CN100393884C - Method for predicting chemical therapy effect for acute medullary cell leucosis patient - Google Patents
Method for predicting chemical therapy effect for acute medullary cell leucosis patient Download PDFInfo
- Publication number
- CN100393884C CN100393884C CNB03142239XA CN03142239A CN100393884C CN 100393884 C CN100393884 C CN 100393884C CN B03142239X A CNB03142239X A CN B03142239XA CN 03142239 A CN03142239 A CN 03142239A CN 100393884 C CN100393884 C CN 100393884C
- Authority
- CN
- China
- Prior art keywords
- patient
- gene
- promoter region
- genotype
- dck
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a method for predicting the chemotherapy effect on acute myelocytic leukemia patients before the medication. The present invention has the steps that self normal tissue DNA of a leukemia patient is extracted; the genotype analysis on two polymorphic points in a promoter region of a deoxycytidine kinase (dCK) gene is carried out; when the genotype of the patient is-199CG/-40CT or-199CC/-40CT or-199GG/-40TT, the present invention predicts that the patient has good reactivity on cytarabine; when the genotype of the patient is-199CC/-40CC, the present invention predicts that the patient has poor reactivity on the cytarabine.
Description
Technical field
The present invention relates to a kind of according to the method for the segmental genetype for predicting acute myelocytic leukemia of this human body gene patient to the chemotherapeutics reaction.
Background technology
Clinically, the result of treatment of acute myelocytic leukemia (AML) relies on the bone marrow smear of patient after the chemotherapy usually, peripheral hemogram is judged in conjunction with clinical symptom, sign, under the situation that the laboratory technique condition is supported, also comprehensively the detected result of karyomit(e), fusion gene level provides reference for clinical treatment, the laboratory that has is for the scientific research purpose, even can also carry out the therapeutic drug monitoring of leukemia chemotherapy related drugs.
Bone marrow smear for the acute myelocytic leukemia patient, karyomit(e), the detected result of fusion gene level must be worn the sampling back by regular bone after the chemotherapy and be obtained, when detecting, also increased patient's misery, and owing to have only the acute myelocytic leukemia patient of minority to have distinctive karyomit(e), fusion gene level unusual, as the acute promyelocytic leukemia hypotype in the acute myelocytic leukemia have distinctive No. 15 and No. 17 chromosome translocations and form the PML-RAR fusion gene and part M2b type leukemia with No. 8 and No. 21 chromosome translocations and form the AML1-ETO fusion gene, most acute myelocytic leukemia patient can not utilize this detection to provide foundation for clinical treatment, and testing cost is also expensive.And therapeutic drug monitoring is only carried out with scientific research character in the laboratory that satisfies the requirements owing to present, can not be as a clinical conventional sense.In addition, the deficiency of these prior art most criticals also is and can only monitors after medication, makes the initial therapeutic regimen of clinicist have certain blindness.
Summary of the invention
The object of the present invention is to provide a kind of before medication the chemotherapy effect to the acute myelocytic leukemia patient carry out forecast method, make the clinicist make corresponding chemotherapy regimen, overcome blindly medication and give patient's body and the economic loss that is brought according to different patients' genetics level.
Chemotherapy effect to the acute myelocytic leukemia patient before the medication of the present invention carries out forecast method, comprises the steps:
The DNA of extracting leukaemic self healthy tissues;
Carry out the gene type assay of two polymorphic sites of deoxycytidine kinase gene (dCK) promoter region;
If patient's genotype is-199CG/-40CT ,-199CC/-40CT ,-199GG/-40TT, then can predict this patient reactive good to cytosine arabinoside;
If patient's genotype is-199CC/-40CC to predict that then this patient is poor to the reactivity of cytosine arabinoside.
Advantage of the present invention is to have overcome the deficiency that must judge curative effect after patient's medication, can be before medication the DNA of extracting leukaemic self healthy tissues (as oral mucosa cell of coming off in the collutory etc.) carry out the gene type assay of two polymorphic sites of dCK gene promoter region, to understand the reactivity of patient to cytosine arabinoside, wear and obtain bone marrow prepare and needn't carry out bone, reduced patient's misery, for clinical application provides foundation, reduced blindness, it is less relatively to detect cost.
Description of drawings
Fig. 1 is PCR product electrophoresis result figure.
Fig. 2 is-199CG/-40CT type deoxycytidine kinase Gene Partial promoter region sequence.
