CN100400664C - Preparation method of fusion protein of tumour blood-targeted peptide and human interferon alpha-2b - Google Patents

Abstract

The present invention discloses a method for preparing specific binding polypeptide NGR of new tumor blood vessels and fusion protein of human interferon alpha-2b(IFNalpha-2b). The present invention selects cyclic peptide NGR containing 13 amino acids and uses a gene engineering method to fuse the cyclic peptide NGR at the tail end of the carboxyl of IFNalpha-2b, wherein the cyclic peptide NGR is sieved from a phage display library and is combined with CD13 capable of being effectively expressed on the surfaces of esoderma cells of new tumor phage vessels. The fusion protein of the specific binding polypeptide NGR and IFNalpha-2b of the prepared new tumor phage vessels can be enriched at the new tumor phage vessel parts so as to enhance the treating specificity of interferon alpha-2b and reduce whole-body dosage; moreover, toxic and side reaction is reduced, and the rate of quality and effect is enhanced.

Description

The preparation method of the fusion rotein of tumor vessel targeted peptide and human interferon alpha-2 b

Technical field

The invention belongs to the medical biotechnology field, be specifically related to the expression in prokaryotic cell prokaryocyte of gene clone, transgenation, foreign gene, purifying, tumour new-born blood vessel-specific bonding polypeptide NGR and the human interferon alpha-2 b of target protein matter (active determination in vitro of fusion rotein of IFN α-2b) and the technology such as evaluation of physico-chemical property.Further relate to a kind of tumour vascular-targeting in conjunction with polypeptide NGR and human interferon alpha-2 b (IFN α-2b) fusion rotein and preparation, be a kind of tumour new-born blood vessel-specific bonding polypeptide NGR and human interferon alpha-2 b (IFN α-2b) fusion rotein and preparation thereof, tumour new-born blood vessel-specific bonding polypeptide NGR and human interferon alpha-2 b (fusion rotein of IFN α-2b) is as antitumor drug, can specific effect in tumor tissues new vessel endotheliocyte and tumour cell.

Background technology

Tumor vessel targeted peptide and the existing many relevant reports of the application of the fusion rotein of cytokine, the applicant is just " tumour new-born blood vessel-specific bonding polypeptide and human alpha interferon fusion rotein and preparation " and " tumor vessel targeted peptide and novel recombinant human tumour necrosis factor fusion protein and preparation " once, applied for Chinese patent, application number is respectively 02139537.3 and 02114663.2, in the background technology of above-mentioned patent documentation detailed introduction the progress situation of TNF of people IFN α, just repeat no more here as space is limited.Mainly introduce the development of polypeptide guiding technique below.

1. the notion of polypeptide guiding technique and origin

All there is a defective that can not be ignored in most at present clinical medicines, promptly lack special avidity to pathogenic site, heavy dose of administration not only makes the medicine cost improve, also produce non-specific toxicity inevitably, healthy tissues is caused serious damage, cause toxic side effect, this toxic side effect sometimes or even lethal.In order to overcome this difficult problem, people have proposed the therapeutic strategy of guidance quality, this tactful theoretical basis is with respect to normal tissue, lesions position (particularly tumour) has own unique surface molecular, these molecules are not only special relatively, and usually be high expression level, so if connect the upward part or the antibody of these molecules to medicine, then by means of the combination of these parts or antibody and their corresponding molecules, medicine just can specificly be brought to lesions position, selectivity is attacked sick cell, normal cell is not almost had detrimentally affect, thereby make the curative effect of medicine reach the ideal degree.This strategy is considered to improve the effective ways of drug specificity, development is in adjacent first status in the drug development field in the exploitation of guidance quality medicine at present, only be example with the U.S., the exploitation of its guidance quality medicine occupies the first place of the whole America pharmaceutical market with 13.2% annual growth.

