CN100379868C

CN100379868C - Novel peptide synthase gene

Info

Publication number: CN100379868C
Application number: CNB038224607A
Authority: CN
Inventors: 原诚一; 横关健三; 阿部巧; 外内尚人; 城岛恭子
Original assignee: Ajinomoto Co Inc
Current assignee: Ajinomoto Co Inc
Priority date: 2002-07-26
Filing date: 2003-07-25
Publication date: 2008-04-09
Anticipated expiration: 2023-07-25
Also published as: CN101186904A; CN1688698A; CN101067125A; CN101067126A; CN101067124B; CN101067124A; CN101186903A

Abstract

DNA and recombinant DNA that encode a peptide-forming enzyme, a method for producing a peptide-forming enzyme, and a method for producing a dipeptide are disclosed. A method for producing a dipeptide includes producing a dipeptide from a carboxy component and an amine component by using a culture of a microbe belonging to the genus Sphingobacterium and having the ability to form the dipeptide from the carboxy component and the amine component, a microbial cell separated from the culture, treated microbial cell product of the microbe or a peptide-forming enzyme derived from the microbe.

Description

Novel peptide-forming enzyme gene

Technical field

The present invention relates to needn't be by complexity synthetic method can be easily, high productivity and generate the novel enzyme of peptide at an easy rate.More specifically, the present invention relates to the novel enzyme of catalysis, produce the microorganism of this enzyme by the peptide formation reaction of carboxyl composition and amine component, and the method that adopts this enzyme or microorganisms producing dipeptides.

Background technology

Peptide is used in medicine, field of food and multiple other field.For example, because the stability and the water-soluble L-glutaminate that is higher than of L-alanyl-L-glutamine, so it is widely used as the composition of transfusion and serum free medium.

Chemical synthesis (producing the currently known methods of peptide) is not the method that always is easy to.The known embodiment of described method comprises that the method for the L-glutaminate that uses N-carbobenzoxy-(Cbz) L-Ala (hereinafter referred to as " Z-L-Ala ") and protection is (referring to Bull.Chem.Soc.Jpn.; 34; 739 (1961); Bull.Chem.Soc.Jpn.; 35; 1966 (1962)); the method of the L-L-glutamic acid-γ-methyl esters of use Z-L-Ala and protection is (referring to Bull.Chem.Soc.Jpn.; 37; 200 (1964)); use the method (referring to patent document 1) of Z-alanine ester and unshielded L-glutamic acid, comprise that the propionyl halogenide that replaces with 2-is raw material, synthetic N-(2-replacement)-propionyl glutamine derivative is as the method (referring to patent document 2) of intermediate.

But, because protecting group or use optical activity intermediate need be introduced and slough to all these methods, so these methods can not fully satisfy industrial favourable requirement.

On the other hand; use the well-known example of the typical peptide production method of enzyme to comprise to use the N protection with the unshielded carboxyl composition of C and N is unshielded, the condensation reaction of the amine component of C protection (hereinafter referred to as " reaction 1 ") and use the carboxyl composition N protection and the C protection and N is unshielded, the replacement(metathesis)reaction of the amine component of C protection (hereinafter referred to as " reaction 2 ").The example of reaction 1 is to produce Z-aspartyl-phenylalanine methyl ester (referring to patent document 3) by Z-aspartic acid and alanine methyl ester, and react 2 example is to produce phenyl methyl ketone alanyl leucyl amine (referring to Biochemical J. by acetylphenylalanine ethyl ester and leucyl amine, 163,531 (1977)).Relevant use N is unshielded, the research report example of the method for the carboxyl composition of C protection is considerably less.In international monopoly publication WO 90/01555 (patent document 4), the example of the replacement(metathesis)reaction (hereinafter referred to as " reaction 3 ") of using carboxyl composition that N is unshielded, C protects and the amine component that N is unshielded, C protects has been described.For example, the method for producing the arginyl leucyl amine by arginine ethyl ester and leucyl amine has wherein been described.In European patent publication EP 278787A1 (patent document 5) and the European patent publication EP 359399B1 (patent document 6), described and used that N is unshielded, the carboxyl composition of C protection and N is unshielded, the example of the replacement(metathesis)reaction of the unshielded amine component of C (hereinafter referred to as " reaction 4 ").For example, the method that tyrosine ethyl ester and L-Ala are produced the tyrosyl L-Ala has wherein been described.

Patent document 1; Japanese patent application H1-96194 communique.

Patent document 2; Patent application H6-234715 communique.

Patent document 3; Japanese patent application S53-92729 communique.

Patent document 4; International monopoly publication WO 90/01555 communique

Patent document 5; European patent publication EP 278787A1 communique

Patent document 6; European patent publication EP 359399B1 communique

Non-patent document 1; Biochemical J., 163,531 (1977)

Summary of the invention

In the method for above-mentioned reaction 1-4, the most cheap production method belongs to the minimum reaction of protecting group 4 naturally.

But, there is following subject matter in the example (referring to European patent publication EP 278787A1) of reaction 4 in the prior art: (1) peptide production rate is very low, (2) the peptide productive rate is low, (3) producible peptide is limited to and comprises the high relatively amino acid whose peptide of hydrophobicity, (4) add-on of enzyme very big and (5) need come from the relatively costly carboxypeptidase preparation of mould, yeast or plant.In reaction 4, do not see the method for the enzyme that the bacterium of using beyond the Saccharomycodes or yeast source are arranged, and do not see have the Dipeptiven of production and other to have the method for the peptide of high-hydrophilic.Under this background, need a kind of commercial run of producing the cheapness of these peptides of exploitation.

The purpose of this invention is to provide needn't be by complexity synthetic method can be easily, high productivity and generate the novel enzyme of peptide at an easy rate.More specifically, the purpose of this invention is to provide the novel enzyme of catalysis, produce the microorganism of this enzyme and adopt this enzyme or microorganism to produce the method for dipeptides at an easy rate by the peptide formation reaction of carboxyl composition and amine component.

The inventor has carried out big quantity research according to above-mentioned purpose, found that from the bacterium of finding recently that belongs to steady Bacillaceae etc., can effectively generate the novel enzyme of peptide, and determine the sequence of this enzyme gene, has finished the present invention thus.

That is, the present invention as described below:

[1] coding following (A) or (B) shown in protein DNA:

(A) have the protein of the aminoacid sequence of forming by the 23-616 amino acids residue of aminoacid sequence shown in the SEQ ID NO:6 in the sequence table,

(B) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 23-616 amino acids residue of aminoacid sequence shown in the SEQ ID NO:6 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[2] coding following (C) or (D) shown in protein DNA:

(C) have the protein of the aminoacid sequence of forming by the 21-619 amino acids residue of aminoacid sequence shown in the SEQ ID NO:12 in the sequence table,

(D) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 21-619 amino acids residue of aminoacid sequence shown in the SEQ ID NO:12 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[3] coding following (E) or (F) shown in protein DNA:

(E) have the protein of the aminoacid sequence of forming by the 23-625 amino acids residue of aminoacid sequence shown in the SEQ ID NO:18 in the sequence table,

(F) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 23-625 amino acids residue of aminoacid sequence shown in the SEQ ID NO:18 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[4] coding following (G) or (H) shown in protein DNA:

(G) have the protein of the aminoacid sequence of forming by the 23-645 amino acids residue of aminoacid sequence shown in the SEQ ID NO:23 in the sequence table,

(H) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 23-645 amino acids residue of aminoacid sequence shown in the SEQ ID NO:23 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[5] coding following (I) or (J) shown in protein DNA:

(I) have the protein of the aminoacid sequence of forming by the 26-620 amino acids residue of aminoacid sequence shown in the SEQ ID NO:25 in the sequence table,

(J) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 26-620 amino acids residue of aminoacid sequence shown in the SEQ ID NO:25 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[6] coding following (K) or (L) shown in protein DNA:

(K) have the protein of the aminoacid sequence of forming by the 18-644 amino acids residue of aminoacid sequence shown in the SEQ ID NO:27 in the sequence table,

(L) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 18-644 amino acids residue of aminoacid sequence shown in the SEQ ID NO:27 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[7] coding following (M) or (N) shown in protein DNA:

(M) have the protein of aminoacid sequence shown in the SEQ ID NO:6 in the sequence table,

(N) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:6 in the sequence table displacement, disappearance in the aminoacid sequence, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[8] coding following (O) or (P) shown in protein DNA:

(O) have the protein of aminoacid sequence shown in the SEQ ID NO:12 in the sequence table,

(P) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:12 in the sequence table displacement, disappearance in the aminoacid sequence, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[9] coding following (Q) or (R) shown in protein DNA:

(Q) have the protein of aminoacid sequence shown in the SEQ ID NO:18 in the sequence table,

(R) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:18 in the sequence table displacement, disappearance in the aminoacid sequence, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[10] coding following (S) or (T) shown in protein DNA:

(S) have the protein of aminoacid sequence shown in the SEQ ID NO:23 in the sequence table,

(T) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:23 in the sequence table displacement, disappearance in the aminoacid sequence, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[11] coding following (U) or (V) shown in protein DNA:

(U) have the protein of aminoacid sequence shown in the SEQ ID NO:25 in the sequence table,

(V) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:25 in the sequence table displacement, disappearance in the aminoacid sequence, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[12] coding following (W) or (X) shown in protein DNA:

(W) have the protein of aminoacid sequence shown in the SEQ ID NO:27 in the sequence table,

(X) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:27 in the sequence table displacement, disappearance in the aminoacid sequence, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion.

[13] following (a) or (b) shown in DNA:

(a) have the DNA of the base sequence of the 127-1908 bit base of base sequence shown in the SEQ ID NO:5 in the sequence table,

(b) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 127-1908 bit base of base sequence shown in the SEQ ID NO:5 in the sequence table.

[14] following (c) or (d) shown in DNA:

(c) have the DNA of the base sequence of the 121-1917 bit base of base sequence shown in the SEQ ID NO:11 in the sequence table,

(d) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 121-1917 bit base of base sequence shown in the SEQ ID NO:11 in the sequence table.

[15] following (e) or (f) shown in DNA:

(e) have the DNA of the base sequence of the 127-1935 bit base of base sequence shown in the SEQ ID NO:17 in the sequence table,

(f) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 127-1935 bit base of base sequence shown in the SEQ ID NO:17 in the sequence table.