The deoxycytidine kinase gene order figure of Fig. 3 for utilizing automatic sequencer (ABI3700) to measure.
To be four routine genotype be-199CC/-40CC to Fig. 4, and four routine genotype are-199CG/-40CT patient's sxemiquantitative RT-PCR result.
Fig. 5 is illustrated in and carries out the uciferase activity result of experiment in the COS-7 cell.
Embodiment
The acute myelocytic leukemia chemotherapy regimen is based on cytosine arabinoside and anthracycline antibiotics drug combination, cytosine arabinoside enters main activity form--the cytosine arabinoside triphosphoric acid that forms medicine under the catalysis of deoxycytidine kinase in back in the body, and the present invention utilizes sequencing technologies to find two and the closely-related mononucleotide polymorphism site of acute myelocytic leukemia patient chemotherapy effect in the molecular biology level.These two mononucleotide polymorphism sites are exactly the promoter region that is positioned at the deoxycytidine kinase gene, gain knowledge according to existing molecular biosciences, and the promoter region of gene is to the expression of gene person of rising keying action.
Following mask body is introduced the extraction and separation method of the DCK gene of the present invention in experiment and the different genes type experimental result to the cytosine arabinoside drug reaction.
The extraction separation of deoxycytidine kinase gene comprises following process:
1, design of primers
That the software that design of primers adopts adopts is the Primer3 of web interface, for the exploitation of the biomedical hoary hair of Massachusetts science and engineering institute (
Http:// www-genome.wi.mit.edu/cgi-bin/primer/primer3www.cgi).Our design of primers mainly is that the promoter region (transcripting start point upstream 1.5-2kb scope) at gene carries out, and primer sequence is as follows:
dCK-P-F：5’ctctcagtgcctgttttccca?3’
DCK-P-R:5 ' ccgctaagccagatcctgac 3 ', the amplification fragment length is 701bp, annealing temperature is 60 ℃.
2, DNA extracting
(1) through the bone marrow prepare 5ml of anticoagulant heparin, separated mononuclearcell with lymphocyte separation medium (Ficoll) same day, after 1 * PBS (phosphate buffered saline(PBS)) washing, adds 5-10ml write cell lysis buffer (general 10-20 * 10
6Individual cell adds the 1ml lysate) and Proteinase K (final concentration is 200ng/ml), jolt with 40 rev/mins of shaking tables under 37 ℃ and spend the night, add isopyknic 1MTris-HCl (a kind of acid-base buffer of having used, pH8.0) balance is to equal-volume phenol-chloroform (1: 1) mixed solution of pH＞7.8, put upside down back and forth several minutes lentamente, 3000rpm is centrifugal 10 minutes under the room temperature, inhale the sub-cloud organic phase, repeat extracting 1-2 time, equal-volume chloroform extracting 1 time adds 2 times of volume dehydrated alcohols and 1/20 volume 3M sodium-chlor (NaCl), gently behind the mixing, shift out the cotton-shaped DNA precipitation of cloud, 70% washing with alcohol 2 times is dried the back naturally and is added an amount of TE (pH8.0) dissolving (37 ℃ of incubators spend the night).After ultraviolet spectrophotometer is surveyed its concentration, get and be diluted to 25ng/ul in right amount.
(2) gather no active hemorrhage patient's collutory sample (suck and tell the centrifuge tube in 50ml after the 15ml stroke-physiological saline solution was gargled 1 minute, repeat 2 times after the space-number minute), the same day, 3000rpm was centrifugal 15 minutes, collection oral mucosa cast-off cells.Reagent that provides according to Wizard genomic dna purification kit and the DNA in the operating process extracting oral mucosa cast-off cells.
3, the amplification in vitro of sample DNA (PCR)
Adopt the Taq enzyme of Shen You company, reaction system (25 μ l) is: 10 * Buffer (damping fluid), 2.5 μ l, primer (10 μ M) 0.4 μ l * 2, dNTPmix (10mM) 0.5 μ l, Mgcl
2(25mM) 1.5 μ l, Taq enzyme 0.25 μ l, ddH
2O 18.65 μ l, dna profiling 25ng.Adopt the PCR response procedures of Touch-down: 95 ℃ 2 minutes; 94 ℃ 30 minutes; 63 ℃ (-0.5 ℃/circulation in 1 minute); 72 ℃ 45 minutes, 10 circulations; 94 ℃ 30 minutes; 58 ℃ 40 minutes; 72 ℃ 45 minutes; 33cycles; 72 ℃ 7 minutes; Under 4 ℃ condition, preserve.
