CN100395342C - Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine - Google Patents
Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine Download PDFInfo
- Publication number
- CN100395342C CN100395342C CNB2006100280224A CN200610028022A CN100395342C CN 100395342 C CN100395342 C CN 100395342C CN B2006100280224 A CNB2006100280224 A CN B2006100280224A CN 200610028022 A CN200610028022 A CN 200610028022A CN 100395342 C CN100395342 C CN 100395342C
- Authority
- CN
- China
- Prior art keywords
- tuberculosis
- ag85b
- gene
- vaccine
- bcg
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
The present invention relates to the field of genetic engineering and the field of tuberculosis vaccines. In the recent ten years, because of the increase of tuberculosis persisters and the coinfection of tuberculosis mycobacteria and HIV, the tuberculosis morbidity is increased, and the tuberculosis becomes a second big killer after HIV. At present, the unique tuberculosis vaccine widely used in the world is BCG. The most significant protective antigen genes of the tuberculosis mycobacteria and the deficiency genes of the tuberculosis mycobacteria in BCG are inserted into escherichia coli, and recombinant plasmids are formed at the polycloning sites of shuttle plasmids of the tuberculosis mycobacteria to be converted into BCG to form the recombinant tuberculosis vaccine. Experimental result indicates that compared with the BCG vaccine, the protective antigens are expressed with high efficiency, the original deficiency Rv3425 antigens are expressed, and the IFN-gamma expression of induced spleen cells of mice is obviously increased, which indicates that the recombinant tuberculosis vaccine of the present invention can induce the cell immunity level which is higher than BCG.
Description
Technical field
The present invention relates to genetically engineered field and new generation vaccine development field, specifically, the invention provides a kind of recombinant Ag 85 B-Rv 3425 bacillus Calmette-Guerin vaccine of novel improved.
Background technology
In recent ten years since the tuberculosis Resistant strain increase coinfection with mycobacterium tuberculosis and HIV, incidence of tuberculosis increases, and becomes the second largest killer of the mankind after HIV.The widely used unique tuberculosis vaccine in the whole world is BCG at present.Yet the protection difference on effect of BCG in different areas very big (0-80%).Although it can effectively prevent the serious pulmonary tuberculosis of children, adult tuberculosis is not almost protected effect.Therefore develop novel and effective Vaccinum Calmette-Guerini is very urgent, infection has very significant meaning for control tuberculosis for this.To studies show that of tuberculosis subunit vaccine, their protection effect does not surpass BCG.Therefore BCG remains the present first-selected vaccine of using.
Summary of the invention
An object of the present invention is to provide a kind of Vaccinum Calmette-Guerini plasmid of novel improved, can be used for efficiently expressing Ag85B and Rv3425 albumen.
Another object of the present invention provides a kind of recombinant bacillus Calmette-Guerin vaccine of novel improved.
A further object of the present invention provides a kind of preparation method of above-mentioned recombinant bacillus Calmette-Guerin vaccine.
One aspect of the present invention provides a kind of new Vaccinum Calmette-Guerini plasmid, is about to Ag85B and Rv3425 gene order and inserts in intestinal bacteria-mycobacterium tuberculosis shuttle plasmid sequence.Ag85B gene accession number BX842578.1; Albumen accession number: CAB10044.1; The Rv3425 gene number of landing BX842583.1; The albumen number of landing: CAE55596.1.
" Ag85B and Rv3425 gene order " of the present invention also comprises one or more codons among BX842578.1 or the BX842583.1 is encoded that the degenerate codon of same amino acid replaces the back and the sequence that produces.Because the degeneracy of codon, so be low to moderate about 70% the degenerate sequence identical sequence of also encoding out with BX842578.1z or BX842583.1 nucleotide sequence homology.This term also comprises can be under the moderate stringent condition, more preferably under the height stringent condition, with the nucleotide sequence of the nucleotide sequence hybridization of BX842578.1 or BX842583.1.Also term also comprises the homology of nucleotide sequence at least 70% with BX842578.1 or BX842583.1, preferably at least 80%, and at least 90% nucleotide sequence more preferably.
In the above-mentioned recombinant plasmid,, be beneficial to insert the stably express of gene usually with the multiple clone site place of Ag85B and Rv3425 gene insertion intestinal bacteria-mycobacterium tuberculosis shuttle plasmid.
