CN100412193C - Anti human CD19 mouse immune globulin variable zone gene and uses - Google Patents

Abstract

The present invention provides an anti-human CD19 mouse immunoglobulin variable region gene which has nucleotide sequences of SEQ ID No. 1 and SEQ ID No. 2 and amino acid sequences of SEQ ID No. 3 and SEQ ID No. 4. The single antigen of the present invention has good characteristics of B lymphocyte tumour cell membrane CD19 antigen identification and no identification of other tissues and cell components. The experiment in vitro indicates that the antibody has good selective lethal effect on acute B cellular leukemia cells, so the antibody has potential application prospects on treating B lymphocytic malignant tumor comprising leukemia and lymphoma. The present invention can be applied to preparation of medicines for treating B lymphocytic malignant tumor.

Description

Anti human CD 19 mouse immune globulin variable zone gene and purposes

Technical field

The invention belongs to biotechnology, relate generally to rat immune globulin heavy chain and chain variable region gene, relate in particular to anti human CD 19 mouse immune globulin variable zone gene, and the purposes in preparation bone-marrow-derived lymphocyte malignant tumour target therapeutic agent.

Background technology

Hematological system tumor such as leukemia, lymphoma are the chronic diseases of serious harm human health, chemotherapy (chemotherapy) remains the main method of current treatment blood system malignant tumour, but conventional chemotherapy is relatively poor to the selectivity between tumour cell and the normal cell, thereby toxic side effect is bigger, and the chemotherapy of non-repeatedly radical-ability dosage, induce the resistance of tumour cell again easily, finally, many patients accuse treatment and fail because of drug-resistant tumor recurrence or high-dose chemotherapy cause serious toxic side effect such as severe infections, hemorrhage, important organ nonfunction etc.

Compare with chemotherapy, the monoclonal antibody targeted therapy has good selectivity and specificity, they only kill and wound the cell of expressing target molecule, and do not damage hemocyte composition and the histoorgan cell that no target molecule is expressed, thereby can improve the specificity of targeted therapy greatly, reduce the whole body toxic side effect of medicine.Effectively targeted therapy depends on good guide's molecule, series specific surfaces differentiation antigen monoclonal antibody is as guide's molecule, medicine or toxin are taken on the tumor cell membrane or in the cell specifically, or do in order to reach the purpose of killing the leukemia cell, to have the advantage that can not be substituted by complete antibody activating complement (CDC) or by antibody-mediated cell toxicant (ADCC).At present, the monoclonal antibody of most of high-affinities belongs to mouse source property, carry out clinical targeted therapy with mouse source property monoclonal antibody and serious serum sickness can take place or eliminate the problems such as antitumor action of medicine, limited their effective application clinically because of producing the anti-rat immune globulin of people (Ig) antibody (HAMA).In order to reuse mouse source property monoclonal antibody treatment blood system malignant tumour clinically in a large number, just must reduce the immunogenicity of mouse source property monoclonal antibody to greatest extent to human body.Know that now the immunogenicity of antibody mainly is positioned at antibody constant region (Fc) section, discern antigenic part (variable region of antibody) then antigenicity a little less than.The Fc section of removing mouse Ig by appropriate means keeps variable region Fv section, can reduce the immunogenicity of mouse monoclonal antibody greatly and keeps it and discern antigenic specificity.People mouse mosaic type mouse-anti human B lymphocyte surface antigen CD20 monoclonal antibody is typical case's representative of this technology, its method of production is to adopt the purebred small white mouse of the immune Balb/C of human B lymphocyte, develops anti-humen CD 20 monoclonal antibody hybridoma cell strain by mouse-murine hybridoma technology then.By amplification to courier's ribonucleotide (mRNA) of this hybridoma cell strain coding anti-humen CD 20 immune globulin variable region peptide chain, clone and order-checking, and will encode this antibody variable gene and human normal immunoglobulin constant region gene carry out recombinant expressed, (variable region is a mouse source property to make mosaic type people mouse CD20 antibody, constant region is humanized's a genetic engineering antibody), make this antibody keep the antigenic characteristic of identification CD20, thereby discern people B specifically is that lymphocyte comprises these antigenic all lymphoma cells of expression, leukemia cell and normal cell, and eliminated human body is produced immunoreactive shortcoming, thereby play effective therapeutic action by mouse source property constant region.The clinical application of this antibody has made B clone tumor treatment enter a brand-new era.Though this antibody can be used for the treatment of B cell malignant lymphoma, but most of acute B progenitor cell leukemia (B precursor leukemia, BPL) cell is not but expressed this antigen and is not had therapeutic action, CD19 expresses on the tumor cell membrane at the B more than 99% because of it, thereby is the target spot of a better targeted therapy B cell tumour.The key that a mouse source property monoclonal antibody can be used in the clinical disease human body repeatedly is the humanization genetic modification of mouse endogenous antibody, and the key of humanization gene antibody development is the sequence of this mouse endogenous antibody variable region gene, because the key of antibody targeting effect is the variable region of this antibody, and the coding variable region gene sequence is each monoclonal antibody of decision key of targeting separately.