The molecule of guidance quality has a lot of classes, as the native ligand of antibody, target molecule, peptide etc., wherein is called as the polypeptide guiding technique with small-molecular peptides as the technology of guide molecule.The peptide that can be used as the guidance quality molecule comprises two big classes, one class is naturally occurring peptide, as somatostatin (somatostatin), vasoactive intestinal peptide (vasoactive intestinal peptide, VIP) etc., they are bringing into play good guidance quality effect aspect the specific diagnosis of disease and the treatment respectively.The naturally occurring peptide of another kind of then right and wrong is compared with native peptides, and the kind of such peptide is more, identify more convenient, and might be higher than the avidity of native peptides acceptor corresponding with it, so such peptide becomes the focus that people in recent years pay close attention to.Phage display techniques then is considered to be used to screen the quick of such peptide and effective means.

2 phage random peptide library technology

Smith in 1985 take the lead in foreign gene is inserted the III district of the coat protein gene of filobactivirus f1 making the goal gene encoded polypeptides be presented on the surface of phage, present technology thereby set up phage surface.Nineteen ninety Scott merges the albumen gIII on stochastic sequence peptide and filobactivirus surface first, and is presented on phage surface, has set up phage random peptide library.The capacity of random peptide library is very big, because a peptide storehouse is exactly the certain-length mixture of peptide section at random, should comprise all possible amino acid arrangement information of this length in theory, if a peptide library that comprises all 15 amino acid lengths, its molecular diversity will reach 20 in theory ¹⁵The phage peptide library technology is exactly to screen certain target molecules bonded peptide with the method for specific target molecule by affine elutriation from random peptide library, by order-checking, determines the gene order of encoded peptide section and knows its aminoacid sequence by inference then.

Screening method commonly used at present can be divided into two big classes, and a class is screening in the body, and a class is screening in the body.

2.1 in-vitro screening

In-vitro screening is present the most frequently used method, and it is designed by people such as Smith the earliest.Concrete operation is such: earlier target molecule is coated on the solid-phase media, adding phage peptide library adsorbs with it, the phage that has wherein presented with the aglucon binding peptide is trapped on the solid phase carrier, not with aglucon bonded phage then by flush away, flush away is combination and the low phage of bonding force not, phage and ehec infection with the elutriant elution of bound increased again, and the phage after the amplification enters the next round circulation.Elutriation can be enriched to specific phage polypeptide through the 1-4 wheel.The target protein that is used for the phage peptide library screening can directly be adsorbed in elisa plate, also can be fixed on the biological little magnetic bead or being fixed to through biotinylated target molecule to wrap by on the ELISA aperture or biomagnetic beads of Streptavidin.Being difficult to isolating membrane protein molecule for some can be that target goes to screen the peptide storehouse to express this proteic cell directly.

2.2 screening in the body

When some antigen and mark were difficult for determining or are difficult to obtain purified product, screening was proper selection in the body.The advantage of screening is that it is to carry out in vivo in the body, so the peptide that filters out is and the target molecule bonded that has kept active condition fully, but the peptide that filters out is with which kind of molecule to combine to await further to determine actually, its main operation is: phage peptide library is gone into mouse through tail vein injection, treat that phage circulates behind the suitable time in vivo, by heart mouse is carried out the phage of total body perfusion with the flush away non-specific binding, collect the phage in the target organ then, increase through ehec infection, inject mouse behind the purifying again, carry out next round and wash in a pan sieve, be generally the 3-4 wheel, obtain enrichment up to phage, the picking mono-clonal presents fragment to phage surface and checks order, the homology of its sequence of deriving.

People such as Ruoslahti, Pasqualini adopted this technology first in 1996, phage peptide library is injected directly in the mouse body screens, obtained and mouse kidney, the little peptide of cerebrovascular bonded, their novelty experimental design and good experimental result are published on then the Nature magazine their work.Coming years, they have done a series of activities aspect the screening in the body of display technique of bacteriophage, and many researchs that are applied to treatment of diseases and mechanism aspect are arranged.