In the recombinant plasmid preparation process of the present invention, can select various carrier known in the art for use, as commercially available carrier, the nucleotide sequence of the present invention of will encoding then operationally is connected in expression regulation sequence, can form protein expression vector.
Among the present invention, adoptable intestinal bacteria-mycobacterium tuberculosis shuttle plasmid has pMV261, pMV361 or E.coli-Mycobacterium shuttle plasmid pBCG-2000 etc.In one embodiment of the invention, used intestinal bacteria-mycobacterium tuberculosis shuttle plasmid is pMV261.
Another aspect of the present invention provides a kind of recombinant Ag 85 B-Rv 3425 bacillus Calmette-Guerin vaccine, is about to above-mentioned recombinant Ag 85 B and Rv3425 plasmid and is transformed into and forms recombinant Ag 85 B-Rv 3425 bacillus Calmette-Guerin vaccine: rBCG::Ag85B-Rv3425 among the BCG.Available BCG has: BCG-Danish (Denmark's strain), BCG-Pasteur (pasteur strain), BCG-Tokyo (Tokyo strain) etc.What use in one embodiment of the present of invention is BCG-Danish (Denmark's strain).
Another aspect of the present invention provides a kind of preparation method of recombinant Ag 85 B-Rv 3425 bacillus Calmette-Guerin vaccine, may further comprise the steps:
(1) preparation of mycobacterium tuberculosis strain gene group DNA;
(2) amplification of Ag85B gene;
(3) amplification of Rv3425 gene;
(4) Ag85B and Rv3425 gene insert intestinal bacteria-mycobacterium tuberculosis shuttle vector;
(5) recon with (4) gained is transformed into bacille Calmette-Guerin vaccine.
The bacille Calmette-Guerin vaccine that uses among the present invention can be commercially available or the homemade bacille Calmette-Guerin vaccine in laboratory.The bacille Calmette-Guerin vaccine that uses among the present invention can be BCG-Danish (bacille Calmette-Guerin vaccine-Denmark's strain).The bacille Calmette-Guerin vaccine that uses among the present invention also can be BCG-Pasteur (bacille Calmette-Guerin vaccine-pasteur strain).The bacille Calmette-Guerin vaccine that uses among the present invention can also be BCG-Tokyo (bacille Calmette-Guerin vaccine-Tokyo strain) etc.
The intestinal bacteria of using among the present invention-mycobacterium tuberculosis shuttle plasmid can be pMV261 or pMV361.
Various experiment parameters are operation selection routinely all, is decided by concrete experiment condition.
Obtaining gene order can obtain with the method for pcr amplification method, recombination method or synthetic usually.For the pcr amplification method, can be disclosed according to the present invention about nucleotide sequence, especially open reading frame sequence designs primer, and with commercially available cDNA storehouse or by the prepared cDNA storehouse of ordinary method well known by persons skilled in the art as template, amplification and must relevant sequence.
Usually there are two kinds of methods to obtain recombinant plasmid of the present invention, first is exactly through after the pcr amplification, two genes are cloned among the pET28a after cutting with corresponding enzyme respectively, show the full genome corresponding gene sequences of H37Rv tuberculosis among insertion sequence and the Gene Bank with general plasmid order-checking then, then with BalI and Hind III double digestion plasmid, obtain the Ag85B-Rv3425 segment and then be cloned among the shuttle plasmid pMV261.Second is exactly through after the pcr amplification, be cloned among the shuttle plasmid pMV261 after directly two genes being cut with enzyme, and then order-checking shows the full genome corresponding gene sequences of H37Rv tuberculosis among insertion sequence and the Gene Bank.
In one embodiment of the invention, be to separate as follows to obtain: design primer Ag85B (P
On: 5 ' TAGGCCAATGACAGACGTGAGCCGAAAG; P
Down: 5 ' ACGAATTCTCAGCCGGCGCCTAACGAACT); Rv3425 (P
On: 5 ' CGAATTCATGCATCCAATGATACCAGC; P
Down: 5 ' ATTAAGCTTCTACCCGCCCCTGTAGATCT).DNA is a template with H37Rv pnca gene group, pcr amplification Ag85B gene and Rv3425 gene.Cut with Bal I and EcoR I enzyme the purified back of the PCR reaction product of Ag85B gene, and the clone is built in intestinal bacteria-mycobacterium tuberculosis shuttle plasmid pMV261Bal I and the EcoR I restriction enzyme site; Cut with EcoR I and HindIII enzyme the purified back of the PCR reaction product of Rv3425 gene, and the clone is built in intestinal bacteria-mycobacterium tuberculosis shuttle plasmid pMV261 EcoR I and the Hind III restriction enzyme site.Order-checking shows the full genome corresponding gene sequences of H37Rv tuberculosis (Ag85B gene accession number BX842578.1 among institute's insertion sequence and the Gene Bank; Albumen accession number: CAB10044.1; The Rv3425 gene number of landing BX842583.1; The albumen number of landing: CAE55596.1) in full accord.