Summary of the invention

An object of the present invention is to provide anti human CD 19 mouse immune sphaeroprotein (ZCH-4-2E8 monoclonal antibody) heavy chain and chain variable region gene, have the nucleotide sequence of SEQ ID NO 1 and SEQ ID NO 2, and the aminoacid sequence of SEQ IDNO 3 and SEQ ID NO 4.

Another object of the present invention provides anti human CD 19 mouse immune sphaeroprotein (ZCH-4-2E8 monoclonal antibody) heavy chain and the application of chain variable region gene in preparation treatment bone-marrow-derived lymphocyte malignant tumor medicine.B cellularity malignant tumour mainly comprises leukemia, lymphoma.

Adopting the primary condition of certain specific neoplastic hematologic disorder of monoclonal antibody targeted therapy is that antibody must be able to be discerned certain blood tumor cell membrane antigen.The ZCH-4-2E8 monoclonal antibody has good identification bone-marrow-derived lymphocyte tumor cell membrane CD19 antigen and the characteristic of its hetero-organization of nonrecognition, cellular constituent, experiment in vitro shows, the 2E8 immunotoxin has good selective killing effect to 2E8 male acute B cellularity leukemia cell, and to the no effect of the cell of 2E8 feminine gender, therefore, this antibody has potential treatment B cellularity malignant tumour and comprises leukemia, lymphadenomatous application prospect.

Anti human CD 19 mouse immune sphaeroprotein provided by the invention (ZCH-4-2E8 monoclonal antibody) heavy chain and chain variable region gene, be as immunogen with children's's undifferentiated type acute lymphoblastic leukemia, the purebred small white mouse of sensitization Balb/C, the monoclonal antibody of the mouse-anti human B lymphocyte membrane antigen of succeeding in developing by mouse-murine hybridoma monoclonal antibody technology [international differentiation bunch (CD) called after CD19], this antibody have carried out comprehensive evaluation and have obtained differentiation bunch (CD) name in the 6th world human leukocyte differentiation antigen cooperative groups meeting (HLDA6).Because same CD number monoclonal antibody, its rat immune globulin subclass, different with response spectrum and some biological characteristics of cell, certain antibody has its singularity, as the 2E8 antibody immunoglobulin M κ light chain (IgM κ subclass) of being born in the year of mouse, and only another CD19 clone (HIB19a) of the domestic Inst. of Hematology, Chinese Academy of Medical Sciences of China belongs to the IgG1 subclass.Because IgM type antibody has the effect of stronger activating complement, thus aspect target killing tumor cell more apparent its validity, the diagnosis and the despot that are used for the B cell malignancies for the 2E8 monoclonal antibody provide molecular basis to treatment.