3. the application of targeted peptide in disease treatment:

3.1 the application aspect traditional treatment

Method for screening has obtained energy specificity and tumor vessel bonded small peptide C DCRGDCFC (being called for short RGD-4C) and CNGRCVSGCAGRC (being called for short NGR) in the human bodies such as Ruoslahti, they are crosslinked with the conventional chemotherapy medicine Zorubicin with anti-angiogenic formation effect respectively, the Zorubicin of finding guidance quality can make the human breast carcinoma transplanted tumor mouse survival time obviously prolong, and toxic side effects reduces.People such as Arap and Pasqualini is with the little chemistry of peptides coupling of these two little peptides and cell death inducing, find that the little peptide of apoptosis directly enters tumor vascular endothelial cell under the guiding of the little peptide of guiding, destroy mitochondrial membrane and bring out endothelial cell apoptosis, and to the not influence of other cells.People such as Angelo have made up the fusion rotein of mouse NGR-TNF with engineered method, and to the tumor-inhibiting action of tumor-bearing mice than the high 12-15 of natural mouse TNF doubly, and toxicity is similar; The NGR-hTNF who makes up with quadrat method is stronger than natural human TNF to the restraining effect of human tumor, and dosage reduces by 30 times.

3.2 the application in gene therapy

Gene therapy vector also can lead with the peptide in phage source.The adenovirus carrier that mixes RGD-4C on the fiber coating protein has significantly improved the guidance quality to the endotheliocyte of ox, but studies show that the tumour cell of former of the adenovirus high-efficiency guide of RGD-4C mark.In the smooth muscle cell of cultivating, the peptide-labeled adenovirus of the various RGD of containing sequence can both lead and integrate element.Other there are some researches show, when the little peptide that obtains at the in-vitro screening TfR was illustrated in the envelope protein of adenovirus, adenovirus carrier can be successfully with the endotheliocyte of transgenosis to human brain, because endogenous TfR high level expression therein.In addition, the retrovirus MLV of mark NGR can strengthen the transduction efficiency to endothelial cells cultured.When will screen that phage antibody library gets be illustrated on the coat protein of MLV with T cell-specific bonded single-chain antibody the time, this single-chain antibody can mediate the elementary T cell that MLV imports the people selectively.

3.3 the application on clinical disease diagnosis

Because phage display peptide library almost can be sieved to the polypeptide with any target specific combination, generally, these little peptides only need the corresponding requirement that some changes just can meet contrast medium of making, and promptly a certain target are had special guidance quality and avidity, and good stability.The polypeptide of wire can be degraded rapidly by the proteolytic enzyme in the serum, and the big albumen transformation period is oversize after entering in the body, and repeated use can cause immune response, therefore is not suitable for doing contrast medium.Have only the cyclic peptide about 6-30 that has disulfide linkage restriction, can synthetic, the transformation period is suitable again, is suitable as contrast medium.The polypeptide that has has obtained the FDA approval and has come into the market, and carries out clinical local angiographic diagnosis.As the thrombosis position of can leading behind a dimerization peptide P748 and P357 (the deriving from RGD motifs) mark, its commodity are by name

4.NGR peptide and acceptor CD13/APN thereof

4.1NGR the discovery of peptide and application

1998, people such as Ruoslahti again by display technique of bacteriophage filtered out can with activatory tumour new-born blood vessel-specific bonded peptide sequence CDCRGDCFC (be called for short RGD-4C) and CNGRCVSGCAGRC (abbreviation NGR).At present, RGD peptide and NGR the peptide mechanism of action are in vivo also illustrated, and promptly they are respectively the α with tumor vessel surface high expression level _vβ ₃The ground combination of integral protein and Aminopeptidase N (CD13) molecular specificity is for these two little peptides provide feasibility and theoretical property foundation as the application of targeted molecular.Being applied in of the little peptide of NGR has more introduction in above-mentioned 3.2, no longer repeat here.

4.2CD13/APN

4.1CD13 general characteristic

Aminopeptidase is the hydrolysising protease of a series of aminoterminal catalyzed degradation amino-acid residues from the protein and peptide chain, Aminopeptidase N wherein because of its relevant receiving much attention of many-sided physiological and pathological process such as tumor invasion, transfer, immunomodulatory and virus infectiones.Aminopeptidase N/CD13 is the metalloprotease of a kind of relative molecular weight 150kDa, but because the difference of degree of glycosylation, difference to some extent on relative molecular weight.Its catalytic active center has a Zn ²⁺, enzymic activity has Zn ²⁺Dependency, can discharge the neutral amino acids (Ala＞Phe＞Leu＞Gly) of N end from hydrolysis on peptide, acid amides or the fragrant acid amides, the natural substrate of effect is blood vessel function peptide (kallidin, Angiotensin II I), neuropeptide hormone (leucine and methionine(Met) kephalin, neurokinin A, GHIF), cytokine and immunomodulator (IL-8, Tuftsin, Thymopentin) or the like.