[16] following (g) or (h) shown in DNA:

(g) have the DNA of the base sequence of the 127-1995 bit base of base sequence shown in the SEQ ID NO:22 in the sequence table,

(h) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 127-1995 bit base of base sequence shown in the SEQ ID NO:12 in the sequence table.

[17] following (i) or (j) shown in DNA:

(i) have the DNA of the base sequence of the 104-1888 bit base of base sequence shown in the SEQ ID NO:24 in the sequence table,

(j) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 104-1888 bit base of base sequence shown in the SEQ ID NO:24 in the sequence table.

[18] following (k) or (l) shown in DNA:

(k) have the DNA of the base sequence of the 112-1992 bit base of base sequence shown in the SEQ ID NO:26 in the sequence table,

(l) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 112-1992 bit base of base sequence shown in the SEQ ID NO:26 in the sequence table.

[19] following (m) or (n) shown in DNA:

(m) have the DNA of the base sequence of the 61-1908 bit base of base sequence shown in the SEQ ID NO:5 in the sequence table,

(n) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 61-1908 bit base of base sequence shown in the SEQ ID NO:5 in the sequence table.

[20] following (o) or (p) shown in DNA:

(o) have the DNA of the base sequence of the 61-1917 bit base of base sequence shown in the SEQ ID NO:11 in the sequence table,

(p) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 61-1917 bit base of base sequence shown in the SEQ ID NO:11 in the sequence table.

[21] following (q) or (r) shown in DNA:

(q) have the DNA of the base sequence of the 61-1935 bit base of base sequence shown in the SEQ ID NO:17 in the sequence table,

(r) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 61-1935 bit base of base sequence shown in the SEQ ID NO:17 in the sequence table.

[22] following (s) or (t) shown in DNA:

(s) have the DNA of the 127-1995 bit base sequence of base sequence shown in the SEQ ID NO:22 in the sequence table,

(t) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 127-1995 bit base of base sequence shown in the SEQ ID NO:22 in the sequence table.

[23] following (u) or (DNA v):

(u) have the DNA of the 29-1888 bit base sequence of base sequence shown in the SEQ ID NO:24 in the sequence table,

(v) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 29-1888 bit base of base sequence shown in the SEQ ID NO:24 in the sequence table.

[24] following (w) or (x) shown in DNA:

(w) have the DNA of the 61-1992 bit base sequence of base sequence shown in the SEQ ID NO:26 in the sequence table,

(x) under stringent condition, comprise the mature protein district and have peptide with DNA hybridization with following base sequence and coding and generate active protein DNA, described base sequence and the base sequence complementation of forming by the 61-1992 bit base of base sequence shown in the SEQ ID NO:26 in the sequence table.

[25] according to each DNA of [13]-[24], wherein stringent condition is under the salt concn that is equivalent to 1 * SSC and 0.1%SDS, in 60 ℃ of conditions of washing.

[26] a kind of comprising according to each the recombinant DNA of DNA of [1]-[25].

[27] a kind of transformant that has imported according to the recombinant DNA of [26].

[28] a kind of method of producing peptide-forming enzyme comprises: cultivate the transformant according to [27] in substratum, peptide-forming enzyme is accumulated in substratum and/or transformant.

[29] a kind of method of producing dipeptides comprises: the transformant of cultivating basis [28] in substratum mixes this culture with synthetic dipeptides to obtain culture with carboxyl composition and amine component.

[30] a kind of method of producing dipeptides, comprise: belong to Sphingobacterium and have the culture that generates the active microorganism of dipeptides by carboxyl composition and amine component by use, isolating microorganism cells from this culture, the microorganism cells of this microorganism is handled product or is come from the peptide-forming enzyme of this microorganism, generates dipeptides by carboxyl composition and amine component.

In addition, aminoacid sequence shown in the SEQ ID NO:6 is determined by DNA described in the SEQ ID NO:5 in the sequence table.Aminoacid sequence shown in the SEQ ID NO:12 is determined by DNA described in the SEQID NO:11 in the sequence table.Aminoacid sequence shown in the SEQ ID NO:18 is determined by DNA described in the SEQ ID NO:17 in the sequence table.Aminoacid sequence shown in the SEQ ID NO:23 is determined by DNA described in the SEQ ID NO:22 in the sequence table.Aminoacid sequence shown in the SEQ ID NO:25 is determined by DNA described in the SEQ ID NO:24 in the sequence table.Aminoacid sequence shown in the SEQ ID NO:27 is determined by DNA described in the SEQ ID NO:26 in the sequence table.

The accompanying drawing summary

Fig. 1 is the figure of optimal pH that illustrates the enzyme of steady bacillus of the present invention;

Fig. 2 is the figure of optimum temperuture that illustrates the enzyme of steady bacillus of the present invention;

Fig. 3 illustrates the time-histories figure that is prepared the L-alanyl-L-glutamine by L-alanine methyl ester and L-glutaminate; With

Fig. 4 is the bar graph that illustrates the enzyme amount that exists in kytoplasm part (Cy) and the pericentral siphon part (Pe).

The optimum implementation of invention

It below is the product dipeptides generation enzyme that novel dipeptide of the present invention generates enzyme gene and this gene.

(1) contains the microorganism of DNA of the present invention

Dna encoding of the present invention has the active protein that is generated peptide by carboxyl composition and amine component.In this manual, the carboxyl composition is meant provides the peptide bond (composition in carbonyl site (CO) CONH-), and amine component is meant the composition that amino sites in the peptide bond (NH) is provided.In addition, in this manual, unless refer in particular in addition, term " peptide " is meant the polymer with at least one peptide bond when using separately.In addition, in this manual, " dipeptides " is meant the peptide with a peptide bond.

The example that contains the microorganism of DNA of the present invention comprises and belongs to steady Bacillaceae, Sphingobacterium, soil bacillus (Pedobacter) belongs to, the shaping Bacillaceae, the bacterium that round bar Pseudomonas or Psycloserpens belong to, and its more specifically example comprise short steady bacillus strain ATCC14234 (bacterial strain FERM P-18545, bacterial strain FERM BP-8113), Sphingobacterium sp. bacterial strain FERM BP-8124, separate Vitrum AB soil bacillus (Pedobacter heparinus) bacterial strain IFO 12017, Taxeobacter gelupurpurascens strain DSM Z 11116, sea round bacteria strains A TCC 25205 and Psycloserpens burtonensis strains A TCC700359.Short steady bacillus strain ATCC 14234 (bacterial strain FERM P-18545, bacterial strain FERMBP-8113), Sphingobacterium sp. bacterial strain FERM BP-8124, separate Vitrum AB soil bacillus strain IFO 12017, Taxeobacter gelupurpurascens strain DSM Z 11116, extra large round bacteria strains A TCC 25205 and Psycloserpens burtonensis strains A TCC700359 be the inventor after deliberation and energy the high yield of selecting ground by the microorganism of carboxyl composition and amine component generation peptide.

In the mentioned microorganism bacterial strain, be preserved in Independent Administrative Leged Industrial Technology Complex Inst and speciallyyed permit biological sustenance center (Chuo Dai-6,1-1Higashi 1-Chome with the microorganism of FERM number expression, Tsukuba-shi, Ibaraki-ken Japan), and can obtain with reference to each number.

In the mentioned microorganism bacterial strain, be preserved in American type culture collection (P.O.Box 1549, Manassas, VA 20110, the UnitedStates of America) with the microorganism of ATCC number expression, and can have obtained with reference to each number.

In the mentioned microorganism bacterial strain, with IFO number the expression microorganism be preserved in fermentation research institute, (Osaka-shi Japan), and can obtain with reference to each number Osaka for 2-17-85 Jusohonmachi, Yodogawa-ku.

In the mentioned microorganism bacterial strain, microorganism with NBRC number expression has been preserved in Japanese state-run technology and evaluation study institute Biological resources center (NITE) (5-8 Kazusa-Kamaashi2-Chome, Kisarazu-shi, Chiba-ken, and can obtain Japan), with reference to each number.

In the mentioned microorganism bacterial strain, microorganism with DSMZ number expression has been preserved in DeutcheSammlung von Mikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center) (Mascheroder Weg 1b, 38124Braunschweig, and can obtain Germany), with reference to each number.

Short steady bacillus strain ATCC 14234 (bacterial strain FERM P-18545, bacterial strain FERM BP-8113) is preserved in Independent Administrative Leged Industrial Technology Complex Inst October 1 calendar year 2001 and speciallys permit biological sustenance center (Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, and to specify its preserving number be FERM P-18545 Japan).Subsequently, regulation according to budapest treaty, on July 8th, 2002 Independent Administrative Leged Industrial Technology Complex Inst that is transferred to of this bacterial strain is speciallyyed permit biological sustenance center, and to specify its preserving number be FERM BP-8113 (microorganism performance: short steady bacillus strain AJ 13933).

Sphingobacterium sp. strains A J 110003 is preserved in Independent Administrative Leged Industrial Technology Complex Inst on July 22nd, 2002 and speciallys permit biological sustenance center, and to specify its preserving number be FERM BP-8124.By following qualification test, strains A J 110003 (FERM BP-8124) is accredited as above-mentioned Sphingobacterium sp..Bacterial strain FERM BP-8124 is gram negative bacillus (0.7-0.8 * 1.5-2.0 μ m), does not generate gemma, no mobility.Its bacterium colony is circular, and the edge is smooth fully, comprises low projection, and is glossy, light yellow.This organism is 30 ℃ of growths, the superoxide enzyme positive, and oxidase positive, OF tests (glucose) feminine gender, according to these features it is accredited as the bacterium that belongs to Sphingobacterium.In addition, because following characteristic: nitrate reduction feminine gender, indoles produces negative, derive from the acid product feminine gender of glucose, the arginine dihydrolase feminine gender, the urase positive, the Vitamin C2 hydrolysis positive, the gelatin hydrolysis feminine gender, the beta-galactosidase enzymes positive, the glucose assimilation is positive, the L-arabinose assimilation is negative, the assimilation of D-seminose is positive, the assimilation of D-N.F,USP MANNITOL is negative, N-acetyl-D-glucosamine assimilation is positive, the maltose assimilation is positive, the Potassium Gluconate feminine gender, the n-capric acid assimilation is negative, the hexanodioic acid assimilation is negative, the assimilation of dl-oxysuccinic acid is negative, the Sodium Citrate assimilation is negative, negative and the Terminal oxidase positive of toluylic acid assimilation can determine that it has the characteristic similar to Sphingobacterium multivorum or Sphingobacterium spiritivorum.In addition, though the homology analysis result of the base sequence of 16S rRNA gene shows that it has the homology (98.8%) with the Sphingobacterium multivorum height, the bacterial isolates that mates fully with this bacterial isolates not.Therefore, this bacterial isolates can be accredited as Sphingobacterium sp.