Ag85B of the present invention also can be inserted between restriction enzyme site Bal I and the BamH I, and the Rv3425 gene is inserted between restriction enzyme site BamH I and the Hind III.Change design primer Ag85B (Bal I and the BamH I restriction enzyme site) P of corresponding design primer
On: 5 ' GATGGCCAATGACAGACGTGAGCCGAAAG; P
Down: 5 ' ACGGATCCTCAGCCGGCGCCTAACGAACT; Rv3425 (BamH I and Hind III restriction enzyme site) P
On: 5 ' ACGGGATCCATGCATCCAATGATACCA; P
Down: 5 ' ATAAGCTTCTACCCGCCCCTGTAGATCTG.
In case obtained relevant sequence, just can obtain Ag85B and Rv3425 gene order in large quantity with recombination method.This normally is cloned into carrier with it, changes cell again over to, separates obtaining relevant sequence then from the host cell after the propagation by ordinary method.For example, the good recombinant shuttle plasmid of checking is transformed in the bacillus coli DH 5 alpha, overnight incubation is a large amount of good shuttle plasmid pMV261-Ag85B-Rv3425 of reorganization of method acquisition by the extracting plasmid DNA then, and then forwards among the BCG by electricity and to go.
After having obtained the Ag85B and Rv3425 gene order of capacity, just can carry out the preparation of bacille Calmette-Guerin vaccine competent cell and transform.Method is as follows: after the bacille Calmette-Guerin vaccine recovery, be seeded to substratum, for example 7H9 or Sauton substratum, the middle cultivation for 2 weeks at logarithmic phase, adds 20% glycine to final concentration 4%, continue to cultivate 24 hours, granulated glass sphere is smashed mycoderm, shakes ice bath 3 hours, 4 ℃ of centrifugal collection bacteriums of 6000rpm, with the 10% glycerine washing of precooling, be resuspended in 10% glycerine of precooling, the bacterium liquid that takes a morsel adds plasmid, ice bath, change over to and carry out electricity in the electroporation cup of precooling and transform, behind the discharge off, ice bath 10min, add isopyknic 2 * 7H9 substratum, 37 ℃ of overnight incubation are got bacterium liquid separate application on the 7H10 flat board that contains kantlex 15 μ g/ml and 20 μ g/ml after centrifugal, and 37 ℃ leave standstill cultivation.Screening positive clone.Continue to cultivate this positive colony, Westernblot analyzes Ag85B and expresses, and the result shows really gene A g85B and Rv3425 are recombinated in the bacille Calmette-Guerin vaccine vaccine, and obtained expressing efficiently.
Detected result shows, utilizes this method Ag85B and Rv3425 gene successfully can be cloned into intestinal bacteria-mycobacterium tuberculosis shuttle vector, and conversion obtains in the bacille Calmette-Guerin vaccine.Experimentation on animals shows that recombinant Ag 85 B-Rv 3425 bacillus Calmette-Guerin vaccine of the present invention can cause the cell immune response strong than BCG.
BCG is good cellular immunization and humoral immunization adjuvant; utilize BCG as live vector; the antigen of mycobacterium tuberculosis gene that some are lacked among the important or BCG imports BCG, allows BCG great expression protective antigen, is expected to the powerful immune protective efficiency of induction ratio BCG.The Mycobacterium tuberculosis antigen Rv3425 of most important protective antigen Ag85B of mycobacterium tuberculosis and BCG disappearance is selected in this research, and the plasmid that can express these two kinds of genes is transformed among the BCG, has made up recombinant BCG (rBCG::Ag85B-Rv3425).We studies show that, the rBCG::Ag85B-Rv3425 bacterial strain can efficiently express Ag85B and Rv3425 albumen, with this bacterial strain immune mouse, can cause the strong cell immune response than BCG.