Because mouse-anti people CD19 antibody ZCH-4-2E8 and non-natural exist, carry out immune sensitized animal but need painstakingly use specific antigen, a series of loaded down with trivial details and the complicated technology process develops by cytogamy, screening, evaluation etc. then, the present invention has finished the clone of this anti human CD 19 antibody (ZCH-4-2E8) heavy chain and chain variable region gene, order-checking and the external target killing acute B of complete 2E8 antibody mediated immunity toxin Lymphocytic leukemia Nalm-6 cell.The humanized genetic engineering antibody of developing based on this gene order may have important application to clinical bone-marrow-derived lymphocyte leukemia and other bone-marrow-derived lymphocyte malignant tumour targeted therapy.

Description of drawings

Fig. 1. the screening of highly purified 2E8 monoclonal cell strain: top row left, center, right figure is respectively and establishes a strategy, negative control, 2E8 antibody positive; Person (6) is respectively the 2E8 subclone of different positive degree to indicate the red arrow, and wherein subclone 67B11 is best clone.

Fig. 2 .VH _2E8Pcr amplification electrophorogram, wherein M: nucleic acid mark DL2000,1. template is 2E8cDNA, 2. template is NS-1 cDNA; The result shows, adopts and amplifies the VH2E8 band with a pair of primer (No. 29 and No. 34) in 2E8 cell cDNA template, and do not amplify band in NS-1 cell cDNA template, illustrates that this band is peculiar by the 2E8 hybridoma.

Fig. 3 .VL _2E8Pcr amplification electrophorogram, wherein M: nucleic acid mark DL2000,1. template is 2E8 cDNA, and 2. template is NS-1 cDNA, and primer is No. 37 and No. 44; 3. template is 2E8 cDNA, and 4. template is NS-1cDNA, and primer is No. 37 and No. 42.Adopt primer in 2E8 cell cDNA template, to amplify the VL2E8 band No. 37 and No. 44, and in NS-1 cell cDNA template, do not amplify band, illustrate that this band is that 2E8 hybridoma institute is peculiar; Adopt another to primer (No. 37 and No. 42) though in 2E8 cell cDNA template, also amplify band, but in NS-1 cell cDNA template, also amplify the segment of identical size, explanation is not that 2E8 cell institute is peculiar by this band that primer amplification is come out, but the gene segment of nonsecreting type κ light chain in the coding NS-1 cell.

Fig. 4. restriction enzyme digestion and electrophoresis figure.M: nucleic acid mark DL2000,1～4: recombinant plasmid (VH _2E8) the DNA enzyme cuts product, 5～8: recombinant plasmid (VL _2E8) the DNA enzyme cuts product.The gene segment size that is cut out is identical with goal gene, illustrates that VH2E8 and VL2E8 are successfully cloned as in the carrier respectively.Wherein 2,4,6,7 swimming lanes are respectively the empty carrier that no gene segment inserts.

Fig. 5. the variable region heavy chain gene (VH of anti human CD 19 antigen monoclonal antibody ZCH-4-2E8 _2E8) sequence (two red arrow between sequence).

Fig. 6. the variable region light chain gene (VL of anti human CD 19 antigen monoclonal antibody ZCH-4-2E8 _2E8) sequence (two red arrow between sequence).

Fig. 7 .2E8-Gen immunotoxin (IT) is to Nalm-6 (Fig. 7 C) leukemia cell's of K562 (Fig. 7 A), the Molt-3 (Fig. 7 B) of CD19-and CD19+ targeting killing effect.NC is a blank, and PBS (phosphate buffered saline buffer), Gen are that toxin trishydroxymethyl isoflavones, pure 2E8 are control group for the purifying 2E8 antibody three who does not connect toxin, and IT is 2E8 antibody and toxin couplings 2E8-Gen.

Embodiment

The present invention is further described in conjunction with the embodiments.

Embodiment one

The nucleotide sequence and the aminoacid sequence of 2 genes of the present invention:

1, anti human CD 19 mouse immune sphaeroprotein heavy chain variable region gene (monoclonal antibody ZCH-4-2E8 VH _2E8) nucleotide sequence (SEQ ID NO 1) and aminoacid sequence (SEQ ID NO 3).

2, anti human CD 19 mouse immune sphaeroprotein chain variable region gene (antigen monoclonal antibody ZCH-4-2E8 VL _2E8) Nucleotide (SEQ ID NO 2) and aminoacid sequence (SEQ ID NO 4).

Embodiment two

2 anti human CD 19 mouse immune globulin variable zone genes provided by the invention obtain through the following steps:

1, the development of ZCH-4-2E8 monoclonal antibody: press Koller﹠amp substantially; Mouse-murine hybridoma the classical way of Milstein report carries out, with children's acute undifferentiated type Lymphocytic leukemia (uALL) cell (its immunophenotype is HLA-DR+, CD19+, CD10-, CD33-, TdT+, CD7-is CD41a-) as immunogen, with 10 ⁷The leukemia cell makes abdominal injection for 8 ages in week female Balb/C mouse, once in a week, totally 4 times, injected the back the 3rd day in the 4th, mouse is killed in dislocation, and aseptic extracting spleen cell mixes by 6: 1 with the murine myeloma cell strain NS-1 cell that is in logarithmic phase, with 50% polyoxyethylene glycol (PEG, U.S. Sigma company, molecular weight 3350 dalton) solution carries out cytogamy as merging media, carries out selectivity and cultivate in 96 orifice plates (U.S. Falcon company).In merging the back the 9th～20 day, the next day with immunogen cell culture supernatant is carried out indirect immunofluorescence (IIF) screening.Positive porocyte reaches positive through 3 time cloningizations and continuous 2 times 100% holes, has promptly set up the hybridoma cell line of energy continuous release 2E8 monoclonal antibody.Through the continuous passage cultivation and the multigelation of 8 wheat harvesting periods, the ability of its secretion 2E8 monoclonal antibody is stable.With its ascites (fluorescent method was tired 1: 3200) or culture supernatant (fluorescent method was tired 1: 16) source as the 2E8 monoclonal antibody.

2, best clone's screening is carried out the subclone cultivation after with frozen 2E8 cell recovery in liquid nitrogen (196 ℃), obtain 6 hole monoclonal cell groups, difference called after 67A10,67B8,67B11,67D2,67F9,67G10 is by the average fluorescent strength of sheep anti mouse immunoglobulin (Ig) (GAMIg-FITC) indirect labelling method each monoclonal cell group culture supernatant of comparison on the Nalm-6 cell of fluorescein isothiocyanate (FITC) mark, referring to Fig. 1.According to the contrast of both average fluorescent strengths, therefrom filter out 1 the inferior monoclonal cell strain of the best 67B11, cloning obtains subclone 83C5 once more, selects for use 83C5 to do further experiment.

3, heavy, the light chain gene (VH of 2E8 _2E8, VL _2E8) amplification

3.1 extracting and the processing of total RNA:

2E8 hybridoma and the rat bone marrow tumour cell of collecting best clone (83C5) are NS-1 cell about respectively 8 * 10 ⁶, with Yeast Nucleic Acid (RNA) extraction agent box (TRIZOL liquid) by specification step extracted total RNA.Be dissolved at last in 25 μ l DEPC (diethyl-pyrocarbonate, the diethylpyrocarbonate) water, and add

(ribonucleotide enzyme inhibitors) to final concentration is 1U/ μ l (unit/microlitre).Ultraviolet spectrophotometer is measured A260, A280 and ratio thereof, and 1% agarose electrophoresis is observed total RNA.It is preceding to carry out reverse transcription-polymerase chain reaction,PCR (RT-PCR), respectively gets 2 μ l 2E8 and the total RNA of NS-1, and the method according to RQ1 (the DNA enzyme reagent kit of no RNA enzyme) illustrates digests the genomic dna that pollutes among total RNA.