(2) microorganism culturing

For the microorganism cells of the microorganism that obtains containing DNA of the present invention, this microorganism can be cultivated on the suitable culture base and is grown.The substratum that is used for this purpose there is not special restriction, as long as can make this microorganism growth.This substratum can be the ordinary culture medium that contains common carbon source, nitrogenous source, phosphorus source, sulphur source, mineral ion and organotrophy source as required.

For example, as long as can be utilized, can use any carbon source by mentioned microorganism.The specific examples of spendable carbon source comprises that sugar is such as glucose, fructose, maltose and amylose starch, alcohol is such as Sorbitol Powder, ethanol and glycerine, organic acid such as fumaric acid, citric acid, acetate and propionic acid and salt thereof are such as the hydrocarbon polymer of paraffin and their mixture.

The example of spendable nitrogenous source comprises the ammonium salt such as the mineral acid of ammonium sulfate and ammonium chloride, organic acid ammonium salt such as ammonium fumarate and ammonium citrate, such as the nitrate of SODIUMNITRATE and saltpetre, such as the organic nitrogen compound of peptone, yeast extract, meat extract and corn steep liquor and their mixture.

In addition, also the nutrition source such as inorganic salt, trace metal salts and VITAMIN that is used for ordinary culture medium suitably can be mixed use.

Also have no particular limits on culture condition, for example, can make pH and temperature suitably be controlled at the scope that pH is 5-8 under aerobic conditions, temperature be in 15-40 ℃ the scope, to cultivate about 12-about 48 hours.

The purifying of enzyme

Dna encoding peptide-forming enzyme of the present invention.For example, this peptide-forming enzyme can be subordinated to purifying in the bacterium of steady Bacillaceae.The method of separation and purifying peptide-forming enzyme will be described as the example of purifying enzyme from short steady bacillus.

At first, by adopting physical method such as ultrasonication or using the enzyme process smudge cells of molten cell walls enzyme and remove insoluble part by method such as centrifugal, thereby from short steady bacillus, for example (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to bacterial strain FERM BP-8113, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: preparation microorganism cells extract in the microorganism cells on July 8th, 2002).By associating common method of purifying protein such as anion-exchange chromatography, cation-exchange chromatography or gel permeation chromatography,, the microorganism cells extract solution available from aforesaid method comes the purifying peptide-forming enzyme then through being carried out fractionation.

The example that is used as the carrier of anion-exchange chromatography is Q-Sepharose HP (Amersham production).When the cell extract process that will comprise enzyme has been filled the post of carrier, under the condition of pH 8.5, can from non-absorbed portion, reclaim enzyme.

The example that is used as the carrier of cation-exchange chromatography is MonoS HR (Amersham production).Thereby make enzyme be adsorbed on the post by the cell extract that will comprise enzyme through the post of having filled carrier and subsequently after the washing column, with buffered soln wash-out enzyme with high salt concentration.At this moment, salt concn can be increased continuously and maybe concentration gradient can be adopted.For example, under the situation of using MonoS HR, be adsorbed on enzyme on the post with the NaCl wash-out of the about 0.5M of about 0.2-.

Enzyme with the aforesaid method purifying further can be carried out even purifying by gel permeation chromatography etc. then.The example that is used for the carrier of gel permeation chromatography is Sephadex 200pg (Amersham production).

In above-mentioned purification process, can generate activity by the peptide that detects each several part according to the described method of following embodiment, thereby confirm to comprise the part of enzyme.Shown internal amino acid sequence among SEQ ID NO:1 in the sequence table and the SEQ ID NO:2 with the enzyme of aforesaid method purifying.

(4) DNA of the present invention and transformant

(4-1) DNA of the present invention

(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center from short steady bacillus strain FERM BP-8113, preservation mechanism address: Chuo Dai-6,1-1Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: on July 8th, 2002), isolate the DNA of the present invention that has at the base sequence of 61-1908 bit base described in the SEQ ID NO:5.The DNA that contains 61-1908 bit base described in the SEQ ID NO:5 is coding region sequence (hereinafter referred to as " CDS ") part.The base sequence of 61-1908 bit base comprises signal sequence district and mature protein district.The signal sequence district is made up of the 61-126 bit base, and ripe protein district is made up of the 127-1908 bit base.That is, the invention provides the peptase protein gene that comprises signal sequence and the peptase protein gene of mature protein form.The signal sequence that comprises in the sequence described in the SEQ ID NO:5 is a kind of leader sequence type, and the major function of inferring the leading peptide that this leader sequence is coded is the secretion in the outside from the cytolemma inboard to cytolemma.By the coded protein of 127-1908 bit base (i.e. site except that leading peptide) is mature protein, but infers that the peptide of its apparent altitude generates active.

(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center from Sphingobacterium sp. bacterial strain FERM BP-8124, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002), isolate the DNA with base sequence of 61-1917 bit base described in the SEQ ID NO:11, it also is DNA of the present invention.DNA with base sequence of being made up of the 61-1917 bit base is encoding sequence (CDS) part.The base sequence of being made up of the 61-1917 bit base comprises signal sequence district and mature protein district.The signal sequence district is the zone of 61-120 bit base, and ripe protein district is the zone of 121-1917 bit base.That is, the invention provides the peptase protein gene that comprises signal sequence and the peptase protein gene of mature protein form.The signal sequence that comprises in the sequence described in the SEQ ID NO:11 is the leader sequence type.The major function of inferring the leading peptide that this leader sequence is coded is the secretion in the outside from the cytolemma inboard to cytolemma.By the coded protein of 121-1917 bit base (i.e. part except that leading peptide) is mature protein, but infers that the peptide of its apparent altitude generates active.

From separating Vitrum AB soil bacillus strain IFO 12017 (preservation mechanism: fermentation research institute, Osaka, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, Japan) in, isolate the DNA of the present invention of base sequence with the described 61-1935 bit base of SEQ ID NO:17.The DNA that is made up of described 61-1935 bit base among the SEQ ID NO:17 is the CDS part.Comprise signal sequence district and mature protein district in the base sequence of forming by the 61-1935 bit base.The signal sequence district is made up of the 61-126 bit base, and ripe protein district is made up of the 127-1935 bit base.That is, the invention provides the peptase protein gene that comprises signal sequence and the peptase protein gene of mature protein form.The signal sequence that comprises in the sequence described in the SEQ ID NO:17 is the leader sequence type, and the major function of inferring the leading peptide that this leader sequence is coded is the secretion in the outside from the cytolemma inboard to cytolemma.The coded protein of 127-1935 bit base (i.e. site except that leading peptide) is mature protein, but infers that the peptide of its apparent altitude generates active.

From Taxeobacter gelupurpurascens strain DSM Z 11116 (preservation mechanism: Deutche Sammlung von Mikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg1b, 38124 Braunschweig isolate the DNA of the present invention with base sequence of 61-1995 bit base described in the SEQ ID NO:22 in Germany).The DNA that is made up of 61-1995 bit base described in the SEQ ID NO:22 is the CDS part.Comprise signal sequence district and mature protein district in the base sequence by the 61-1995 bit base.The signal sequence district is made up of the 61-126 bit base, and ripe protein district is made up of the 127-1995 bit base.That is, the invention provides the peptase protein gene that comprises signal sequence and the peptase protein gene of mature protein form.The signal sequence that comprises in the sequence described in the SEQ ID NO:22 is the leader sequence type, and the major function of inferring the leading peptide that this leader sequence is coded is the secretion in the outside from the cytolemma inboard to cytolemma.By the coded protein of 127-1995 bit base (i.e. site except that leading peptide) is mature protein, but infers that the peptide of its apparent altitude generates active.

From extra large round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the UnitedStates of America) in, isolates DNA of the present invention with base sequence of 29-1888 bit base described in the SEQ ID NO:24.The DNA that is made up of 29-1888 bit base described in the SEQ ID NO:24 is the CDS part.Contain in the base sequence of 29-1888 bit base and comprise signal sequence district and mature protein district.The signal sequence district is made up of the 29-103 bit base, and ripe protein district is made up of the 104-1888 bit base.That is, the invention provides the peptase protein gene that comprises signal sequence and the peptase protein gene of mature protein form.The signal sequence that is comprised in the described sequence of SEQ ID NO:24 is the leader sequence type, and the major function of inferring the leading peptide that this leader sequence is coded is the secretion in the outside from the cytolemma inboard to cytolemma.By the coded protein of 104-1888 bit base (i.e. site except that leading peptide) is mature protein, but infers that the peptide of its apparent altitude generates active.

From Psycloserpens burtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United States of America) in, isolates the DNA of the present invention of base sequence with the described 61-1992 bit base of SEQ ID NO:26.The DNA that is made up of 61-1992 bit base described in the SEQ ID NO:26 is the CDS part.Contain in the base sequence of 61-1992 bit base and comprise signal sequence district and mature protein district.The signal sequence district is by the 61-111 bit base, and ripe protein district is made up of the 112-1992 bit base.That is, the invention provides the peptase protein gene that comprises signal sequence and the peptase protein gene of mature protein form.The signal sequence that comprises in the sequence described in the SEQ ID NO:26 is the leader sequence type, and the major function of inferring the leading peptide that this leader sequence is coded is the secretion in the outside from the cytolemma inboard to cytolemma.The coded protein (i.e. site except that leading peptide) of 112-1992 bit base is mature protein, but infers that the peptide of its apparent altitude generates active.

In addition, according to such as Molecular Cloning, 2nd edition, the description in the publication of Cold SpringHarbor Press (1989) can be implemented following several genes recombinant technology.