Description of drawings
Fig. 1 detects Rv3425 gene amplification figure among the rBCG::Ag85B-Rv3425 for PCR.Wherein, M is a molecular weight standard; 1 is mycobacterium tuberculosis Rv3425 gene amplification result; 2 is the Rv3425 gene amplification result of rBCG::Ag85B-Rv3425.
Ag85B expresses figure to Fig. 2 in the rBCG::Ag85B-Rv3425 cell pyrolysis liquid for Western-blot detects.Wherein, M is a molecular weight standard; 1 is the Ag85B albumen Western-blot detected result of rBCG::Ag85B-Rv3425.
Fig. 3 is splenocyte secretion of gamma-IFN Function detection figure.PPD (purified protein derivative of tuberculin) irritating concentration is 10ug/ml; Ag85B and Rv3425 antigenic stimulation concentration all are 2/ml.
Embodiment
Design primer Ag85B (P
On: 5 ' GCGAATTCATGACAGACGTGAGCCGAAAGATTC; P
Down: 5 ' TGTCGACCTAGCCGGCGCCTAACGAACTCTGG); Rv3425 (P
On: 5 ' CGAATTCATGCATCCAATGATACCAGC; P
Down: 5 ' ATTAAGCTTCTACCCGCCCCTGTAGATCT).DNA is a template with H37Rv pnca gene group, pcr amplification Ag85B gene.The PCR reaction conditions is as follows: 98 ℃ of pre-sex change 5 minutes; 98 ℃ of sex change 45 seconds, 62 ℃ of renaturation 45 seconds, 72 ℃ were extended 30 circulations 2 minutes and 30 seconds; 72 ℃ were extended 12 minutes.DNA is a template with H37Rv pnca gene group, pcr amplification Rv3425 gene.The PCR reaction conditions is as follows: 98 ℃ of pre-sex change 5 minutes; 98 ℃ of sex change 45 seconds, 60 ℃ of renaturation 60 seconds, 72 ℃ were extended 30 circulations 1 fen; 72 ℃ were extended 10 minutes.Cut with Bal I and EcoRI enzyme the purified back of the PCR reaction product of Ag85B gene, and the clone is built in intestinal bacteria-mycobacterium tuberculosis shuttle plasmid pMV261Bal I and the EcoR I restriction enzyme site; Cut with EcoR I and Hind III enzyme the purified back of the PCR reaction product of Rv3425 gene, and the clone is built in intestinal bacteria-mycobacterium tuberculosis shuttle plasmid pMV261 EcoR I and the Hind III restriction enzyme site.Order-checking shows the full genome corresponding gene sequences of H37Rv tuberculosis (Ag85B gene accession number BX842578.1 among institute's insertion sequence and the GeneBank; Albumen accession number: CAB10044.1; The Rv3425 gene number of landing BX842583.1; The albumen number of landing: CAE55596.1) in full accord.
Preparation of bacille Calmette-Guerin vaccine competent cell and conversion, method is as follows: after the bacille Calmette-Guerin vaccine recovery, be seeded in the 400ml 7H9 substratum and cultivated 10-14 days, at logarithmic phase, add 20% glycine 100ml to final concentration 4%, continue to cultivate 24 hours, granulated glass sphere is smashed mycoderm, shakes 3 hours, ice bath 1 hour, 4 ℃ of centrifugal 10 minutes collection bacteriums of 6000rpm use 10% glycerine of precooling to wash 4 times, are resuspended in 10% glycerine 3ml of precooling, get 200 μ l bacterium liquid and add the 50-500ng plasmid, ice bath 30min changes in the 2mm electroporation cup of precooling, at 1.25kv/cm, 25 μ F, carry out electricity under 720 ohm and transform, behind the discharge off, ice bath 10min, add isopyknic 2 * 7H9 substratum, 37 ℃ of overnight incubation are got bacterium liquid 125 μ l separate application on the 7H10 flat board that contains kantlex 15 μ g/ml and 20 μ g/ml after centrifugal, and 37 ℃ leave standstill cultivation.Screening positive clone.Continue to cultivate this positive colony, Western blot analyzes Ag85B and expresses, and the result shows really gene A g85B and Rv3425 are recombinated in the bacille Calmette-Guerin vaccine vaccine, and obtained expressing efficiently.(Fig. 1)
With rBCG::Ag85B-Rv3425 vaccine immunization C57BL/c mouse, use bacille Calmette-Guerin vaccine (BCG) simultaneously as contrast.4 week of immunity back application ELISpot technology for detection splenocyte is subjected to PPD, and Ag85B albumen and Rv3425 albumen stimulate the expression of back IFN-γ.Concrete steps are: the PVDF plate is spent the night with IFN-gamma antibodies bag in advance, and 37 ℃ of blocking reagent sealings are 1 hour in the test kit.Aseptic excision mouse spleen grinds after 200 eye mesh screens filter, through the lymphocyte separation medium isolated lymphocytes.Add the suitable number lymphocyte and go in the 96 hole PVDF plates, give PPD, Ag85B and Rv3425 albumen stimulate.After hatching 48 hours jointly, add reagent such as detecting antibody successively, wash plate, colour developing, read the spot number by the ELISpot operation instructions.The result shows: the rBCG::Ag85B-Rv3425 vaccine is compared with the BCG group, and the inductive splenocyte IFN-γ of institute expression (Fig. 3) has significantly increases.This explanation rBCG::Ag85B-Rv3425 can induce the cellular immune level high than BCG.
