CN100410371C

CN100410371C - Expression method of recombination human bone formation protein-2

Info

Publication number: CN100410371C
Application number: CNB2006100328007A
Authority: CN
Inventors: 汪炬; 孙奋勇; 戴云; 谢秋玲
Original assignee: Jinan University
Current assignee: Jinan University
Priority date: 2006-05-13
Filing date: 2006-05-13
Publication date: 2008-08-13
Anticipated expiration: 2026-05-13
Also published as: CN1869216A

Abstract

The present invention discloses an expression method of recombination human bone formation protein-2, which comprises the following steps: a target gene hBMP-2 is synthesized; NdeI and BamHI are used to carry out double enzyme cutting to the hBMP-2 gene and a carrier, a recombination carrier is constructed by connection, a host bacterium is converted, and an hBMP-2 gene engineering bacterium is constructed; the hBMP-2 gene engineering bacterium is cultured, and inclusion bodies are separated, washed and dissolved to obtain inclusion body solution; the inclusion bodies are purified and renatured; hyperfiltration, dialysis and freeze drying are carried out to obtain the recombination human bone formation protein-2. The present invention has the advantages of simple and convenient process, low cost, high output and activity, has superior in industrial production and is suitable for large-scale production. The renaturation efficiency can reach about 60%.

Description

A kind of recombination human bone shaping protein-2 expression method

Technical field

The present invention relates to the genetically engineered field, relate in particular to a kind of recombination human bone shaping protein-2 expression method.

Background technology

(human bone morphorgenetic protein-2 is bone morphogenetic protein family a member hBMP-2) to Human Bone Morphogenetic Proteins-4-2, belongs to the TGF-beta superfamily, and it is by two 114 homodimers that amino-acid residue constitutes that active sophisticated hBMP-2 is arranged.HBMP-2 is extensive in the physiological function of human body, all play an important role at the aspects such as growth, differentiation, chemotaxis and apoptosis of regulating cell, can promote the healing of big area bone injury in conjunction with the human compatibility tissue engineering material, and can be widely used in tooth reparation, beauty and shaping, thereby be with a wide range of applications clinically.

Serve as the main rhBMP-2 of production with the animal cell expression system abroad, the cost height yields poorly, and is active good, normally glycosylation.The listing of U.S. FDA approved is used for spinal fusion.The used escherichia coli expression rhBMP-2 of domestic East China gene studies, it is a purifying after inclusion body stage elder generation's renaturation, annealing efficiency is lower like this, and is active bad.

Summary of the invention

The objective of the invention is to overcome the problem that existing Human Bone Morphogenetic Proteins-4-2 production method exists, the Human Bone Morphogenetic Proteins-4's-2 that a kind of cost is low, annealing efficiency is high, activity is good expression method is provided.

To achieve these goals, the present invention adopts following technical scheme:

A kind of recombination human bone shaping protein-2 expression method comprises the steps:

(1) goal gene hBMP-2's is synthetic;

(2) double digestion hBMP-2 gene and carrier connect the structure recombinant vectors, transform the host bacterium, make up the hBMP-2 genetic engineering bacterium;

(3) cultivate the hBMP-2 genetic engineering bacterium, separate, clean, dissolve inclusion body and obtain solubilization of inclusion bodies liquid;

(4) purifying inclusion body;

(5) renaturation;

(6) ultrafiltration, dialysis, freeze-drying obtain recombination human bone shaping protein-2.

Synthesizing of above-mentioned steps (1) described goal gene: design upstream primer ATCGCATATGGGCCTAACCTTCTTTTGAAGCTTATTCAA, downstream primer ACGTGGATCCCTATTAGCAACACCCACAACCCT; With people's embryo cDNA library is template, RT-PCR amplification hBMP-2 gene, and the condition of RT-PCR is 94 ℃, 5min, 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 30s, 35 circulations, 72 ℃, 10min.

The described carrier of above-mentioned steps (2) is pET35b (+) or PBV220.When carrier was pET35b (+), the used restriction enzyme of double digestion was Nde I, BamH I; When carrier was PBV220, the used restriction enzyme of double digestion was BamH I, EcoR I.

The described host bacterium of above-mentioned steps (2) is intestinal bacteria.

The substratum of the described cultivation of above-mentioned steps (3) hBMP-2 genetic engineering bacterium is the LB substratum, and culture temperature was 30～32 ℃ when carrier was pET35b (+); Culture temperature was 30 ℃ when carrier was PBV220, and inducing temperature is 42 ℃.

The described separation of above-mentioned steps (3), cleaning, dissolving inclusion body are with the engineering bacteria ultrasonication, and centrifugal collecting precipitation cleans with solution 1, with solution 2 dissolvings; Described solution 1 is 2%Triton X-100,50mmol Tris-HCl, pH 7.4,1mmol EDTA; Described solution 2 is 8M urea, 50mmol Tris, pH 7.0,1mmol EDTA, 0.1M beta-mercaptoethanol.

The described purifying inclusion body of above-mentioned steps (4) is to adopt the anion-exchange chromatography purifying, and required filler is DEAE, PEI or QAE; Adsorption conditions is that pH is between 7～9; Elution requirement is for salt or change pH, and salt concn is 0.1～0.4mol/LNaCl, and pH is between 7～9.

The described renaturation of above-mentioned steps (5) is to adopt the dilution method renaturation, and renaturation solution is: pH 10.5,50mmol/L yellow soda ash, 1mol/L sodium-chlor, 20% glycerine, 0.5 μ mol/LCuCl ₂With the 1mmol/L dithiothreitol (DTT).

The described ultrafiltration of above-mentioned steps (6) is to adopt molecular weight 10000 daltonian ultra-filtration membrane ultrafiltration, and described dialysis is to adopt semi-permeable membranes that mass percent 0.1% acetic acid is dialysed.

Compared with prior art, the present invention has following beneficial effect:

The rhBMP-2 of escherichia coli expression exists with the inclusion body form, sophisticated activated hBMP-2 structure more complicated, it is carried out relatively difficulty of external change renaturation, the present invention is passing through on the basis of escherichia coli high-level expression rhBMP-2, the various factors that influences its annealing efficiency has been carried out qualitative, quantitative research, determined the comparatively suitable method of the external change renaturation of recombination human bone shaping protein-2, its annealing efficiency is reached about 50%～60%, the ED of rhBMP-2 after the renaturation ₅₀Be up to 0.71 μ g/ml, be fit to carry out industrialization.Technology of the present invention is easy, and cost is low, the output height, and active good, renaturation yield can reach about 60%, has advantage on industrialization is produced, and is suitable for scale operation.

Description of drawings

Fig. 1 is the design of graphics of pET/hBMP-2 expression plasmid;

Fig. 2 is expression and the purifying figure of rhBMP-2;

Fig. 3 is the non-reduced and reductive SDS-PAGE figure of rhBMP-2 dimer after the renaturation;

Fig. 4 be after the renaturation rhBMP-2 at the mensuration figure of C2C12 cell neutral and alkali phosphatase activity.

Wherein, among Fig. 1,1 is pET35b (+), and 2 is NdeI+BamH I, and 3 is the PCR product, and M is λ-Hind III; Among Fig. 2,1 is inductive bacterial protein not, and 2 is to induce the back bacterial protein, and 3 be the preceding purified rhBMP-2 of renaturation, and M is albumen marker; Among Fig. 3,1 is non-reduced electrophoresis, and 2 are the reduction electrophoresis, and 3 is the rhBMP-2 dimer behind the purifying, and 4 is reference substance, and M is albumen marker.

Embodiment

Embodiment 1

(1) design upstream primer ATCG CATATGGGCCTAACCTTCTTTTGAAGCTTATTCAA, downstream primer ACGT GGATCCCTATTAGCAACACCCACAACCCT; With people's embryo cDNA library is template, pcr amplification BMP-2 gene, and the PCR condition is: 94 ℃, 5min, 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 30s, 35 circulations, 72 ℃, 10min.1.5% agarose gel electrophoresis, the visible one obvious band at the 342bp place matches with estimating the product size.(Fig. 1)

(2) cut the hBMP-2 gene of glue recovery behind pcr amplification, behind hBMP-2 and pET35b (+) behind the Nde I+Bam H I double digestion, connect according to ordinary method, and be transformed into DH5 α competent cell.The several clones of random choose on flat board, the extracting plasmid is cut the evaluation recon with Nde I+BamH I enzyme, and recon is by the accuracy of the definite sequence of company's order-checking simultaneously, and sequencing result is consistent with design.

(3) select the highest recon of expression amount, by 1% inoculum size its access is equipped with in the culturing bottle of 5mlLB substratum, spend the night, be forwarded in 500ml LB substratum by 1% next day, is cultured to OD ₆₀₀=0.2, add IPTG to final concentration 1mM, continue to cultivate 4 hours.8000 rev/mins of centrifugal collection thalline of 30min, PBS is resuspended, ultrasonication thalline, 8000 rev/mins of centrifugal collection inclusion bodys of 30min.

(4) inclusion body is cleaned with solution 1,8000 rev/mins of 30min are centrifugal, collecting precipitation, and dissolve with solution 2.Described solution 1 is 2%Triton X-100,50mmol/Ltris-HCl, 1mmol/LEDTA, pH7.0; Described solution 2 is 8mol/L urea, 50mmol/Ltris-HCl, 1mmol/LEDTA, 0.1mol/L beta-mercaptoethanol.

(5) with DEAE-Sephorase (Pharmacia company product) filler dress post (30cm * 3cm), with 20mmol/LPBS+8M urea (pH 8.0) balance, with sample on the sample to be purified, applied sample amount is 30mL, wash to baseline with balance liquid after the completion of the sample, use 0.25mol/LNaCl+8M urea+20mmol/LPBS (pH 7.0) wash-out pillar again, collect elution peak.(Fig. 2)

(6) above-mentioned elution peak is collected liquid by the dilution method renaturation, renaturation solution is: pH10.5,50mmol/L yellow soda ash, 1mol/L sodium-chlor, 20% glycerine, 0.5 μ mol/LCuCl ₂And 1mmol/L dithiothreitol (DTT).Final concentration of protein is 0.2mg/ml during renaturation, and the renaturation time is 48 hours.

(7) albumen after the renaturation is the ultra-filtration membrane ultrafiltration that 10000 roads pause by molecular weight, then to after the dialysis of mass percent 0.1% acetic acid, and freeze-drying.(Fig. 3)

(8) the cell method is measured the biological activity of the C2C12 cell induction being expressed ALP, and method is with reference to relevant document.Be higher than contrast through the rhBMP-2 of renaturation activity.RhBMP-2 activity after the renaturation is respectively 0.71 μ g/ml, reference substance (R﹠amp; D systems) is 1.2 μ g/ml.(Fig. 4)

Test shows that the present invention is by unique technology, and easy method becomes a reality the scale operation of BMP-2.Escherichia coli expression BMP-2, cost is low, and the output height because our technology renaturation yield can reach about 60%, therefore, has advantage on industrialization is produced.

Claims

1. a recombination human bone shaping protein-2 expression method is characterized in that comprising the steps:

(1) goal gene hBMP-2's is synthetic;

(4) purifying inclusion body;

(5) renaturation;

(6) ultrafiltration, dialysis, freeze-drying obtain recombination human bone shaping protein-2;

In the above-mentioned steps (1), the synthesizing of described goal gene: design upstream primer ATCGCATATGGGCCTAACCTTCTTTTGAAGCTTATTCAA, downstream primer ACGTGGATCCCTATTAGCAACACCCACAACCCT; With people's embryo cDNA library is template, RT-PCR amplification hBMP-2 gene, and the condition of RT-PCR is 94 ℃, 5min, 94 ℃, 30s, 60 ℃, 30s, 72 ℃, 30s, 35 circulations, 72 ℃, 10min;

In the above-mentioned steps (2), described carrier is pET35b (+) or PBV220; When carrier was pET35b (+), the used restriction enzyme of double digestion was Nde I, BamH I; When carrier was PBV220, the used restriction enzyme of double digestion was BamH I, EcoR I;

In the above-mentioned steps (3), the substratum of described cultivation hBMP-2 genetic engineering bacterium is the LB substratum; Culture temperature was 30～32 ℃ when carrier was pET35b (+); Culture temperature was 30 ℃ when carrier was PBV220, and inducing temperature is 42 ℃;

In the above-mentioned steps (3), described separation, cleaning, dissolving inclusion body are with the engineering bacteria ultrasonication, and centrifugal collecting precipitation cleans with solution 1, with solution 2 dissolvings; Described solution 1 is 2%Triton X-100,50mmol Tris-HCl, pH 7.4, and 1mmol EDTA, described solution 2 is 8M urea, 50mmol Tris, pH 7.0,1mmol EDTA, 0.1M beta-mercaptoethanol;

In the above-mentioned steps (4), described purifying inclusion body is to adopt the anion-exchange chromatography purifying, and required filler is DEAE, PEI or QAE; Adsorption conditions is that pH is between 7～9; Elution requirement is for salt or change pH, and salt concn is 0.1～0.4mol/LNaCl, and pH is between 7～9;

In the above-mentioned steps (5), described renaturation is to adopt the dilution method renaturation, and renaturation solution is: pH10-11,50mmol/L yellow soda ash, 1mol/L sodium-chlor, 5-20% glycerine, 0.1-1 μ mol/LCuCl ₂And 1-10mmol/L dithiothreitol (DTT).

2. the method for claim 1 is characterized in that the host bacterium is intestinal bacteria described in the step (2).

3. the method for claim 1 is characterized in that the described ultrafiltration of step (6) for adopting molecular weight 10000 daltonian ultra-filtration membrane ultrafiltration, and described dialysis is to adopt semi-permeable membranes that 0.1% acetic acid is dialysed.