4, PCR product electrophoresis is identified
After PCR finishes, draw 2 μ l add 2 μ l, 2 * Loading Buffer (sample-loading buffer) 2000rpm (rev/min) go up sample after centrifugal 30 seconds, 100V voltage is 20 minutes in the agarose 1.5% (agarose) glue.Gel video camera shooting results sees also Fig. 1, dCK promoter region PCR product electrophoresis result figure, and the mark of PCR product size is distinguished in the M representative, and the right side band is the PCR product band of 701bp size.
5, PCR product purification
1) gets about specific PCR product 50ng, add 0.5 unit shrimp alkali enzyme and the 5 excision enzyme I of unit, supply water to 7ul.
2) purification reaction program: 37 ℃ 60 minutes, 80 ℃ 15 minutes, 4 ℃ of preservations.
3) get 2 μ l purified products and 2 μ l sample-loading buffers mixed after, electrophoresis detection, quantitatively.
6, the PCR fragment is checked order
1)-20 takes out PCR purified product (about 15ng/ul), BigDye TerminationSequence Mix (a kind of commercial sequencing reaction mixed solution), the unidirectional primer of 0.8uM (the reverse primer dCK-P-R:5 ' ccgctaagccagatcctgac3 ' in the pcr amplification reaction mentioned above) in ℃ refrigerator, respectively get 2ul and add in the 96 hole PCR reaction tubess.
2) pcr amplification: (9700 model pcr amplification instrument, PE company)
3) after amplification finished, adding 70% ethanol (add-on is 9: 1 with the ratio of reaction system) was to precipitate in room temperature about 50ul, and the time must not be above 24 hours more than 15 minutes.
4) 4000 rev/mins, 4 ℃ centrifugal 30 minutes.
5) remove supernatant liquor gently, the inversion of 96 orifice plates is centrifugal, reach 800 rev/mins and promptly stop.
6) every hole adds 200ul left and right sides tri-distilled water, 2000 rev/mins 1 minute centrifugal, treat sample.
7) on automatic sequencer (ABI3700 Automatic Sequencer), carry out electrophoresis.Running gel POP5 standard sequencing gel, the time is 3 hours.
7, the search in SNP site
The graphic file that Sequence Analysis3.3 analyze is produced reaches and has Phredphrap, on the unix host of Polyphred and Consed software.Create four sub-directory chromat_dir earlier, edit_dir, poly_dir and phd_dir, the sequencer map shape file with each sample moves under the chromat_dir catalogue then, successively moves phredphrap and polyphred under edit_dir.In fact, usually phredphrap and polyphred are done batch file, have only this file of operation to get final product, for example we make the snp file with it, so as long as operation snp order is just passable.Behind the end of run, still operation Consed order under the edit_dir catalogue shows the result with graphical interfaces intuitively.Polyphred can put on cue such as shades of colour with the SNP site that software is suspected.
According to above-mentioned experiment, to the coding region of deoxycytidine kinase gene, the land of exon and intron, the promoter region of gene checks order, at the promoter region area discover two mononucleotide polymorphism sites that frequency is higher, they have formed four kinds of genotype in the crowd.Figure 2 shows that a kind of deoxycytidine kinase Gene Partial promoter region sequence, wherein
Be initiator codon, aaagtca is a transcripting start point, two mononucleotide polymorphism sites lay respectively at the 199th of transcripting start point upstream and the 40th base place, can represent with-199CG/-40CT for this kind deoxycytidine kinase gene, other three types are respectively-199CC/-40CC,-199CC/-40CT ,-199GG/-40TT.
See also Fig. 3, the arrow indication is the polymorphic distribution of deoxycytidine kinase genetic transcription starting point upstream the 199th and 40 bases, a represents the 40th CC of the base place homozygote in deoxycytidine kinase gene (dCK) promoter region transcripting start point upstream, CT heterozygote and TT homozygote; B represents deoxycytidine kinase gene (dCK) promoter region transcripting start point upstream the 199th CC of base place homozygote, CG heterozygote and GG homozygote.
According to the basis for estimation of clinical leukemia chemotherapy curative effect, obtain fully a course of treatment that alleviation person is judged as good effect, then be not judged as weak curative effect if surpass to alleviate yet two courses of treatment.Bone marrow prepare with discrepant these the two groups of acute myelocytic leukemia patients of chemotherapy effect, according to above-mentioned steps extracting genomic dna, pcr amplification after product purifying and order-checking, carry out genotypic detection, through statistical analysis, discovery is in the patient of (n=64) of good effect (n=60) and weak curative effect, and there is significant difference in these four kinds of genotypic distributions.Distribution and statistical analysis among the acute myelocytic leukemia patient of four kinds of genotype forming for two single nucleotide polymorphism of deoxycytidine kinase gene (dCK) promoter region as shown in table 1 and difference good in result of treatment, as can be seen, genotype is-the patient treatment effect of 199CC/-40CC is relatively poor, genotype is-199CG/-40CT,-199CC/-40CT, the patient treatment effect of-199GG/-40TT is better relatively.
Table 1
According to the oral mucosa cell DNA that comes off in extracting part patient (n=30) collutory,, find that these two single nucleotide polymorphism are had by patient itself, with disease independent as self normal control detection.
Detect by sxemiquantitative RT-PCR, find that two kinds in these four kinds of genotype there are differences in mrna expression, the uciferase activity experimental result also points out genotype to there are differences at transcriptional level.As shown in Figure 4, on behalf of the 40th and the 199th base in four routine dCK promoter region transcripting start point upstreams, B1-B4 be respectively CC and CC homozygote patient sxemiquantitative RT-PCR result; On behalf of the 40th and the 199th base in four routine dCK promoter region transcripting start point upstreams, G1-G4 be respectively CT and CG heterozygote patient sxemiquantitative RT-PCR result, and GAPDH is an internal reference, and G1-G4 patient dCK gene is higher than B1-B4 patient at the mRNA horizontal expression.According to the known theory, gene promoter region can regulatory gene expression, dCK genetic expression is high more, and the patient is to chemotherapeutics cytosine arabinoside responsive more (being that curative effect is good more), so-the genotypic patient's of 199CG/-40CT curative effect than-the genotypic patient of 199CC/-40CC is good.
Fig. 5 is illustrated in and carries out the uciferase activity result of experiment in the COS-7 cell, ordinate zou is represented the plain enzymic activity value of relative fluorescence, as can be seen two polymorphic sites of dCK gene promoter region for-199CC/-40CC and-the genotypic transcriptional activity of 199GG/-40TT has 10 times of differences.PGL3-basic represents the internal reference in the transcriptional activity experiment,-199GG/-40TT and-the 199CC/-40CC transcriptional activity is all as relatively, pGL3-CC+GG representative general-199GG/-40TT and the-common transfection COS-7 of 199CC/-40CC plasmid cell cause to be similar to-situation of 199CG/-40CT heterozygote.The difference of transcriptional activity represents these two genotype that polymorphic site constituted of dCK gene promoter region influential to genetic expression.
According to above experimental result, method of the present invention is predicted acute myelocytic leukemia patient's chemotherapy effect before medication, is comprised the steps:
The DNA of extracting acute myelocytic leukemia patient self healthy tissues;
Carry out the gene type assay of two polymorphic sites of deoxycytidine kinase gene (dCK) promoter region;
If patient's genotype is-199CG/-40CT ,-199CC/-40CT ,-199GG/-40TT, then can predict this patient reactive good to cytosine arabinoside;
If patient's genotype is-199CC/-40CC to predict that then this patient is poor to the reactivity of cytosine arabinoside.
Technical solution of the present invention has overcome the deficiency that must judge curative effect after patient's medication, can be before medication the DNA of extracting leukaemic self healthy tissues (as oral mucosa cell of coming off in the collutory etc.) carry out the gene type assay of two polymorphic sites of dCK gene promoter region, to understand the reactivity of patient to cytosine arabinoside, wear and obtain bone marrow prepare and needn't carry out bone, reduced patient's misery, for clinical application provides foundation, reduced blindness, it is less relatively to detect cost.
Claims (1)
1. the deoxycytidine kinase gene is predicting that the acute myelocytic leukemia patient is to the application in the reactivity of chemotherapeutics cytosine arabinoside, it is characterized in that there are two polymorphic sites in described deoxycytidine kinase gene promoter region, these two polymorphic sites lay respectively at the 40th of promoter region transcripting start point upstream and the 199th base place, constitute four kinds of gene types, if patient's gene type is-199CG/-40CT ,-199CC/-40CT ,-199GG/-40TT, then can predict this patient reactive good to cytosine arabinoside; If patient's genotype is-199CC/-40CC to predict that then this patient is poor to the reactivity of cytosine arabinoside.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB03142239XA CN100393884C (en) | 2003-08-13 | 2003-08-13 | Method for predicting chemical therapy effect for acute medullary cell leucosis patient |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB03142239XA CN100393884C (en) | 2003-08-13 | 2003-08-13 | Method for predicting chemical therapy effect for acute medullary cell leucosis patient |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1580282A CN1580282A (en) | 2005-02-16 |
| CN100393884C true CN100393884C (en) | 2008-06-11 |
Family
ID=34579425
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB03142239XA Expired - Fee Related CN100393884C (en) | 2003-08-13 | 2003-08-13 | Method for predicting chemical therapy effect for acute medullary cell leucosis patient |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100393884C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| JP5491377B2 (en) * | 2007-03-30 | 2014-05-14 | ９８９８リミテッド | Drug platform technology for natural product development |
| CN109887599B (en) * | 2019-02-25 | 2021-07-06 | 中国计量大学 | Neural network-based traditional Chinese medicine prescription curative effect deduction method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1205640A (en) * | 1995-12-22 | 1999-01-20 | 东卡罗来纳大学 | Method of treating disorders characterized by overexpression of cytidine deaminase or deoxycytidine deaminase |
-
2003
- 2003-08-13 CN CNB03142239XA patent/CN100393884C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN1205640A (en) * | 1995-12-22 | 1999-01-20 | 东卡罗来纳大学 | Method of treating disorders characterized by overexpression of cytidine deaminase or deoxycytidine deaminase |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1580282A (en) | 2005-02-16 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| AU2007275140B2 (en) | Method for the detection of EGFR mutations in blood samples | |
| AU2018202963B2 (en) | Biomarkers useful for detection of types, grades and stages of human breast cancer | |
| JP2010504102A5 (en) | ||
| CN108315416A (en) | Primer, kit and the method for lung cancer gene mutation site are determined based on high throughput sequencing technologies | |
| CA2945531A1 (en) | Mirna expression signature in the classification of thyroid tumors | |
| Guan et al. | High miR-196a and low miR-367 cooperatively correlate with unfavorable prognosis of high-grade glioma | |
| Gulluoglu et al. | Simultaneous miRNA and mRNA transcriptome profiling of glioblastoma samples reveals a novel set of OncomiR candidates and their target genes | |
| CN103923975A (en) | Kit for detecting deletion mutation of EGFR gene exon 19, and method thereof | |
| CN104988141B (en) | G.32912799T ＞ C mutation and its application in Computer-aided Diagnosis of Breast Cancer of BRCA2 genes | |
| CN109161543B (en) | DNA probe for enriching low-frequency DNA mutation and application thereof | |
| CN105506138B (en) | RET fusion ARMS fluorescence quantitive PCR typing detection kit | |
| CN107254546B (en) | SNP marker related to breast cancer neoadjuvant chemotherapy curative effect and application thereof | |
| CN109022583A (en) | Hsa_circ_0021977 is preparing the application on Diagnosis of Breast cancer product | |
| CN100393884C (en) | Method for predicting chemical therapy effect for acute medullary cell leucosis patient | |
| CN107058305A (en) | One group of nucleotide sequence and the application in EML4 ALK fusion gene quick detections | |
| CN102021228B (en) | Specific primers for tissue or whole blood EGFR gene mutation detection | |
| CN104946751B (en) | BRCA1 genes are g.41244291delT mutated and its application in Computer-aided Diagnosis of Breast Cancer | |
| CN103789436B (en) | A kind of quantitative abrupt climatic change system based on manually modified primer | |
| CN104059987A (en) | Osteosarcoma diagnostic kit and application of CPE (carboxypeptidase E) gene to preparing osteosarcoma diagnostic kit | |
| CN105648057B (en) | A kind of primer sets, kit and its detection method for screening human EGFR gene polymorphism | |
| CN108103181A (en) | The detection method and detection kit in hypertriglyceridemia mutational site | |
| WO2016106645A1 (en) | Primer for detecting colorectal cancer drug-related gene mutation and detection method | |
| KR101860547B1 (en) | Use of Cell-Free DNA for Diagnosing the Disease of Cancer | |
| CN105154547B (en) | The primer and method of a kind of detection IDH1 and IDH2 gene mutations | |
| CN104293961B (en) | For detecting primer and the kit of SCZ related gene polymorphism |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080611 Termination date: 20100813 |