Claims (10)
1. a recombinant plasmid is characterized in that, Ag85B gene and Rv3425 gene order are inserted in intestinal bacteria-mycobacterium tuberculosis shuttle plasmid sequence.
2. recombinant plasmid according to claim 1 is characterized in that, the multiple clone site place that Ag85B and Rv3425 gene are inserted intestinal bacteria-mycobacterium tuberculosis shuttle plasmid.
3. recombinant plasmid according to claim 1 is characterized in that intestinal bacteria-mycobacterium tuberculosis shuttle plasmid is pMV261.
4. recombinant plasmid according to claim 1 is characterized in that intestinal bacteria-mycobacterium tuberculosis shuttle plasmid is pMV361.
5. the recombiant vaccine of a tubercule bacillus is characterized in that, recombinant plasmid transformed is gone into bacille Calmette-Guerin vaccine according to claim 1, thereby obtains the rBCG::Ag85B-Rv3425 recombiant vaccine.
6. the preparation method of a recombinant Ag 85 B-Rv 3425 bacillus Calmette-Guerin vaccine is characterized in that, this method may further comprise the steps:
(1) preparation of mycobacterium tuberculosis strain gene group DNA;
(2) amplification of Ag85B gene;
(3) amplification of Rv3425 gene;
(4) Ag85B and Rv3425 gene insert intestinal bacteria-mycobacterium tuberculosis shuttle vector;
(5) intestinal bacteria that contain Ag85B and the Rv3425 gene-mycobacterium tuberculosis shuttle plasmid recombinant vectors with (4) gained is transformed into bacille Calmette-Guerin vaccine.
7. a preparation method as claimed in claim 6 is characterized in that, the bacille Calmette-Guerin vaccine that uses in this method is bacille Calmette-Guerin vaccine-Denmark's strain.
8. a preparation method as claimed in claim 6 is characterized in that, the bacille Calmette-Guerin vaccine that uses in this method is bacille Calmette-Guerin vaccine-pasteur strain.
9. a preparation method as claimed in claim 6 is characterized in that, the bacille Calmette-Guerin vaccine that uses in this method is bacille Calmette-Guerin vaccine-Tokyo strain.