DNA of the present invention can pass through polymerase chain reaction (hereinafter referred to as " PCR ") (referring to PCR; White T.J. etc., Trends Genet., 5,185 (1989)) or by the hybridization of lacking steady bacillus, Sphingobacterium sp., the chromosomal DNA of separating Vitrum AB soil bacillus, Taxeobactergelupurpurascens, extra large round bacteria or Psycloserpens burtonensis or DNA library obtain.The PCR primer can be according to based on designing by the determined internal amino acid sequence of peptide-forming enzyme of carrying out purifying described in above-mentioned (3) joint.In addition, because the present invention has clearly determined the base sequence (SEQ IDNO:5, SEQ ID NO:11, SEQ ID NO:22, SEQ ID NO:24 and SEQ ID NO:26) of peptide-forming enzyme gene, so can be designed for the primer or the probe of hybridization according to these base sequences, also can adopt this gene of probe separates.If will have primer with 5 ' non-translational region and the corresponding sequence of 3 ' non-translational region as PCR primer, the total length of the coding region of the enzyme of the present invention that then can increase.For example, when amplification comprises leader sequence described in the SEQ ID NO:5 and mature protein coding region regional, specifically, the example of 5 ' side primer is the primer with base sequence of the upstream region of 61 bit bases among the SEQ ID NO:5, and the example of 3 ' side primer is the primer that has with the base sequence complementary sequence of 1908 bit base downstream areas.

For example, the 380B type dna synthesizer that can adopt Applied Biosystems to produce according to a conventional method is by phosphoamidite method (referring to Tetrahedron Letters (1981), 22,1859) synthetic primer.For example, can adopt Gene Amp PCR System 9600 (Perkin-Elmer production) and TakaraLA PCR body outer clone test kit (Takara Shuzo production) enforcement PCR to react according to by provider's illustrated method of manufacturers for example.

No matter whether comprise leader sequence, also comprise among the DNA of the present invention with sequence table in SEQID NO:5 described in the same basically DNA of DNA of CDS.That is, the DNA of enzyme of the present invention that can be by having sudden change from coding or contain the cell of this DNA, be separated under the stringent condition with have with sequence table in SEQ ID NO:5 described in the DNA hybridization of CDS complementary base sequence, or with probe hybridization from the preparation of identical base sequence, and coding has peptide and generates active protein DNA and obtain the DNA same basically with DNA of the present invention.

No matter whether comprise leader sequence, also comprise among the DNA of the present invention with sequence table in SEQID NO:11 described in the same basically DNA of DNA of CDS.That is, the DNA of enzyme of the present invention that can be by having sudden change from coding or contain the cell of this DNA, be separated under the stringent condition with have with sequence table in SEQ ID NO:11 described in the DNA hybridization of CDS complementary base sequence, or with probe hybridization from the preparation of identical base sequence, and coding has peptide and generates active protein DNA and obtain the DNA same basically with DNA of the present invention.

No matter whether comprise leader sequence, also comprise among the DNA of the present invention with sequence table in SEQID NO:17 described in the same basically DNA of DNA of CDS.That is, the DNA of enzyme of the present invention that can be by having sudden change from coding or contain the cell of this DNA, be separated under the stringent condition with have with sequence table in SEQ ID NO:17 described in the DNA hybridization of CDS complementary base sequence, or with probe hybridization from the preparation of identical base sequence, and coding has peptide and generates active protein DNA and obtain the DNA same basically with DNA of the present invention

No matter whether comprise leader sequence, also comprise among the DNA of the present invention with sequence table in SEQID NO:22 described in the same basically DNA of DNA of CDS.That is, the DNA of enzyme of the present invention that can be by having sudden change from coding or contain the cell of this DNA, be separated under the stringent condition with have with sequence table in SEQ ID NO:22 described in the DNA hybridization of CDS complementary base sequence, or with probe hybridization from the preparation of identical base sequence, and coding has peptide and generates active protein DNA and obtain the DNA same basically with DNA of the present invention.

No matter whether comprise leader sequence, also comprise among the DNA of the present invention with sequence table in SEQID NO:24 described in the same basically DNA of DNA of CDS.That is, the DNA of enzyme of the present invention that can be by having sudden change from coding or contain the cell of this DNA, be separated under the stringent condition with have with sequence table in SEQ ID NO:24 described in the DNA hybridization of CDS complementary base sequence, or with probe hybridization from the preparation of identical base sequence, and coding has peptide and generates active protein DNA and obtain the DNA same basically with DNA of the present invention.

No matter whether comprise leader sequence, also comprise among the DNA of the present invention with sequence table in SEQID NO:26 described in the same basically DNA of DNA of CDS.That is, the DNA of enzyme of the present invention that can be by having sudden change from coding or contain the cell of this DNA, be separated under the stringent condition with have with sequence table in SEQ ID NO:26 described in the DNA hybridization of CDS complementary base sequence, or with probe hybridization from the preparation of identical base sequence, and coding has peptide and generates active protein DNA and obtain the DNA same basically with DNA of the present invention

For example, can be according to fixed method, prepare probe according to the base sequence described in the SEQ ID NO:5 in the sequence table for example.In addition, also can be according to fixed method, implement by using probe to find DNA with probe hybridization, thus the method that is used to separate target DNA.For example, dna probe can be sheared the base sequence that needs as probe with Restriction Enzyme by the base sequence that increases and clone in plasmid or phage vector, extract required base sequence then and prepare.The part that cuts off can be adjusted according to target DNA.

Term used herein " under stringent condition " is meant the so-called specific hybrid of formation under this condition, and does not form non-specific hybridization.Represent accurately that with numerical value this condition is difficult.For example, these conditions can be, the high DNA of homology (for example, 50% or higher, preferred 80% or higher, more preferably 90% or higher) can hybridize each other and condition that homology can not be hybridized each other than these low DNA, or the usual terms of washing in the Southern hybridization, wherein hybridize with 1 * SSC and 0.1%SDS, under the corresponding salt concn of preferred 0.1 * SSC and 0.1%SDS, carry out in 60 ℃.Though under the described conditions Za Jiao gene comprise occur on the specific position in the sequence terminator or since the active centre in sudden change and those genes of loss of activity, but can be by being connected to commercially available expression vector, thereby the enzymic activity of it being expressed in suitable host and adopting following method to detect expression product is removed it at an easy rate.

But, when base sequence is hybridized under above-mentioned stringent condition, under this base sequence encoded protein condition that is selected in 50 ℃ and pH 8 of fine quality, keep have by as the proteinic pact of the coded aminoacid sequence of the original base sequence that keeps half or higher, preferred 80% or higher, more preferably 90% or higher enzymic activity.For example, when being described as follows situation, during the base sequence that for example illustrates under stringent condition and have with the DNA hybridization of the base sequence complementary base sequence of the 127-1908 bit base of base sequence shown in the SEQ ID NO:5, under this base sequence encoded protein condition that is selected in 50 ℃ and pH 8 of fine quality, keep the 23-616 amino acids residue with aminoacid sequence shown in the SEQ IDNO:6 aminoacid sequence proteinic pact half or higher, preferred 80% or higher, more preferably 90% or higher enzymic activity.

Shown among the SEQ ID NO:6 in the sequence table by the coded aminoacid sequence of the described CDS of SEQ ID NO:5 in the sequence table.Shown among the SEQ ID NO:12 in the sequence table by the coded aminoacid sequence of the described CDS of SEQ ID NO:11 in the sequence table.Shown among the SEQ ID NO:18 in the sequence table by the coded aminoacid sequence of the described CDS of SEQ ID NO:17 in the sequence table.Shown among the SEQ ID NO:23 in the sequence table by the coded aminoacid sequence of the described CDS of SEQ ID NO:22 in the sequence table.Shown among the SEQ IDNO:25 in the sequence table by the coded aminoacid sequence of the described CDS of SEQ ID NO:24 in the sequence table.Shown among the SEQ ID NO:27 in the sequence table by the coded aminoacid sequence of the described CDS of SEQ ID NO:26 in the sequence table.

Complete amino acid sequence comprises leading peptide and mature protein district described in the SEQ ID NO:6, and wherein 1-22 amino acids residue constitutes leading peptide, and 23-616 amino acids residue constitutes the mature protein district.In addition, complete amino acid sequence comprises leading peptide and mature protein district described in the SEQ ID NO:11, and wherein 1-20 amino acids residue constitutes leading peptide, and 21-619 amino acids residue constitutes the mature protein district.

Complete amino acid sequence comprises leading peptide and mature protein district described in the SEQ ID NO:18, and wherein 1-22 amino acids residue constitutes leading peptide, and 23-625 amino acids residue constitutes the mature protein district.

Complete amino acid sequence described in the SEQ ID NO:23 comprises leading peptide and mature protein district, and wherein 1-22 amino acids residue constitutes leading peptide, and 23-645 amino acids residue constitutes the mature protein district.

Complete amino acid sequence described in the SEQ ID NO:25 comprises leading peptide and mature protein district, and wherein 1-25 amino acids residue constitutes leading peptide, and 26-620 amino acids residue constitutes the mature protein district.

Complete amino acid sequence described in the SEQ ID NO:27 comprises leading peptide and mature protein district, and wherein 1-17 amino acids residue constitutes leading peptide, and 18-644 amino acids residue constitutes the mature protein district.