This enzyme once had multiple name, as microsomal aminopeptidase, grain is aminopeptidase, APM, p146, p161 and gp150 etc., 1988, international biological chemistry and molecular biology federation are with its called after membranous type alanyl-amino peptidase (membrane alanyl aminopeptidase), 1989 according to the cDNA sequence, and the CD13 of this enzyme and early discovery is defined as with a kind of albumen.

CD13/ aminopeptidase N (APN) is considered to the mark of normal or pernicious myelocyte subgroup the earliest.Found afterwards that its cell in many showed that expression is all arranged, especially abundant in the epithelium of the intestinal epithelial cells of small intestine and kidney proximal tubule.

People's APN gene coded sequence contains 20 exons, is positioned karyomit(e) 15 (q25-26).Its intracellular region only has 7 amino-acid residues; The 8-39 position is αLuo Xuanjiegou for striding the film district, and protein molecular is fixed on the cytolemma by striding the film district; Then all outside born of the same parents, extracellular region is relevant with amino-peptidase activity for other residue.The molecule of aminopeptidase family is (as Aminopeptidase N and A, leukotriene A ₄Lytic enzyme, intestinal bacteria Aminopeptidase N etc.) near zine ion chelating residue aminoacid sequence has similarity, and their the block VBXHEBXHXWFG that has one section weak point is called zine ion chelating block.

4.2CD13/APN the major physiological function

4.2.1 the effect of proteolytic ferment

CD13/APN is by the different different effect of biologically active peptides performance of degraded, and its function is decided according to its different positions.In addition, the normal and CD13/APN coexistence of other membranous type peptases such as CD10 or CD26, they bring into play synergy in the peptide degradation process.At IBB, CD13/APN is relevant with amino acid whose excision with the degraded of small-molecular peptides with CD26; On synaptic membrane, CD13/APN and CD10 can make enkephalin and kephalin inactivation; When melanoma cells formed group, CD13/APN was positioned the iuntercellular junction, was closely related with the extracellular mixture, and basilar membrane is passed through in the regulate tumor cell migration.

4.2.2 the effect in tumour takes place and shifts

Find that by the pathology inflammatory reaction in research sacroiliitis and the proliferative retinopathy CD13/APN is the important regulatory factor that new vessel forms, its expression on blood vessel is subjected to inducing of vasculogenesis signal.On the endotheliocyte CD13 pair cell factor induce the adjusting that has been subjected to different feritin/hypertensin systems (RAS) effector, comprise RAS/ mitogen activated protein kinase (MAPK) or phosphoinositide (PI-3K) etc.CD13 still is the important target spot of Ras signal process during new vessel generates, and is the restricted factor in the angiogenesis.In vasculogenesis, endotheliocyte CD13/APN level can be subjected to the adjusting of the signal of histanoxia, angiogenesis factor and the formation of adjusting capillary vessel.The functional antibodies of CD13 can disturb the formation of capillary vessel.Studies show that the monoclonal antibody of CD13 (WM15) can suppress the degraded of tumour cell to the IV Collagen Type VI, reduce the hydrolytic activity of kinds of tumor cells aminopeptidase substrate.Therefore infer, CD13 may with IV Collagen Type VI enzyme and other stromatin enzymes, as the activation of lyase with transform relevantly, mechanism may be that excision N terminal amino acid residue causes and finishes activation process.

Summary of the invention

The objective of the invention is to, a kind of tumour new-born blood vessel-specific bonding polypeptide NGR and the human interferon alpha-2 b (preparation method of fusion rotein of IFN α-2b) is provided.The present invention is at application number 02139537.3, has carried out follow-up study on the patent basis of " tumour new-born blood vessel-specific bonding polypeptide and human alpha interferon fusion rotein and preparation ".