10. preparation method as claimed in claim 6 is characterized in that, used intestinal bacteria-mycobacterium tuberculosis shuttle plasmid is pMV261 or pMV361.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100280224A CN100395342C (en) | 2006-06-22 | 2006-06-22 | Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100280224A CN100395342C (en) | 2006-06-22 | 2006-06-22 | Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1884552A CN1884552A (en) | 2006-12-27 |
| CN100395342C true CN100395342C (en) | 2008-06-18 |
Family
ID=37582857
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100280224A Expired - Fee Related CN100395342C (en) | 2006-06-22 | 2006-06-22 | Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100395342C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN103589676B (en) * | 2013-11-14 | 2015-07-29 | 复旦大学 | A kind of recombinant bacillus Calmette-Guerin vaccine rBCG::Rv3425 |
| CN111471632B (en) * | 2020-02-28 | 2022-03-08 | 中国科学院广州生物医药与健康研究院 | Construction method and application of recombinant drug-resistant BCG strain |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005021790A2 (en) * | 2003-08-29 | 2005-03-10 | Consiglio Nazionale Delle Ricerche | Use of gene sequences specific for mycobacterium tuberculosis and their related proteins for diagnosis and prevention of tubercular infection |
-
2006
- 2006-06-22 CN CNB2006100280224A patent/CN100395342C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005021790A2 (en) * | 2003-08-29 | 2005-03-10 | Consiglio Nazionale Delle Ricerche | Use of gene sequences specific for mycobacterium tuberculosis and their related proteins for diagnosis and prevention of tubercular infection |
Non-Patent Citations (4)
| Title |
|---|
| Recombinant and synthetic peptides to identifyMycobacterium tuberculosis antigens and epitopes ofdiagnostic and vaccine relevance. Abu Salim Mustafa.Tuberculosis,Vol.85 . 2005 |
| Recombinant and synthetic peptides to identifyMycobacterium tuberculosis antigens and epitopes ofdiagnostic and vaccine relevance. Abu Salim Mustafa.Tuberculosis,Vol.85 . 2005 * |
| 钩端螺旋体外膜蛋白基因重组载体构建及在卡介菌中的表达. 邱洪宇等.中国生物制品学杂志，第13卷第3期. 2000 |
| 钩端螺旋体外膜蛋白基因重组载体构建及在卡介菌中的表达. 邱洪宇等.中国生物制品学杂志，第13卷第3期. 2000 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1884552A (en) | 2006-12-27 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| US7355016B2 (en) | Methods for detection of mycobacteria | |
| JP2001514000A5 (en) | ||
| CN104844712B (en) | Streptococcus pneumoniae protein antigen and its preparation method and application | |
| CN102836425A (en) | A tuberculosis vaccine comprising antigens expressed during a latent infection phase | |
| Paccez et al. | Stable episomal expression system under control of a stress inducible promoter enhances the immunogenicity of Bacillus subtilis as a vector for antigen delivery | |
| WO2021063355A1 (en) | Method for constructing food-grade ethanol-degrading bacillus subtilis recombinant bacteria | |
| CN114085860A (en) | Recombinant lactic acid bacteria for expressing rabies virus g protein, construction method and application | |
| CN101920009B (en) | Vaccine for preventing and curing tumor | |
| CN100395342C (en) | Recombinant Ag85B-Rv3425 bacillus Calmette-Guerin vaccine | |
| CN101880647A (en) | Recombinant salmonella choleraesuis, bivalent genetic engineering vaccine and application | |
| CN100518821C (en) | Mosaic vaccine of Ag85B and ESAT-6 | |
| CN102178950A (en) | Subunit vaccine immunologic adjuvant and application thereof | |
| CN103387604B (en) | CD8+T cell epitope polypeptide of S1 protein of chicken IBV (Infectious Bronchitis Virus) S1 protein | |
| CN100457912C (en) | Recombinant Ag85B bacillus Calmette-Guerin vaccine | |
| CN106117365A (en) | Anti-streptococcus suis is sick and has the active fusion protein of autoimmune and preparation thereof and application | |
| CN101921801A (en) | Recombinant BCG vaccine rBCG::X | |
| CN108359682B (en) | Edwardsiella tarda outer membrane protein PagC with immune protection effect | |
| CN105420174A (en) | Establishment of genetically engineered bacterium expressing recombined VEGF fusion protein | |
| CN103343102B (en) | Streptococcus suis serotype II htpsC gene knockout mutant strain and application thereof | |
| CN100529059C (en) | Oral recombined DNA vaccine for accelerating growth of animal, and application | |
| CN101302524A (en) | Fusion gene of Toxoplasma gondii multi-epitope gene and cholera toxin CTXA2/B subunit and use thereof | |
| CN102614504A (en) | Pseudomonas fluorescens recombinant protein vaccine and preparation method thereof | |
| CN103589676B (en) | A kind of recombinant bacillus Calmette-Guerin vaccine rBCG::Rv3425 | |
| CN112190701A (en) | Recombinant DNA vaccine of mycobacterium tuberculosis and preparation method thereof | |
| CN102174555A (en) | Recombinant expression vector of Hsp65-hIL-2 fusion expression and recombinant strain |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080618 Termination date: 20170622 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |