclature.Trends?Plant?Sci.7：301-308.
(document 66)
Mitchell，P.J.and?Tjian，R.(1989)Transcriptional?regulation?inmammalian?cells?by?sequence-specific?DNA?binding?proteins.Science?245：371-378.
(document 67)
Ratcliff，F.，Martin-Hernandez，A.M.and?Baulcomb，D.C.(2001)Tobacco?rattle?virus?as?a?vector?for?analysis?of?gene?function?by?silencing.Plant?J.25：237-245.
(document 68)
Reed，K.C.and?Mann，D.A.(1985)Rapid?transfer?of?DNA?fromagarose?gel?to?nylon?membranes.Nucleic?Acids?Res.13：7207-7221.
(document 69)
Samuel，M.A.and?Ellis，B.，E.(2002)Double?jeopardy：bothoverexpression?and?supression?of?a?redox-activated?plant?mitogen-activated?protein?kinase?render?tobacco?plants?ozone?sensitive.Plant?Cell14：2059-2069.
(document 70)
Voinnet，O.(2001)RNA?silencing?as?a?plant?immune?system?againstviruses.Trends?genet.17：449-459.
(document 71)
Yoshioka，H.，Numata，N.，Nakajima，K.，Katou，S.，Kawakita，K.，Rowland，O.，Jones，J.D.G.and?Doke，N.(2003)Nicotiana?benthamianagp91 phox?homologs?NbrbohA?and?NbrbohB?participate?in?H 2O 2accumulation?and?resistance?to?Phytophthora?infestans.Plant?Cell?15：706-718.
(document 72)
Zhang，S.，Du，H.and?Klessig，D.F.(1998)Activation?of?the?tobaccoSIP?kinase?by?both?a?cell?wall-derived?carbohydrate?elicitor?and?purifiedproteinaceous?elicitors?from?Phytophthora?spp.Plant?Cell?10：435-449.
(document 73)
Zhang，S.and?Liu，Y.(2001)Activation?of?salicylic?acid-inducedprotein?kinase，a?mitogen-activated?protein?kinase，induces?multipledefensc?responses?in?tobacco.Plant?Cell?13：1877-1889.
(document 74)
Zuo，J.，Niu，Q.-W.and?Chua，N.-H.(2000)An?estrogen?receptor-based?transactivator?XVE?mediates?highly?inducible?gene?expression?intransgenic?plants.Plant?J.24：265-273.
Summary of the invention
The resistance that people attempt to utilize plant to possess is reacted and is enhanced disease resistance.A research wherein is to utilize disease responsive promoter specificity when disease to generate the method for induction of resistance material.According to described method, can be specifically during disease and promptly generate the induction of resistance material, realize effectively defence thus.
Found several disease responsive promoters in the past, but up to now, the disease responsive promoter of being reported is induced when pathogenic bacterial infection not only, also induced in wound or at growth phase mostly.Therefore, use such promotor preparation to import the transgenic plant of induction of resistance material generation genes involved, (beyond during infection) transgenosis is also expressed beyond the infection site of pathogenic bacteria, can envision plant and can therefore be injured.The present invention finishes under above background, and its purpose is: the promotor of replying for the infection specificity of pathogenic bacteria (germ-responsive promoter) is provided, and utilizes this promotor to prepare method of anti-microbial pathogen plant etc.
The inventor is in view of above problem, and the late disease bacteria of attempting obtaining from potato plants for as the pathogenic bacteria representative has the promotor of special responsiveness.At first research is concentrated on the gene relevant---potato vetispiradiene synthase (PVS), at length studied the expression of each PVS member (PVS1-PVS4) in the main primary infection position leaf texture of late disease bacteria with the generation of phytoalexin.The result learns: when having only PVS3 to inoculate affinity microspecies or non-affinity microspecies all by induced strong.The promotor that promptly shows PVS3 infects for the affinity microspecies and also shows responsiveness.
Next, make up potato gene group library, attempt utilizing this library to understand the sequence of PVS3.Through repeatedly screening, finally successfully determined the PVS3 genomic dna sequence.At the promoter region of inferring PVS3, when studying its function, confirmed responsiveness to late disease bacteria according to determined sequence information.In order further to study the function that this infers promoter region in great detail, at first connect this and infer promoter region in the upstream of gus gene, it is imported potato, preparation Transformation of potato body.Use this transformant to carry out various tests, the result does not see the GUS dyeing that leaf texture's excision (wound) causes, and seen the GUS dyeing that inoculation late disease bacteria affinity microspecies cause, confirm thus this promoter region show late disease bacteria specifically, be pathogenic bacteria specificity responsiveness.
As mentioned above, the present invention has successfully obtained pathogenic bacterial infection is shown the promotor (germ-responsive promoter) that specificity is replied.The plant that utilizes this promotor to prepare only when infection pathogen, to make special genes to express.That is, import in the transformant of gained behind the gene be connected with this promotor, when pathogenic bacterial infection, the promotor of importing is induced by specificity, and render transgenic is expressed as a result.Can activate gene that defence replys as transgenosis if adopt, in the time of then can preparing the infection when pathogenic bacteria, but specificity activates the plant that defence is replied, and, can prepare the plant that has high resistance for pathogenic bacterial infection that is.
Here, common genetic transcription is attached to the sequence of several bases-tens base that is called as the cis sequence in the promoter region and initial (document 66) by the rho factor that is called as the transcriptional activity factor.Therefore, determine that the cis sequence is to illustrate the first step of transcribing mechanism.Given this, the above-mentioned part of inferring promotor that the inventor identifies success removes the PVS3 promoter sequence of back gained successively and the mosaic gene (PVS3:GUS) of gus gene formation passes through the instantaneous importing of agrobacterium tumefaciens (Agrobacterim tumefaciens) leaf texture, research PVS3 promoter activity.Found that the important district of promoter activity---the district of 50bp (SEQ ID No.23).That is, successfully identifying may be the district that the PVS3 promoter activity is expressed necessary 50bp.But do not find known controlling element at this Qu Zhongshang at present.
The germ-responsive promoter that the inventor successfully identifies (PVS3 promotor) is though obtained by potato plants, and its applicable object is not limited only to potato plants.First point at first, PVS3 is a phytoalexin synthetic enzyme in the catalysis potato plants, and the phytoalexin in potato plants and other plant of Solanaceae all is a terpene compound, and this point is a common, and they have the route of synthesis of common phytoalexin.As described later, inducing of an also known gene depends on SIPK and WIPK, and two kinds of enzymes are not limited only to plant of Solanaceae usually, all is common in a lot of plants, and it replys relevant with defence.Consider so many common ground, can envision promotor of the present invention (PVS3 promotor) and be not limited only to plant of Solanaceae, report that SIPK and WIPK directly use for other of center can be used as germ-responsive promoter in plant widely too to the Cruciferae (reference literature 57) of homology dependency, leguminous plants (reference literature 58).
The present invention is based on above result of study and finishes, and following content is provided.
[1] contain the germ-responsive promoter of DNA any in following (a)-(c):
(a) contain the DNA of base sequence shown in the SEQ ID NO.1;
(b) contain and in base sequence shown in the SEQ ID NO.1, have 1 or a plurality of base replaces, disappearance, the base sequence that inserts or add, the DNA of performance germ-responsive promoter function in vegetable cell;
(c) under rigorous condition with (a) or DNA (b) hybridization, the DNA. of performance germ-responsive promoter function in vegetable cell
[2] contain the germ-responsive promoter of DNA any in following (A)-(C):
(A) contain the DNA of base sequence shown in the SEQ ID NO.2;
(B) contain and in base sequence shown in the SEQ ID NO.2, have 1 or a plurality of base replaces, disappearance, the base sequence that inserts or add, the DNA of performance germ-responsive promoter function in vegetable cell;
(C) under rigorous condition with (A) or DNA (B) hybridization, the DNA of performance germ-responsive promoter function in vegetable cell.
[3] contain the germ-responsive promoter of DNA any in following (1)-(3):
(1) contains a successive part in the base sequence shown in the SEQ ID NO.1, the DNA of performance germ-responsive promoter function in vegetable cell;
(2) contain and in the DNA of (1), have 1 or a plurality of base replaces, disappearance, the base sequence that inserts or add, the DNA. of performance germ-responsive promoter function in vegetable cell
(3) under rigorous condition, hybridize the DNA. of performance germ-responsive promoter function in vegetable cell with the DNA of (1) or (2)
[4] contain the germ-responsive promoter of DNA any in following (i)-(iii):
(i) contain the DNA of base sequence shown in the SEQ ID NO.22;
(ii) containing has 1 or a plurality of base replaces, disappearance, the base sequence that inserts or add, the DNA of performance germ-responsive promoter function in vegetable cell in base sequence shown in the SEQ ID NO.22;
(iii) under rigorous condition with (i) or DNA (ii) hybridization, the DNA. of performance germ-responsive promoter function in vegetable cell
[5] contain any one DNA in following (I)-(III), the germ-responsive promoter of performance germ-responsive promoter function in vegetable cell:
(I) contain the DNA of base sequence shown in the SEQ ID NO.23;
(II) contain and in the base sequence shown in the SEQ ID NO.23, have 1 or a plurality of base replaces, disappearance, insert or the DNA of the base sequence that adds;
(III) under rigorous condition with (I) or the DNA. of DNA (II) hybridization
[6] each germ-responsive promoter in [1]-[5] is characterized in that: the pathogenic bacterial infection specificity is replied.
[7] DNA, this DNA contain base sequence shown in the SEQ ID NO.23.
[8] DNA, this DNA contain shown in the SEQ ID NO.23 continuous 10 or above base sequence in the base sequence, have the germ-responsive promoter activity.
[9] carrier, this carrier comprise in [1]-[6] each germ-responsive promoter.
[10] carrier, this carrier contains the DNA. of [7] or [8]
[11] DNA construct, this DNA construct comprise in [1]-[6] each promotor; Link to each other with this promotor and be subjected to its control, at plant interior expression and activate the gene that the defence of this plant is replied.
[12] DNA construct, this DNA construct comprises the DNA of [7] or [8]; With the collaborative DNA that constitutes germ-responsive promoter of this DNA; Link to each other with constructed germ-responsive promoter and be subjected to its control, at plant interior expression and activate the gene that the defence of this plant is replied.
[13] DNA construct of [11] or [12], wherein said gene has the function that its expression product activates the information transduction pathway that the defence of controlling plant replys.
[14] DNA construct of [11] or [12], wherein said gene has the function that its expression product activates SIPK or WIPK.
[15] DNA construct of [11] or [12], the wherein gene of said gene code set moulding activity form MEK.
[16] transformant, this transformant transforms host plant with each DNA construct in [11]-[15] and obtains.
[17] transformant of [16], wherein above-mentioned host plant is a plant of Solanaceae.
[18] transformant of [16], wherein above-mentioned host plant are the plants that potato belongs to.
[19] preparation method of transgenic plant comprises in usefulness [11]-[15] that each DNA construct transforms the step of host plant.
[20] give the method for host plant pathogenic bacteria resistance, comprise that each DNA construct in usefulness [11]-[15] transforms the step of host plant.
[21] plant, this plant external source have imported in [1]-[6] each germ-responsive promoter.
[22] plant, this plant external source has imported the DNA. of [7] or [8]
Among the present invention, " germ-responsive promoter " is meant pathogenic bacterial infection produced the promotor of replying (by inducing). here, " promotor " is meant the initial functional zone of genetic transcription that are adjusted under its control.
" external source importing " among the present invention is meant by the outside and imports.Therefore " promotor that external source imports " is meant the promotor that is imported host cell by the outside, for example when host cell is possessed the promotor identical with the promotor that imports originally, though constitute identically, have only the promotor of importing just to be called as the promotor that external source imports, distinguish both with this.
Among the present invention, term " contains DNA " and also comprises the phraseology of " being made up of DNA ". and therefore for example for " promotor that contains specific DNA ", its implication also comprises " promotor of being made up of this DNA " certainly.
The implication of each shorthand notation that uses in this specification sheets is as follows.ATP: adenosine 5 '-triphosphoric acid, BPB: tetrabromophenol sulfonphthalein, BSA: bovine serum albumin(BSA), CBB: Xylene Brilliant Cyanine G, CTP: cytidine 5 '-triphosphoric acid, DEPC: diethylpyrocarbonate, DTT: dithiothreitol (DTT), EDTA: quadrol-N, N, N ', N '-tetraacethyl, EGTA: ethylene glycol bis (beta-amino ether) ethylenediamino tetraacetic acid, FPP: farnesyl bisphosphate, GAP: glyceraldehyde-3-phosphate, GTP: guanosine-5 '-triphosphoric acid, the HMG-CoA:3-hydroxy-3-methyl glutaryl coenzyme A, the HMGR:3-hydroxy-3-methyl glutaryl coenzyme A reductase, HWC: mycelia wall fraction, Ig: immunoglobulin (Ig), IPP: prenyl diphosphate, IPTG: sec.-propyl-1-sulfo--β-D-thiogalactoside, KD: kilodalton, MOPS:3-(N-morpholino) propane sulfonic acid, PAGE: polyacrylamide gel electrophoresis, PBS: phosphate buffered saline buffer, PCR: polymerase chain reaction, PMSF: phenylmethylsulfonyl fluoride, PR: pathology is relevant, SDS: sodium lauryl sulphate, SHAM: bigcatkin willow hydroxamic acid (salycylhydroxamic acid), SSPE: sodium-chlor-sodium phosphate, EDTA, TBE:tris-boric acid, EDTA, the TBS:tris buffer salt solution, TE:tris-EDTA, Tris:2-N-three (methylol) aminomethane, TTP:5 '-thiamine triphosphate, X-gal:5-bromo-4-chloro-3-indoles-β-D-galactoside.
If no special instructions, following genetically engineered operation can be with reference to Molecular Cloning (ThirdEdition, Cold Spring Harbor Laboratory Press, New York) or Currentprotocols in Molecular biology (edited by Frederick M.Ausubel etc., 1987) carry out.
The invention provides inductive promotor by pathogenic bacterial infection. utilize promotor of the present invention to carry out gene and import, then can in transgenic plant, make required gene specifically expressing when pathogenic bacterial infection. therefore, for example use with defence and reply relevant gene, can prepare the anti-microbial pathogen plant that when pathogenic bacterial infection, can be on the defensive rapidly and reply.
The accompanying drawing summary
Fig. 1 is the figure of the biosynthetic pathway of expression potato tuber moderate stimulation responsiveness isoprenoid.In the anaphylaxis, synthetic active the carrying out of sesquiterpene phytoalexin, wound-induced sterol and the synthetic of steroid glycoalkaloid are suppressed.
Fig. 2 is interior PVS (the potato vetispiradiene synthase) gene of the ageing potato flakes behind the expression infection late disease bacteria and the figure of PSS (potato squalene synthase) expression of gene state. infects microspecies 0 (non-affinity) or infects microspecies 1,2,3,4 (affinities) (10 4Zoospore/sheet) or water treatment before with potato flakes ageing 24 hours.
Fig. 3 is that the figure as a result that is carried out RT-PCR by the total RNA that extracts in the ageing potato flakes that infects (Mock) after (order is non-affinity, affinity) behind non-affinity late disease bacteria or the affinity late disease bacteria or the water treatment is used in expression. use PVS1, PVS2, PVS3 and PVS4 clone-specific primer separately to carry out PCR. has obtained 469bp, 132bp, 326bp and 469bp respectively for PVS1, PVS2, PVS3 and PVS4 amplified production.
Fig. 4 is that the figure as a result that is carried out the Western engram analysis by the total protein that extracts in the ageing potato flakes that infects (Mock) after (order is non-affinity, affinity) behind non-affinity late disease bacteria or the affinity late disease bacteria or the water treatment is used in expression. by the SDS-polyacrylamide gel electrophoresis, the total protein that each separates 10 μ g uses anti-PVS antiserum(antisera) to carry out immunoblotting. and detect and adopted HRP in conjunction with anti-mouse antibodies and ECL detection kit.
Fig. 5 is that expression uses the total RNA that extracts the leaf of potato of (order is non-affinity, affinity) after (Mock), wound are handled the back or infected non-affinity late disease bacteria or affinity late disease bacteria after water treatment to carry out the figure as a result of RT-PCR. swimming lane T1: use by the positive control that infects the RT-PCR product that obtains in the potato tuber of non-affinity late disease bacteria after 6 hours. use each member (PVS1, PVS2, PVS3 and PVS4) Auele Specific Primer.The result has obtained the product of 176bp, 132bp, 326bp and 131bp respectively. separate the RT-PCR product by agarose gel electrophoresis, the transfer printing nylon membrane. make 32Each PCR product of P mark and the hybridization of the film after the transfer printing.
Fig. 6 represents the base sequence of PVS3 genomic clone and the aminoacid sequence of inferring. provided a part of inferring promoter region and coding region among Fig. 6. and aminoacid sequence is illustrated under the base of this sequence of coding.Non-coding region is represented with lowercase. terminator codon is represented with asterisk.
Fig. 7 represents the base sequence and the putative amino acid sequence of PVS3 genomic clone. provided the part of coding region and coupled non-translational region among Fig. 7.Aminoacid sequence is illustrated under the base of this sequence of coding. and non-coding region is represented with lowercase. and terminator codon is represented with asterisk.
Fig. 8 represents PVS3 genomic clone and PVS3cDNA clone's restriction endonuclease map and structure collection of illustrative plates. and the coding region shows with the hollow frame table. and thick line is represented intron.The position of the corresponding intron of vertical line.
Fig. 9 is with tobacco (Nicotiana tabacum) (TEAS), potato (Solanumtuberosum) (PVS), blunt Semen Hyoscyami (Hyoscyamus muticus) is (HVS) and the comparison mode chart of capsicum (Capsiumannum) aminoacid sequence (PEAS). use the infer amino acid corresponding with each exon. and thick vertical line is represented in the tobacco gene, in the potato gene, interior and the intragenic introne position of capsicum of blunt Semen Hyoscyami gene. the numeral in the sash is by the total number of atnino acid of exons coding. and percentage ratio is represented the homology score between the comparison domain, H, Histidine is rich in C and DDXXD (or DDXX) expression, the conserved residues of (known) of halfcystine and aspartic acid as substrate binding site.
Figure 10 be with late blight mycelia wall become after the divisional processing or potato protoplastis after the water treatment in the measurement result of luciferase activity. the construct of employed Luc gene when (A) expression is carried out transient expression mensuration with the PVS3 promoter region. (B), luciferase activity when 35S represents to use CaMV 35S promoter district, HWC represents to use and infers promoter region, luciferase activity when handling with HWC, the luciferase activity when " water " expression water replaces HWC to handle.
Figure 11 is the figure of modal representation PVS3 promoter construct.GUS is a reporter gene.
Figure 12 is expression PVS3 promotor inductive GUS expression pattern figure when replying wound.Use has the transgenic Rhizoma Solani tuber osi leaf texture of PVS3 promotor.
Figure 13 is the expression pattern figure that the PVS3 promotor of late disease bacteria infection is replied in expression.The non-transgenic leaf of potato tissue (sharp buttocks) of render transgenic leaf of potato tissue (MayQueen) or conduct dyeing check plot infects microspecies 0 (for MayQueen is affinity, is non-affinity for sharp buttocks).Detect the GUS activity of infection after 6 hours, 12 hours, 24 hours and 48 hours with the GUS dyeing solution.Observe at microscopically.
Figure 14 represents in the transgenic Rhizoma Solani tuber osi plant, PVS3 promotor inductive GUS expression pattern figure.Use the GUS dyeing solution to detect the GUS activity of transgenic Rhizoma Solani tuber osi plant.Arrow is represented late disease bacteria infected area (GUS dye contrast).
Figure 15 represents to reply the PVS3 promotor inductive GUS expression pattern figure of arachidonic acid (AA).AA (5mM) or water are injected transgenic Rhizoma Solani tuber osi leaf texture.Detect the GUS activity of injection after 6 hours, 12 hours, 24 hours and 48 hours with the GUS dyeing solution.
Figure 16 represents to reply H 2O 2PVS3 promotor inductive GUS expression pattern figure.With H 2O 2(5mM) inject transgenic Rhizoma Solani tuber osi leaf texture.Detect the GUS activity of injection after 6 hours, 12 hours, 24 hours and 48 hours with the GUS dyeing solution.
Figure 17 represents to reply the PVS3 promotor inductive GUS expression pattern figure of glucose/notatin.Glucose (5mM) and notatin (0.5U/ml) are injected transgenic Rhizoma Solani tuber osi leaf texture.Detect the GUS activity of injection after 6 hours, 12 hours, 24 hours and 48 hours with the GUS dyeing solution.
Figure 18 represents to reply the PVS3 promotor inductive GUS expression pattern figure of Whitfield's ointment (SA).SA (5mM) is injected transgenic Rhizoma Solani tuber osi leaf texture.Detect the GUS activity of injection after 6 hours, 12 hours, 24 hours and 48 hours with the GUS dyeing solution.
Figure 19 represents to reply Cf-9/Avr9 and interacts or StMEK DDPVS3 promotor inductive GUS expression pattern figure.To possess 35s, Cf-9/Avr9, StMEK DDOr the Agrobacterium of empty carrier (contrast) is inoculated into transgenic Rhizoma Solani tuber osi leaf texture.Detect the GUS activity of inoculation Agrobacterium after 2 days with the GUS dyeing solution.
Figure 20 is illustrating of expression releaser inducement signal transduction pathway.MAPKKK: mitogen-activated protein kinase kinase kinases; MAPKK: mitogen-activated protein kinase kinase; MAPK: mitogen-activated protein kinase; SIPK: the protein kinase of Induced by Salicylic Acid; WIPK: the protein kinase of wound-induced; The HMGR:3-hydroxy-3-methyl glutaryl coenzyme A reductase; PVS: potato vetispiradiene synthase
Figure 21 represent potato plants MEK gene (MEK) coding region sequence and infer its coded aminoacid sequence.
Figure 22 represents constitutive activity form MEK gene (stMEK DD) coding region sequence and infer its coded aminoacid sequence.
Figure 23 represents the site plan of the primer sequence that uses among the embodiment.Numbering with the arrow mark of representing each primer location is represented SEQ ID NO (for example P9 is the primer with sequence of SEQ ID NO.9).Use P9, P10, P11, P14, P15, P16, P17 and P18. among the embodiment 2 and used P11, P12, P13, P14, P15, P16, P19 and P20 among the embodiment 4.
Employed primer sequence when Figure 24 represents by pPVS3-1 structure pPVS3-10 deletion clone.F represents forward primer, and R represents reverse primer, and underscore is represented the position of restriction enzyme.
Figure 25 represents the binary vector structure that contains the PVS promoter region of use in the transient expression mensuration.Gus gene comprises intron.
Figure 26 represents to handle or StMEK1 for INF1 DDThe research method of the PVS3 promoter activity of expressing.For INF1, be that the Agrobacterium of possessing PVS3:GUSint is injected leaf; For StMEK1 DD, be to possess PVS3:GUSint and XVE:StMEK1 DDThe Agrobacterium mixed solution inject leaf, leave standstill one day (A).Then, for INF1, INF1 solution is injected leaf; For StMEK1 DD, (B) left standstill one day again behind the injection beta estradiol, made StMEK1 DDExpress research GUS activity (C).