To achieve these goals, the technical solution adopted in the present invention is: the applying gene clone technology makes up tumour new-born blood vessel-specific bonding polypeptide NGR and the human interferon alpha-2 b (fusion gene of IFN α-2b), and obtain to efficiently express in intestinal bacteria.Its preparation method is 13 the amino acid whose cyclic peptide NGR of CD13 bonded that select for use energy specificity and endothelial cells in tumor neogenetic blood vessels to express, and the method for applying gene reorganization merges itself and IFN α-2b carboxyl terminal, and obtains to efficiently express in intestinal bacteria.

The present invention with reference to the purification process of IFN α-2b, has set up purifying process with low cost on the basis that successfully makes up and express fusion gene.In activity test in vitro, this fusion rotein IFN α-2b-NGR can obviously suppress the propagation of virus, and specific activity reaches 5.8 * 10 ⁸IU/mg.

Description of drawings

Fig. 1 is the complete sequence determination figure of middle IFN α of the present invention-2b-NGR fusion gene;

Fig. 2 is the electrophorogram of the purge process of IFN α-2b-NGR fusion rotein among the present invention.M wherein: harmonic component protein standard; 1: inductive thalline not; 2: the inductive thalline; 3: the supernatant of inclusion body after washing; 4: the precipitation of inclusion body after washing; 5: the albumen of purifying (reductibility SDS-PAGE); 6: the albumen of purifying (irreducibility SDS-PAGE).

Fig. 3 inserts the correct IFN α-2b-NGR fusion gene pronucleus expression vector of clip size;

Fig. 4 is that the determination of activity and the SDS-PAGE of recombinant protein detects.

The present invention is described in further detail below in conjunction with drawings and Examples.

Embodiment

Prepare aforesaid tumour new-born blood vessel-specific bonding polypeptide NGR and human interferon alpha-2 b (method of the fusion rotein of IFN α-2b), preparation according to the following steps:

1) clone of IFN α-2b-NGR fusion gene

Human leukocyte cDNA library is available from Clontech company; At first design a pair of primer 5 ' end and the 3 ' restriction enzyme site of holding are sported NdeI and BamHI respectively;

Primer 1 (26nt): 5 '-CGC ATA TGT GTG ATC TGC CTC AAA CC-3 '

Primer 2 (58nt): 5 '-CGG GAT CCT TCC TTA CTT CTT AAA CTT TCT TGCAAG TTT GTT GAC AAA GAA AAA GAT C-3 '

The dialogue cell cdna library carries out pcr amplification;

Consisting of of pcr amplification reaction pipe:

200ng/ml?cDNA 0.5μl

2.5mM?dNTPs 1μl

25mM?MgCl ₂ 4μl

20μM?P1 0.5μl

20μM?P2 0.5μl

5.0U/ul Taq enzyme 0.5 μ l

10×PCR?Buffer 5μl

H ₂O 38μl

Amount to 50 μ l.

The preparation of pcr amplification reaction pipe is all carried out in ice bath, in the process for preparation, and Xian Jiashui, template cDNA and other reactive components, 95 ℃ of reaction 5min add the Taq enzyme again, carry out the PCR reaction then, and the loop parameter of pcr amplification is: 94 ℃, the 60s reaction of degeneration; 55 ℃, the 60s annealing reaction; 72 ℃, the 60s amplified reaction carries out 30 circulations, extends 10min in 72 ℃;

After the PCR product is used NdeI and BamHI double digestion, separate (Fig. 2), reclaim the purpose fragment, called after mutant IFN α-2b through 1.5% agarose gel electrophoresis;

Habitually practise the nucleic acid fragment that codon has designed and synthesized coding NGR targeted peptide according to intestinal bacteria, can form the sticky end (restriction enzyme site of BamHI and SalI) that contains 13 amino acid whose targeted peptide fragments and 5 ' end and 3 ' end after these two fragments annealing;

Fragment 1 (46nt): 5 '-GAT CCT GCAACG GTC GTT GCG TGA GCG GTT GCGCGG GTC GTT GCT G-3 '

Fragment 2 (46nt): 5 '-TCG ACC TAG CAA CGA CCC GCG CAA CCG CTC ACGCAA CGA CCG TTG CAG-3 '

With two fragments of synthetic in boiling sex change 5min, annealing then, be connected with mutant IFN α-2b and with pET-22b (+) plasmid that NdeI and SalI handled again, connect product transformed competence colibacillus cell DH5 α, picking positive colony, overnight incubation in the LB nutrient solution, extract plasmid DNA, cut evaluation through enzyme, obtain to insert the correct IFN α-2b-NGR fusion gene pronucleus expression vector (Fig. 3) of clip size, carry out dna sequence analysis (Fig. 1).Correct person's called after pET-22b (+)-IFN α-2b-NGR checks order.The gene that wherein contains codes for tumor new-born blood vessel-specific bonding polypeptide NGR and IFN α-2b fusion rotein;

3) abduction delivering of recombinant protein

Plasmid pET-22b (+)-IFN α-2b-NGR transformed competence colibacillus cell BL21 (DE3) that order-checking is correct, random choose mono-clonal bacterium, 30 ℃ of activation jolting overnight incubation in the LB nutrient solution, morning next day, 37 ℃ were continued to be cultured to OD with 1: 100 ratio inoculation LB (containing Amp 100 μ g/ml) substratum _600nm=0.6 o'clock, adding final concentration was the IPTG of 0.1mM, continued to cultivate 4 hours, and the centrifugal 15min of 3000rpm collects thalline, and row SDS-PAGE and Western Blot use thin layer scanning to measure the expression amount of target protein to SDS-PAGE result.

Above-mentioned engineering bacteria e. coli bl21 (DE3) cell, genotype is F-ompT hsdS _B(r _B ^-m _B ^-) galdcm (DE3), wherein contain Prokaryotic Expression carrier pET-22b (+)-IFN α-2b-NGR of codes for tumor new-born blood vessel-specific bonding polypeptide NGR and human interferon-alpha-2 b fusion rotein.

4) purifying of recombinant protein

By 1 gram thalline add 5ml the STE damping fluid (100mM NaCl, 50mM Tris, pH8.0, ratio 1mMEDTA) is resuspended with thalline, adds N,O-Diacetylmuramidase 0.5mg/g and DOC 5ug/g then, stirring at room 30min; Add DNase 20ug/g again, leave standstill 20min after, 4 ℃ of centrifugal 15min, 12,000rpm abandons supernatant liquor, collecting precipitation; With washings (3M Urea, 2%TritonX-100, after the STE) washing precipitation (adding the 20ml washings) by 1 gram thalline, 4 ℃ of centrifugal 15min, 12,000rpm abandons supernatant liquor, regathers precipitation; To be deposited in thoroughly dissolving in the damping fluid (6.5M Guanidinium hydrochloride, 1% β mercaptoethanol, 25mM Tris); To PBS (pH 7.2) dialysis 24h, 4 ℃ of centrifugal 10min, 12,000rpm, the supernatant of collecting fully equilibrated affinity chromatography column chromatography purification of PBS (pH 7.2), elutriant is 0.1M glycine (pH2.5), 5 column volumes of continuous gradient wash-out, collect elutriant, carry out determination of activity and SDS-PAGE and detect (Fig. 4).

5) extracorporeal biology of recombinant protein is active detects

WISH cell is at the 10%FSC that contains microbiotic and glutamine, 37 ℃ of cultivations in Eagle ' the s nutrient solution of pH7.4.After treating that cell is monolayer growth, had digestive transfer culture continues to cultivate.With the WISH cell of digestion, be inoculated in 96 orifice plates by 1,000 cells/well.37 ℃ of incubator overnight incubation.Change to protein sample with the different concns of Eagle ' the s liquid dilution that contains 5%FCS; continue to cultivate; inferior daily Eagle ' the s nutrient solution that contains 2%FCS presses 1: the VSV virus-culturing fluid of 10-30 dilution; change to Tissue Culture Plate; cultivate 24h for 37 ℃; observations is that IFN α-2b-NGR tires with the IFN α-2b-NGR extent of dilution of 50% cytoprotective.

The present invention the experiment proved that its beneficial effect is as follows:

1) utilize PCR the method success transformation the 5 ' end and 3 ' of IFN α-2b hold restriction enzyme site, and the oligonucleotide fragment of the coding NGR of synthetic is connected with the 3 ' end of IFN α-2b, made up prokaryotic expression carrier pET-22b (+)-IFN α-2b-NGR of IFN α-2b fusion gene, determined dna sequence confirms entirely true.