3.2 the extracting of total RNA:

(1) counting cells, totally 8 * 10 ⁶Individual viable cell;

(2) normal temperature following 1000 rev/mins (rpm) is centrifugal 15 minutes, abandons supernatant;

(3) add after the stroke-physiological saline solution under the 1000rpm condition centrifugal 15 minutes in the precipitation, repeated washing 2 times;

(4) in precipitation, add 8ml TRIZOL (1ml/10 ⁶Cell), lash shearing several minutes repeatedly with the aseptic syringe of 5ml immediately;

(5) above-mentioned TRIZOL solution is changed in 1.5ml little plastics with cover (eppendorf) pipe by the 1ml/ pipe, left standstill under the room temperature 5 minutes;

(6) every pipe adds the 0.2ml chloroform, acutely shakes 15 seconds, leaves standstill under the room temperature 10 minutes;

Centrifugal 15 minutes of (7) 4 ℃ of following 12000g change water in the eppendorf pipe of new 1.5ml, and every pipe adds the 0.5ml Virahol, shakes up immediately, leaves standstill under the room temperature 10 minutes;

Under (8) 4 ℃, centrifugal 10 minutes of 12000g;

(9) abandon supernatant, every pipe adds 1.5ml 75% ethanol, mixing, and under 4 ℃, centrifugal 5 minutes of 7500g abandons supernatant;

(10) dry in the Vacuumdrier, every pipe adds the DEPC water dissolution precipitation that 25 μ l do not have the RNA enzyme, and-80 ℃ of refrigerators are preserved.

3.3 the mensuration of total rna concentration:

Take out the new extractive total RNA of 2 μ l, add 98 μ l DEPC water mixings, ultraviolet spectrophotometer (GeneQuant II) is measured 260 light absorption values (A260) and 280 light absorption values (A280), and the RNA actual concentrations calculates with following formula:

3.4 total RNA gel electrophoresis:

Get new extractive total RNA 3 μ l and add electrophoresis sample-loading buffer 5 μ l, brominated second pyridine (EB) concentration 0.5 μ g/ml in 1% sepharose, electrophoresis is 5 minutes under the 100V volts DS, and gel imaging system observed result and shooting are preserved.

3.5 the processing of total RNA: get DNA enzyme (RNase-freeDnase) (1U/ μ l) 10 μ l+RNasin (40U/ μ l) 1 μ l+ magnesium chloride (25mM) the 1 μ l that total RNA 1 μ l+ does not have the RNA enzyme, total amount reaches 13 μ l, through 37 ℃ * 1 hour, incubated in 90 ℃ * 5 minutes put immediately after the bath stand-by on ice.

3.6RT-PCR：

To specifications, RQ1 is not had total RNA that the DNA enzyme of RNA enzyme handled carry out reverse transcription (25 μ l system), and with DNA purification kit (QIAquick) purified mRNA/cDNA heteroduplex.The cDNA2.5 μ l that gets purifying carries out PCR.

3.6.1RT reaction system: get total RNA 13 μ l+ oligomerization deoxythymidines [Oligo (dT)] 1.5 μ l that RQ1 handled, total amount reaches 14.5 μ L, through 65 ℃ of pre-sex change 5 minutes, put immediately on ice, add following reagent: DEPC water 2.5 μ l+5 times damping fluids 5 μ l+25mM dNTP (deoxynucleoside mixture) 0.5 μ l+RNA enzyme inhibitors, 1.5 μ l+ reversed transcriptive enzymes (200U/ μ L) 1 μ l is to cumulative volume 25 μ l, through 37 ℃, incubated bath in 30 minutes with synthetic complementary DNA Nucleotide (cDNA), put 95 ℃ 5 minutes, it is standby to move to 4 ℃ of ice baths then.