Figure 27 represents the process of virus induction type gene silencing. (A) structure of expression silent carrier pGR106. and will treat reticent gene fragment, insert pGR106. (B) for the cDNA fragment of SIPK and WIPK this moment is that expression is by inoculating the mode chart that carrier-containing Agrobacterium comes infective virus.
Figure 28 represents the PVS3 promoter activity for the INF1 processing. compares with the check plot, inject INF among right-1337 (pPVS3-2) and then induce the GUS activity. on the other hand, make-1287 (pPVS3-3) PVS3 promoter deletion before, then handle and the active significantly minimizing of inductive GUS through INF1.
Figure 29 represents the base sequence of PVS3 promotor and by the disappearance position of pPVS3-1 to pPVS3-10. may exist the cis sequence-1337 and-1287 between sequence represent with boldface type, the TATA frame and the CAAT box of inferring surrounded with square frame.
Figure 30 represents to reply StMEK1 DDThe PVS3 promoter activity of expressing. compare with the check plot, right-1337 (pPVS3-2) inject beta estradiol and then induce the GUS activity.On the other hand, make-1287 (pPVS3-3) PVS3 promoter deletion before, then handle and the active significantly minimizing of inductive GUS through beta estradiol.
Figure 31 represents that WIPK or SIPK are to by StMEK1 DDExpress and the research method of the influence of inductive PVS3 promoter activity. will possess PVS3:GUSint and XVE:StMEK1 DDThe Agrobacterium mixed solution inject reticent leaf, leave standstill one day (A). (B) left standstill one day again after injecting beta estradiol, made StMEK1 DDExpress research GUS activity (C).
Figure 32 represents that WIPK or SIPK are to by StMEK1 DDExpress and the influence of inductive PVS3 promoter activity and TEAS genetic expression.Make WIPK or SIPK silence, then StMEK1 DDInductive PVS3 promoter activity significantly is suppressed (A).And when extracting total RNA and carrying out the Nortern engram analysis, only in the district that makes WIPK or SIPK silence, the sesquiterpene cyclase genetic expression of Ben Saimushi tobacco (Nicotiana benthamiana) is suppressed (B).
The best mode that carries out an invention
(promotor)
A first aspect of the present invention relates to germ-responsive promoter, and one of them scheme is to comprise the DNA that is formed by base sequence shown in the SEQ ID NO.1.Embodiment is illustrated as described later, and this DNA is accredited as the sequence of the promoter region of potato PVS3 gene, and it has the special responsiveness as a kind of late disease bacteria of pathogenic bacteria.Further the result of research shows, even the upstream of this DNA disappearance, contain and have an appointment 1, the DNA of 300bp (SEQ ID NO.22) also can keep target start active. consider above-mentioned situation, a preferred scheme of the present invention is the pathogenic bacteria specificity promoter that comprises by the DNA of base sequence shown in the SEQ ID NO.22. on the other hand, if make the upstream of this dna sequence dna (SEQ ID NO.22) further lack 50bp (SEQ ID NO.23), then promoter activity sharply reduces. and the 50bp (SEQ ID NO.23) that can infer this disappearance thus is for the very important district of the performance of this promoter activity, the zone that promptly comprises the cis sequence of PVS3 gene promoter. therefore, (below be also referred to as " 1DNA sequence ") is extremely useful for the structure of germ-responsive promoter in this district, in addition by using this district, can be with high freedom design and make up the DNA construct that is combined with germ-responsive promoter (for example be used to give the recombinant vectors of phytopathogen resistance. specifically with reference to the content of one of aftermentioned DNA construct). like this, as another kind of scheme, the invention provides the dna sequence dna that can be used for making up germ-responsive promoter. here, if considering common cis sequence is the sequence that contains tens bases mostly, then the part of 1DNA sequence may be the cis sequence.This means:, when it comprises the cis sequence, promptly become and can be used for making up the DNA useful germ-responsive promoter even contain the DNA in the part district of 1DNA sequence.For example can infer such DNA: contain the base sequence of continuous 10 or above base in the 1DNA sequence, preferably contain the base sequence of continuous 15 or above base, further preferably contain the DNA of the base sequence of continuous 20 or above base.
Use 1DNA sequence (perhaps its successive part, perhaps as described later, the DNA (modification body) that under keeping the condition of its function, 1DNA sequence or its successive part is implemented desirable modification and obtain) time, by making up, can make up germ-responsive promoter with other dna sequence dna.Other dna sequence dna described here can use by can make up the dna sequence dna of germ-responsive promoter with 1DNA sequence (or it modifies body) synergy.Specifically, as other dna sequence dna, for example can use the dna sequence dna shown in the SEQ ID NO.24.This dna sequence dna is in the PVS3 gene, is clipped in the dna sequence dna (with reference to Figure 29) in the district between 1DNA sequence and the coding region.There are CAAT box or TATA frame in this district, use this district can also make up PVS3 promoter region originally, therefore by such scheme, can obtain to have the germ-responsive promoter of high promoter activity. in addition, be not limited to this example, as long as adopt the dna sequence dna that contains CAAT box or TATA frame etc., then by the synergy of the sequence relevant with these transcription initiations or transcriptional control, expection can be brought into play good promoter function. and the dna sequence dna of here other can directly or via other sequences be connected with the 1DNA sequence.
" pathogenic bacteria " described here is meant that infection plant makes its any mushroom that is subjected to wound, except that cause of disease thread funguss such as late disease bacteria, also comprises pathogenic bacteria certainly.Described here, " late disease bacteria " is meant the mushroom that belongs to phytophthora (Phytophthora), classifies according to infecting the object plant.The object lesson of late disease bacteria has: phytophthora infestans (phytophthora infestans (Phytophthorainfestans)), tobacco late disease bacteria (Phytophthora nicotianae (Phytophthora nicotianae)), soybean stem late disease bacteria (mutation of big male epidemic disease tempeh (Phytophthora megasperma var.sojae)), apple late disease bacteria (Phytophthora cactorum (Phytophthora cactorum) and chestnut Heisui River epidemic disease mould (Phytophthoracambivora)). on the other hand, the cause of disease thread fungus except that late disease bacteria has: potato sclerotium germ (sclerotinite (Sclerotinia sclerotiorum)), Pyricularia oryzae (Magnaprothe grisea), the soybean rust bacterium (soybean rest fungus (Phakopsora pachyrhizi). pathogenic bacteria can exemplify bacterial wilt of tomato bacterium (blue or green withered Lei Er Salmonella (Ralstonia solanacearum) in addition, bacterium).
Here, promotor of the present invention (comprises the DNA that is built with usefulness to germ-responsive promoter.If no special instructions, below too) preferably the infection of pathogenic bacteria is had special responsiveness. " specificity " described here is meant the specificity height. therefore, promotor of the present invention is preferably has high specificity to pathogenic bacterial infection, promptly pathogenic bacterial infection is had responsiveness, and the disease beyond the pathogenic bacterial infection is not had the promotor of responsiveness basically.
(preparation method of promotor)
Promotor of the present invention can be prepared as follows: for example extract genomic dna according to ordinary method from baron potato potato plants such as (Splanum tuberosum L.), use promotor Auele Specific Primer of the present invention then, utilize gene amplification reactions such as PCR method to prepare. specifically, for example can prepare promotor of the present invention according to following process. at first, the leaf or the stem tuber of the potato plants of freezing treatment after the sampling are ground in mortar. then, add an amount of damping fluid (the Tris-HCl damping fluid that for example contains SDS) that extracts, with this as extracting solution. then pass through phenol extraction, ethanol sedimentations etc. carry out the extraction of genomic dna, purifying. with the genomic dna that obtains like this is template, using the promotor Auele Specific Primer of SEQ ID NO.1 to carry out PCR, obtain target dna (promotor) as amplified production. primer for example can use the primer with following sequence right.
Adopted primer: TTGTCTGCTGCTGCTTGTGG (SEQ ID NO.15) is arranged
Antisense primer: TCTCCATGAGTCCTTACATG (SEQ ID NO.16)
But design of primers is the specific amplification target dna. but the primer of the DNA of following expression specific amplification SEQ IDNO.22 is right.
Adopted primer: CGGAATTCGTCCGCCCTTACTATTCCCATC (SEQ IDNO.26) is arranged
Antisense primer: CCATCGATTCCTCTTCATTGTTAAAGGGGA (SEQ IDNO.35)
The preparation method of promotor of the present invention is not limited to above-mentioned, for example can utilize commercially available potato gene group library (for example potato kind Desiree genomic library (Clontech)) to prepare.During by such potato gene group library separate targets promotor, can be according to the kind in library, utilize plaque hybridization method or colony hybridization method (with reference to Molecular Cloning, Third Edition, Cold Spring Harbor Laboratory Press, New York etc.).For example, for instance, can utilize the plaque hybridization method when when using the library that phage makes up.When the clone in target start subarea is possessed in selection, can use to have promotor specific sequence of the present invention and be probe.
After choosing the target clone, can be template with the DNA that this clone was possessed, use SEQ IDNO.1 sequence specific primers to carry out PCR, obtain promotor of the present invention thus as amplified production.
Can with the DNA subclone that the clone possessed that obtains in appropriate carriers, be used for later application.Thus, for example can be used for transforming structure (with reference to aftermentioned a second aspect of the present invention), perhaps make up the plasmid that is used to understand base sequence with recombinant vectors.
The preparation method of promotor of the present invention is not limited to above-mentioned, for example can utilize synthetic promotors of the present invention such as commercially available dna synthesizer.
(modification promotor)
Therefore the sequence of SEQ ID NO.1 is approximately 2600bp, is sizable as promoter region, infers just wherein the part district that direct relation is arranged with promoter activity.Consider based on this, if,, then can make up germ-responsive promoter of the present invention as long as it can bring into play the germ-responsive promoter function even can confirm to contain the district of a successive part in the SEQ ID NO.1 sequence.Consider that the functional zone of common promotor are positioned at the front of next-door neighbour's structure gene mostly, for example in the PVS3 gene order shown in Fig. 6 and 7, the district (SEQ ID NO.4) that comprise the district (SEQ IDNO.2) of-2000 to-1 base, preferably comprise in the same area the district (SEQ ID NO.3) of-1500 to-1 base, further preferably comprises in the same area-1000 to-1 base is exactly the strong material standed for of functional zone.In fact, as described later shown in the embodiment, when use is positioned at the district (SEQ ID NO.22) of about 1300bp of front of next-door neighbour's structure gene, just can confirm that it has promoter activity. and the upstream 50bp (SEQ ID NO.23) in the district of this about 1300bp is further lacked, then visible promoter activity sharply reduces.That is, at least one functional zone that can determine the PVS3 promotor thus are present in this 50bp.Consider this fact, preferably comprise the sequence shown in the SEQ ID NO.23 in the promotor of the present invention.The object lesson of such promotor has: the DNA shown in the SEQ ID NO.22 (PVS3 gene-1337 to-1).
On the other hand, usually, can keep its function even the part of DNA with specific function modified also.Based on this consideration, even have the part that makes the DNA (being DNA shown in the SEQ ID NO.1 or the DNA (for example DNA shown in the SEQ ID NO.22) that contains above-mentioned functions district (SEQ ID NO.23)) that constitutes above promotor of the present invention through the DNA of the base sequence modified (below be also referred to as " modifying DNA "), as long as the function that it has as germ-responsive promoter can constitute germ-responsive promoter of the present invention.In other words, as long as keep the germ-responsive promoter function, the modification of a part of sequence is acceptable.The typical situation of here " part modify " has: in base sequence shown in the SEQ ID NO.1 (or among the SEQ ID NO.2-4 any) or the base sequence shown in the SEQ ID NO.22, and 1 or a plurality of base replaces, disappearance, insert or additional.Such modification can take place in a plurality of sites.Here " a plurality of " for example be 2-100 because of the kind of the position modified or modification is different, and preferred 2-50, more preferably 2-10 is individual.The DNA of aforesaid modification for example can pass through restriction enzyme treatment, the processing through exonuclease or dna ligase etc., importing site-directed mutagenesis (Molecular Cloning, Third Edition, Chapter 13, Cold Spring HarborLaboratory Press, New York) or import random mutagenesis (Molecular Cloning, ThirdEdition, Chapter 13, Cold Spring Harbor Laboratory Press, New York) etc. the method that imports sudden change obtains.
Can with hybridize under rigorous condition with the DNA of sequence or DNA with sequence of SEQ ID NO.22 with SEQ ID NO.1 (or among the SEQ ID NO.2-4 any) and in vegetable cell the DNA of performance germ-responsive promoter function use as the DNA that constitutes promotor of the present invention.Can also use with the DNA that has applying on the sequence of SEQ ID NO.1 that above-mentioned part is modified the sequence that obtains (or in SEQ ID NO.2-4, apply on any one sequence above-mentioned part is modified and the sequence that obtains) or apply on the sequence of SEQ ID NO.22 that above-mentioned part is modified and the sequence that obtains hybridize under rigorous condition and in vegetable cell the DNA. of performance germ-responsive promoter function " rigorous condition " described here be meant the so-called specific hybrid body of formation, but do not form the condition of non-specific heterozygote.Rigorous condition changes according to the kind of sequence length or formation base, for example following condition: use hybridization solution (50% methane amide, 10 * SSC (0.15M NaCl, the 15mM Trisodium Citrate, pH7.0), 5 * Denhardt solution, 1%SDS, 10% T 500,10 μ g/ml sex change salmon sperm DNAs, 50mM phosphoric acid buffer (pH 7.5)), hatch at 42 ℃, wash with 0.1 * SSC, 0.1%SDS at 68 ℃ then.Further preferred rigorous condition has: use 50% methane amide, 5 * SSC (0.15M NaCl, the 15mM Trisodium Citrate, pH 7.0), 1 * Denhardt solution, 1%SDS, 10% T 500,10 μ g/ml sex change salmon sperm DNAs, 50mM phosphoric acid buffer (pH 7.5) is as the condition of hybridization solution.
(DNA construct)
By being connected promotor control of the present invention down, any gene (transgenosis) that the defence of activated plant is replied by expression, all can make up the DNA construct that can make plant have the pathogenic bacteria resistance. as the DNA construct that transforms usefulness, preferably promotor of the present invention and transgenosis are mixed appropriate carriers (for example, plasmid, bacteriophage, virus).
(transgenosis)
Transgenosis is used the gene with following function: by expressing in the plant that is imported, activate the defence of this plant and reply.For example can be with the gene of function as transgenosis with active information transduction pathway, the information transduction pathway that the defence that wherein said information transduction pathway is a controlling plant is replied. the object lesson of such gene has: the MEK gene with function of kinase whose a kind of SIPK of activation mitogen-activated protein(MAP) (MAP) (protein kinase of Induced by Salicylic Acid) or WIPK (protein kinase of wound-induced).As an example of MEK gene, the coding region sequence of the MEK gene (StMEK) of potato plants (SEQ ID NO.5) with and coded aminoacid sequence (SEQ ID NO.6) as shown in figure 21.
Especially preferably adopt the proteinic gene of code set moulding activity form as transgenosis.The protein activity form originally that these genes can be replied from the activation defence that originally promptly generates in transformant, it can be rapidly and the reaction that positively is on the defensive.The proteinic gene of code set moulding activity form can be prepared as follows: based on the sequence of the proteinic gene of encoding wild type, implement part and modify, the part of its coded aminoacid sequence is morphed.In the potato plants, prepared the constitutive activity form MEK (StMEK of the MEK with modification DD), among the present invention, can utilize this StMEK of coding DDGene as transgenosis.StMEK DDThe coding region sequence of gene (SEQ ID NO.7) with and coded aminoacid sequence (SEQ ID NO.8) as shown in figure 22.
Here, the kind of above-mentioned " defence is replied " is not particularly limited, and the generation of for example generation of phytoalexin, the proteic expression of PR (pathology is relevant), active oxygen, the formation of papilla, lignifying etc. are all at its row.
(carrier)
As long as in the structure of above-mentioned DNA construct used carrier can with promotor of the present invention with and the transgenosis that is provided with down of control import target cell (host cell) but and the render transgenic carrier of in target cell, expressing, it is not particularly limited, can be according to the suitable plasmid vector of corresponding target utilization, λShi Juntizaiti etc.Making up described laterly when utilizing in the Agrobacterium-mediated Transformation employed carrier, for example can utilize Ti-plasmids carrier, Ti-plasmids binary vector with T-DNA border sequence.On the other hand, when use need not method for transformation (electroporation, particle bombardment etc.) via Agrobacterium, can utilize various pUC was that plasmid vector, various λShi Juntizaiti (ZAPII etc.) etc. make up recombinant vectors.A lot of carrier markets are all on sale, and the present invention can be according to purpose from wherein suitably selecting use.
At first make up the carrier that contains promotor of the present invention, can carry out genetically modified connection afterwards.That is, can make up and to insert the high carrier of required genetically modified versatility, utilize its preparation to transform and use recombinant vectors.
The typical conversion with in the recombinant vectors also can be contained transgenosis and suitable terminator except that promotor of the present invention.Set gradually promotor, transgenosis and terminator downstream by the upstream, to realize genetically modified suitable transcribing by promotor.Can contain selected marker in the recombinant vectors or have the sequence of enhanser function, the sequence of coded signal peptide etc.
(terminator)
Terminator is the sequence that is identified as making the synthetic terminated signal of mRNA.The terminator of function is suitably brought into play in use in vegetable cell.For example can use the Nos terminator.
(selected marker)
Selected marker is used for identification or selects cell transformed, tissue, callus etc.Various selected markers all are well-known, for example can be according to employed carrier-host system or application target, suitably select kantlex etc. is had the npt gene (Herrera Estrella, EMBO be (1983), 987-995 J.2) or nptII gene (the Messing ﹠amp of resistance; Vierra.Gene 19:259-268 (1982)), hph gene (the Blochinger ﹠amp that Totomycin is had resistance; Diggl mann, Mol Cell Bio 4:2929-2931), to methotrexate have resistance the dhfr gene (Bourouis etc., EMBO is (7) J.2), β-glucuronidase (GUS) gene, GFP gene (Gerdes, FEBS Lett.389 (1996), 44-47), luciferase (Giacomin, p1.Sci.116 (1996), 59-72; Scikantha, j.Bact.178 (1996), 121) etc. use.
Promotor or transgenosis can use the ordinary methods such as method of restriction enzyme and dna ligase to carry out (for example with reference to Molecular Cloning to the insertion of carrier, Third Edition, 1.84, ColdSpring Harbor Laboratory Press, New York).
(method for transformation)
DNA construct of the present invention or recombinant vectors can be used for the conversion of plant.The metal ion that method for transformation (method of gene introduction) can use the method (agrobacterium co-cultivation) of utilizing Agrobacterium, utilize the polyoxyethylene glycol transgenic method, utilize electricity irritation transgenic method (electroporation) and will be combined with gene is injected method (particle bombardment) of plant tissue (cell) etc.The detailed content of each method is all on the books in various documents and publication books, and for example agrobacterium co-cultivation can be with reference to Proc.Natl.Acad.Sci.USA 86 (1989), 8467-8471 or Plant Mol. Biol.20 (1992), 963-976 etc.
When transforming potato plants, can adopt the method (reference literature 19) of Jefferson (1987).
Importing comprises promotor of the present invention and genetically modified DNA construct and in the transformant that obtains, is induced result, the transgene expression under its control because of pathogenic bacterial infection makes promotor.Therefore, if adopt defence efficient gene to pathogenic bacterial infection, then can obtain having the plant (transformant) of pathogenic bacteria resistance as transgenosis.
The vegetable cell that uses conversion to obtain can the regeneration of transgenic plant.Such renovation process can carry out according to ordinary method according to the kind of plant.
(target plant)
Using DNA construct of the present invention or recombinant vectors plant transformed (target plant) to be not particularly limited, can be monocotyledons or dicotyledons arbitrarily.Dicotyledons for example has the plant of Solanaceae of being classified as (potato genus, Nicotiana, tomato genus etc.), the Rosaceae (plum genus, peach genus, Malus etc.), pulse family (Glycine, Pisum etc.), Cruciferae (Rhaphanus etc.), sesame section etc., and monocotyledons for example has the plant that is classified as Gramineae (Oryza, Triticum, Secale, Hordeum, Avena, Zea, saccharum etc.), Liliaceae (big allium, garlic belong to) etc.
The present invention is described in more detail below to utilize embodiment.
[embodiment]
Employed biologic material, reagent, experimental technique etc. are as follows among the following embodiment 1-8.
1. test plant
Use and do not have the Cultivar baron potato of true resistance gene R1 and the sharp buttocks of kind (interspecific hybrid of Solanum tuberosum L. and wild kind S.demissum L.) with true resistance gene R1 as potato plants.Kind baron adopts the attached farm of Nagoya University agronomy portion to cultivate and in the stem tuber of results in July, the sharp buttocks of kind is adopted the stem tuber of cultivating and gathering in the crops October in the agricultural experiment station nursery, Agriculture, Forestry and Fisheries Ministry Hokkaido, all 4 ℃ of preservations, is used for test.Preparation is during transgenic plant, uses not have a MayQueen of true resistance gene.
2. for the examination bacterium
Use is stored in life agronomy research section of the big institute of Nagoya University resource biological function and learns phytophthora infestans [Phytophthora infestan (Mont.) de Bary] microspecies 0 of lecture pathological research chamber and microspecies 1,2,3,4. in addition, phytophthora infestans [Phytophthora infestan (Mont.) de Bary] microspecies 1,2,3,4 of using this research department to preserve are as the employed bacterium of preparation late blight of potato germ mycelia wall composition (HWC) releaser.
3. the preparation of bacterium inoculum
The motility spore suspension of phytophthora infestans is prepared as follows.The stem tuber of potato (kind baron) that is stored in 4 ℃ is fully clean with tap water, in 1% clorox, soaked about 10 minutes then.With potato tuber section (the about 10mm of thickness), coating inoculum density in washing back is about 10 4Spore/ml zoospore suspension was cultivated 6 days under 20 ℃ wet dark condition.Take off the bacterium that slice surface is grown with tweezers, be suspended in the cold distilled water (4 ℃).Spore suspension is filtered with metallic screen (356 screen size), remove mycelia, (ADVANTEC No.5B) carries out suction strainer with filter paper.With the zoosporangium of collecting on the cold distilled water washing filter paper, and then be suspended in the cold distilled water, left standstill 2 hours at 10 ℃.With the absorbancy of ultraviolet-visible analytical system (DU series 600, Beckman) mensuration zoospore suspension, be 0.068 (10 for the absorbancy under the 500nm wavelength with concentration adjustment 5Spore/ml), use as inoculum with this.
4. the preparation of mycelia wall composition releaser
According to Doke and Tomiyama, the method for (1980) (reference literature 14) is prepared as follows late disease bacteria mycelia wall composition (HWC).Phytophthora infestans is placed the 100ml Erlenmeyer flask that 30ml rye substratum is housed, leave standstill at 20 ℃ and cultivated for 2 weeks.With tap water the mycelia clump of reclaiming is cleaned, removed moisture by suction strainer ,-80 ℃ of freezing preservations.The frozen bacteria filament is ground in mortar, be suspended in the 50mM acetate buffer (pH4.5) of 5 times of amounts of mycelia body weight.With ultrasonic disruption instrument (W-225R Heat System-Ultrsonics inc.), with the output of 45W to this suspension ultrasonication 5 minutes, use 14 then, centrifugal 30 minutes of 000 * g. with gained precipitation be suspended in the 50mM acetate buffer of equivalent (pH 4.5) before in, again with identical before condition under carry out ultrasonication and centrifugal.Gained precipitation is suspended in the 0.1M borate buffer (pH8.8) with weight such as mycelium, with above-mentioned same condition under carry out ultrasonication, handled 20 minutes through 120 ℃ of autoclaves then, centrifugal 30 minutes of 14,000 * g reclaims supernatant.On the other hand, will precipitate resuspending in 0.1M borate buffer (pH8.8), it is centrifugal that ultrasonication and autoclave are handled the back.Gained supernatant and the supernatant that obtains are before merged, use dialysis tubing (the exclusion limit molecular weight is 12,000), 4 ℃ of water dialysis 24 hours.Solution after will dialysing with separating funnel mixes with the diethyl ether of equivalent, leaves standstill.Reclaim the milkiness liquid layer,, in enriched material, add an amount of water, lyophilize with rotary evaporation moisture eliminator drying under reduced pressure ether.The dry mark of gained product are HWC, are used for later experiment.When using HWC, with ultrasonoscope, carry out 3 minutes ultrasonication, suspend in water with the output of 45W.
5. the preparation of potato tuber sheet
The potato tuber sheet is prepared as follows.The stem tuber of potato (kind sharp buttocks) that is stored in 4 ℃ is fully clean with tap water, in 1% clorox, soaked about 10 minutes then.(diameter 20mm) pierces stem tuber along the caulom direction with cork drill, gets parenchyma and partly prepares the columned post of organizing.The sheet for preparing 2mm thickness with slicing machine by this post.The sheet of preparation uses cold distilled water (about 4 ℃) to clean immediately, is arranged in the vinyl disc, leaves standstill ageing 21 hours under wet dark condition.This operation is carried out under dark condition fully.
6.HWC the inoculation of processing and bacterium
To the potato tuber sheet according to the preparation of above-mentioned 5. method, each sheet carries out pre-treatment with 100 μ l distilled water respectively, leaves standstill 3 hours.Then each sheet is handled with 1mg/ml HWC or 100 μ l distilled water in contrast.Phytophthora infestans motility spore inoculating on sheet the time, is kept evenly in order to make the motility spore concentration, on one side stirred suspension (10 5Yi Bian spore/ml) is inoculated 100 μ l.During to the leaf texture of potato inoculation bacterium, each carries out pre-treatment with 500 μ l distilled water each sheet, leaves standstill 3 hours.Then for the motility spore concentration is kept evenly, on one side stirred suspension each leaf texture is inoculated 500 μ l on one side.
The sheet, the leaf texture that handle and inoculate are left standstill under 20 ℃ of wet dark condition again, leave standstill specific time.After the processing, being one group with 3 potato tuber sheets that leave standstill, is one group with 8 leaf textures, wraps in the aluminium foil, and cryofixation in liquid nitrogen is-80 ℃ of preservations.
7. extract total RNA by leaf of potato or stem tuber
The extraction of total RNA is carried out according to the method (reference literature 52) of (1996) such as Yoshioka.Each 2g leaf of potato or stem tuber sheet are ground while adding liquefied ammonia in mortar, be added to and 5ml is housed extracted damping fluid [100mM Tris-HCl (pH9.0), 100mM NaCl, 1%SDS], 1ml 2 mercapto ethanol, the saturated phenol of 2.5ml 1M Tris (pH9.0), 2.5ml chloroform isoamyl alcohol (24: 1; V/v) and in the sterilization centrifuge tube that DEPC handled, fully suspend centrifugal then (8,000rpm, 15 minutes).In the supernatant that reclaims, add 5M sodium-chlor, the 5ml Virahol of 1/20th amount, left standstill 1 hour at-20 ℃.Added 5ml guanidinesalt damping fluid [4M guanidine thiocyanate, 25mM sodium acetate (pH 7.0), 0.5%N-lauroyl sarcosine, 20mM 2 mercapto ethanol], 500 μ l 2M sodium acetates (pH 4.0), 5ml water saturation phenol, 1ml chloroform isoamyl alcohol in the precipitation that obtains to centrifugal (8,000rpm, 15 minutes) (49: 1; V/v) in, fully suspend centrifugal (8,000rpm, 15 minutes).In the supernatant that reclaims, add the 5ml Virahol, left standstill 1 hour at-20 ℃.The precipitation that centrifugal (8,000rpm, 15 minutes) are obtained is suspended in 300 μ l guanidinesalt damping fluids, adds the Virahol of equivalent, leaves standstill 1 hour at-20 ℃.At room temperature, the precipitation that centrifugal (12,000rpm, 15 minutes) obtain is washed centrifugal (12,000rpm, 15 minutes) with 500 μ l 3M sodium acetates (pH5.2).This washing operation is repeated 2 times, use 500 μ l70% washing with alcohol again, separate centrifugal (15,000rpm, 15 minutes).Be dissolved in 100 μ l DEPC treating water after the precipitation vacuum-drying of gained, with it as total RNA sample.
8.Nortern engram analysis
With formaldehyde agarose gel electrophoresis (reference literature 37) total RNA is carried out classification, by alkali blotting (alkaline blotting) (reference literature 36) transfer printing Hybond-N +Nylon membrane (Amersham) is also fixing.Adopt leaf PVS1 cDNA as probe.
The nylon membrane that is adsorbed with RNA placed 1 hour in 42 ℃ prehybridization solution [50% methane amide, 5 * Denhartz solution (reference literature 37), 5 * SSPE (reference literature 37), 0.5%SDS, 100 μ g/ml thermally denature salmon sperm DNAs (Pharmacia)] or more than, add then 32The P labeled DNA probe, 42 ℃ down hybridization 16 hours or more than.With this film in containing 4 * SSPE of 0.1%SDS, at room temperature wash 15 minutes (2 times); Washing is 15 minutes in containing 4 * SSPE of 0.1%SDS, under 60 ℃; Again in containing 2 * SSPE of 0.1%SDS, 60 ℃ of down washings 15 minutes (1 time).Use X-ray film OMAT-AR (Kodak) and intensifying paper Lighting Plus (Dupont), under-80 ℃, carry out radioautograph.
9.RT-PCR
RT-PCR uses RT-PCR high-Plus (TOYOBO) to carry out.The synthetic following of cDNA carries out: use the total RNA of 1.0 μ g, 10pmol/ μ l antisense primer and 10pmol/ μ l antisense primer, will comprise that the amplified reaction of 94 ℃ (1 minutes), 47 ℃ (1 minutes) carries out 25 circulations.The primer that uses is as follows, has represented each cDNA annealed position among Figure 23.
PVS1:5 '-AGGAGATTGTTCGCCCCATA-3 ' (SEQ ID NO.9) and 5 '-TCTCCATGAGTCCTTACATG-3 ' (SEQ ID NO.10) (469bp) or 5 '-CATCGATTGTTTTGTACATCTG-3 ' (SEQ ID NO.11) and 5 '-AATAATGATACAAAAAAAAATTAAGG-3 ' (SEQ ID NO.12) (176bp)
PVS2:5 '-TATCAATTCACCAAGGAACACT-3 ' (SEQ ID NO.13) and 5 '-GAAGTAATTAAATTTAAATATTATCAA-3 ' (SEQ ID NO.14) are (132bp)
PVS3:5 '-TTGTCTGCTGCTGCTTGTGG-3 ' (SEQ ID NO.15) and 5 '-TCTCCATGAGTCCTTACATG-3 ' (SEQ ID NO.16) are (326bp)
PVS4:5 '-AGGACATTGTTCGACCTGTT-3 ' (SEQ ID NO.17) and 5 '-TCTCCATGAGTCCTTACATG-3 ' (SEQ ID NO.18) (469bp) or 5 '-CATCCCTTAAAATTATAAGTATTC-3 ' (SEQ ID NO.19) and 5 '-AATAATGATACAAAATAAATTAAGG-3 ' (SEQ ID NO.20) (131bp)
To synthetic cDNA classification, use ethidium bromide staining by 2% agarose gel electrophoresis, confirm have or not (reference literature 37) of band.
10. prepare soluble component by potato tuber
The method that is prepared soluble component by the potato tuber sheet can be to Dixon and Fuller, and the method for (1978) (reference literature 13) is carried out part and changed and carry out.
3 potato tuber sheets as 1 group, are wrapped in the aluminium foil, and cryofixation in liquid nitrogen is-80 ℃ of preservations.Refrigerated potato tuber sheet is pulverized while adding the liquid nitrogen grinding rod in mortar.In the potato tuber powder of gained, add 2g phenol sorbent material polycra AT, stir with grinding rod.Add 7ml afterwards and extract damping fluid [0.1M Sodium Tetraborate (pH 8.8), 1mM PMSF (phenylmethylsulfonyl fluoride), 10mM 2 mercapto ethanol], suspension postcooling centrifugal (14,000rpm, 20 minutes, 4 ℃) is preserved the supernatant that obtains down at-80 ℃.
11. Expression of Fusion Protein and extraction thereof in the intestinal bacteria
In order to obtain to be used to prepare the antigen of antibody, with potato PVS at expression in escherichia coli.The translated district of the PVS1 cDNA of total length is inserted the expression vector pET-32b (+) (precious wine is made) that is cut by EcoRI and XhoI enzyme, with the gained carrier import intestinal bacteria (BL21, Novagen).These intestinal bacteria are inoculated on the LB nutrient agar that contains 50 μ g/ml carvenicilin, 37 ℃ of overnight incubation.Prepare four the 500ml flask that 50ml contains the LB liquid nutrient medium of 200 μ g/ml carvenicilin is housed, choose single bacterium colony, be suspended in respectively in each flask from substratum.In 37 ℃ of shaking culture (140rpm), until A 600=0.6.Wherein 250 μ l as inducing preceding protein example, are used to confirm Expression of Fusion Protein.Add IPTG afterwards, making final concentration is 1mM, and induced protein is expressed, again in 37 ℃ of shaking culture 3 hours (140rpm).Cooled on ice 5 minutes, then with medium centrifugal (5,000rpm, 10 minutes).Remove supernatant, will precipitate resuspending, wherein 100 μ l as inducing the back protein example, are used to confirm the abduction delivering to fusion rotein in 5ml intestinal bacteria aaerosol solution [50mM Tris-HCl (pH8.0), 2mM EDTA].With nutrient solution recentrifuge (5,000rpm, 10 minutes), remove supernatant, colibacillary precipitation is used to confirm the solubility of fusion rotein.
Carry out to the affirmation of inducing expressing fusion protein with to the affirmation of solubility is following.With before the inducing of as above sampling and induce back protein example centrifugal (5,000rpm, 30 seconds), remove supernatant, will precipitate resuspending in 100 μ l intestinal bacteria aaerosol solutions.By each suspension 10 μ l that respectively take a sample, carry out SDS-PAGE, Western engram analysis.SDS-PAGE and Western engram analysis carry out according to the content of 14.SDS-PAGE and Western engram analysis item.After confirming abduction delivering, the colibacillary precipitation of inducing expressing fusion protein fully is suspended in ice-cooled in advance 5ml binding buffer liquid [5mM imidazoles, 0.5M sodium-chlor, 20mM Tris-HCl (pH7.9)].Suspension is moved in the transparent centrifuge tube, on one side the broken intestinal bacteria of ultrasonic disruption instrument are used on the ice-cooled one side of centrifuge tube.With thallus suspension liquid centrifugal (12,000rpm, 10 minutes), with supernatant as the solubilized component.In precipitation, add the urea-containing binding buffer liquid of 5ml (6M urea is added binding buffer liquid gained), resuspending, then with suspension centrifugal (12,000rpm, 10 minutes), with supernatant as the urea component.From solubilized component, the urea component 10 μ l that take a sample, carry out SDS-PAGE, Western engram analysis respectively.SDS-PAGE and Western engram analysis carry out according to the content of 14.SDS-PAGE and Western engram analysis item.
In the urea component, confirm to have fusion rotein, therefore progressively remove urea and the proteinic structure of regenerating and being generated.Proteinic regenerative operation is following to carry out.The urea component is transferred to dialysis tubing, dialysed 1 hour with 200ml 4M urea dialyzate [4M urea, 10mM Tris-HCl (pH7.0), 5mM DTT] at 4 ℃.Dialyzate is changed to 200ml 2M urea dialyzate [urea concentration changes 2M in the 4M urea dialyzate], 4 ℃ of dialysis 1 hour.Dialyzate being changed to 200ml did not have urea dialyzate [removing the urea gained in the 4M urea dialyzate] again, 4 ℃ of dialysis 1 hour.Once more dialyzate being changed to 200ml does not have urea dialyzate [removing the urea gained in the 4M urea dialyzate], 4 ℃ of dialysed overnight.This solution is moved in the Eppendorf pipe, and centrifugal (15,000rpm, 10 minutes) move into supernatant in the new pipe then.With this component as regeneration component, as the antigen that is used to prepare antibody.By above operation, obtained the fusion rotein of 4ml 8mg/ml.
12. the preparation of anti-PVS antibody
Mouse (BALB/c, female, 4 ages in week) was raised 5 days, will be contained solution and complete Freund's adjuvant (DIFCO) balanced mix of 100 μ g, 100 μ l gained emulsions are carried out peritoneal injection at the fusion rotein of expression in escherichia coli.After 1 week,, 100 μ l gained emulsions are carried out peritoneal injection with 100 μ g fusion roteins and incomplete Freund's adjuvant (DIFCO) balanced mix.Cut the afterbody blood sampling of mouse after 10 days, whether produce anti-HMGR antibody with the research of Western engram analysis method.Confirm to have taken place antigen antibody reaction,, 100 μ l gained emulsions are carried out peritoneal injection therefore again with 100 μ g fusion roteins and incomplete Freund's adjuvant (DIFCO) balanced mix.The blood sampling of one usefulness back 4 ℃ of standing over night, is settled out blood clot.With this centrifugal blood (10,000rpm, 15 minutes), supernatant as antiserum(antisera), is divided into aliquot and injects the Eppendorf pipe ,-80 ℃ of preservations.
13. quantification of protein
The determination of protein concentration of sample uses the quantification of protein test kit of making according to Bradford (1976) method (BIO-RAD) to carry out.Calibration curve uses BSA to make.
14.SDS-PAGE and Western engram analysis
The SDS-PAGE of protein example carries out according to the method for Laemmli (1970).10 μ l samples are mixed with 10 μ l sample buffers [the 50mM Tris-HCl (pH8.5) that contains 2%SDS, 10% mercaptoethanol, 0.002%BPB, 20% glycerine], boil after 5 minutes ice-cooledly, carry out electrophoresis with 10% polyacrylamide gel.
The Western engram analysis carries out according to the method (reference literature 55) of (1979) such as Towbin.With the gel behind the SDS-PAGE, filter paper, Nitrocellulose film (PROTPRAN, Schleicher and Schuell) use in the damping fluid (0.1M Tris, 0.192M glycine, 20% methyl alcohol, 0.1%SDS) in transfer printing respectively and soaked 30 minutes, place then on the Stage microscope of semidry blotter (ATTO), use 2mA/cm 2Constant current energising 60 minutes, protein transduction in the gel is printed on the Nitrocellulose film. this Nitrocellulose film is contained the 50mM Tris-HCl damping fluid (pH7.6) of 137mM sodium-chlor, 0.1% polysorbas20 at the TBS-T[that contains 5% skimming milk] in shaken overnight, seal.This film is washed 15 minutes once in TBS-T; Washed twice was washed 5 minutes at every turn again, vibrated 1 hour in the TBS-T that contains the anti-potato PVS antibody (diluting 2,000 times) as first antibody then.Again film is washed vibration 30 minutes in containing then as the TBS-T of the anti-mouse Ig antibody (Amersham) of second antibody in TBS-T.Film is washed in TBS-T, use ECL detection kit (Amersham) on Hyper Film (Amersham), to carry out the detection of signal then.
15. the preparation of probe
As template, use primer shown in Figure 23 with the plasmid of the PVS1-4 cDNA that mixed potato, the base sequence of each gene is carried out specific amplification by PCR.Use 2ng to mix the plasmid of TaKaRa TaqTM (precious wine is made) and insertion sheet segment DNA, on DNA thermal cycler PJ 2000 (Perkin Elmer Cetus), with 94 ℃-1 minute (thermally denatures), 53 ℃-45 seconds (annealing), 72 ℃-2 minutes (DNA extensions) is a circulation, carries out 25 round-robin reactions.Confirm the size of the dna fragmentation of amplification by 0.8% agarose gel electrophoresis.Use QIAquickGel to extract test kit (QIAGEN) purifying DNA fragment from gel.
16. potato gene group library screening
Genomic library use existing potato gene group library (potato kind Desiree, Clontech).
According to plaque hybridization method screening phage clone (reference literature 37).Each culture dish is adjusted to 30,000 plaques, with this phage solution and 200 μ l host e. coli XL1-BlueMRA (P2) bacterial strain (10mM sal epsom, A 600=2) mix, left standstill 20 minutes at 37 ℃, then it is mixed overlapping being inoculated on the NZYM nutrient agar (1%NZ amine, 0.5% yeast extract, 10mM sal epsom, 0.5% sodium-chlor, 1.5% agar powder) with 3ml NZYM top agarose (1%NZ amine, 0.5% yeast extract, 10mM sal epsom, 0.5% sodium-chlor, 0.6% agarose).Under 37 ℃, be cultured to the about 0.5mm of plaque diameter, left standstill 1 hour at 4 ℃ then.Make the plaque on the substratum be adsorbed on Hybond-N +On the nylon membrane (Amersham), handled 7 minutes, handled 3 minutes, use 2 * SSPE washing then with neutralization solution [1.5M sodium-chlor, 0.5mM Tris-HCl (pH 7.2), 1mM EDTA] with denaturing soln (1.5M NaCl, 0.5M NaOH).By 0.4M sodium hydroxide DNA is fixed on the film again, uses 5 * SSPE washing (2 times) then.From adding up to 6.0 * 10 5Screening target clone among the individual clone.
After the first screening, use each member's Auele Specific Primer of PVS1-4 to carry out PCR, select to have PVS1, PVS2 and the PVS4 that infers big or small band, carry out secondary, three screenings again.
The preparation of probe, hybridization, washing and radioautograph and 18.Described in the situation of Southern hybridization identical.
17. the separation and purification of phage DNA
The separation and purification of phage DNA is carried out according to following method according to the liquid culture method (reference literature 23) and polyoxyethylene glycol (PEG) precipitator method (reference literature 37).From agar, reclaim the target plaque, be transferred in the 1.5ml pipe that contains 100 μ l SM solution [50mM Tris-HCl (pH 7.5), 0.1M sodium-chlor, 7mM sal epsom, 0.01% gelatin] and 1 μ l chloroform,, fully suspend then 4 ℃ of standing over night.With the 200ml flask with host e. coli [XL1-BlueMRA (P2) bacterial strain] in 80ml NZYM (1%NZ amine, 0.5% yeast extract, 10mM sal epsom, 0.5% sodium-chlor), spend the night 30 ℃ of following shaking culture.Reclaim sedimentary host e. coli by centrifugal (8,000rpm, 3 minutes, 4 ℃), be suspended in then in the 10mM Adlerika, be adjusted into A 600=2.500 μ l host e. coli suspension of preparation are like this mixed with 50 μ l phage suspension liquid, under 37 ℃, left standstill 20 minutes, use 50ml NZYM then, confirm bacteriolyze 37 ℃ of following shaking culture.Add 2.9g sodium-chlor and 0.4ml chloroform, vibrated again 10 minutes.Reclaim supernatant by centrifugal (10,000rpm, 10 minutes, 4 ℃), mix, in ice, left standstill then 1 hour with the 50%PEG 6000 of 1/5th amounts that are equivalent to supernatant.Reclaim precipitation by centrifugal (12,000rpm, 20 minutes, 4 ℃), be suspended in 400 μ l Tris-Mg-NaCl[10mMTris-HCl (pH 7.5), 49.6mM sodium-chlor, 4.9mM magnesium chloride].Add 4 μ l 10mg/ml RNase A (Sigma) and 4 μ l 10mg/ml DNase I (Sigma) in this solution, handled 1 hour down at 37 ℃, chloroform extraction is three times then.Add 2 * STE[80mM Tris-HCl (pH7.5), 2%SDS, 0.5M EDTA with the upper strata equivalent that reclaims] and 1/5th 10mg/ml Proteinase Ks of measuring, handled 10 minutes at 65 ℃, use the saturated phenol of Tris, the phenol of same capability then: chloroform: primary isoamyl alcohol (25: 24: 1, v/v/v), chloroform: primary isoamyl alcohol (24: 1, v/v) extract successively.In the upper strata of reclaiming, add the cold ethanol of 2 times of amounts, under-20 ℃, left standstill 30 minutes, reclaim precipitation by centrifugal (12,000rpm, 10 minutes, 4 ℃) then.To precipitate and use 70% washing with alcohol, drying under reduced pressure is dissolved in the 100 μ l water then.
18.Southern engram analysis
Total DNA with selected restriction enzyme (precious wine is made) digestion target clone carries out classification (reference literature 37) by 0.8% agarose gel electrophoresis.By alkali blotting (reference literature 36) the fractionated dna fragmentation is transferred to Hybond-N +On the nylon membrane (Amersham).
32The P labeled DNA probe is according to random priming (Feinberg and Vogelstein, 1983), use [α- 32P] dCTP (ICN Biochemicals) and Megaprime DNA Labellingsystems (Amersham) preparation.
The nylon membrane that is adsorbed with DNA placed 1 hour in 42 ℃ prehybridization solution [5 * Denhardt solution (reference literature 37), 5 * SSPE (reference literature 37), 0.5%SDS, 100 μ g/ml thermally denature salmon sperm DNAs (Pharmacia)] or more than, add then 32The P labeled DNA probe, 42 ℃ down hybridization 16 hours or more than.This film is washed 10 minutes (2 times) in containing 2 * SSPE of 0.1%SDS, washing 10 minutes (1 time) in containing 1 * SSPE of 0.1%SDS again.Washing is all at room temperature carried out.Use X-ray film OMAT-AR (Kodak) and intensifying paper Lighting Plus (Dupont), under-80 ℃, carry out radioautograph.
19. the preparation of plasmid
In order to determine base sequence, use pBluescript KS+ (Stratagene) that the target dna fragment is carried out subclone.
Total DNA with selected restriction enzyme (precious wine is made) digestion target clone carries out classification (reference literature 37) by 0.8% agarose gel electrophoresis, extracts test kit (QIAGEN) purifying with QIAquick Gel and contains the segmental sepharose of target dna.Undertaken by alkaline phosphatase E.coli C75 (precious wine is made) using phenol: chloroform after dephosphorylation handles (37 ℃, 1 hour) through the carrier of restriction enzyme digestion: primary isoamyl alcohol (25: 24: 1, v/v/v), chloroform: primary isoamyl alcohol (24: 1, v/v) extraction successively.In the upper strata of reclaiming, add the cold ethanol of 2 times of amounts and the 3M NaCl of 1/20th amount, under-20 ℃, left standstill 30 minutes, reclaim precipitation by centrifugal (12,000rpm, 10 minutes, 4 ℃) then.To precipitate and use 70% washing with alcohol, drying under reduced pressure then, be dissolved in 20 μ l TE[10mM Tris-HCl (pH8.0), 1mM EDTA]. carrier that will as above prepare and insertion fragment thereof are adjusted into carrier: inserting segmental mol ratio is 1: 1, connect with dna ligation kit ver.2 (precious wine is made), with the plasmid DNA Transformed E .coli JM109 competent cell (precious wine is made) that connects, be inoculated in (1% bacto-tryptone on the LB/Amp/X-gal/IPTG nutrient agar then, 0.5% yeast extract, 1% sodium-chlor, 0.1mg/ml penbritin solution, 0.004%X-gal solution, 0.5mM IPTG solution, 1.5% agar powder), 37 ℃ of following overnight incubation.To carry out single bacterium colony overnight incubation in LB/Amp liquid nutrient medium (2ml LB, 0.1mg/ml penbritin) of blue white bacterium colony screening, isolated plasmid dna.Use Flexiprep Kit (AmershamPharmacia Biotech) to carry out the extraction and the purifying of plasmid DNA.
20.DNA base sequence fixed sum data storehouse is really analyzed
Definite use of base sequence is carried out based on the PRISM DyeDeoxy Termination Cycle Sequencing Ready Reaction Kit (AppliedBiosystem) of deoxidation cessation method (reference literature 38).Use ABI 373S dna sequencing instrument dna sequence dna automatic analysing apparatus (Applied Biosystem) to carry out electrophoresis and the reading of base sequence of reaction product in denaturing polyacrylamide gel.Use the giant-powered computer blast program (reference literature 1) of Japanese National Institute of Genetics Japan's DNA database (DDBJ) to the connection of base sequence, read the aminoacid sequence of frame and analyze with the homology of known.CLUSTALw program (reference literature 43) is adopted in the comparison of aminoacid sequence.
21. the transient expression that uses the potato tuber protoplastis to carry out is measured
The transient expression that uses the potato tuber protoplastis to carry out is measured with reference to Hashimoto etc.(1992) following the carrying out of method (reference literature 18).Contain 1 * 10 at 800 μ l 6Solution (0.5M mannitol, the 0.1mM MgSO of individual protoplastis from the potato culturing cell 4, pH 7.0) in add 25 μ g transgenosiss, by transfer pipet lightly pressure-vaccum mix, left standstill 10 minutes on ice.This solution is moved in advance in the refrigerative cup, use gene gatherer CUY 21 (TokiwaScience), under constant current conditions, implement electroporation (6v, 50pon, 75poff, 4 times).Solution is moved to centrifuge tube.Left standstill 10 minutes on ice, remove supernatant then, add 900 μ l nutrient solutions, move to 12 well culture plates, left standstill 1 hour 20 ℃ dark place.Add 100 μ l aqua sterilisas or 100 μ l 1mg/ml HWC to having imported through electroporation to contain in the protoplastis of carrier that PVS3 infers promoter region afterwards, left standstill 12 hours.Positive control leaves standstill them 12 hours for imported the protoplastis of the carrier that contains CaMV 35S promoter district through electroporation.Remove supernatant,, (Promega) measure luciferase activity with two luciferases report detection systems (Dual-Luciferase Reporter Assay System) then with 1 * PBS washing protoplastis.
22. preparation of transgenic plant and GUS dyeing
Preparation of transgenic plant and GUS dyeing are carried out according to the method (reference literature 19) of Jefferson (1987).The stem of the MayQueen of sterile culture is used in the preparation of transgenic plant.Make the CaMV35S promoter deletion of conversion carrier pBI121 (Clonetech), make the PVS3 of translation initiation codon upstream 2648bp infer promoter region and be connected with the upstream of gus gene via BamHI, make GUS can frame in translation (Figure 11).By electroporation this carrier is imported agrobacterium tumefaciens (Agrobacterium tumefaciens) LBA4404 (Clonetech).The stem that cuts was soaked 2 minutes in the nutrient solution of agrobacterium tumefaciens, make its infection, 3C5ZR substratum under 20 ℃, in culture dish [30g sucrose, 2g gellan gum, 100ml MS mineral substance (10 *), 5mlFe-EDTA, 100ml inositol, 2.4ml 3C5ZR VITAMIN (the 1mg/l vitamin of 1ml, 0.5ml 1mg/ml nicotinic acid, the 1mg/ml hydrochloric acid vitamins B of 0.5ml 6, 0.4ml the 1mg/ml aspartic acid), 5.3ml IAA (0.1mg/ml), 17.5ml ribosylzeatin (0.1mg/ml), pH 5.9, every 1000ml] in left standstill 3 days.Move to then on the 3C5ZR substratum that contains kantlex (100 μ g/ml) and cefotaxime cephamycin (300 μ g/ml).This step repeats weekly once, bear seedling after, move on the S1 regeneration culture medium (15g sucrose, 3g gellan gum, 100mlS1 mineral substance (10 *), 5ml Fe-EDTA, 2.0ml V2 VITAMIN, pH5.7, every 1000ml), confirm the regeneration of root.
During GUS dyeing, with plant tissue [100 μ l X-Gluc (among the 50mg/mlDMF), 1ml 500mM phosphoric acid buffer (pH 7.0), 2ml 100% methyl alcohol, 7.9ml 0.5%triton X-100 in the GUS staining fluid, every 10ml] decompress osmosis, diel dyes under 37 ℃ dark condition.Afterwards, dyeing is organized in acetate: ethanol: boiling decoloring and observation in the destainer of glycerine (1: 3: 1).During the phytophthora infestans of microscopic examination inoculation, with decolouring be organized in that (10ml lactic acid, 10g phenol, 10ml glycerine, 10ml water, 40ml ethanol) boils in the lactophenol solution, carry out repeatedly.Afterwards in decolouring 2 days on the filter paper that is soaked with Chloral Hydrate (2.5g/ml), under 4 ℃ dark condition and observation (reference literature 49).
23. the transient expression via agrobacterium tumefaciens in the leaf of potato tissue is measured
Transient expression via agrobacterium tumefaciens is measured according to people such as Chang.(2002) method (reference literature 7) is carried out.Contain Cf-9/Avr9 or StMEK having imported by electroporation DDAdd Rifampin (50 μ g/ml) and selected antibiotics in the agrobacterium tumefaciens lba4404 of the binary vector of (SEQ IDNO.7), cultivate.With agrobacterium tumefaciens centrifugal (3,000rpm, 15 minutes) collect thalline, suspend in importing damping fluid [1 * 10x Murashige-Skoog salt, 1/10x vitamin B5,2% sucrose, 1% glucose, 150 μ M Syringylethanones, 20mM MES pH5.4], it is OD that concentration is reconciled 600=0.1.Use the injection tube of 1ml, inject suspension, GUS dyeing after 2 days by the back side of leaf.
＜embodiment 1〉situation of accumulating of PVS mRNA in the potato tuber tissue of inoculation late disease bacteria
Potato tuber is carried out affinity, the inoculation of non-affinity microspecies and water treatment, extract total RNA at different time by 3 potato tubers then, use PVS1 cDNA to carry out the Nortern engram analysis.Analytical results as shown in Figure 2.All see accumulating of PVS mRNA at affinity bacterium treatment zone, non-affinity bacterium treatment zone.
＜embodiment 2〉inoculation late disease bacteria the potato tuber tissue in each member's specificity RT-PCR of PVS1-4
Whether each member of PVS1-4 expresses in the potato tuber tissue in order to study, after having carried out inoculation of affinity, non-affinity microspecies and water treatment,, use each member's Auele Specific Primer of PVS1-4 (SEQ ID NO.9,10,13,14,15,16,17 and 18) to carry out RT-PCR through extracting total RNA the refrigerated potato tuber after 3,6 hours.The expectation size that has all detected in affinity bacterium treatment zone, the non-affinity bacterium treatment zone corresponding to PVS1-4 is the band (Fig. 3) of 469bp, 132bp, 326bp and 469bp.
＜embodiment 3〉the proteic Western engram analysis of PVS in the potato tuber tissue of inoculation non-affinity microspecies and affinity microspecies
For whether the situation of accumulating of studying PVS mRNA is reflected in the actual protein synthesis, prepared anti-potato PVS antibody, carry out the Western engram analysis.In order to obtain to be used to prepare the antigen of antibody, based on putative amino acid sequence, at e. coli expression.To insert expression vector by the PVS1 cDNA translation district of PCR preparation, as with the fusion rotein of Trx at e. coli expression.E. coli total protein matter before and after the abduction delivering is carried out SDS-PAGE, with CBB solution-dyed gel.Detect the band of about 83kD in the urea component, therefore remove urea, as the antigen that is used to prepare antibody by this component dialysis.
Use the antibody of preparation to study tiring of antibody, when diluting 1,000 times of use, can detect the antigen of 10ng.Judge that thus this antibody has enough tiring with the Western engram analysis after carrying out, therefore after carrying out ageing in 24 hours, the preparation soluble component uses anti-potato PVS antibody to carry out Western engram analysis (Fig. 4) in inoculation water treatment, non-affinity microspecies or affinity microspecies 24 hours from the potato tuber sheet.After 6 hours, all as seen PVS is proteic in the inoculation district of non-affinity and affinity microspecies accumulates.Not seeing then at water treatment zone that PVS is proteinic accumulates. and these results have supported the result that the peak appearred in 6-9 hour in inoculation of being accumulated in of PVS mRNA among Fig. 2.
＜embodiment 4〉inoculation late disease bacteria the leaf of potato tissue in each member's specificity RT-PCR of PVS1-4
Whether each member of PVS1-4 expresses in the leaf of potato tissue in order to study, carried out affinity, the inoculation of non-affinity microspecies and water treatment, wound is handled the different time in back 12 hours, from 3 leaf of potato, extract total RNA, use each member's Auele Specific Primer of PVS1-4 (SEQ IDNO.11,12,13,14,15,16,19 and 20) to carry out RT-PCR. and use each member's specificity cDNA probe of PVS1-4 to carry out the Southern engram analysis then.In affinity bacterium inoculation district, the non-affinity bacterium inoculation district, only detect a band that shows that significant m RNA accumulates, it is to represent the expectation size of PVS3 be the band of 326bp (Fig. 5). use as positive control from the RNA of stem tuber tissue the time, detect respectively corresponding to the expectation of PVS1-4 is big or small and be the band (Fig. 5) of 176bp, 132bp, 326bp and 131bp.
＜embodiment 5〉potato gene group library screening
Consider that monoploid potato gene group size is 1.6-1.8 * 10 9Bp (Arumuganathan and Earle, 1991), the big or small mean value in potato gene group library are that each plaque is 1.5 * 10 4Bp, and potato is tetraploid plant, in order to screen whole karyomit(e)s of potato, must screen 5.2 * 10 at least 5Individual plaque.Therefore, be probe with the total length of PVS1 cDNA, screened 6.0 * 10 5Individual plaque.First results of screening has been confirmed 87 clones.In order to distinguish PVS1-4, obtain simultaneously to infer promoter region, from these 87 clones, utilize each member's specificity site of PVS1-4 to make up primer respectively, its PCR product is carried out electrophoresis. PVS1, PVS2, PVS3 and PVS4 are selected 3 clones respectively, carry out secondary, three screenings.
To screen institute's DCRP and digest separately with EcoRI, HindIII or XhoI respectively, obtaining the PCR product by described primer screening is that probe carries out the Southern blot hybridization.The result detects the band with this probe hybridization.Owing to confirmed to have obtained the target clone, the dna fragmentation subclone that therefore will hybridize, digest through EcoRI, HindIII is determined base sequence to pBluescript KS+ carrier.
＜embodiment 6〉the fixed sum data storehouse analysis really of DNA base sequence
PVS1 to subclone, the dna fragmentation of PVS3 and PVS4 carries out the (Fig. 6 that determines of full base sequence, 7,8,9). Fig. 6 and Fig. 7 represent promoter region (SEQ ID NO.1) and coding region (the SEQ ID NO.21) of PVS3. for the genome structure of PVS3 cDNA and PVS3 is studied, the PVS3 genomic dna sequence of isolating PVS3 cDNA (reference literature 53) and present embodiment gained compares. as can be known: for PVS3, except 3 '-non-translational region, whole base sequences and the aminoacid sequence of inferring are all consistent, separate (Fig. 8) by six introns. and different with PVS3, PVS1 and PVS4 separate by 5 introns, (Fig. 9). the Cultivar of known potato plants is a tetraploid, in genome, there are a plurality of homologous genes (document 56). the PVS3 genomic clone that obtains in the present embodiment has only 3 '-non-translational region different with PVS3cDNA, can think that therefore this is the gene of one of coding PVS3 subfamily.
Back and Chappel (1996) have reported the functional segregation in the sesquiterpene cyclase (reference literature 4).Sesquiterpene cyclase to tobacco (TEAS), capsicum (PEAS)---5-table-aristolochine synthase, and the putative amino acid sequence of the vetispiradiene synthase of Semen Hyoscyami (HVS), potato (PVS) compares. learn: all be between the HVS and PVS3 or PVS4 of VS, in vetipiradiene specificity territory, visible 90% or above identity (Fig. 9).Identity between PVS3 and the PEAS then be 80% or below. exist in the aristolochine specificity territory of substrate binding site, PVS and TEAS, perhaps between PVS and the PEAS, identity is 78%-89%, and between PVS and the HVS visible 98% or above high identity. the sesquiterpene cyclase of expressing in leaf texture contains seven exons being separated by six introns; And PVS1 that expresses in the potato tuber tissue and PVS4 contain six exons (Fig. 9) of being separated by five introns.
＜embodiment 7〉to measure by the transient expression that uses protoplastis, research PVS3 promotor is to the responsiveness of HWC
PVS3 is inferred the upstream that promoter region is connected to luciferase, preparation pGL3 carrier, by electroporation it is imported protoplastis, research is for the responsiveness (Figure 10) of HWC. compares with water treatment zone, the visible significantly high luciferase activity of HWC treatment zone, show in this experiment 2 of the translation initiation codon upstream of using, the district of 648bp produces releaser and replys.
＜embodiment 8〉PVS3 expression of gene situation in the transgenic plant
In order at length to study the expression of PVS3, PVS3 is inferred the upstream that promoter region is connected to gus gene, preparation binary vector (Figure 11), this binary vector is imported the MayQeen that Phytophthora infestans does not have the true resistance gene, the preparation transformant. in order to study PVS3 gene replying for wound, with the excision of the part of transgenic Rhizoma Solani tuber osi leaf texture, carrying out GUS dyeing (Figure 12) at different time. the result excises the position and still was unstained after 48 hours. and showing thus that this promotor does not produce wound replys.
For research to the replying of late disease bacteria, inoculation late blight rhzomorph and property microspecies are also carried out microscopic examination, can see GUS dyeing (Figure 13) in the invasion cell with interior in 6 hours.Inoculate after 48 hours, visible intensive is expressed on whole inoculation leaf.This demonstration: this promotor is replied the infection of late disease bacteria affinity microspecies.
Whether there to be the organ that this promotor can constant expression in order studying, will to put in order strain transgenic Rhizoma Solani tuber osi plant and carry out GUS dyeing (Figure 14).Except the late disease bacteria inoculation leaf texture that uses as the painted positive control of GUS, not seeing dyeing at positions such as vegetative point or roots. this result shows: this promotor is replied for the pathogenic bacteria specificity.
Whether any disease signal is all replied in order to study this promotor, leaf texture handled with various releasers and carry out GUS dyeing (Figure 15,16,17,18). with the formation lipid acid of phytophthora infestans film---when arachidonic acid is handled, visible GUS dyeing (Figure 15) after 24 hours. and for a kind of hydrogen peroxide treatment of active oxygen or the glucose notatin that generates hydrogen peroxide is handled or GUS dye (Figure 16,17,18) is not all seen in any processing such as Whitfield's ointment relevant with whole strain acquired resistance.
The resistant gene product C f-9 of tomato variety replys the specificity releaser Avr9 of leaf muld of tomato bacterium (tomato leaf mould (Cladosporium fulvum)), then the information transduction mechanism works, the induced hypersensitivity reaction, this be well-known (reference literature 41). via Agrobacterium, Cf-9/Avr9 is transient expression in leaf texture, and this moment can GUS dyeing (Figure 19).And, make constitutive activity mutant enzyme StMEK DD(SEQ ID NO.7,8) is same to express the visible GUS activity of result (Figure 19). wherein said StMEK DDBe used for making protein kinase (WIPK) phosphorylation of the protein kinase (SIPK) of Induced by Salicylic Acid of the known downstream that is present in above-mentioned resistant gene, the various defensive ractions of control and wound-induced and activate. and do not see that in the leaf texture that has inoculated the Agrobacterium of using in contrast GUS dyes, wherein said contrast Agrobacterium contains not that tool inserts segmental binary vector.
HMG-CoA reductase enzyme (HMGR) gene that plays an important role in Rishitin is synthetic forms multigene family (Fig. 1).Known HMG1 replys wound, acts on the generation of steroid glycoalkaloid; And HMG2 and HMG3 are subjected to the disease signal induction, act on synthetic (reference literature 9) of Rishitin.Have report to point out: the PVS gene of potato plants forms multigene family too, has member's (reference literature 53) of PVS1-4.In this research,, use each member's Auele Specific Primer to carry out RT-PCR in order to study the expression of each member of PVS1-4 in potato tuber tissue and the leaf texture.Extract total RNA in the potato tuber sheet of the affinity of late disease bacteria and the inoculation of non-affinity microspecies, carry out RT-PCR (Fig. 3) as template.Inoculate any microspecies and all detect band corresponding to each member's of PVS1-4 expectation size.These results show: in the stem tuber tissue, the member of PVS may not have different effects for the metabotic change of replying stimulation at least.
Whether be reflected to for the situation of accumulating of studying PVS mRNA in the PVS protein synthesis of potato tuber tissue, prepared anti-potato PVS antibody, carry out Western engram analysis (Fig. 4).By inoculating non-affinity microspecies and affinity microspecies, visible during back 6 hours to 24 hours PVS is proteic accumulates in inoculation.Report is arranged: use the total RNA by the potato tuber tissue extraction to carry out the Nortern engram analysis, the result is in non-affinity microspecies and affinity microspecies inoculation district, and PVSmRNA is the 6-9 hour appearance instantaneous peak of accumulating (Fig. 2, document 53) after inoculation.Consider the situation of accumulating of PVSmRNA, can think the proteinic long half time of PVS.In addition, report is arranged: having inoculated the PVS enzymic activity for preparing in the soluble component in the potato tuber tissue of non-affinity microspecies and affinity microspecies all increases (reference literature 54) to some extent.But report is arranged also: have only the non-affinity microspecies of inoculation, phytoalexin is just accumulated, above-mentioned report and this report contradiction (reference literature 40).Can think in the biosynthesizing of phytoalexin of potato, play an important role (reference literature 29,54 and 9) (Fig. 1) by the enzyme HMGR of 3-hydroxy-3-methylglutaryl-coenzyme A (HMG-CoA) biosynthesizing mevaldic acid with by two kinds of protein of PVS of farnesyl bisphosphate biosynthesizing vetispiradiene.Have report to point out: HMGR is active only significantly to be increased in non-affinity microspecies inoculation district, and the district reduces (reference literature 52) in time in the inoculation of affinity microspecies.Consider the active situation of HMGR, can think that the key of synthetic control of the specificity phytoalexin between potato kind-late disease bacteria microspecies is the supply of mevaldic acid.In order to verify this possibility, be necessary by supplying with the farnesyl bisphosphate by the outside, whether research phytoalexin lubimin and Rishitin are accumulated to having inoculated the stem tuber tissue of affinity microspecies.
Reality first infected tissue of phytophthora infestans is a leaf texture.In this research,, after inoculation affinity, non-affinity microspecies and water treatment, from leaf texture, extract total RNA, carried out RT-PCR (Fig. 5) as template in the different time for whether each member of PVS1-4 after studying the inoculation late disease bacteria expresses.In affinity, non-affinity microspecies inoculation district, all as seen have only PVS3 significantly to be induced.Known usually in the leaf of potato tissue Rishitin do not accumulate (reference literature 34).But, have the example of observation to show Rishitin also instantaneous synthetic (reference literature 26) in leaf texture.In the leaf texture, the effect of Rishitin in defence is replied is not clear and definite as yet so far, but PVS3 is induced after the inoculation affinity microspecies, can utilize this promotor to make the disease resistance crop thus.Therefore, in order to obtain the PVS3 promoter sequence, separated genomic clone.Screening has obtained PVS1, PVS3 and PVS4 (Fig. 6,7,8,9).This isolating PVS3 genomic clone is compared with isolated PVS3cDNA, all consistent with putative amino acid sequence.The restriction enzyme sites unanimity in exon district, corresponding (Fig. 8) separately.
The phytoalexin of tobacco and capsicum---the Rishitin that capsicum glycol and Semen Hyoscyami and potato are generated all by similar route of synthesis synthetic (reference literature 4 and 29) (Fig. 1).With the former synthetic relevant sesquiterpene cyclase 5-table-aristolochine synthase (EAS), the EAS of tobacco (TEAS) and capsicum (PEAS) extremely similar on amino acid levels (reference literature 35).Back and Chappell use the HVS cDNA of TEAS and Semen Hyoscyami to make up various mosaic genes, have synthesized protein (reference literature 4) by mosaic gene in intestinal bacteria.The substrate farnesyl bisphosphate that adds EAS and AS in the thalline soluble constituent by the generation ratio of 5-table-aristolochine or vetispiradiene is carried out quantitatively, can be inferred the active district of two kinds of enzymes of control.According to their research report, the putative amino acid sequence in the active territory by the definition of each exon is compared, in the vetispiradiene specificity territory, between the HVS of Semen Hyoscyami and PVS4 or the PVS3 visible 90% or above identity.Exist in the aristolochine specificity territory of substrate binding site, the identity between PVS and TEAS or the PEAS is 78%-89%, and between PVS and the HVS visible 98% or above high identity (Fig. 9).This result has supported the hypothesis (reference literature 4) that Back and Chappell propose.PVS1 and PVS4 contain six exons being separated by five introns, and PVS3 that expresses in leaf texture or other sesquiterpene cyclase contain seven exons (Fig. 9) of being separated by six introns. infer field, palace (1984): the intron that does not have function in Mitochondrial Genome Overview is efficiently duplicated is removed during evolution, DNA shortens. according to this hypothesis, the 5th intron of PVS1 that expresses in stem tuber and PVS4 may be removed during evolution, shortens.
If utilize promotor to prepare the disease resistance plant, then must carry out the analysis of PVS3 promoter region, identify. in the present embodiment, what make that gus gene is connected to PVS3 infers the promotor downstream, preparation transgenic Rhizoma Solani tuber osi plant, responsiveness to this promotor has carried out detailed research thus. and it is worth noting: this promotor is not only replied (Figure 12) to wound, do not see dyeing (Figure 14) at positions such as vegetative point or roots yet. equally connect GUS in the promotor downstream of the sesquiterpene cyclase TEAS of tobacco plant, the preparation rotaring gene tobacco plant, the existing report of its expression (reference literature 51). but they have reported the low-level of wound have been replied, and visible GUS activity in root or stem. according to this report, can think that the response mode of the TEAS promotor in PVS3 promotor and the tobacco leaf tissue in the leaf of potato tissue is different. in the tobacco leaf, handle to the attack of pathogenic bacteria or to releaser and to reply, phytoalexin capsicum glycol high density is accumulated. and do not see accumulating of Rishitin in the leaf of potato tissue, PVS3mRNA accumulates just can detect so low-level degree (Fig. 5) by RT-PCR. and consider this result, the special responsiveness of PVS3 promotor may be because of low expression level.
Recently, have report to point out: HMGR genetic expression is subjected to the control (reference literature 33) of the kinase whose a kind of SIPK one by one of mitogen-activated protein(MAP) (MAP). in this research, make constitutive activity mutant enzyme StMEK DD(reference literature 50) similarly expresses, the visible GUS activity of result (Figure 19).Wherein said StMEK DDMake SIPK and WIPK phosphorylation and be activated. and via Agrobacterium, make the specificity releaser Avr9 of leaf muld of tomato bacterium and resistant gene product C f-9 transient expression in leaf texture of tomato variety, this moment can GUS people's report such as dyeing (Figure 19) .Romeis: handle tobacco plant and the culturing cell that has transformed Cf-9 with Avr9, then SIPK and WIPK are activated (reference literature 35). and can be inferred by these results: the PVS3 promotor is also same with the HMGR gene, controlled by SIPK. with HWC or arachidonic acid treatment potato tuber tissue, the map kinase that then is equivalent to SIPK is activated, and this has also supported above-mentioned supposition (reference literature 20). and the information transduction pathway of this deduction is as shown in figure 20.
The MAPK cascade is one of controlling elements important in the plant signal transduction pathway, in recent years be subjected to people's attention (document 65). wherein, having known that SIPK and WIPK play an important role by (document 57) in the disease resistance expression of plant. the MAPKKK of the upstream of the known MAPK of being positioned at cascade is by making the MAPKK phosphorylation and activating, and MAPKK makes the MAPK phosphorylation, cause various defensive ractions. recently, make MAPKK---the constitutive activity form mutant enzyme StMEK1 of StMEK1 in a kind of Ben Saimushi tobacco (Nicotianabenthamiana) of tobacco DDOverexpression, show that then SIPK and WIPK are activated, the sesquiterpene cyclase of tobacco plant---5-table-aristolochine synthase (TEAS) is induced (document 64). can easily be contemplated to same with tobacco plant, the PVS gene regulating of potato is also relevant with the MAPK cascade. among the following embodiment, adopt the method for the gene silencing (VIGS) of virus induction, its possibility is inquired into.In recent years, VIGS is as being subjected to people's attention (document 59) at efficient gene knockout technique aspect the analysis plant gene function.VIGS is the organism system of defense at virus originally, be with virus in the high host's gene transcription product of the dna homolog phenomenon of being decomposed by specificity.Usually, with import plant gene fragment in the virus show 80% or the mRNA of above homology be decomposed, be not only 1 gene, also effective to the gene that knocks out multigene family.This method is compared easy and rapid with preparation transformant or mutant.Wherein, as retrospective genetics functional analysis approach, accumulated a lot of achievement in research (document 67, document 70) for potato virus X (PVX) and Ben Saimushi tobacco system at present. here, knock out SIPK or WIPK by VIGS, with the instantaneous importing of above-mentioned PVS3:GUS leaf texture, study the PVS3 promoter activity by Agrobacterium with this.
Employed biologic material, reagent, experimental technique etc. are as follows among the following embodiment 9-12. do not specify, and employed identical in material etc. and the foregoing description.
1. test plant
The Ben Saimushi tobacco that use is provided by Co., Ltd. of Japan Tobacco is as test plant.The Ben Saimushi tobacco seed is seeded in the polyethylene flowerpot that Kureha soil (Wu Yu chemistry) is housed, in 25 ℃ thermostatic chamber, made its growth under the lighting condition in 24 hours.Use the 6-8 sheet leaf of sowing plant materials in the time of 30-35 days to carry out measuring via the transient expression of Agrobacterium.
2.INF1 preparation
The Infestin (INF1) that the Ben Saimushi tobacco is handled uses the fusion rotein of expressing in intestinal bacteria (coli strain pBF53), imported the FLAG-ATS carrier (FLAG-INF1) (document 62) that contains the inf1 gene in the wherein said intestinal bacteria. and being prepared as follows of fusion rotein carried out.
With intestinal bacteria in the LB liquid nutrient medium that contains 50 μ g/ml penbritins, in 37 ℃ of vibrations (140rpm) overnight incubation. the intestinal bacteria nutrient solution is joined 100 times of amounts, promptly contain in the LB liquid nutrient medium of 50ppm penbritin, cultivate in 37 ℃ of vibrations (140rpm), until OD 600=0.6. adds IPTG, making final concentration is 1mM, the expression of induced protein, again in 37 ℃ of shaking culture 3 hours (140rpm), then with medium centrifugal (5,000 * g, 10 minutes). supernatant filters with strainer, (the exclusion limit molecular weight is 3 to be transferred to dialysis tubing, 500), to dialyse 24 hours with sterile purified water at 4 ℃. the component that above operation is obtained is adjusted to protein concn 10mg/ml, make FLAG-INF1 solution. when plant was handled, use was 3 times INF1 solution with distilled water diluting.
3. be inserted with the structure of the binary vector of the PVS3 promotor that connects gus gene
MUG measures the following structure of employed expression vector. and with the PVS3 genomic clone is template, use the primer (Figure 24) of additional restricted restriction enzyme site (EcoRI or ClaI), contain following the carrying out of base sequence .PCR of inferring promoter region and PVS3 gene coding region initiation site by pcr amplification: use KOD-Plus-DNA polysaccharase (Toyobo), annealing temperature with 55 ℃, react according to appended explanation. this PCR product is digested with EcoRI and ClaI, by 1% agarose gel electrophoresis classification, extract test kit (qiagen) purification of target dna fragmentation with QIAquick Gel then, using as inserting fragment. carrier uses the pGreen 0229 that contains gus gene .2000 such as () Hellens, wherein said gus gene contains intron. similarly digests with the insertion fragment with EcoRI and ClaI, by 1% agarose gel electrophoresis classification. extract test kit purification of target dna fragmentation with QIAquick Gel, to use as carrier. carrier that will prepare as mentioned above and insertion fragment are adjusted into carrier: inserting the fragment mol ratio is 1: 3, connect with dna ligation kit ver.2 (Takara), with the plasmid DNA Transformed E .coli JM109 competent cell (Takara) that connects, be inoculated in [1% Tryptones on the LB nutrient agar then, 0.5% yeast extract powder, 1%NaCl, 50 μ g/ml kantlex, 1% agarose], 37 ℃ of following overnight incubation.The single bacterium colony of picking is on the 2ml LB liquid nutrient medium that contains kantlex solution (50 μ g/ml) [1% Tryptones, 0.5% yeast extract powder, 1%NaCl, 1% agarose], 37 ℃ of following overnight incubation. reclaim plasmid DNA. and Figure 25 has represented to insert the collection of illustrative plates of the binary vector of PVS3 promotor.
4. be used for structure at the deletion clone of Ben Saimushi tobacco leaf transient expression mensuration
GUS expression vector with preparation in above-mentioned 3. is a template, use is begun by target disappearance point, the primer (Figure 24) of additional restricted restriction enzyme site (EcoRI or ClaI), contain following the carrying out of base sequence .PCR of inferring promoter region and PVS3 gene coding region initiation site by pcr amplification: use KOD-Plus-DNA polysaccharase (Toyobo), annealing temperature with 55 ℃, to react according to appended explanation. the preparation of binary vector is carried out according to above-mentioned 3. operation, imports Agrobacterium according to 6. described methods. and the base sequence of confirming the gained deletion clone does not have mistake.
5.StMEK1 DDThe structure of expression vector
Ben Saimushi tobacco leaf MUG measures the following structure of employed expression vector.Use primer (the 5 '-TT of additional restricted restriction enzyme site (ApaI or SpeI) GGGCCCATGCGACCTCTTCAACCACC-3 ': SEQ ID NO.36,5 '-G ACTAGTACAAAAGAGTGTGGAATTAC-3 ': SEQ ID NO.37), contain the StMEK1 of non-translational region by pcr amplification 5 ' one side DDThe base sequence of (document 64).PCR reacts following carrying out: use KOD-Plus-DNA polysaccharase (Toyobo), with 55 ℃ annealing temperature, react according to appended explanation.This PCR product is digested with ApaI and SpeI, by 1% agarose gel electrophoresis classification, extract test kit (qiagen) purification of target dna fragmentation with QIAquick Gel then, using as inserting fragment. carrier uses and induces the pER8 (document 74) of genetically modified expression by beta estradiol, similarly digest with the insertion fragment with ApaI and SpeI, by 1% agarose gel electrophoresis classification. extract test kit purification of target dna fragmentation with QIAquick Gel, use as carrier. carry out according to above-mentioned 3. attended operation later.
6. transform Agrobacterium
The carrier that will import is adjusted to 10ng/ μ l with TE, is used to transform Agrobacterium.The competent cell of 80 μ l Agrobacterium GV3101 bacterial strains in dissolving on ice, is added 2 μ l carrier solns, mix, left standstill 30 minutes on ice with transfer pipet.This solution is moved in the cup, by Micro Pulser TM(BioRad) implement electroporation (V=1.44kV, T=2.5kV/ resistance, C=all out, R=R5 129), transform.Solution is transferred in the 1.5ml Eppendorf pipe, adds 1ml SOC substratum [2% Tryptones, 0.5% yeast extract powder, 0.05%NaCl, 10mM MgCl 2, 10mMMgSO 4], at room temperature left standstill 1 hour. be inoculated in LB nutrient agar [1% Tryptones, 0.5% yeast extract powder, 1%NaCl, 50 μ g/ml kantlex, 50 μ g/ml Rifampins, 1% agarose] then, cultivated two days at 28 ℃.Reclaim single bacterium colony, be used for following 7. edaphic bacillus infiltration (Agroinfiltration) test.
7. use the Ben Saimushi tobacco by edaphic bacillus soaking method transgenosis
According to the method (document 41) of people such as Thoma (2000), the following edaphic bacillus that carries out soaks into test.The Agrobacterium that importing is had a binary vector is in containing the LB liquid nutrient medium of regulation antibiotics, 28 ℃ of shaking culture 2 days.The 2ml nutrient solution is suspended in 8ml contains in the LB liquid nutrient medium of antibiotics, again 28 ℃ of shaking culture 3 hours.Use ultraviolet-visible analytical system (DU series 600, Beckman) to measure the density of Agrobacterium in the suspension, measure the absorbancy under the 600nm wavelength.With suspension at room temperature centrifugal (3,000 * g, 15 minutes), will precipitate resuspending in containing 150 μ M acetonitocilingon, 10mM MgCl 210mM MES (pH5.6) in, make OD 600=0.5.
The Agrobacterium that to possess PVS:GUSint carries out edaphic bacillus separately and soaks into when testing, with OD 600=0.5 suspension injects leaf, injects the INF1 solution of 10 μ g/ml after one day, induces PVS3 promotor (Figure 26).On the other hand, will be with the pER8 carrier to possessing XVE:StMEK1 DDOr the Agrobacterium of PVS:GUSint carries out edaphic bacillus when soaking into test, and dilution is OD respectively 600=0.005 and OD 600=0.25, induce XVE (LexA, VP16, the estrogen receptor) system that connects in the downstream of G10-90 promotor by the beta estradiol of 20 μ M, make StMEK1 DDExpress by (document 74).Use the pER8 carrier to replace XVE:StMEK1 in the check plot DD, inject the beta estradiol (Figure 26) of 20 μ M.
Suspension was left standstill 1 hour in room temperature (20 ℃), use the injection tube that does not have entry needle to be injected into the intercellular substance of Ben Saimushi tobacco leaf then.After the injection, plant materials is left standstill under the condition of illumination in 25 ℃, 24 hours, be used for following 9. MUG (4-methyl umbelliferone β-D-glucuronide) mensuration.
8. the gene silencing of virus induction in the Ben Saimushi tobacco
The base sequence of the virus that known plants infected comprises the sequence with the dna homolog of plant, then the producer silence (gene silencing of virus induction in the plant; VIGS) (document 67).Stable PVX that takes place of gene silencing and Ben Saimushi tobacco system have been adopted in the present embodiment.The cDNA fragment of the 178bp that contains the cDNA fragment that is inserted with the 230bp that is begun by the SIPK translation initiation codon among the binary vector pGR106 of PVX, begun by the WIPK translation initiation codon or make SIPK and cDNA fragment that WIPK is connected in series imports Agrobacterium with the gene silencing carrier that obtains thus.Method according to above-mentioned 7. is cultivated Agrobacterium, injects the Ben Saimushi tobacco leaf in 3 weeks of after planting growing, and grows 1 month, gets upper leaf and is used for test (Figure 27).
9.MUG measure
According to the method (document 60) of Gallagher (1992),, GUS quantitatively carries out MUG (4-methyl umbelliferone β-D-glucuronide) mensuration for being expressed.3 Ben Saimushi tobacco leaf of 1 square centimeter that injected Agrobacterium are ground at liquid nitrogen, add 200 μ l then and extract damping fluid [50mM NaHPO 4(pH7.0), 10mM beta-mercaptoethanol, 10mM EDTA, 0.1% sodium lauroyl sareosine, 0.1%Triton X-100], centrifugal (12,000rpm, 4 ℃, 5 minutes) reclaim supernatant.According to above-mentioned 13.The quantification of protein method measure the protein concn of extracting solution, 10 μ l extracting solutions are joined in 90 μ l, 37 ℃ the fluorometric assay damping fluid [extracting damping fluid, 2mMMUG], reaction solution is made 100 μ l, left standstill 1 hour at 37 ℃.Reaction solution is joined reaction terminating liquid (the 0.2M Na of 900 μ l 2CO 3) in be used for measuring.Use spectrophotofluorometer RF-5300PC (Shimadzu),, measure the emmission spectrum of 455nm with the exciting light of 365nm.Calibration curve uses 4-MU (7-hydroxy-4-methylcoumarin) to make, and measured value is scaled 4-MUnM/ minute mg albumen.In order from measured value, to remove endogenous GUS activity,, prepare to make the sample of enzyme thermally denature, obtain the poor of scaled value thus, thereby calculate GUS activity from expression vector.
10. by extracting total RNA in the Ben Saimushi tobacco leaf
By extracting total RNA in the Ben Saimushi tobacco leaf, can carry out by the following method according to the SDS/ phynol method.1g Ben Saimushi tobacco leaf limit in mortar is added the liquid nitrogen limit to grind, it is joined 5ml is housed extracted damping fluid (EB) [50mM Tris-HCl (pH7.5), 150mM sodium-chlor, 5mM EDTA, 5%SDS], 0.4ml PCI[phenol/chloroform/primary isoamyl alcohol (50: 49: 1, v/v/v), in the 50ml capacity of the 10 μ l mercaptoethanols sterilization centrifuge tube, the violent mixing 1 minute, add 4.8ml PCI, light and slow stirring.Use polytron homogenizer (HG30, Hitachi) to grind 2 minutes, centrifugal then (1,300 * g, 15 minutes).Water layer (upper strata) is moved in the new 50ml capacity sterilization centrifuge tube, add 6ml PCI, stirred 2 minutes, and then centrifugal at normal temperatures (1,300 * g, 15 minutes).In water layer (upper strata), add the 4M sodium-chlor of 1/40 amount and the ethanol of 2 times of amounts, mix ,-20 ℃ left standstill 2 hours or more than, centrifugal then (1,300 * g, 15 minutes).Add 2ml resuspending damping fluid (RB) [50mM Tris-HCl (pH 7.5), 5mMEDTA, 0.5%SDS] in the gained precipitation, light and slow vibration 15 minutes suspends.In suspension, add 0.2ml 4M sodium-chlor and 4ml ethanol,-20 ℃ left standstill 2 hours or more than, centrifugal then (1,300 * g, 15 minutes). with 1ml 70% cold washing with alcohol gained precipitation, be suspended in 1ml TE damping fluid [10mM Tris-HCl (pH7.5) then, 1mM EDTA], move in the Eppendorf pipe, add 250 μ l10M lithium chlorides, left standstill 1 hour on ice. with suspension at 4 ℃ centrifugal (22,000 * g, 15 minutes), RNA reclaims as precipitation. and this lithium precipitation operation is repeated twice, the gained precipitation is suspended in 300 μ l TE damping fluids, added 100 μ l chloroform/primary isoamyl alcohol (24: 1; V/v), after the vigorous stirring, at 4 ℃ centrifugal (22,000 * g, 15 minutes). in water layer (upper strata), add the 3M sodium acetate (pH5.2) of 1/10 amount and the ethanol of 2 times of amounts ,-20 ℃ left standstill 2 hours or more than, centrifugal then (22,000 * g, 5 minutes). with 70% cold washing with alcohol gained precipitation, air-dry 10 minutes, be suspended in 40 μ l TE damping fluids, make total RNA. with this as the RNA sample ,-80 ℃ of preservations.
11.Nortern engram analysis
, be (reference literature 68) transfer printing of mark method and be fixed on Hybond-N total RNA classification (document 37) with the formaldehyde agarose gel electrophoresis by alkali +On the nylon membrane (Amersham).
The nylon membrane that is adsorbed with RNA placed 1 hour in 42 ℃ prehybridization solution [50% methane amide, 5 * Denhardt solution (document 37), 5 * SSPE (document 37), 0.5%SDS, 100 μ g/ml thermally denature salmon sperm DNAs (Pharmacia)] or more than, add then 32The P labeled DNA probe, 42 ℃ down hybridization 16 hours or more than. this film contained among 4 * SSPE of 0.1%SDS, at room temperature washing 15 minutes (2 times), again in containing 4 * SSP E of 0.1%SDS, 60 ℃ of down washings 15 minutes, again in containing 2 * SSPE of 0.1%SDS, 60 ℃ of down washings 15 minutes (1 time). use X-ray film OMAT-AR (Kodak) and intensifying paper Lighting Plus (Dupont), under-80 ℃, carry out radioautograph.
12. the preparation of probe
Plasmid pTEAS (Facchini and Chappel with the TEAS cDNA that mixes tobacco, 1992) be template, the use primer (5 '-GTCGACGACACAGCCACGTACGAGGT-3 ': SEQID NO.38,5 '-ATCGATAGACTTTCTCCGGATGAGTG-3 ': SEQ IDNO.39), by pcr amplification TEAS cDNA fragment.React following carrying out: use 2ng to mix the plasmid of TaKaRa TaqTM (precious wine is made) and insertion sheet segment DNA,, react under 25 round-robin conditions at 94 ℃-1 minute (thermally denatures), 53 ℃-45 seconds (annealing), 72 ℃-2 minutes (DNA extension) with DNA thermal cycler (PJ 2000, Perkin Elmer Cetus).Confirm the size of the dna fragmentation of amplification by 0.8% agarose gel electrophoresis.Use QIAquick Gel to extract test kit (QIAGEN) purifying DNA fragment from gel.According to random priming (document 17), use [α- 32P] dCTP (111TBq/mmol, ICN Biochemicals) and Megaprime DNALabelling systems (Amersham) preparation 32The P labeled DNA probe.
＜embodiment 9〉clone replying by the PVS3 promoter deletion of soil Agrobacterium soaking method importing to INF1
Releaser protein I NF1 from late disease bacteria is to the effective releaser of Ben Saimushi tobacco (document 63).To contain the downstream that is connected to the PVS3 promotor in the gus gene frame of intron, form binary vector, this binary vector will be imported in the Ben Saimushi tobacco leaf by the edaphic bacillus soaking method, study INF1 inductive GUS activity (Figure 27) thus.When the binary vector pPVS3-1 of PVS3 promotor total length has almost been inserted in importing, compare with the water treatment check plot, can be observed significant GUS activity (Figure 28).In order to study the cis sequence of the PVS3 promotor of replying INF1, the preparation deletion clone makes up binary vector, research GUS activity.The result has kept the INF1 responsiveness at-1337 (pPVS3-2:SEQ ID NO.22), if but disappearance to-1287 (pPVS3-3) before, then INF1 induces remarkable reduction to GUS is active.This result shows: the 50bp (SEQ ID NO.23) relevant (Figure 29) between the cis sequence of PVS3 promotor and pPVS3-2 and the pPVS3-3.
＜embodiment 10〉StMEK1 DDTo inducing of PVS3 promotor
StMEK1 DDBe the constitutive activity mutant that the aminoacid replacement owing to MAPKK produces, import in the Ben Saimushi tobacco leaf, can induce SIPK and WIPK (document 64) by the soil Agrobacterium soaking method.In order to study the PVS3 promoter region at the acknowledgement field of INF1 processing and at StMEK1 DDAcknowledgement field whether identical, the gus gene that will contain intron is connected with the PVS3 promotor, forms binary vector, and this binary vector is imported in the Ben Saimushi tobacco by the soil Agrobacterium soaking method.Make this tobacco use the Agrobacterium coinfection that transforms through binary vector simultaneously, described binary vector has the StMEK1 that is connected to by the downstream connection of beta estradiol inductive XVE DDBehind the injection beta estradiol (B), left standstill again one day, make StMEK1 DDExpression is with research GUS activity (Figure 27).The result compares with the check plot, and (B) induced GUS activity (Figure 30) after disappearance was injected beta estradiol to-1337 (pPVS3-2:SEQ ID NO.22).And if the PVS3 promoter deletion to-1287 (pPVS3-3) before, then beta estradiol is handled and to be induced remarkable reduction to GUS is active.This result shows: 50bp between pPVS3-2 and the pPVS3-3 (SEQ ID NO.23) with reply StMEK1 DDThe cis sequence relevant, itself and cis sequence identical (Figure 29) at INF1.
＜embodiment 11〉SIPK and WIPK silence be for StMEK1 DDThe influence of inductive PVS3 promoter activity
By the soil Agrobacterium soaking method pPVS3-1 is imported and to make SIPK, WIPK separately or the Ben Saimushi tobacco of SIPK and WIPK both sides' gene silencing, carry out the active research of GUS.At this moment, the StMEK1 in XVE downstream will be connected DDBy this Ben Saimushi tobacco of soil Agrobacterium soaking method coinfection, infect and inject beta estradiol after 1 day, left standstill again one day, make StMEK1 DDExpress (Figure 31).Compare with the control plant of inoculation PVX, in the plant materials that makes SIPK, WIPK silence respectively, do not observe the active remarkable reduction of GUS (Figure 32).And in the plant materials that makes SIPK, WIPK both sides' silence, can be observed the active remarkable reduction of GUS.
＜embodiment 12〉SIPK and WIPK silence be for StMEK1 DDThe influence that inductive TEAS expresses
Control mechanism for the sesquiterpene cyclase TEAS that studies tobacco will contain the StMEK1 that is connected with 35S promoter by the soil Agrobacterium soaking method DDExpression vector import the Ben Saimushi tobacco make SIPK and WIPK silence, extract total RNA at different time.When using TEAScDNA to carry out the Nortern engram analysis as probe, make all reticent district of SIPK and WIPK, accumulating significantly of TEAS mRNA suppressed (Figure 32).This result shows: SIPK is identical for the active effect of PVS3 promotor with WIPK.
Shown in above embodiment, in order to study, the PVS3 promotor is connected to the upstream of gus gene for the important promoter region of PVS3 genetic expression, make up deletion clone, implement INF1 and handle, measure GUS activity (Figure 28).Among the disappearance pPVS3-2 (SEQ ID NO.22), visible INF1 handles and makes active remarkable increasing, but does not see active increase (Figure 28) among the disappearance pPVS3-3.Transcribing of known is because the transcription factor protein that produces because of stimulation combines derivative with cis sequence in the promoter region.Can think and exist and transcription factor bonded cis sequence between disappearance pPVS3-2 and the pPVS3-3.Also do not find known controlling element (Figure 29) in the district (SEQ ID NO.23) of this 50bp at present.
Have report to show: the MAPK of tobacco is the expression (document 73) that SIPK is controlled at the 3-hydroxy-3-methylglutaryl-coenzyme A reductase enzyme (HMGR) that the sesquiterpene phytoalexin plays a significant role in synthetic.Known MAPK level is associated in the signal transduction pathway of plant and is undertaking important controlled function, activates various defensive ractions (document 71) in its downstream.There is report to show recently: with StMEK1 DDBe connected to the downstream of 35S promoter, construction of expression vector imports the Ben Saimushi tobacco with this expression vector by the soil Agrobacterium soaking method, and then TEAS is induced (document 64) at transcriptional level.In order to study the PVS3 promotor at the acknowledgement field of INF1 processing and at StMEK1 DDAcknowledgement field whether identical, make deletion clone and StMEK1 by the soil Agrobacterium soaking method DDCoexpression in the Ben Saimushi tobacco leaf is studied the GUS activity with this.Identical with the situation of INF1.Among the disappearance pPVS3-2, visible StMEK1 DDMake active significantly increase, but do not see active significantly increase (Figure 30) among the disappearance PVS3-3.People such as Zhang (1998) report: the parasiticein that the latent ground albumen of producing with latent ground epidemic disease mould (Phytophthora cryptogea) excites element or phytophthora parasitica (P.parasitica) to produce excites plain processing tobacco culturing cell, then SIPK and WIPK be activated (document 72).Consider in conjunction with this test-results, then show: the MAPK cascade excites plain signal transduction to induce the process possibility of PVS3 relevant with the INF1 of late disease bacteria production.In order to study this possibility, the binary vector importing that will contain the PVS3 promotor by the soil Agrobacterium soaking method makes in the Ben Saimushi tobacco leaf of SIPK, WIPK or SIPK and WIPK both sides' silence, excites plain the processing with INF1, research GUS activity (Figure 32).Compare with the control plant of inoculation PVX, in the plant materials that makes SIPK or WIPK silence, only see the active reduction of GUS.And in the plant materials that makes SIPK and WIPK both sides' silence, can be observed the active remarkable reduction of GUS.These results show: endogenous sesquiterpene cyclase TEAS also may be subjected to the control of SIPK and WIPK.Therefore, make StMEK1 DDWhen gene was expressed in the Ben Saimushi tobacco that makes SIPK and WIPK silence, only in the district of SIPK and WIPK both sides' silence, accumulating of TEAS mRNA was subjected to remarkable inhibition (Figure 32).