2) after IPTG induces, IFN α-2b-NGR albumen obtains to efficiently express in intestinal bacteria.Confirm that through immunoblotting this fusion rotein all can specificity combine with anti-IFN alpha monoclonal antibodies and anti-NGR monoclonal antibody.

3) purifying IFN α-2b-NGR fusion rotein, SDS-PAGE detected through gel electrophoresis purity is greater than 95%.

4) the external activity experiment shows that IFN α-2b-NGR fusion rotein has tangible antiviral multiplication capacity, and specific activity reaches 5.8 * 10 ⁸IU/mg.

The complete sequence of IFN α-2b-NGR fusion gene

ATGTGTGATCTGCCTCAAACCCACAGCCTGGGTAGCAGGAGGACCTTGAT

GCTCCTGGCACAGATGCGCAGAATCTCTCTTTTCTCCTGCTTGAAGGACA

GACATGACTTTGGATTTCCCCAGGAGGAGTTTGGCAACCAGTTCCAAAAG

GCTGAAACCATCCCTGTCCTCCATGAGATGATCCAGCAGATCTTCAATCT

CTTCAGCACAAAGGACTCATCTGCTGCTTGGGATGAGACCCTCCTAGACA

AATTCTACACTGAACTCTACCAGCAGCTGAATGACCTGGAAGCCTGTGTG

ATACAGGGGGTGGGGGTGACAGAGACTCCCCTGATGAAGGAGGACTCCA

TTCTGGCTGTGAGGAAATACTTCCAAAGAATCACTCTCTATCTGAAAGAG

AAGAAATACAGCCCTTGTGCCTGGGAGGTTGTCAGAGCAGAAATCATGA

GATCTTTTTCTTTGTCAACAAACTTGCAAGAAAGTTTAAGAAGTAAGGAA

GGATCCTGCAACGGTCGTTGCGTGAGCGGTTGCGCGGGTCGTTGCTAGTC

TAGAGTCGACCTGCAGGCATGCAAGCTTGAGTATTCTATAGTGTCACCTA

AATAAGCTTGGCGTAATCATGGGCATAGCTGTTTCCTGTGTGAAAATGGT

AT

Claims (2)

1. the preparation method of tumour new-born blood vessel-specific bonding polypeptide NGR and human interferon alpha-2 b fusion rotein is characterized in that, according to the following steps preparation:

1) clone of codes for tumor new-born blood vessel-specific bonding polypeptide NGR and IFN α-2b antigen-4 fusion protein gene:

Select human leukocyte cDNA library, at first design a pair of primer 5 ' end and the 3 ' restriction enzyme site of holding are sported NdeI and BamHI respectively;

Primer P1:5 '-CGC ATA TGT GTG ATC TGC CTC AAA CC-3 ';

Primer P2:5 '-CGG GAT CCT TCC TTA CTT CTTAAA CTT TCT TGC AAGTTT GTT GAC AAA GAAAAA GAT C-3 ';

2) pcr amplification is carried out in human leukocyte cDNA library:

The preparation of pcr amplification reaction pipe is all carried out in ice bath, the consisting of of described pcr amplification reaction pipe:

200ng/ml?cDNA 0.5μl

2.5mM?dNTPs 1μl

25mM?MgCl ₂ 4μl

20μM?P1 0.5μl

20μM?P2 0.5μl

5.0U/ul Taq enzyme 0.5 μ l

10×PCR?Buffer 5μl

H ₂O 38μl

Amount to 50 μ l;

Laggard performing PCR reaction is finished in preparation, and the loop parameter of pcr amplification is: 94 ℃, and the 60s reaction of degeneration; 55 ℃, the 60s annealing reaction; 72 ℃, the 60s amplified reaction; Carry out 30 circulations, extend 10min in 72 ℃;

After the PCR product is used NdeI and BamHI double digestion, separate, reclaim the purpose fragment, called after mutant IFN α-2b through 1.5% agarose gel electrophoresis;

Habitually practise the nucleic acid fragment that codon has designed and synthesized coding NGR targeted peptide according to intestinal bacteria, can form the sticky end that contains 13 amino acid whose targeted peptide fragments and 5 ' end and 3 ' end after these two fragments annealing is the point of contact of BamHI and SalI;