The coded protein of DNA of the present invention is that wherein mature protein has peptide and generates active protein, comprise also among the DNA of the present invention that coding and the protein with aminoacid sequence shown in SEQ ID NO:6, SEQ ID NO:12, SEQ ID NO:18, SEQ ID NO:23, SEQ ID NO:25 or the SEQ ID NO:27 in the sequence table goes up same protein DNA substantially, no matter whether it comprises leading peptide (is noted, according to universal code, base sequence is determined by aminoacid sequence).That is, the invention provides protein DNA shown in the coding following (A)-(X):

(B) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 23-616 amino acids residue of aminoacid sequence shown in the SEQ ID NO:6 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(D) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 21-619 amino acids residue of aminoacid sequence shown in the SEQ ID NO:12 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(E) have the protein of the aminoacid sequence that the 23-625 amino acids residue of aminoacid sequence shown in the SEQ ID NO:18 in the sequence table forms,

(F) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 23-625 amino acids residue of aminoacid sequence shown in the SEQ ID NO:18 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(H) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 23-645 amino acids residue of aminoacid sequence shown in the SEQ ID NO:23 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(J) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 26-620 amino acids residue of aminoacid sequence shown in the SEQ ID NO:25 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(L) has following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in displacement in the aminoacid sequence of being made up of the 18-644 amino acids residue of aminoacid sequence shown in the SEQ ID NO:27 in the sequence table, disappearance, inserts, adds, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(M) contain the protein of aminoacid sequence shown in the SEQ ID NO:6 in the ordered list,

(N) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:6 in the sequence table in the aminoacid sequence, comprise displacement, disappearance, insertion, add, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(P) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:12 in the sequence table in the aminoacid sequence, comprise displacement, disappearance, insertion, add, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(R) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:18 in the sequence table in the aminoacid sequence, comprise displacement, disappearance, insertion, add, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(T) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:23 in the sequence table in the aminoacid sequence, comprise displacement, disappearance, insertion, add, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(V) contain the mature protein district, have following aminoacid sequence and have peptide and generate active protein, described aminoacid sequence is included in shown in the SEQ ID NO:25 in the sequence table in the aminoacid sequence, comprise displacement, disappearance, insertion, add, and/or the aminoacid sequence of the one or more amino acid gained of inversion

(W) have aminoacid sequence shown in the SEQ ID NO:27 in the sequence table protein and

(X) contain the mature protein district, have aminoacid sequence shown in the SEQ ID NO:27 in the sequence table and have peptide and generate active protein.

Herein, though the implication of term " a plurality of " changes according to the position and the type of amino-acid residue in the proteinic three-dimensional structure, its scope comprises the number that can significantly not damage the amino-acid residue of three-dimensional structure and protein active, is specially 2-50, be preferably 2-30, more preferably 2-10.But, in (B), (D), (F), (H), (J), (L), (N), (P), (R), (T), (V) or proteinic aminoacid sequence (X), comprise displacement, disappearance, insertion, add, and/or under the situation of the aminoacid sequence of the one or more amino acid gained of inversion, protein is preferably under the condition of 50 ℃ and pH 8, keep the proteinic pact be under the state that does not comprise sudden change half or higher, preferred 80% or higher, more preferably 90% or higher enzymic activity.For example, the situation to (B) provides explanation; When aminoacid sequence (B) is shown in the SEQ ID NO:6 in sequence table in the aminoacid sequence, comprise displacement, disappearance, insertion, add, and/or under the one or more amino acid whose situations of inversion, this protein is preferably under the condition of 50 ℃ and pH 8, keep aminoacid sequence shown in the SEQ ID NO:6 have in the sequence table proteinic pact half or higher, preferred 80% or higher, more preferably 90% or higher enzymic activity.

Amino acid mutation shown in similar above-mentioned (B) etc. can obtain by the following method, for example by the site-directed mutagenesis method, and the base sequence that the amino acid of the privileged site of this enzyme gene is replaced, lack, inserts, adds change.In addition, the DNA of above-mentioned change also can obtain by known mutagenic treatment.Mutagenic treatment is meant, for example, with azanol etc. in the encode method of DNA of this enzyme of extracorporeal treatment, and, handle the method for the Escherichia bacterium of the DNA that comprises this enzyme of encoding such as uviolizing, N-methyl-N '-nitro-N-nitrosoguanidine (NTG) or nitrous acid with the mutagenic compound that are generally used for induced mutations.

In addition, the displacement of above-mentioned base, disappearance, insertion, interpolation and/or inversion comprise that also naturally occurring sudden change is such as because the difference that microbial species or bacterial strain cause.By in suitable cell, expressing DNA with described sudden change and the enzymic activity that detects expression product, can obtain to encode with sequence table in SEQ ID NO:6 or 12 described in protein go up same protein DNA substantially.

(4-2) production of the preparation of transformant and peptide-forming enzyme

Peptide-forming enzyme can by DNA of the present invention is imported suitable host and in this host expressible dna produce.

The example that can be used for expressing by the determined proteinic host of DNA of the present invention comprises that multiple prokaryotic cell prokaryocyte is such as belonging to Escherichia such as intestinal bacteria, steady bacillus, Sphingobacterium, the bacterium of Flavobacterium and Bacillaceae such as Bacillus subtilus, and multiple eucaryon is such as yeast saccharomyces cerevisiae, pichia and aspergillus oryzae.

Be used for the recombinant DNA that DNA imports the host can be inserted with the corresponding carrier of type that will express the host of this DNA by the DNA that will need to import and prepare, can be expressed by the coded protein of this DNA in this mode.Under promotor to the function of peptide-forming enzyme gene in host cell of short steady bacillus etc. was unique situation, this promotor can be used as the promotor of expressing DNA of the present invention.In addition, another promotor that works in host cell can be connected with DNA of the present invention, can under the control of this promotor, express this DNA on demand then.

The example that recombinant DNA is imported the method for transformation of host cell comprises that the method for D.M.Morrison is (referring to Methods in Enzymology, 68,326 (1979)) or by handling the recipient microorganism cell increase the method for DNA permeability (referring to Mandel with calcium chloride, H. and Higa, A., J.Mol.Biol., 53,159 (1970)).

Using under the proteinic situation of recombinant DNA technology mass production, also is to implement preferred implementation of the present invention with the protein bound that produces in the proteinic transformant to form the protein inclusion body.The advantage of this expression and production method comprises the digestion of the proteolytic enzyme that the protection target protein is avoided existing in the microorganism cells, and by the cracking microorganism cells, the centrifugal then simple and easy ground purifying target protein etc. that gets final product.

The protein inclusion body that obtains in this mode dissolves with protein denaturant, by the active regeneration step dissolved protein transduction is turned to suitable fold, physiologically active protein matter, described active regeneration step mainly comprises with protein denaturant crack protein matter, removes denaturing agent then.This process has a lot of examples, comprises Human Inter Leukin-2's active regeneration (opening clear S61-257931 referring to the Japanese Patent spy).

In order from the protein inclusion body, to obtain active protein, need carry out sequence of operations, comprise the dissolving and active regeneration, this method steps than direct preparation active protein complexity many.But, in microorganism cells, microorganism growth is had under the proteinic situation of large volume of deleterious effect producing, can suppress described effect with the protein of the inclusion body form of inactive protein matter by accumulation in microorganism cells.

The example of the method for the large volume target protein of mass production inclusion body form is included in the down independent method of expressing target protein of control of potent promotor, and the method for target protein to express with the form of the fused protein of known large volume expressed protein.

Below, will more specifically explain the present invention as example with preparation intestinal bacteria that transform and the method for using microorganism transformed to produce peptide-forming enzyme.In addition, microorganism such as intestinal bacteria in preparation during peptide-forming enzyme, can mix the DNA of coding precursor protein matter (comprising leader sequence), maybe can mix the DNA that forms by the mature protein district that does not comprise leader sequence, and can be suitable for the DNA of protein coding sequence according to selections such as the working condition of the enzyme that will produce, form, working conditionss.

The promotor that is often used in production heterologous protein in the intestinal bacteria can be used as the promotor of the DNA that expresses the coding peptide-forming enzyme.The example of described promotor comprises T7 promotor, lac promotor, trp promotor, trc promotor, tac promotor, lambda phage PR promotor, PL promotor and other strong promoter.In addition, the example of spendable carrier comprises pUC19, pUC18, pBR322, pHSG299, pHSG298, pHSG399, pHSG398, RSF1010, pMW119, pMW118, pMW219 and pMW218.In addition, can also use the carrier of phage DNA.And, can use the expression vector that comprises promotor and can express the dna sequence dna (comprising the available promotor) that inserts.

In order to produce the peptide-forming enzyme of fused protein inclusion body form, another protein of will encoding (preferred hydrophilic peptide) thus the gene upstream or the downstream that are connected to peptide-forming enzyme gene obtain the fusion rotein plasmagene.In this mode, another proteinic gene of encoding can be the amount that can increase the cumulative fused protein, and strengthens the deliquescent any gene of fused protein after sex change and regeneration step.Candidate's example of described gene comprises T7 gene 10, beta-galactosidase gene, dihydrofolate reductase gene, gamma-interferon gene, interleukin-2 gene and prochymosin gene.

When these genes are connected with the gene of coding peptide-forming enzyme, full gene is connected so that make the reading frame unanimity of its codon.This gene can be connected to suitable restriction enzyme sites, maybe can use the synthetic DNA that contains suitable sequence.

In addition, in order to increase the output of peptide-forming enzyme, preferably in some cases terminator (transcription termination sequence) is connected to the downstream of fusion rotein plasmagene.This terminator comprises, for example, and T7 terminator, fd phage terminator, T4 terminator, tetracycline resistance gene terminator and intestinal bacteria trpA gene terminator.

In intestinal bacteria, import the preferred so-called multiple copied type carrier of carrier of the gene of the fused protein between coding peptide-forming enzyme or peptide-forming enzyme and other protein; the example comprise have the replication orgin that comes from ColE1 plasmid; for example; based on the plasmid of pUC, and based on the plasmid or derivatives thereof of pBR322." derivative " as used herein is meant those plasmids that displacement, disappearance, insertion, interpolation and/or the inversion by base modified.Should be noted that modification as used herein comprises by the modification with the mutagenic treatment of mutagenic compound or UV irradiation, or the modification by spontaneous mutation.

Be the screening transformant, carrier preferably contains the marker such as the Ampicillin Trihydrate resistant gene.Described plasmid comprise can the commercial expression vector that contains effectively start that obtains (based on the carrier (production of Takara Shuzo company) of pUC, based on the carrier (production of ClonetechLaboratories company) of pRROK, pKK233-2 (production of Clonetech Laboratories company) etc.

Obtain recombinant DNA by dna fragmentation being connected to carrier DNA; In described dna fragmentation, connect promotor in the following sequence, coding L-amino acid amide lytic enzyme or comprise the gene (according to circumstances) of L-amino acid amide lytic enzyme and another proteinic fused protein, terminator.