Samuel and Ellis (2002) report: tobacco plant is placed the high-concentrated ozone environment, and then SIPK and WIPK are activated, and have induced to be accompanied by the necrocytosis (document 69) that active oxygen generates.They find: will make the transgenic plant of SIPK silence place ozone owing to RNAi (RNA interference), then the WIPK activity significantly increases, inducing cell death.In conjunction with this report, can think that SIPK and WIPK control the PVS3 expression of gene in downstream with form complimentary to one another
The present invention is not subjected to the embodiment of foregoing invention and any restriction of embodiment explanation.Only otherwise break away from the scope of claim, the various variation schemes in the scope that those skilled in the art can expect easily are also contained among the present invention.
Sequence table
<110>NAGOYA?INDUSTRIAL?SCIENCE?RESEARCH?INSTITUTE
YOSHIOKA，Hirofumi
＜120〉germ-responsive promoter
<130>P0206402
<150>JP?P2002-351701
<151>2002-12-03
<150>JP?P2003-294409
<151>2003-08-18
<160>39
<170>PatentIn?version?3.1
<210>1
<211>2648
<212>DNA
＜213〉potato
<220>
<221>misc_feature
<222>(246)..(246)
＜223〉n represents any base
<220>
<221>misc_feature
<222>(278)..(278)
＜223〉n represents any base
<400>1
ctcttctgtt?gatgtgctat?agtcttttat?atagcgctct?attcatgttg?taatttggcc 60
tctactttaa?tttttttcaa?cctaaaccaa?cgtacaataa?tgtgtaatga?tactaatttg 120
actcacataa?tagcatggtg?ctagaagagt?cacttgaaag?agtatactga?agagtattaa 180
aaatataatt?ctaaagaatt?tcgaagattc?aattataatt?gatcaagaag?gtgataagag 240
ccttcnacaa?caacgtaaag?tttgggtagc?ctctatanat?gactatgaaa?atagccaaaa 300
aaaaattcaa?attcgaattc?ttgtaatcct?tatttaggat?tattgcgacc?atcacttgtg 360
ggtgccttac?ttgactaaat?atttgattaa?acattaattt?ttggtcagtg?gatatacatg 420
ccactcaatt?ttaaataaat?tagtgatccc?ttacgatctt?aaaaaaattg?tatttttgtg 480
tgtaatgtca?actttggttc?aaatgtctaa?tataataagt?attaattcca?acagtattag 540
aattttattt?ctaagatcac?tcttacggtc?ttaccactga?aagattaaaa?ttctaaccaa 600
gaatttgaac?tttaaatagt?acttatgaat?tttacttgcc?gtttgaattt?tatgtacatg 660
cttagaataa?ttaggtcctc?atgtagtcaa?ctttaagaaa?attacaatgt?tacgttctaa 720
caagaacaaa?tttgactcta?gatttttaat?tttttttttt?taaaaaaaaa?ctaaatactc 780
atccgattca?atttgtttga?aactatgttc?caattattaa?tccgtttcaa?aaacaatgtt 840
acattcagat?atttaaaatc?aattaactta?aatttctcat?catcagtaag?aagttttaat 900
aatcacatga?aggaaagcct?gtttggagaa?agttatgcgt?aaaatattgc?atatatctct 960
tccattgaat?tagttacatc?tggatttgca?taaaatcaac?atttagtaaa?atacgatggc 1020
ttagatgatt?gaactttgaa?caggaaaaat?aagcgtgcaa?ataagccatc?aatcttgaac 1080
tttagaaata?tatatatata?attcaataag?ttactttatt?ggaatagcta?tagtgacggc 1140
ggatttagaa?ttttcattaa?agggactcta?aaaaaatata?gtgcctaaga?tttgaacttg 1200
aaactcaaga?tgccactaaa?caacctctaa?tcttacattc?agaaggttca?aaatcaatat 1260
atatagacat?aattttttaa?atttttttta?acctccctcg?actacctcta?ggtccgccct 1320
tactattccc?atccgatctc?ttgggaagcg?ggggagaaaa?ttttataata?gtgcactcat 1380
gctataatta?catactaaga?ttttatgtaa?tgctatattt?tttcaagttg?aagacggaaa 1440
caatagcatt?ggatcaagac?agacgccatt?gaaggaagaa?aaaacctaaa?aaaataaaca 1500
aaaggagaga?cactttcttg?gtcccttcga?ggccatatat?cccattaata?taaaaatata 1560
aaacaaaaaa?aaagacagac?ggtcgcccaa?ggaaagaagg?cggacgtcac?taacggctaa 1620
ccctaactac?aaataatgta?attttccaaa?aacggaacta?taaggaataa?aaaacatgaa 1680
gattattgag?tattattaat?ttttaaaaga?cagacgccac?tcgaggaaat?aaggaatcac 1740
aaggagtaaa?gaaagaaatt?aaaggcacgt?tacagtatca?tataatataa?atttaagttt 1800
ggttgcattg?aagttatata?gtttttaaaa?aaaaataaaa?ttgtccaaca?atacttgtcc 1860
aatttagaaa?atctaaaaga?taatttatta?ttttgtgttt?gttttacctc?aacatctaat 1920
acatttctca?aattattaaa?tttaatatat?tcaaaaggta?atatagtaat?attactctta 1980
ttatttattt?attgtttctt?aagatttgtg?caggtcaata?ataaataact?atcgttgaat 2040
taagggagta?ccatcaaaga?aattgattta?taacacgatg?cgggtggagg?gagctagaaa 2100
gttagtacaa?atttggttgc?actaagtact?tcatccgtct?caatttatga?gattttgttt 2160
gattcgagac?gaaatttaat?aaagatgatt?tttttaaagt?tgtaatctaa?aacaagtcat 2220
aaatatttgc?atcactataa?taatctcatt?aaatgtaaat?gaatattttt?agctaaatta 2280
ttactactcc?ctccatgtcc?atattagttg?atcatcttac?tatatattaa?ctgtccacct 2340
tactcaatta?ataaaatatt?aattaaagtt?tttctatact?agatataaaa?atgttattat 2400
tatttttgat?aaagactaga?aagagtatac?tatttgtata?tctacagtgg?gacgaccagt 2460
taagtatatt?gtagtcaaag?taaggcaacc?ggatggactg?catgcagcac?aaaggctctc 2520
accactataa?atactcaata?ttccttctct?ttcatttcca?tcaacacctt?caccaactaa 2580
caaattaaaa?gaaagaaaaa?aaaatctctc?agtttcctca?caagctaatt?agacccgttt 2640
ccgaagaa 2648
<210>2
<211>2000
<212>DNA
＜213〉potato
<400>2
tttatgtaca?tgcttagaat?aattaggtcc?tcatgtagtc?aactttaaga?aaattacaat 60
gttacgttct?aacaagaaca?aatttgactc?tagattttta?attttttttt?tttaaaaaaa 120
aactaaatac?tcatccgatt?caatttgttt?gaaactatgt?tccaattatt?aatccgtttc 180
aaaaacaatg?ttacattcag?atatttaaaa?tcaattaact?taaatttctc?atcatcagta 240
agaagtttta?ataatcacat?gaaggaaagc?ctgtttggag?aaagttatgc?gtaaaatatt 300
gcatatatct?cttccattga?attagttaca?tctggatttg?cataaaatca?acatttagta 360
aaatacgatg?gcttagatga?ttgaactttg?aacaggaaaa?ataagcgtgc?aaataagcca 420
tcaatcttga?actttagaaa?tatatatata?taattcaata?agttacttta?ttggaatagc 480
tatagtgacg?gcggatttag?aattttcatt?aaagggactc?taaaaaaata?tagtgcctaa 540
gatttgaact?tgaaactcaa?gatgccacta?aacaacctct?aatcttacat?tcagaaggtt 600
caaaatcaat?atatatagac?ataatttttt?aaattttttt?taacctccct?cgactacctc 660
taggtccgcc?cttactattc?ccatccgatc?tcttgggaag?cgggggagaa?aattttataa 720
tagtgcactc?atgctataat?tacatactaa?gattttatgt?aatgctatat?tttttcaagt 780
tgaagacgga?aacaatagca?ttggatcaag?acagacgcca?ttgaaggaag?aaaaaaccta 840
aaaaaataaa?caaaaggaga?gacactttct?tggtcccttc?gaggccatat?atcccattaa 900
tataaaaata?taaaacaaaa?aaaaagacag?acggtcgccc?aaggaaagaa?ggcggacgtc 960
actaacggct?aaccctaact?acaaataatg?taattttcca?aaaacggaac?tataaggaat 1020
aaaaaacatg?aagattattg?agtattatta?atttttaaaa?gacagacgcc?actcgaggaa 1080
ataaggaatc?acaaggagta?aagaaagaaa?ttaaaggcac?gttacagtat?catataatat 1140
aaatttaagt?ttggttgcat?tgaagttata?tagtttttaa?aaaaaaataa?aattgtccaa 1200
caatacttgt?ccaatttaga?aaatctaaaa?gataatttat?tattttgtgt?ttgttttacc 1260
tcaacatcta?atacatttct?caaattatta?aatttaatat?attcaaaagg?taatatagta 1320
atattactct?tattatttat?ttattgtttc?ttaagatttg?tgcaggtcaa?taataaataa 1380
ctatcgttga?attaagggag?taccatcaaa?gaaattgatt?tataacacga?tgcgggtgga 1440
gggagctaga?aagttagtac?aaatttggtt?gcactaagta?cttcatccgt?ctcaatttat 1500
gagattttgt?ttgattcgag?acgaaattta?ataaagatga?tttttttaaa?gttgtaatct 1560
aaaacaagtc?ataaatattt?gcatcactat?aataatctca?ttaaatgtaa?atgaatattt 1620
ttagctaaat?tattactact?ccctccatgt?ccatattagt?tgatcatctt?actatatatt 1680
aactgtccac?cttactcaat?taataaaata?ttaattaaag?tttttctata?ctagatataa 1740
aaatgttatt?attatttttg?ataaagacta?gaaagagtat?actatttgta?tatctacagt 1800
gggacgacca?gttaagtata?ttgtagtcaa?agtaaggcaa?ccggatggac?tgcatgcagc 1860
acaaaggctc?tcaccactat?aaatactcaa?tattccttct?ctttcatttc?catcaacacc 1920
ttcaccaact?aacaaattaa?aagaaagaaa?aaaaaatctc?tcagtttcct?cacaagctaa 1980
ttagacccgt?ttccgaagaa 2000
<210>3
<211>1500
<212>DNA
＜213〉potato
<400>3
aattttcatt?aaagggactc?taaaaaaata?tagtgcctaa?gatttgaact?tgaaactcaa 60
gatgccacta?aacaacctct?aatcttacat?tcagaaggtt?caaaatcaat?atatatagac 120
ataatttttt?aaattttttt?taacctccct?cgactacctc?taggtccgcc?cttactattc 180
ccatccgatc?tcttgggaag?cgggggagaa?aattttataa?tagtgcactc?atgctataat 240
tacatactaa?gattttatgt?aatgctatat?tttttcaagt?tgaagacgga?aacaatagca 300
ttggatcaag?acagacgcca?ttgaaggaag?aaaaaaccta?aaaaaataaa?caaaaggaga 360
gacactttct?tggtcccttc?gaggccatat?atcccattaa?tataaaaata?taaaacaaaa 420
aaaaagacag?acggtcgccc?aaggaaagaa?ggcggacgtc?actaacggct?aaccctaact 480
acaaataatg?taattttcca?aaaacggaac?tataaggaat?aaaaaacatg?aagattattg 540
agtattatta?atttttaaaa?gacagacgcc?actcgaggaa?ataaggaatc?acaaggagta 600
aagaaagaaa?ttaaaggcac?gttacagtat?catataatat?aaatttaagt?ttggttgcat 660
tgaagttata?tagtttttaa?aaaaaaataa?aattgtccaa?caatacttgt?ccaatttaga 720
aaatctaaaa?gataatttat?tattttgtgt?ttgttttacc?tcaacatcta?atacatttct 780
caaattatta?aatttaatat?attcaaaagg?taatatagta?atattactct?tattatttat 840
ttattgtttc?ttaagatttg?tgcaggtcaa?taataaataa?ctatcgttga?attaagggag 900
taccatcaaa?gaaattgatt?tataacacga?tgcgggtgga?gggagctaga?aagttagtac 960
aaatttggtt?gcactaagta?cttcatccgt?ctcaatttat?gagattttgt?ttgattcgag 1020
acgaaattta?ataaagatga?tttttttaaa?gttgtaatct?aaaacaagtc?ataaatattt 1080
gcatcactat?aataatctca?ttaaatgtaa?atgaatattt?ttagctaaat?tattactact 1140
ccctccatgt?ccatattagt?tgatcatctt?actatatatt?aactgtccac?cttactcaat 1200
taataaaata?ttaattaaag?tttttctata?ctagatataa?aaatgttatt?attatttttg 1260
ataaagacta?gaaagagtat?actatttgta?tatctacagt?gggacgacca?gttaagtata 1320
ttgtagtcaa?agtaaggcaa?ccggatggac?tgcatgcagc?acaaaggctc?tcaccactat 1380
aaatactcaa?tattccttct?ctttcatttc?catcaacacc?ttcaccaact?aacaaattaa 1440
aagaaagaaa?aaaaaatctc?tcagtttcct?cacaagctaa?ttagacccgt?ttccgaagaa 1500
<210>4
<211>1000
<212>DNA
＜213〉potato
<400>4
aaaacggaac?tataaggaat?aaaaaacatg?aagattattg?agtattatta?atttttaaaa 60
gacagacgcc?actcgaggaa?ataaggaatc?acaaggagta?aagaaagaaa?ttaaaggcac 120
gttacagtat?catataatat?aaatttaagt?ttggttgcat?tgaagttata?tagtttttaa 180
aaaaaaataa?aattgtccaa?caatacttgt?ccaatttaga?aaatctaaaa?gataatttat 240
tattttgtgt?ttgttttacc?tcaacatcta?atacatttct?caaattatta?aatttaatat 300
attcaaaagg?taatatagta?atattactct?tattatttat?ttattgtttc?ttaagatttg 360
tgcaggtcaa?taataaataa?ctatcgttga?attaagggag?taccatcaaa?gaaattgatt 420
tataacacga?tgcgggtgga?gggagctaga?aagttagtac?aaatttggtt?gcactaagta 480
cttcatccgt?ctcaatttat?gagattttgt?ttgattcgag?acgaaattta?ataaagatga 540
tttttttaaa?gttgtaatct?aaaacaagtc?ataaatattt?gcatcactat?aataatctca 600
ttaaatgtaa?atgaatattt?ttagctaaat?tattactact?ccctccatgt?ccatattagt 660
tgatcatctt?actatatatt?aactgtccac?cttactcaat?taataaaata?ttaattaaag 720
tttttctata?ctagatataa?aaatgttatt?attatttttg?ataaagacta?gaaagagtat 780
actatttgta?tatctacagt?gggacgacca?gttaagtata?ttgtagtcaa?agtaaggcaa 840
ccggatggac?tgcatgcagc?acaaaggctc?tcaccactat?aaatactcaa?tattccttct 900
ctttcatttc?catcaacacc?ttcaccaact?aacaaattaa?aagaaagaaa?aaaaaatctc 960
tcagtttcct?cacaagctaa?ttagacccgt?ttccgaagaa 1000
<210>5
<211>1125
<212>DNA
＜213〉potato
<400>5
atgcgacctc?ttcaaccacc?cccaccagct?gccaactcca?cctcctccgc?cgccgcatca 60
tccatgcctc?ctccctcttc?cgccggacaa?cgcagtcgtc?cccggcgtcg?tactgatttg 120
acccttcctc?ttcctcaacg?tgacgttgct?cttgctgttc?ctctccccct?tcctccaacc 180
tccgctcctt?cctcttcctc?atcctcatct?tcctccccgc?ttcctacccc?tttacatttc 240
tctgagctcg?agagggttaa?tcgcatcggt?agtggcaccg?gaggtactgt?ttacaaggtt 300
ctacatcgtc?ccactggcag?actctatgct?ttgaaagtta?tctatggtaa?ccatgaggat 360
tctgtccgtc?tccagatgtg?ccgtgagatc?gagattctcc?gagatgtaga?caaccctaac 420
gtcgttaggt?gtcacgatat?gttcgatcac?aacggcgaaa?tccaagttct?tcttgagttc 480
atggataaag?gctctctcga?agggatccat?atccctctcg?aacaacctct?ctccgatcta 540
actcgacagg?ttctctccgg?cctctactac?ctccacaggc?gtaagattgt?tcacagagat 600
atcaaacctt?ctaacctctt?aatcaactcc?aggcgtgagg?tcaagattgc?agattttggg 660
gtctccagag?ttctcgcaca?aactatggat?ccttgcaatt?cctccgtggg?taccatcgct 720
tacatgagtc?ccgagagaat?caacacagat?ctgaatcacg?gacagtacga?cggatatgct 780
ggggacatat?ggagtcttgg?ggtgagcatc?ttagagttct?acttgggaag?gttccccttc 840
tctgtgggga?gacaaggaga?ctgggccagc?cttatgtgcg?ccatttgtat?gtcgcagcct 900
cctgaggcac?cacccactgc?ttccagggag?tttagggagt?tcattgcctg?ctgtttgcag 960
agggatcctg?ctaggcggtg?gacggccgcg?cagctcttgc?gccatccctt?catcacccag 1020
aatagcccag?gcacccacac?cggtcctgct?actacctcat?tgagtaatca?ggcacatcaa 1080
ttgttacctc?cacctcctca?tttttcttct?tcttcttctt?cttga 1125
<210>6
<211>374
<212>PRT
＜213〉potato
<400>6
Met?Arg?Pro?Leu?Gln?Pro?Pro?Pro?Pro?Ala?Ala?Asn?Ser?Thr?Ser?Ser
1 5 10 15
Ala?Ala?Ala?Ser?Ser?Met?Pro?Pro?Pro?Ser?Ser?Ala?Gly?Gln?Arg?Ser
20 25 30
Arg?Pro?Arg?Arg?Arg?Thr?Asp?Leu?Thr?Leu?Pro?Leu?Pro?Gln?Arg?Asp
35 40 45
Val?Ala?Leu?Ala?Val?Pro?Leu?Pro?Leu?Pro?Pro?Thr?Ser?Ala?Pro?Ser
50 55 60
Ser?Ser?Ser?Ser?Ser?Ser?Ser?Ser?Pro?Leu?Pro?Thr?Pro?Leu?His?Phe
65 70 75 80
Ser?Glu?Leu?Glu?Arg?Val?Asn?Arg?Ile?Gly?Ser?Gly?Thr?Gly?Gly?Thr
85 90 95
Val?Tyr?Lys?Val?Leu?His?Arg?Pro?Thr?Gly?Arg?Leu?Tyr?Ala?Leu?Lys
100 105 110
Val?Ile?Tyr?Gly?Asn?His?Glu?Asp?Ser?Val?Arg?Leu?Gln?Met?Cys?Arg
115 120 125
Glu?Ile?Glu?Ile?Leu?Arg?Asp?Val?Asp?Asn?Pro?Asn?Val?Val?Arg?Cys
130 135 140
His?Asp?Met?Phe?Asp?His?Asn?Gly?Glu?Ile?Gln?Val?Leu?Leu?Glu?Phe
145 150 155 160
Met?Asp?Lys?Gly?Ser?Leu?Glu?Gly?Ile?His?Ile?Pro?Leu?Glu?Gln?Pro
165 170 175
Leu?Ser?Asp?Leu?Thr?Arg?Gln?Val?Leu?Ser?Gly?Leu?Tyr?Tyr?Leu?His
180 185 190
Arg?Arg?Lys?Ile?Val?His?Arg?Asp?Ile?Lys?Pro?Ser?Asn?Leu?Leu?Ile
195 200 205
Asn?Ser?Arg?Arg?Glu?Val?Lys?Ile?Ala?Asp?Phe?Gly?Val?Ser?Arg?Val
210 215 220
Leu?Ala?Gln?Thr?Met?Asp?Pro?Cys?Asn?Ser?Ser?Val?Gly?Thr?Ile?Ala
225 230 235 240
Tyr?Met?Ser?Pro?Glu?Arg?Ile?Asn?Thr?Asp?Leu?Asn?His?Gly?Gln?Tyr
245 250 255
Asp?Gly?Tyr?Ala?Gly?Asp?Ile?Trp?Ser?Leu?Gly?Val?Ser?Ile?Leu?Glu
260 265 270
Phe?Tyr?Leu?Gly?Arg?Phe?Pro?Phe?Ser?Val?Gly?Arg?Gln?Gly?Asp?Trp
275 280 285
Ala?Ser?Leu?Met?Cys?Ala?Ile?Cys?Met?Ser?Gln?Pro?Pro?Glu?Ala?Pro
290 295 300
Pro?Thr?Ala?Ser?Arg?Glu?Phe?Arg?Glu?Phe?Ile?Ala?Cys?Cys?Leu?Gln
305 310 315 320
Arg?Asp?Pro?Ala?Arg?Arg?Trp?Thr?Ala?Ala?Gln?Leu?Leu?Arg?His?Pro
325 330 335
Phe?Ile?Thr?Gln?Asn?Ser?Pro?Gly?Thr?His?Thr?Gly?Pro?Ala?Thr?Thr
340 345 350
Ser?Leu?Ser?Asn?Gln?Ala?His?Gln?Leu?Leu?Pro?Pro?Pro?Pro?His?Phe
355 360 365
Ser?Ser?Ser?Ser?Ser?Ser
370
<210>7
<211>1125
<212>DNA
＜213〉artificial
<220>
＜223〉Tu Bian MEK gene
<400>7
atgcgacctc?ttcaaccacc?cccaccagct?gccaactcca?cctcctccgc?cgccgcatca 60
tccatgcctc?ctccctcttc?cgccggacaa?cgcagtcgtc?cccggcgtcg?tactgatttg 120
acccttcctc?ttcctcaacg?tgacgttgct?cttgctgttc?ctctccccct?tcctccaacc 180
tccgctcctt?cctcttcctc?atcctcatct?tcctccccgc?ttcctacccc?tttacatttc 240
tctgagctcg?agagggttaa?tcgcatcggt?agtggcaccg?gaggtactgt?ttacaaggtt 300
ctacatcgtc?ccactggcag?actctatgct?ttgaaagtta?tctatggtaa?ccatgaggat 360
tctgtccgtc?tccagatgtg?ccgtgagatc?gagattctcc?gagatgtaga?caaccctaac 420
gtcgttaggt?gtcacgatat?gttcgatcac?aacggcgaaa?tccaagttct?tcttgagttc 480
atggataaag?gctctctcga?agggatccat?atccctctcg?aacaacctct?ctccgatcta 540
actcgacagg?ttctctccgg?cctctactac?ctccacaggc?gtaagattgt?tcacagagat 600
atcaaacctt?ctaacctctt?aatcaactcc?aggcgtgagg?tcaagattgc?agattttggg 660
gtctccagag?ttctcgcaca?agatatggat?ccttgcaatg?actccgtggg?taccatcgct 720
tacatgagtc?ccgagagaat?caacacagat?ctgaatcacg?gacagtacga?cggatatgct 780
ggggacatat?ggagtcttgg?ggtgagcatc?ttagagttct?acttgggaag?gttccccttc 840
tctgtgggga?gacaaggaga?ctgggccagc?cttatgtgcg?ccatttgtat?gtcgcagcct 900
cctgaggcac?cacccactgc?ttccagggag?tttagggagt?tcattgcctg?ctgtttgcag 960
agggatcctg?ctaggcggtg?gacggccgcg?cagctcttgc?gccatccctt?catcacccag 1020
aatagcccag?gcacccacac?cggtcctgct?actacctcat?tgagtaatca?ggcacatcaa 1080
ttgttacctc?cacctcctca?tttttcttct?tcttcttctt?cttga 1125
<210>8
<211>374
<212>PRT
＜213〉artificial
<220>
＜223〉Tu Bian MEK
<400>8
Met?Arg?Pro?Leu?Gln?Pro?Pro?Pro?Pro?Ala?Ala?Asn?Ser?Thr?Ser?Ser
1 5 10 15
Ala?Ala?Ala?Ser?Ser?Met?Pro?Pro?Pro?Ser?Ser?Ala?Gly?Gln?Arg?Ser
20 25 30
Arg?Pro?Arg?Arg?Arg?Thr?Asp?Leu?Thr?Leu?Pro?Leu?Pro?Gln?Arg?Asp
35 40 45
Val?Ala?Leu?Ala?Val?Pro?Leu?Pro?Leu?Pro?Pro?Thr?Ser?Ala?Pro?Ser
50 55 60
Ser?Ser?Ser?Ser?Ser?Ser?Ser?Ser?Pro?Leu?Pro?Thr?Pro?Leu?His?Phe
65 70 75 80
Ser?Glu?Leu?Glu?Arg?Val?Asn?Arg?Ile?Gly?Ser?Gly?Thr?Gly?Gly?Thr
85 90 95
Val?Tyr?Lys?Val?Leu?His?Arg?Pro?Thr?Gly?Arg?Leu?Tyr?Ala?Leu?Lys
100 105 110
Val?Ile?Tyr?Gly?Asn?His?Glu?Asp?Ser?Val?Arg?Leu?Gln?Met?Cys?Arg
115 120 125
Glu?Ile?Glu?Ile?Leu?Arg?Asp?Val?Asp?Asn?Pro?Asn?Val?Val?Arg?Cys
130 135 140
His?Asp?Met?Phe?Asp?His?Asn?Gly?Glu?Ile?Gln?Val?Leu?Leu?Glu?Phe
145 150 155 160
Met?Asp?Lys?Gly?Ser?Leu?Glu?Gly?Ile?His?Ile?Pro?Leu?Glu?Gln?Pro
165 170 175
Leu?Ser?Asp?Leu?Thr?Arg?Gln?Val?Leu?Ser?Gly?Leu?Tyr?Tyr?Leu?His
180 185 190
Arg?Arg?Lys?Ile?Val?His?Arg?Asp?Ile?Lys?Pro?Ser?Asn?Leu?Leu?Ile
195 200 205
Asn?Ser?Arg?Arg?Glu?Val?Lys?Ile?Ala?Asp?Phe?Gly?Val?Ser?Arg?Val
210 215 220
Leu?Ala?Gln?Asp?Met?Asp?Pro?Cys?Asn?Asp?Ser?Val?Gly?Thr?Ile?Ala
225 230 235 240
Tyr?Met?Ser?Pro?Glu?Arg?Ile?Asn?Thr?Asp?Leu?Asn?His?Gly?Gln?Tyr
245 250 255
Asp?Gly?Tyr?Ala?Gly?Asp?Ile?Trp?Ser?Leu?Gly?Val?Ser?Ile?Leu?Glu
260 265 270
Phe?Tyr?Leu?Gly?Arg?Phe?Pro?Phe?Ser?Val?Gly?Arg?Gln?Gly?Asp?Trp
275 280 285
Ala?Ser?Leu?Met?Cys?Ala?Ile?Cys?Met?Ser?Gln?Pro?Pro?Glu?Ala?Pro
290 295 300
Pro?Thr?Ala?Ser?Arg?Glu?Phe?Arg?Glu?Phe?Ile?Ala?Cys?Cys?Leu?Gln
305 310 315 320
Arg?Asp?Pro?Ala?Arg?Arg?Trp?Thr?Ala?Ala?Gln?Leu?Leu?Arg?His?Pro
325 330 335
Phe?Ile?Thr?Gln?Asn?Ser?Pro?Gly?Thr?His?Thr?Gly?Pro?Ala?Thr?Thr
340 345 350
Ser?Leu?Ser?Asn?Gln?Ala?His?Gln?Leu?Leu?Pro?Pro?Pro?Pro?His?Phe
355 360 365
Ser?Ser?Ser?Ser?Ser?Ser
370
<210>9
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>9
aggagattgtt?cgccccata 20
<210>10
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>10
tctccatgag?tccttacatg 20
<210>11
<211>22
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>11
catcgattgt?tttgtacatc?tg 22
<210>12
<211>26
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>12
aataatgata?caaaaaaaaa?ttaagg 26
<210>13
<211>22
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>13
tatcaattca?ccaaggaaca?ct 22
<210>14
<211>27
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>14
gaagtaatta?aatttaaata?ttatcaa 27
<210>15
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>15
ttgtctgctg?ctgcttgtgg 20
<210>16
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>16
tctccatgag?tccttacatg 20
<210>17
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>17
aggacattgt?tcgacctgtt 20
<210>18
<211>20
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>18
tctccatgag?tccttacatg 20
<210>19
<211>24
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>19
catcccttaa?aattataagt?attc 24
<210>20
<211>25
<212>DNA
＜213〉artificial
<220>
＜223〉be used for the primer of RT-PCR
<400>20
aataatgata?caaaataaat?taagg 25
<210>21
<211>2231
<212>DNA
＜213〉potato
<400>21
atggccctag?ctatcccctt?taacaatgaa?gaggagattg?ttcgccctgt?tgccaatttc 60
tctccaagtc?tttggggtga?tcgtttccat?tcattctctc?tcgacaatca?ggtaattact 120
taattaatta?ctaattaaat?ccttctctat?cgcttatatt?tggttaatta?ctactaatcc 180
caatcatgaa?cattttacag?gttgctgaaa?agtatgctca?agagattgaa?actttgaagg 240
aacaaacaag?gagtttgttg?tctgctgctg?cttgtggaat?aacattggct?gagaaattga 300
atctgataga?cattgttgag?cgccttggct?tagcttatca?ttttgagaaa?caaatagatg 360
atatgttgga?tcaaatttac?aaagcagatc?ccaactttga?cgctcatgat?ttaaacactt 420
tatcccttca?atttcgaata?ttaagacaac?atggttacaa?tatctcccaa?agtaggtcca 480
tcatttaaaa?caattcacca?aaataatacg?tttttttctg?catgaaaact?aattatcttt 540
tgcttttatt?cgatcatgat?ccagaatttt?tcagcagatt?ccaagatgcg?aatggcaagt 600
tcaaggaatg?tcttagcaac?gacatcaggg?gtctattgaa?cttatacgaa?gcttcacatg 660
taaggactca?tggagaagat?attttagaag?aggcacttgt?tttctccact?gctcatcttg 720
agtctgcagc?tccacatttg?gagtcacctc?tgagtaagca?agtgactcat?gcccttgagc 780
agtctctcca?taagagcatt?ccaagagtcg?agacgcgcta?cttcatctcc?atctacgaag 840
aggaggaatt?taagaatgat?gtgttgcttc?gatttgccaa?attggattac?aacttactcc 900
agatgttgca?caaacacgaa?cttagtgaag?tatcaaggta?tacagatgtg?ttaagttgaa 960
ttaaaaatac?tagtataaat?tatttgttga?tagtaatttc?taagattggt?acttattttg?1020
taggtggtgg?aaagatttgg?attttgtgac?aacgcttcca?tatgctaggg?atagagcagt?1080
ggaatgttac?ttttggacga?tgggagtgta?tgctgaacct?caatactctc?aggctcgtgt?1140
catccttgca?aagactatag?caatgatttc?gatagtagat?gacacattcg?atgcttatgg?1200
aatagtaaaa?gaacttgagg?tctacaccga?tgccatacaa?aggtatggac?ttgcctctcc 1260
aacagttcat?ggatttatta?gacgggaaac?ttactaaatc?tctttctgtt?ttattaggtg 1320
ggatattagt?caaattgatc?gactcccaga?atacatgaaa?gttagtttta?aggctctttt 1380
ggatctctat?gaagattatg?aaaaggagtt?gtcaaaggat?ggcagatccg?atgttgtcca 1440
ctacgcaaaa?gaaagagtag?gactcactga?tttctattta?aaaacacttg?tatttacctt 1500
atactatttc?tttattatac?aattagatct?gttatgggag?tattgatggt?tgaatgtctt 1560
gtggtttctg?ttaaacagat?gaaggagatt?gtgagaaact?attttgtaga?agcaaagtgg 1620
ttcattgagg?gatatatgcc?gcctgtttct?gagtatctta?gcaatgcatt?agctaccagc 1680
acatattact?tgctaactac?aacatcctat?ttgggagtga?agtcagcaac?aaaggaagat 1740
tttgaatggt?tggctacgaa?ccctaaaatt?cttgaagcca?atgtgacatt?atgccgagtt 1800
gttgatgaca?tagcaacgta?tgaggtaatt?agcatcgcat?tacactacat?aaatcatctt 1860
ataatttaga?gttacagtaa?tttaatacaa?attgatttca?catacttata?aatgaattat 1920
aattgccatt?ccaggttgag?aagggtaggg?gccaaatcgc?aacaggaatt?gagtgttata 1980
tgagggatta?tgacgtatca?acagaagtag?caatggaaaa?attccaagag?atggctgaga 2040
tagcatggaa?ggatgtaaat?gaaggaattc?ttcgaccaac?acctgtctct?acagaaattc 2100
ttactcgcat?tctcaatctt?gctcgtatta?tagatgtcac?ttacaagcac?aatcaagatg 2160
gatacactca?tcccgaaaaa?gttctaaaac?ctcacatcat?tgctttactg?gtggactcca 2220
ttgagatcta?a 2231
<210>22
<211>1337
<212>DNA
＜213〉potato
<400>22
gtccgccctt?actattccca?tccgatctct?tgggaagcgg?gggagaaaat?tttataatag 60
tgcactcatg?ctataattac?atactaagat?tttatgtaat?gctatatttt?ttcaagttga 120
agacggaaac?aatagcattg?gatcaagaca?gacgccattg?aaggaagaaa?aaacctaaaa 180
aaataaacaa?aaggagagac?actttcttgg?tcccttcgag?gccatatatc?ccattaatat 240
aaaaatataa?aacaaaaaaa?aagacagacg?gtcgcccaag?gaaagaaggc?ggacgtcact 300
aacggctaac?cctaactaca?aataatgtaa?ttttccaaaa?acggaactat?aaggaataaa 360
aaacatgaag?attattgagt?attattaatt?tttaaaagac?agacgccact?cgaggaaata 420
aggaatcaca?aggagtaaag?aaagaaatta?aaggcacgtt?acagtatcat?ataatataaa 480
tttaagtttg?gttgcattga?agttatatag?tttttaaaaa?aaaataaaat?tgtccaacaa 540
tacttgtcca?atttagaaaa?tctaaaagat?aatttattat?tttgtgtttg?ttttacctca 600
acatctaata?catttctcaa?attattaaat?ttaatatatt?caaaaggtaa?tatagtaata 660
ttactcttat?tatttattta?ttgtttctta?agatttgtgc?aggtcaataa?taaataacta 720
tcgttgaatt?aagggagtac?catcaaagaa?attgatttat?aacacgatgc?gggtggaggg 780
agctagaaag?ttagtacaaa?tttggttgca?ctaagtactt?catccgtctc?aatttatgag 840
attttgtttg?attcgagacg?aaatttaata?aagatgattt?ttttaaagtt?gtaatctaaa 900
acaagtcata?aatatttgca?tcactataat?aatctcatta?aatgtaaatg?aatattttta 960
gctaaattat?tactactccc?tccatgtcca?tattagttga?tcatcttact?atatattaac 1020
tgtccacctt?actcaattaa?taaaatatta?attaaagttt?ttctatacta?gatataaaaa 1080
tgttattatt?atttttgata?aagactagaa?agagtatact?atttgtatat?ctacagtggg 1140
acgaccagtt?aagtatattg?tagtcaaagt?aaggcaaccg?gatggactgc?atgcagcaca 1200
aaggctctca?ccactataaa?tactcaatat?tccttctctt?tcatttccat?caacaccttc 1260
accaactaac?aaattaaaag?aaagaaaaaa?aaatctctca?gtttcctcac?aagctaatta 1320
gacccgtttc?cgaagaa 1337
<210>23
<211>50
<212>DNA
＜213〉potato
<400>23
gtccgccctt?actattccca?tccgatctct?tgggaagcgg?gggagaaaat 50
<210>24
<211>1287
<212>DNA
＜213〉potato
<400>24
tttataatag?tgcactcatg?ctataattac?atactaagat?tttatgtaat?gctatatttt 60
ttcaagttga?agacggaaac?aatagcattg?gatcaagaca?gacgccattg?aaggaagaaa 120
aaacctaaaa?aaataaacaa?aaggagagac?actttcttgg?tcccttcgag?gccatatatc 180
ccattaatat?aaaaatataa?aacaaaaaaa?aagacagacg?gtcgcccaag?gaaagaaggc 240
ggacgtcact?aacggctaac?cctaactaca?aataatgtaa?ttttccaaaa?acggaactat 300
aaggaataaa?aaacatgaag?attattgagt?attattaatt?tttaaaagac?agacgccact 360
cgaggaaata?aggaatcaca?aggagtaaag?aaagaaatta?aaggcacgtt?acagtatcat 420
ataatataaa?tttaagtttg?gttgcattga?agttatatag?tttttaaaaa?aaaataaaat 480
tgtccaacaa?tacttgtcca?atttagaaaa?tctaaaagat?aatttattat?tttgtgtttg 540
ttttacctca?acatctaata?catttctcaa?attattaaat?ttaatatatt?caaaaggtaa 600
tatagtaata?ttactcttat?tatttattta?ttgtttctta?agatttgtgc?aggtcaataa 660
taaataacta?tcgttgaatt?aagggagtac?catcaaagaa?attgatttat?aacacgatgc 720
gggtggaggg?agctagaaag?ttagtacaaa?tttggttgca?ctaagtactt?catccgtctc 780
aatttatgag?attttgtttg?attcgagacg?aaatttaata?aagatgattt?ttttaaagtt 840
gtaatctaaa?acaagtcata?aatatttgca?tcactataat?aatctcatta?aatgtaaatg 900
aatattttta?gctaaattat?tactactccc?tccatgtcca?tattagttga?tcatcttact 960
atatattaac?tgtccacctt?actcaattaa?taaaatatta?attaaagttt?ttctatacta 1020
gatataaaaa?tgttattatt?atttttgata?aagactagaa?agagtatact?atttgtatat 1080
ctacagtggg?acgaccagtt?aagtatattg?tagtcaaagt?aaggcaaccg?gatggactgc 1140
atgcagcaca?aaggctctca?ccactataaa?tactcaatat?tccttctctt?tcatttccat 1200
caacaccttc?accaactaac?aaattaaaag?aaagaaaaaa?aaatctctca?gtttcctcac 1260
aagctaatta?gacccgtttc?cgaagaa 1287
<210>25
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>25
cggaattctt?gtaatcctta?tttaggatta 30
<210>26
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>26
cggaattcgt?ccgcccttac?tattcccatc 30
<210>27
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>27
cggaattctt?tataatagtg?cactcatgct 30
<210>28
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>28
cggaattcgc?tatatttttt?caagttgaag 30
<210>29
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>29
cggaattcga?cgccattgaa?ggaagaaaaa 30
<210>30
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>30
cggaattcac?tttcttggtc?ccttcgaggc 30
<210>31
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>31
cggaattcaa?caaaaaaaaa?gacagacggt 30
<210>32
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>32
cggaattcgt?tatatagttt?ttaaaaaaaa 30
<210>33
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>33
cggaattcga?tttataacac?gatgcgggtg 30
<210>34
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>34
cggaattctt?actatatatt?aactgtccac 30
<210>35
<211>30
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>35
ccatcgattc?ctcttcattg?ttaaagggga 30
<210>36
<211>28
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>36
ttgggcccat?gcgacctctt?caaccacc 28
<210>37
<211>27
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>37
gactagtaca?aaagagtgtg?gaattac 27
<210>38
<211>26
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>38
gtcgacgaca?cagccacgta?cgaggt 26
<210>39
<211>26
<212>DNA
＜213〉artificial
<220>
＜223〉PCR primer
<400>39
atcgatagac?tttctccgga?tgagtg 26

Claims (17)

1. the germ-responsive promoter of forming by the DNA of following (a),
(a): the DNA that base sequence shown in the SEQ ID NO.1 is formed.
2. the germ-responsive promoter of forming by the DNA in following (A),
(A): the DNA that base sequence shown in the SEQ ID NO.2 is formed.
3. the germ-responsive promoter of forming by the DNA in following (i),
(i): the DNA that base sequence shown in the SEQ ID NO.22 is formed.
4. as each described germ-responsive promoter among the claim 1-3, it is characterized in that: this promotor has specificity to reply to pathogenic bacterial infection.
5. the DNA that forms of base sequence shown in the SEQ ID NO.23.
6. carrier, this carrier comprises the germ-responsive promoter of claim 3.
7. carrier, this carrier comprises the DNA of claim 5.
8. DNA construct, this DNA construct comprise among the claim 1-4 each promotor; Link to each other with this promotor and be subjected to its control, at plant interior expression and activate the gene that the defence of this plant is replied.
9. DNA construct, this DNA construct comprises the DNA of claim 5; DNA with this DNA synergy formation germ-responsive promoter; Link to each other with constructed germ-responsive promoter and be subjected to its control, at plant interior expression and activate the gene that the defence of this plant is replied.
10. the DNA construct of claim 8, wherein said gene has the function that its expression product activates the information transduction pathway that the defence of controlling plant replys.
11. the DNA construct of claim 8, wherein said gene has the function that its expression product activates SIPK or WIPK.
12. the DNA construct of claim 8, wherein said gene is the gene of code set moulding activity form MEK.
13. through the plant transformed tissue, this obtains through the DNA construct conversion host plant cell of conversion plant tissue with claim 8.
14. claim 13 through the plant transformed tissue, wherein above-mentioned host plant is a plant of Solanaceae.
15. claim 13 through transforming plant tissue, wherein above-mentioned host plant is the plant that potato belongs to.
16. the preparation method of transgenic plant comprises the step that transforms host plant with the DNA construct of claim 8.
17. give the method for host plant pathogenic bacteria resistance, comprise the step that transforms host plant with the DNA construct of claim 8.
CNB2003801092960A 2002-12-03 2003-12-01 Germ-responsive promoter Expired - Fee Related CN100422325C (en)

Applications Claiming Priority (3)

Application Number Priority Date Filing Date Title
JP351701/2002 2002-12-03
JP2002351701 2002-12-03
JP294409/2003 2003-08-18

Publications (2)

Publication Number Publication Date
CN1745171A CN1745171A (en) 2006-03-08
CN100422325C true CN100422325C (en) 2008-10-01

Family

ID=36139990

Family Applications (1)

Application Number Title Priority Date Filing Date
CNB2003801092960A Expired - Fee Related CN100422325C (en) 2002-12-03 2003-12-01 Germ-responsive promoter

Country Status (1)

Country Link
CN (1) CN100422325C (en)

Families Citing this family (4)

* Cited by examiner, † Cited by third party
Publication number Priority date Publication date Assignee Title
CN105861509B (en) * 2016-06-21 2019-04-19 南京农业大学 A kind of artificial synthesized promoter PMP3 of phytophthora inductivity and its recombinant expression carrier and application
CN105861508B (en) * 2016-06-21 2019-04-19 南京农业大学 A kind of artificial synthesized promoter PMP2 of phytophthora inductivity and its recombinant expression carrier and application
CN106119246B (en) * 2016-06-21 2019-04-19 南京农业大学 A kind of artificial synthesized promoter PMP1 of phytophthora inductivity and its recombinant expression carrier and application
CN114395582A (en) * 2022-02-09 2022-04-26 中国农业科学院烟草研究所(中国烟草总公司青州烟草研究所) Tobacco transient expression method and detection method thereof

Non-Patent Citations (3)

* Cited by examiner, † Cited by third party
Title
Expression of 35S::Pto globally activates defense-relatedgenes in tomato plants. Xiao F. et al.Plant Physiol,Vol.126 No.4. 2001 *
Local and syntemic induction of two defense-relatedsubtilisin-like protease promoters in transgenic Arabidopsisplants. Jorda L. et al.Plant Physiol,Vol.124 No.3. 2000 *
Roles of plastid w-3 fatty acid desaturases in defenseresponse of higher plants. Nishiuchi T. et al.J.Plant Res.,Vol.111 No.1104. 1998 *

Also Published As

Publication number Publication date
CN1745171A (en) 2006-03-08

Similar Documents

Publication Publication Date Title
Chan et al. Transgenic tomato plants expressing an Arabidopsis thionin (Thi2. 1) driven by fruit-inactive promoter battle against phytopathogenic attack
Rowland et al. Functional analysis of Avr9/Cf-9 rapidly elicited genes identifies a protein kinase, ACIK1, that is essential for full Cf-9–dependent disease resistance in tomato
US5689056A (en) HMG2 promoter expression system
Shi et al. GhWRKY39, a member of the WRKY transcription factor family in cotton, has a positive role in disease resistance and salt stress tolerance
Song et al. Overexpression of the stress-induced OsWRKY08 improves osmotic stress tolerance in Arabidopsis
US8133988B2 (en) Tissue specific promoters
Jiao et al. Overexpression of a stress-responsive U-box protein gene VaPUB affects the accumulation of resistance related proteins in Vitis vinifera ‘Thompson Seedless’
Wang et al. Phytosulfokine is involved in positive regulation of Lotus japonicus nodulation
CN109136260A (en) The application of WRKY20 protein and its encoding gene in regulation stress resistance of plant
Lee et al. Root-specific expression of defensin in transgenic tobacco results in enhanced resistance against Phytophthora parasitica var. nicotianae
CN105861517A (en) Panax notoginseng antimicrobial peptide gene PnSN1 and application thereof
Zhang et al. Isolation and characterization of a Fusarium oxysporum-resistant gene LrGLP1 from Lilium regale Wilson
AU758559B2 (en) Stress tolerant plants
Jung Enhanced resistance to bacterial pathogen in transgenic tomato plants expressing cathelicidin antimicrobial peptide
Hiroyuki et al. Regulation of expression of rice thaumatin-like protein: inducibility by elicitor requires promoter W-box elements
CN100422325C (en) Germ-responsive promoter
US20130305411A1 (en) Method for conferring disease resistance to plant
Woo et al. Altered susceptibility to infection by Sinorhizobium meliloti and Nectria haematococca in alfalfa roots with altered cell cycle
Ko et al. Heterologous expression of the Brassica rapa transcription factor BrWRKY7 enhances resistance against bacterial soft rot caused by Pectobacterium carotovorum in Arabidopsis
EP1574571B1 (en) Germ-responsive promoter
Hong et al. Distinct roles of the pepper pathogen-induced membrane protein gene CaPIMP1 in bacterial disease resistance and oomycete disease susceptibility
CN111269302B (en) MaARF1 transcription factor interacting with promoter of key enzyme gene in synthesis pathway of banana salicylic acid and application thereof
WO2000078944A1 (en) Methods to design and identify new plant resistance genes
CN117904143B (en) Upland cotton GhDIR gene, coded protein and expression vector and application thereof
Subramanian Hairy root composite plant systems in root-microbe interaction research

Legal Events

Date Code Title Description
C06 Publication
PB01 Publication
C10 Entry into substantive examination
SE01 Entry into force of request for substantive examination
C14 Grant of patent or utility model
GR01 Patent grant
C17 Cessation of patent right
CF01 Termination of patent right due to non-payment of annual fee

Granted publication date: 20081001

Termination date: 20131201