Fragment 1:5 '-GAT CCT GCA ACG GTC GTT GCG TGA GCG GTT GCGCGG GTC GTT GCT G-3 ';

Fragment 2:5 '-TCG ACC TAG CAA CGA CCC GCG CAA CCG CTC ACGCAA CGA CCG TTG CAG-3 ';

Two fragments of synthetic are boiled sex change 5min, annealing then, be connected with mutant IFN α-2b and with pET-22b (+) plasmid that NdeI and SalI handled again, connect product transformed competence colibacillus e.colidh5, the picking positive colony, overnight incubation in the LB nutrient solution, extract plasmid DNA, cut evaluation through enzyme, obtain to insert the correct IFN α-2b-NGR fusion gene pronucleus expression vector of clip size, carry out dna sequence analysis, the correct person's called after pET-22b (+) that checks order-IFN α-2b-NGR wherein contains the gene of codes for tumor new-born blood vessel-specific bonding polypeptide NGR and IFN α-2b fusion rotein;

3) abduction delivering of recombinant protein:

Plasmid pET-22b (+)-IFN α-2b-NGR transformed competence colibacillus e. coli bl21 (DE3) cell that order-checking is correct, picking mono-clonal bacterium, 30 ℃ of activation jolting overnight incubation in LB, morning next day was with 1: 100 ratio inoculation LB substratum, wherein contain Amp 100 μ g/ml, 37 ℃ are continued to be cultured to OD _650nm=0.6 o'clock, adding final concentration was the IPTG of 0.1mM, continued to cultivate 4 hours, and the centrifugal 15min of 3000rpm collects thalline, carries out SDS-PAGE and Western Blot, used thin layer scanning to measure the expression amount of target protein to SDS-PAGE result;

4) purifying of recombinant protein:

By the STE damping fluid of 1 gram thalline adding 5ml, its prescription is 100mM NaCl, 50mM Tris, and pH8.0,1mM EDTA, thalline is resuspended, add then and melt bacterium enzyme 0.5mg/g and DOC 5ug/g, stirring at room 30min; Add DNase 20 μ g/g again, leave standstill 20min after, 4 ℃ of centrifugal 15min, 12,000rpm abandons supernatant liquor, collecting precipitation; With washings 3M Urea, 2%TritonX-100, after the STE washing precipitation, add the 20ml washings by 1 gram thalline, 4 ℃ of centrifugal 15min, 12,000rpm abandons supernatant liquor, regathers precipitation; To be deposited in thoroughly dissolving in the damping fluid, the prescription of damping fluid is the 6.5M Guanidinium hydrochloride, 1% β mercaptoethanol, 25mM Tris; To PBS dialysis 24h, the pH of its PBS is 7.2,4 ℃ of centrifugal 10min, 12,000rpm, the supernatant of collecting is with the abundant equilibrated affinity chromatography of PBS column chromatography purification, elutriant is the 0.1M glycine, and its pH is 2.5,5 column volumes of continuous gradient wash-out, collect elutriant, carry out determination of activity and SDS-PAGE and detect;

5) extracorporeal biology of recombinant protein is active detects:

WISH cell is at the 10%FSC that contains microbiotic and glutamine, 37 ℃ of cultivations in Eagle ' the s nutrient solution of pH7.4, treat that cell is monolayer growth after, had digestive transfer culture continues to cultivate; WISH cell with digestion; by 1; 000 cells/well is inoculated in 96 orifice plates, 37 ℃ of incubator overnight incubation, and the IFN that changes to the different concns that dilutes with Eagle ' the s liquid that contains 5%FCS splits the bacterium supernatant; continue to cultivate; the inferior daily VSV virus-culturing fluid that contains Eagle ' the s nutrient solution of 2%FCS by dilution in 1: 10～1: 30 changes to Tissue Culture Plate, cultivates 24h for 37 ℃; observations is that IFN tires with the IFN extent of dilution of 50% cytoprotective.

2. the method for claim 1 is characterized in that, the genotype of described e. coli bl21 (DE3) cell is F ^-OmpT hsdS _B(r _B ^-m _B ^-) gal dcm (DE3).

Images