When cultivating the gained intestinal bacteria then with the recombinant DNA transformed into escherichia coli, peptide-forming enzyme or comprise peptide-forming enzyme and another proteinic fused protein and expressed and produce.Can be used as and transform the host though be generally used for the bacterial strain of expression of heterologous genes, preferred, coli strain JM109 for example.The method that the method that implement to transform and being used to filters out transformant is described in Molecular Cloning, and 2nd Edition is in Cold Spring Harbor Press (1989) and other publication.

When the peptide-forming enzyme of expressed fusion protein matter form, can use with peptide-forming enzyme, come the cracking peptide-forming enzyme such as non-existent sequence in factor Xa or the kallikrein as the restricted proteolytic enzyme of recognition sequence.

Can be with being generally used for cultivating colibacillary substratum, such as M9-casamino acids substratum or LB substratum, as producing substratum.In addition, wait according to marker, promotor, the host microorganism type of used carrier and select the suitable culture condition and produce inductive condition.

Following method can be used to reclaim peptide-forming enzyme and comprise peptide-forming enzyme and another proteinic fused protein.If this peptide-forming enzyme or its fused protein are dissolved in microorganism cells, then reclaim this microorganism cells, then with its fragmentation or cracking so that used as crude enzyme liquid.And, can carry out purifying by ordinary skill such as precipitation, filtration or column chromatography to this peptide-forming enzyme or its fused protein as required before using.At this moment, also can use the purifying antibody method that adopts peptide-forming enzyme or its fused protein.

Under the situation that forms the protein inclusion body, dissolve this inclusion body with denaturing agent.Though it can dissolve with microorganism cells protein, considers purification step subsequently, so the preferred inclusion body that takes out dissolves then.Can adopt conventional currently known methods from microorganism cells, to reclaim inclusion body.For example, thus can be by the centrifugal then recovery of cracking microorganism cells inclusion body.The example that can dissolve the denaturing agent of inclusion body comprises that Guanidinium hydrochloride (for example, 6M, pH 5-8) and urea are (for example, 8M) etc.

Having active protein waits by dialysis and removes these denaturing agents and regenerated.The Tris-HCl damping fluid, phosphate buffer solutions etc. can be used as dialyzate used in the dialysis, and its concentration can be, for example, 20mM-0.5M, and its pH can be, and for example, 5-8.

Protein concn during the regeneration step preferably is maintained at about 500 μ g/ml or lower.The dialysis temperature is preferably 5 ℃ or lower so that prevent regenerated peptide-forming enzyme generation self-crosslinking.In addition, except dialysing, the method for removing denaturing agent comprises dilution or ultrafiltration, and which kind of denaturing agent activity no matter expection use all can be reproduced.

(5) characteristic of the coded enzyme of DNA of the present invention

For example, can react in comprising amino acid ester and the amine borate buffer solution as substrate by making enzyme, the peptide that quantitatively generates detects the activity of the coded enzyme of DNA of the present invention then.In embodiment more specifically, adopt the borate buffer solution (pH 9.0) that comprises 100mM L-alanine methyl ester and 200mM L-glutaminate, implement the reaction some minutes at 25 ℃.

The definition of the activity unit of used enzyme is among the present invention, 1 unit (U) is the 100mM borate buffer solution (pH9.0) that comprises 100mM L-alanine methyl ester and 200mM L-glutaminate in use, under 25 ℃ the reaction conditions, produce the enzyme amount of 1 micromole (μ mole) peptide in 1 minute.

The coded protein of DNA of the present invention is peptide-forming enzyme protein.Peptide generates the active activity that is generated peptide by carboxyl composition and amine component that is meant.Below, will the characteristic of the preferred implementation of the coded enzyme of DNA of the present invention be described.

A kind of preferred implementation of the enzyme that DNA of the present invention is coded comprises having following active enzyme, and dipeptides productivity is as its indicator.That is, a kind of preferred implementation of enzyme of the present invention comprises having the activity that is generated peptide by carboxyl composition and amine component, and under the condition of following (i)-(iv), in the dipeptides formation reaction, has the 0.03mM/min of being preferably or higher, more preferably 0.3mM/ minute or higher, the enzyme of the productivity of preferred especially 1.0mM/min or higher L-alanyl-L-glutamine.The condition of dipeptides formation reaction is as follows:

(i) the carboxyl composition is a L-alanine methyl ester hydrochloride (100mM);

(ii) amine component is L-glutaminate (200mM);

(iii) pH is 9.0; With,

(iv) according to protein mass, evenly the add-on of the enzyme of purifying is lower than 0.61mg/ml.

Above-mentioned productivity is far above the conventional productivity of using the enzymic synthesis peptide, and enzyme of the present invention has the catalysis peptide with very fast speed synthetic ability.

The above-mentioned add-on indication of enzyme adds the final quantity of the enzyme of reactive system, and by required zymoprotein quality, the enzyme add-on is 0.01mg/ml or higher, preferred 0.02mg/ml or higher.Term " protein mass " is meant by adopting protein determination CBB solution (Nakarai production) and bovine serum albumin as reference material, by the shown value of Xylene Brilliant Cyanine G colorimetry.

In the specific examples of the method for measuring enzymic activity, can in comprising amino acid ester and amine borate buffer solution, react by making enzyme, and the peptide that quantitatively obtains detects enzymic activity as substrate.In example more specifically, method comprises uses the 100mM borate buffer solution (pH 9.0) that comprises 100mM L-alanine methyl ester and 200mM L-glutaminate, makes the enzyme reaction some minutes in 25 ℃.

In addition, the preferred implementation of the coded enzyme of DNA of the present invention comprises that have can be with amino acid ester and amino acid amide all as the enzyme of the ability of the substrate of carboxyl composition.Word " with amino acid ester and amino acid amide all as substrate " be meant at least one class or more multiclass amino acid ester and at least one class or more the multiclass amino acid amide can be used as substrate.In addition, a kind of preferred implementation of enzyme of the present invention has the amino acid of all amino acid, C protection and the amine enzyme as the ability of the substrate of amine component.Word " amino acid of amino acid, C protection and amine are as substrate " is meant at least one class or multiclass amino acid more, the amino acid of at least one class or more multiclass C protection and at least one class or more multiclass amine can be used as substrate.Owing to have the substrate specificity widely of carboxyl composition or amine component, enzyme of the present invention is preferred, wherein can select raw material widely, and it is beneficial in the industrial production needs to expense and production unit successively.

The specific examples of carboxyl composition comprises the L-amino acid ester, D-amino acid ester, L-amino acid amide and D-amino acid amide.In addition, amino acid ester not only comprises and the corresponding amino acid ester of naturally occurring amino acid, also comprises the corresponding amino acid ester of amino acid or derivatives thereof that exists with non-natural.In addition, the example of amino acid ester comprise α-An Jisuanzhi and β-, γ-and omega-amino-acid esters etc., it has different amino binding sites.The representative instance of amino acid ester comprises amino acid whose methyl esters, ethyl ester, n-propyl, isopropyl ester, positive butyl ester, isobutyl ester and the tert-butyl ester.

The specific examples of amine component comprises L-amino acid, the L-amino acid of C protection, D-amino acid, the D-amino acid and the amine of C protection.In addition, the example of amine not only comprises naturally occurring amine, also comprises the amine or derivatives thereof that non-natural exists.In addition, amino acid whose example not only comprises naturally occurring amino acid, also comprises the amino acid or derivatives thereof that non-natural exists.It comprises a-amino acid and β-, γ-and omega-amino acid etc., it has different amino binding sites.

In addition, on the other hand, a kind of preferred implementation of the enzyme that DNA of the present invention is coded comprises that the pH scope of catalysis peptide formation reaction is the enzyme of 6.5-10.5.Preferably can be in above-mentioned wide in range pH scope the enzyme of the present invention of catalyzed reaction, it can adapt to the industrial production that multiple restriction may occur neatly.But in the actual generation of peptide, when using enzyme, preferably further be adjusted to the corresponding optimal pH of gained enzyme so that with the katalysis maximization of enzyme.

And on the other hand, a kind of preferred implementation of the enzyme that DNA of the present invention is coded comprises that the temperature range of catalysis peptide formation reaction is 0-60 ℃ a enzyme.Because endonuclease capable of the present invention is catalyzed reaction in above-mentioned wide in range temperature range, so it is preferred, it can adapt to the industrial production that multiple restriction may occur neatly.But in the actual generation of peptide, when using enzyme, preferably further be adjusted to the corresponding optimum temperuture of gained enzyme so that with the katalysis maximization of enzyme.

(6) two peptide production methods

Two peptide production methods of the present invention are included in when having above-mentioned enzyme, the reaction between carboxyl composition and the amine component.Two peptide production methods of the present invention comprise making to have the enzyme that is generated the ability of peptide by carboxyl composition and amine component, thereby or contain the enzyme thing and act on carboxyl composition and the synthetic dipeptides of amine component.

Making the used enzyme of the present invention or contain method that the enzyme thing acts on carboxyl composition and amine component can be to be mixed with each other enzyme or contain the enzyme thing, carboxyl composition and amine component.More specifically, can adopt enzyme or contain the enzyme thing and add the method that the solution that contains carboxyl composition and amine component makes its reaction then.Alternatively, under the situation of the microorganism that use to produce this enzyme, can use to comprise and cultivate the microorganism that produces this enzyme, in microorganism or microbial culture medium, produce and the accumulation enzyme, then carboxyl composition and amine component be added the method for nutrient solution.Collect the dipeptides that produces by fixed method then, and carry out purifying as required.

Term " contains the enzyme thing " and is meant any material that comprises enzyme, the example of its specific form comprises the culture of the microorganism that can produce enzyme, from the isolating microorganism cells of culture with by handling the product (hereinafter referred to as, " microorganism cells processing product ") that microorganism cells obtains.The culture of microorganism is meant by culturing micro-organisms resulting, more specifically, is meant microorganism cells, is used for the substratum of culturing micro-organisms and the mixture of the material that produced by cultured microorganism etc.In addition, can wash microorganism cells, and use with the form of microorganism cells of washing.In addition, microorganism cells is handled product and is comprised cracking, dissolving or freeze dried microorganism cells etc., also comprise by handling thick enzyme that microorganism cells reclaims etc., and the enzyme of the purifying that obtains by the thick enzyme of purifying etc.The partially purified enzyme that obtains by multiple purification process can be used as the enzyme of purifying, maybe can use by method fixed immobilized enzyme such as covalent attachment method, absorption method, entrapping methods.In addition, because certain micro-organisms can generating unit divide cracking (depending on employed microorganism) in the training period, culture supernatant also can be used as and contain the enzyme thing at this moment.