3.6.2PCR system

The PCR reaction system of (1) 50 μ l: the 2E8 of 2.5 μ l purifying or NS-1 cDNA, each 1 μ l of the light chain of 10pmol or variable region of heavy chain upstream and downstream primer, the dNTP of 0.5 μ l 25mM, 5 μ l, 10 * high-fidelity PCR damping fluid, 2 μ l 50mM * MgSO ₄(sal epsom) solution, 0.2 μ l high-fidelity Taq polysaccharase (Platinum TaqHigh Fidelity); Primer sequence is as follows:

Variable region of heavy chain 5 ' primer sequence (SEQ ID NO 5):

GAGGTGAAGCTGGTGGAGTC

Variable region of heavy chain 3 ' primer sequence (SEQ ID NO 6):

GGAGACGAGGGGGAAAAGCTTTGGGAAGGACTGACTCTC

Variable region of light chain 5 ' primer sequence (SEQ ID NO 7):

GATATCCAGATGACACAGACT

Variable region of light chain 3 ' primer sequence (SEQ ID NO 8):

GGATACAGTTGGTGCAGCATC

(2) reaction conditions: 94 ℃ of pre-sex change 2 minutes, 94 ℃ of sex change 30 seconds, 57 ℃ of annealing 30 seconds, 72 ℃ were extended totally 38 circulations 30 seconds;

(3) after last circulation is finished, add 1 μ l Taq DNA Polymerase (Taq archaeal dna polymerase) and extended 7 minutes for 72 ℃;

(4) get 5 μ l PCR products and carry out 1% agarose gel electrophoresis, add standard molecule amount mark DL2000 simultaneously, identify PCR product segment size, respectively called after VL _2E8And VH _2E8Gene.The result can be observed the VL about 350 base pairs (bp) _2E8VH about band and 400bp _2E8Band.Aforementioned positive band is cut glue recovery purifying obtain VL _2E8And VH _2E8Gene.With the NS-1 cell cDNA that merges object as this hybridoma is that the PCR product electrophoresis result of template does not see that amplified band is (referring to Fig. 2, Fig. 3).

4.VH _2E8, VL _2E8The clone of gene amplification product and evaluation are with VH _2E8And VL _2E8Gene fragment by ligase enzyme respectively with cloning vector Easy connects, the connection product of acquisition

Easy/VH and

Easy/VL, by transforming DH5 α competence bacterium, obtain dozens of white colony and several blue colonies, 4 white colonies of picking carry out plasmid amplification respectively, carry out nucleic acid restriction endonuclease EcoRI enzyme after the extracting and cut processing, purpose fragment (Fig. 4) about all visible 350bp of 1% agarose electrophoresis result and 400bp, wherein M: low ribonucleotide (DNA) standard molecular weight mark; 1:VH _2E8Gene; 2:NS-1 heavy chain variable region gene (VH _NS-1); 3:VL _2E8Gene; 4:NS-1 chain variable region gene (VL _VS-1); 5～8: recombinant plasmid The EcoRI enzyme of Easy/VL is cut; 9～12: recombinant plasmid

The EcoRI enzyme of Easy/VH is cut.

5.VH _2E8, VL _2E8Gene sequencing and analysis

To checking order VH behind the positive recombinant plasmid purifying _2E8(Fig. 5) and VL _2E8(Fig. 6) gene all meets mouse Ig variable region skeleton construction.VH _2E8Full length gene 366bp (seeing sequence SEQ ID NO 1), 122 amino acid (seeing sequence SEQ ID NO 3) of encoding, at the enterprising line retrieval of American National biotechnology information center (NCBI), the homology of finding this heavy chain variable region gene and mouse immuning ball protein heavy chain reaches 98%, the homology of aminoacid sequence and mouse Ig heavy chain reaches 86%, belongs to the VH gene of mouse Ig.The amino acid sequence analysis result shows that variable region of heavy chain contains clear and definite 4 framework regions (FR) and 3 complementary districts of antigenic determinant (CDR), is characteristic Cys (halfcystine) at the 22nd and the 96th.VH _2E8The aminoacid sequence structural framing is as follows:

1～25 FR1

26～33 CDR1

34～50 FR2

51～58 CDR2

59～96 FR3

97～110 CDR3

111～122 FR4

VL _2E8Full length gene 321bp (seeing sequence SEQ ID NO 2), 107 amino acid (seeing sequence SEQ ID NO 4) of encoding, at the enterprising line retrieval of NCBI, the homology of finding this chain variable region gene and mouse Ig κ chain reaches 97%, the homology of aminoacid sequence and mouse Ig κ chain reaches 95%, belongs to the V kappa gene of mouse Ig.The amino acid sequence analysis result shows that variable region of light chain contains clear and definite 4 framework regions (FR) and 3 complementary districts of antigenic determinant (CDR), is characteristic halfcystine (Cys) at the 23rd and the 88th.VL _2E8The aminoacid sequence framework is as follows:

1～26 FR1

27～32 CDR1

33～49 FR2

50～52 CDR2

53～88 FR3

89～97 CDR3

98～107 FR4

Embodiment three

For confirming the potential clinical treatment application prospect of 2E8 antibody, we are with the 2E8 mouse source property complete antibody and the trihydroxy-isoflavone (Genistein of purifying, abbreviation Gen) immunotoxin (2E8-Gen) of 2E8 antibody is made in coupling, observe it to the 2E8 positive (acute B Lymphocytic leukemia, Nalm-6) and negative (acute T chronic myeloid leukemia clone Mplt-3 and marrow leukaemia cell system) cell carry out target killing research, found that, 2E8-Gen has very strong selective killing effect to Nalm-6 cell (B clone leukemia/lymphoma cell strain), through 37 ℃ incubated in 48 hours bathe cultivate after, the cell survival rate of 2E8-Gen group only 5%, apparently higher than control group, and 2E8-Gen does not but have lethal effect to the Molt-3 and the K562 cell of 2E8 feminine gender, illustrate that 2E8-Gen has the effect (referring to Fig. 7) of good target killing B cell leukemia cell, wherein PBS is a phosphate buffered saline buffer, Gen is free trihydroxy-isoflavone, and purifying 2E8 is the 2E8 rat immune globulin IgM κ of purifying.

Need not further to elaborate, believe and adopt the disclosed content in front, those skilled in the art can use the present invention to greatest extent.Therefore, the embodiment of front is interpreted as only illustrating, but not limits the scope of the invention by any way.

The sequence that the present invention relates to

＜120〉anti human CD 19 mouse immune globulin variable zone gene and purposes

<160>6

<170>Patent?In?Version?2.1

<210>1

<211>366

＜213〉artificial sequence

<220>

<221>

<222>

<223>101a?79c?102g?84t

<400>1

GAGGTGAAGC?TGGTGGAGTC?GGGACCTGAG?CTGAAGAAGC?CTGGAGAGAC?AGTCAAGATC 60

TCCTGCAAGG?CTTCCGGGTA?TTCCTTCAGA?AACTATGGAA?TGAACTGGGT?GAAGCAGGCT 120

CCAGGAAAGG?GTTTAAAGTG?GATGGGCTGG?ATAAACACCT?ACAGTGGAGA?GCCAACACAT 180

GCTGATGACT?TCAAGGGACG?GTTTGCCTTC?TCTTTGGAAA?CCTCAGCTAG?TACTGCCTAT 240

TTGCAGATCA?ACAACCTCAA?AAATGAGGAC?ATGGCTACAT?ATTTCTGTGC?AAGACGGGAT 300

TTCGACGGAT?ATTACTATGC?TATGGACTAC?TGGGGTCAAG?GAACCTCAGT?CACCGTCTCC 360

TCAGAG 366

<210>2

<211>321

<212>DNA

＜213〉artificial sequence

<220>

<221>

<222>

<223>92a?71c?74g?84t

<400>2

GATATCCAGA?TGACACAGAC?TTCATCCTAC?TTGTCTGTAT?CTCTAGGAGG?CAGAGTCACC 60

ATTACTTGCA?AGGCAAGTGA?CCACATTAAT?AATTGGCTAG?CCTGGTATCA?GCAGAAACCA 120

GGAAATGCTC?CTAGGCTCTT?AATATCTGGT?GCAACCAGTT?TGGCAACTGG?GATTCCTTCA 180

AGATTCAGTG?GCAGTGGATC?TGGAAAGGAT?TACACTCTCA?GCATTACCAG?TCTTCAGACT 240

GAAGATGATG?CTACTTATTA?CTGTCAACAG?TATTGGAGTA?CTCCGTGGAC?GTTCGGTGGA 300

GGCACCAAGC?TGGAAATCAA?A 321

<210>3

<211>122

<212>

＜213〉artificial sequence

<220>

<221>

<222>

＜223 〉, designed the synthetic base of the coding hPTH (1-34) of restriction enzyme site and joint peptide according to the codon of intestinal bacteria preference

Cause

<400>3

EVKLVESGPE?LKKPGETVKI?SCKASGYSFR?NYGMNWVKQA?PGKGLKWMGW?INTYSGEPTH 60

ADAFKGRFAF?SLETSASTAY?LQINNLKNED?MATYFCARRD?FDGYYYAMDY?WGQGTSVTVS 120

SE 122

<210>4

<211>107

<212>

＜213〉artificial sequence

<220>

<221>

<222>

<223>

<400>4

DIQMTQTSSY?LSVSLGGRVT?ITCKASDHIN?NWLAWYQQKP?GNAPRLLISG?ATSLATGIPS 60

RFSGSGSGKD?YTLSITSLQT?EDDATYYCQQ?YWSTPWTFGG?GTKLEIK 107

<210>5

<211>20

<212>

＜213〉artificial sequence

<220>

<221>

<222>

＜223〉variable region of heavy chain 5 ' primer sequence

<400>5

GAG?GTG?AAG?CTG?GTG?GAG?TC

<210>6

<211>39

<212>

＜213〉artificial sequence

<220>

<221>

<222>

＜223〉variable region of heavy chain 3 ' primer sequence

<400>6

GGA?GAC?GAG?GGG?GAA?AAG?CTT?TGG?GAA?GGA?CTG?ACT?CTC

<210>7

<211>21

<212>

＜213〉artificial sequence

<220>

<221>

<222>

＜223〉variable region of light chain 5 ' primer sequence

<400>7

GAT?ATC?CAG?ATG?ACA?CAG?ACT

<210>8

<211>21

<212>

＜213〉artificial sequence

<220>

<221>

<222>

＜223〉variable region of light chain 3 ' primer sequence

<400>8

GGA?TAC?AGT?TGG?TGC?AGC?ATC

Claims (5)

1. anti human CD 19 mouse immune globulin variable zone gene has the nucleotide sequence of SEQ ID NO 1 and SEQ ID NO 2.

2. anti human CD 19 mouse immune globulin variable zone gene according to claim 1, its amino acid sequence coded are SEQ ID NO 3 and SEQ ID NO 4.

3. the application of anti human CD 19 mouse immune globulin variable zone gene according to claim 1 and 2 in preparation treatment bone-marrow-derived lymphocyte malignant tumor medicine.

4. application according to claim 3 is characterized in that: the application in preparation treatment leukemia medicament.

5. application according to claim 3 is characterized in that: the application in preparation treatment lymphoid tumor medicament.

Images