In addition, wild strain can be used as the microorganism that comprises enzyme, or also can use the gene recombination bacterial strain of expressing this enzyme.Microorganism is not limited to complete microorganism cells, can also use the microorganism cells of acetone treatment, cryodesiccated microorganism cells or other treated microorganism cells.Can also use by covalent attachment method, absorption method, entrapping method or other method fixation of microbe cell and microorganism cells and handle fixation of microbial cell and the fixation of microbial cell processing product that product obtains, and the fixation of microbial cell of handling.

In addition, when handling product, wherein can occur not participating in the enzyme that peptide generates usually and decompose the peptide that generates when the microorganism cells that uses culture, cultured microorganism cell, washing or by the microorganism cells that fragmentation or cracking microorganism cells obtain.At this moment, preferred inhibitors of metalloproteinase such as the ethylenediamine tetraacetic acid (EDTA) (EDTA) of adding under some situation.Add-on is 0.1 mmole (mM)-300mM, preferred 1mM-100mM.

The preferred implementation of two peptide production methods of the present invention is following methods, cultivates above-mentioned (4-2) described transformant in substratum, and peptide-forming enzyme is accumulated in substratum and/or transformant.Because by using transformant can easily produce peptide-forming enzyme in a large number, so can be in a large number and produce dipeptides apace.

Reach the target effect if enzyme or the usage quantity that contains the enzyme thing demonstrate, then this amount is enough (significant quantity), and those of ordinary skills can easily determine this significant quantity by simple preliminary experiment.For example, under the situation of using enzyme, usage quantity is the about 100U of about 0.01U-, and under the situation of the microorganism cells that uses washing, usage quantity is the about 500g/L of about 1g/L-.

Any carboxyl composition is spendable, as long as it can generate peptide by the condensation with other material of amine component form.The example of carboxyl composition comprises the L-amino acid ester, D-amino acid ester, L-amino acid amide and D-amino acid amide and the organic acid acetic that does not contain amino.In addition, the example of amino acid ester not only comprises and the corresponding amino acid ester of naturally occurring amino acid, also comprises the corresponding amino acid ester of amino acid or derivatives thereof that exists with non-natural.In addition, the example of amino acid ester comprise α-An Jisuanzhi and β-, γ-and omega-amino-acid esters etc., it has different amino binding sites.The representative instance of amino acid ester comprises amino acid whose methyl esters, ethyl ester, n-propyl, isopropyl ester, positive butyl ester, isobutyl ester and the tert-butyl ester.

Any amine component is spendable, as long as it can generate peptide by the condensation with other material of amine component form.The example of amine component comprises L-amino acid, the L-amino acid of C protection, D-amino acid, the D-amino acid and the amine of C protection.In addition, the example of amine not only comprises naturally occurring amine, also comprises the amine or derivatives thereof that non-natural exists.In addition, amino acid whose example not only comprises naturally occurring amino acid, also comprises the amino acid or derivatives thereof that non-natural exists.It comprises a-amino acid and β-, γ-and omega-amino acid etc., it has different amino binding sites.

Be respectively 1mM to 10M as the carboxyl composition of raw material and the concentration of amine component, be preferably 0.05M to 2M; But, in some cases, preferably to add amine component with carboxyl become to grade mole or the amount of molar excess.In addition, under the situation of the material inhibited reaction of high density, can after being adjusted to the concentration that does not cause suppressing, it during reaction it be added step by step.

Allow that peptide synthetic temperature of reaction is 0-60 ℃, preferred 5-40 ℃.In addition, allow that peptide synthetic reaction pH is 6.5-10.5, preferred 7.0-10.0.

Embodiment

Below, explain the present invention by embodiment.But the present invention is not limited to these embodiment.Except the triketohydrindene hydrate dyeing (qualitative) with membrane chromatographic confirms, implement detection by quantitative so that measure product by following high performance liquid chromatography.Post: Inertsil ODS-2 (production of GLScience company), elutriant: phosphate aqueous solution, wherein comprise 5.0mM 1-perfluorooctane sulfonate (pH 2.1): methyl alcohol=100: 15-50, flow velocity: 1.0mL/ minute, detect: 210 nanometers (hereinafter referred to as " nm ").

(embodiment 1) microorganism culturing (short steady bacillus strain FERM BP-8113)

In 500ml slope Kou Shi bottle, add 50mL every liter (L) and contain the substratum (pH 6.2) of 5 gram (g) glucose, 5g ammonium sulfate, 1g potassium primary phosphate, 3g dipotassium hydrogen phosphate, 0.5g sal epsom, 10g yeast extract and 10g peptone, 115 ℃ of sterilizations 15 minutes.Contained on the same substratum at inoculation 1 platinum loop on this substratum then, cultivated 16 hours the steady bacillus strain FERM of weak point BP-8113 (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst has speciallyyed permit biological sustenance center for 30 ℃, preservation mechanism address: Chuo Dai-6,1-1Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: cell on July 8th, 2002), at 30 ℃, 120 reciprocal/minute following concussions were cultivated 16 hours then.

(embodiment 2) produce peptide with microorganism cells

To the medium centrifugal (10,000 rev/mins (rpm), 15 minutes) that obtains among the embodiment 1, collect microorganism cells, then it being suspended to concentration in containing the 100mM borate buffer solution of 10mM EDTA (pH 9.0) is 100g/L.Contain in following carboxyl composition of 10mM EDTA, 200mM and the following amino acid whose 100mM borate buffer solution of 400mM (pH9.0) at each 1mL, add this suspension of 1ml respectively, make total amount, 18 ℃ of reactions 2 hours to 2mL.Shown the peptide that this reaction result generated in the table 1.

Table 1

(all carboxyl compositions are all used hydrochloride.)

The purifying of (embodiment 3) enzyme

Step after centrifugal is on ice or 4 ℃ of enforcements.(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to cultivate short steady bacillus strain FERM BP-g113 according to the method identical with embodiment 1, preservation mechanism address: Chuo Dai-6,1-1 Higashi1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: on July 8th, 2002), collect microorganism cells by centrifugal (10,000rpm, 15 minutes).After with 50mM Tris-HCl damping fluid (pH 8.0) washing 16g microorganism cells, it is suspended in 40 milliliters of (ml or mL) same buffer, carry out ultrasonic degradation with 195 watts then and handled 45 minutes.Centrifugal then this ultrasonic degradation liquid (10,000rpm, 30 minutes) to remove cell debris, obtains ultrasonic degradation liquid supernatant., remove insoluble part by ultracentrifugation (50,000rpm, 30 minutes) then, thereby obtain the soluble part of supernatant liquor form this ultrasonic degradation liquid supernatant dialysed overnight with 50mM Tris-HCl damping fluid (pH8.0).The soluble part adding that obtains is used in Tris-HCl damping fluid (pH 8.0) the equilibrated Q-Sepharose HP post (Amersham production) in advance, from non-absorbed portion, collected active part then.With 50mM acetate buffer (pH 4.5) to this active part dialysed overnight, then by centrifugal (10,000rpm, 30 minutes) thus remove the part that insoluble part obtains the dialysis of supernatant liquor form.The part that to dialyse then adds to be used in 50mM acetate buffer (pH 4.5) the equilibrated Mono S post (Amersham production) in advance, with the linear concentration gradient wash-out enzyme of the same buffer that contains 0-1M NaCl.The part that contains minimum level contaminating protein matter in the active part is added in advance with containing in 50mM acetate buffer (pH 4.5) the equilibrated Superdex 200pg post (Amersham product) of 1M NaCl, by making same buffer (pH 4.5) post of flowing through that contains 1M NaCl implement gel-filtration, obtain active part solution.The result of aforesaid operations confirmed, according to electrophoretic experimental result, used peptide-forming enzyme is by purifying equably among the present invention.The enzyme rate of recovery in the above-mentioned purification step is 12.2%, and purification degrees is 707 times.

(embodiment 4) detect the molecular weight of enzyme

(SDS-gel electrophoresis)

0.3 microgram (μ g) equivalent to the enzyme part of the method gained purifying by embodiment 3 carries out polyacrylamide gel electrophoresis.With 0.3% (w/v) Tris, 1.44% (w/v) glycine and 0.1% (w/v) Sulfuric acid,monododecyl ester, sodium salt are as electrophoretic buffer, gel (the Multigel 10-20 that will have the concentration gradient of 10-20% gel strength, Daiichi Pure Chemicals produces) as polyacrylamide gel, Pharmacia molecular weight marker thing is used as the molecular weight marker thing.After electrophoresis is finished, to gel-colored, find the homogeneous band in the molecular weight position of about 75 kilodaltons (kDa) with Xylene Brilliant Cyanine G R-250.

(gel-filtration)

The enzyme of method gained purifying that will be by embodiment 3 partly adds in advance with containing in 50mM acetate buffer (pH 4.5) the equilibrated Superdex 200pg post (Amersham product) of 1M NaCl, by making the same buffer (pH 4.5) that contains 1M NaCl thus the post of flowing through is implemented gel-filtration detection molecules amount.The molecular weight marker thing that Pharmacia molecular weight marker thing is used as the known molecular amount is to make working curve.As a result, the molecular weight of this enzyme is about 150kDa.

According to the result of SDS-gel electrophoresis and gel-filtration, pointing out this enzyme is the homodimer with molecular weight of about 75kDa.

The optimal pH of (embodiment 5) enzyme reaction

Generating in the reaction of L-alanyl-L-glutamine, detect the influence of pH by L-alanine methyl ester hydrochloride and L-glutaminate.With acetate buffer (pH 3.9-5.4), MES damping fluid (pH 5.4-6.4), phosphate buffered saline buffer (pH 6.0-7.9), borate buffer solution (pH 7.8-9.3), CAPS damping fluid (pH 9.3-10.7), and K ₂HPO ₄-NaOH damping fluid (pH 10.8-11.6) is as damping fluid.1 microlitre (μ l) the Mono S enzyme part (about 180U/ml) that obtains among the embodiment 3 is added 100 μ l contain 100mM L-alanine methyl ester, in each damping fluid (100mM) of 200mM L-glutaminate and 10mM EDTA, make it 18 ℃ of reactions 5 minutes, detect the influence of pH reaction.Shown among Fig. 1 that the value by will use borate buffer solution (pH 9.3) time is decided to be 100% result who represents.As a result, find that optimal pH is 8-9.5.

The optimum temperuture of (embodiment 6) enzyme reaction

Generating in the reaction of L-alanyl-L-glutamine the influence of detected temperatures by L-alanine methyl ester hydrochloride and L-glutaminate.1 μ l is partly added 100 μ l with embodiment 5 used identical enzymes contain 100mM L-alanine methyl ester, in the 100mM borate buffer solution of 200mM L-glutaminate and 10mM EDTA (pH 9.0), it was reacted 5 minutes under each temperature, and detected temperatures is to the influence of reaction.Shown among Fig. 2 by being decided to be 100% result who represents at the activity value under 34 ℃.As a result, optimum temperuture is 30-40 ℃.

(embodiment 7) enzyme inhibitors

Adopt L-alanine methyl ester hydrochloride and L-glutaminate as substrate, detect inhibitor producing the influence of L-alanyl-L-glutamine.2 μ l are partly added 50 μ l with embodiment 5 used identical enzymes contain in the 100mM borate buffer solution (pH 9.0) of each enzyme inhibitors shown in the 10mM table 2, make it 25 ℃ of reactions 5 minutes.Notice that before use, with phenanthrolene, phenylmethylsulfonyl fluoride and p-nitrophenyl-p '-guanidine benzoate are dissolved in the methyl alcohol, concentration is 50mM.L-alanyl-L-glutamine generation value when not having inhibitor peptides is decided to be 100, and the enzymic activity under each condition provides with relative reactivity.The result is as shown in table 2.As a result, in the serinase inhibitor that is detected, enzyme is not suppressed by phenylmethyl sulfonylfluoride, but it is suppressed by p-nitrophenyl-p '-guanidine benzoate.

Table 2

(embodiment 8) produce the L-alanyl-L-glutamine by L-alanine methyl ester and L-glutaminate

3 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain 100mM L-alanine methyl ester hydrochloride, 200mM L-glutaminate and 10mM EDTA 100mM borate buffer solution (pH 9.0) in, make it 18 ℃ of reactions.The result generates 83mM L-alanyl-L-glutamine (L-Ala-L-Gln) as shown in Figure 3 in adding the enzyme district, the concentration of by product L-Ala-L-Ala-L-Gln is 1.3mM.On the other hand, almost do not observe any generation of L-Ala-L-Gln in not adding the enzyme district, enzyme concn only is about 0.07mM after 120 minutes and react.

(embodiment 9) L-glutaminate concentration is to producing the influence of L-alanyl-L-glutamine

1 μ l is partly added 100 μ l with embodiment 5 used identical enzymes contain 100mM L-alanine methyl ester hydrochloride, in the 100mM borate buffer solution of the L-glutaminate of concentration shown in the table 3 and 10mM EDTA (pH 9.0), make it 18 ℃ of reactions 2 hours.The result is as shown in table 3.

Table 3

The substrate specificity (1) of (embodiment 10) enzyme

As under the situation of carboxyl composition, detect the ester specificity at the L-amino acid ester.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the carboxyl composition shown in the 100mM table 4, in the 100mM borate buffer solution of 200mM L-glutaminate and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 2 hours.The growing amount (HCl represents hydrochloric acid in the table 4) that has shown L-Ala-L-Gln in this reaction in the table 4.

Table 4

The carboxyl composition	The L-Ala-L-Gln (mM) that generates
The carboxyl composition	The L-Ala-L-Gln (mM) that generates	L-alanine methyl ester HCl L-alanine ethyl ester HCl L-L-Ala isopropyl ester HCl L-L-Ala-tert-butyl ester HCl	84.3 91.5 78.9 7.5

The substrate specificity (2) of (embodiment 11) enzyme

Be used as under the situation of amine component as carboxyl composition and multiple L-amino acid at the L-alanine methyl ester, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain 100mM L-alanine methyl ester hydrochloride, in the 100mM borate buffer solution of L-amino acid shown in the 150mM table 5 and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 5.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard, and " tr " expression trace).

Table 5

The substrate specificity (3) of (embodiment 12) enzyme

Be used as under the situation of amine component as carboxyl composition and L-glutaminate at multiple L-amino acid methyl ester, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the L-amino acid methyl ester hydrochloride (AA-OMeHCl) shown in the 100mM table 6, in the 100mM borate buffer solution of 150mM L-glutaminate and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 6.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard, and " tr " expression trace).In addition, when using L-Trp-OMe and L-Tyr-Ome, in reactive system, add Tween-80 to final concentration be 0.1%.

Table 6

(all carboxyl compositions are all used hydrochloride.)

(embodiment 13) enzyme substrates specificitys (4)

Be used as under the situation of amine component as carboxyl composition and multiple L-amino acid at multiple L-amino acid methyl ester, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the L-amino acid methyl ester hydrochloride (AA-OMeHCl) shown in the 100mM table 7, in the 100mM borate buffer solution of 150mM L-glutaminate and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown each peptide that is generated in this reaction in the table 7.(" tr " represents trace).In addition, when using L-Trp-OMe, in reactive system, add Tween-80 to final concentration be 0.1%.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard).

Table 7

(all carboxyl compositions are all used hydrochloride.)

(embodiment 14) enzyme substrates specificitys (5)

Be used as carboxyl composition and L or D type multiple amino acids as under the situation of amine component at L or D type multiple amino acids methyl esters, detection of peptides generates.With 2 μ l and embodiment 5 used identical enzymes partly add 100 μ l contain the L-amino acid methyl ester hydrochloride shown in the 100mM table 8 (from-OMeHCl), in the 100mM borate buffer solution of multiple amino acids shown in the 150mM table 8 and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 8.(" tr " represents trace).

Table 8

(all carboxyl compositions are all used hydrochloride.)

The substrate specificity (6) of (embodiment 15) enzyme

Be used as under the situation of amine component as carboxyl composition and multiple L-amino acid at multiple L-amino acid amide, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the L-amino acid amide hydrochloride (AA-NH shown in the 100mM table 9 ₂HCl), in the 100mM borate buffer solution of L-amino acid shown in the 150mM table 9 and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 9.

Table 9

The carboxyl composition	Amine component	The peptide that generates	(mM)
The carboxyl composition	Amine component	The peptide that generates	(mM)	L-Phe-NH ₂	L-Gln	L-Phe-L-Gln	0.2
L-Phe-NH ₂	L-Ser	L-Phe-L-Ser	0.6	L-Phe-NH ₂	L-Gln	L-Phe-L-Gln	0.2
L-Phe-NH ₂	L-Ser	L-Phe-L-Ser	0.6	L-Ala-NH ₂	L-Gln	L-Ala-L-Gln	7.6
L-Ala-NH ₂	L-Met	L-Ala-L-Met	3.4	L-Ala-NH ₂	L-Gln	L-Ala-L-Gln	7.6
L-Ala-NH ₂	L-Met	L-Ala-L-Met	3.4	L-Ala-NH ₂	L-His	L-Ala-L-His	3.9
L-Thr-NH ₂	L-Gln	L-Thr-L-Gln	0.3	L-Ala-NH ₂	L-His	L-Ala-L-His	3.9

The substrate specificity (7) of (embodiment 16) enzyme

Be used as under the situation of amine component at the L-amino acid of multiple L-alanine methyl ester as carboxyl composition and C protection, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the L-alanine methyl ester hydrochloride (Ala-OMeHCl) shown in the 100mM table 10, in the 100mM borate buffer solution of L-amino acid amide hydrochloride shown in the 150mM table 10 and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 10.

Table 10

The substrate specificity (8) of (embodiment 17) enzyme

Be used as under the situation of amine component as carboxyl composition and methylamine at the multiple amino acids methyl esters, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the L-amino acid methyl ester hydrochloride (AA-OMeHCl) shown in the 100mM table 11, in the 100mM borate buffer solution of methylamine shown in the 150mM table 11 and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 11.

Table 11

The substrate specificity (9) of (embodiment 18) enzyme

Be used as under the situation of amine component as carboxyl composition and beta-amino acids at beta-amino acid esters, detection of peptides generates.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the carboxyl composition shown in the 100mM table 12, in the 100mM borate buffer solution of amine component shown in the 150mM table 12 and 10mMEDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 12.(" tr " represents trace).

Table 12

The carboxyl composition	Amine component	The peptide that generates	(mM)
The carboxyl composition	Amine component	The peptide that generates	(mM)	Gly-OMe	β-Ala	Gly-β-Ala	2.2
Gly-OMe	β-Phe	Gly-β-Phe	0.4	Gly-OMe	β-Ala	Gly-β-Ala	2.2
Gly-OMe	β-Phe	Gly-β-Phe	0.4	L-Ala-OMe	β-Ala	Ala-β-Ala	7.7
L-Ala-OMe	β-Phe	Ala-β-Phe	1.4	L-Ala-OMe	β-Ala	Ala-β-Ala	7.7
L-Ala-OMe	β-Phe	Ala-β-Phe	1.4	L-Thr-OMe	β-Ala	Thr-β-Ala	3.2
L-Thr-OMe	β-Phe	Thr-β-Phe	1.4	L-Thr-OMe	β-Ala	Thr-β-Ala	3.2
L-Thr-OMe	β-Phe	Thr-β-Phe	1.4	β-Ala-OMe	L-α-Ala	β-Ala-L-α-Ala	tr
β-Ala-OMe	β-Ala	β-Ala-β-Ala	0.2	β-Ala-OMe	L-α-Ala	β-Ala-L-α-Ala	tr
β-Ala-OMe	β-Ala	β-Ala-β-Ala	0.2	β-Ala-OMe	L-Gln	β-Ala-L-Gln	0.6
β-Ala-OMe	L-Ser	β-Ala-L-Ser	3.2	β-Ala-OMe	L-Gln	β-Ala-L-Gln	0.6

All carboxyl compositions are all used hydrochloride.

The substrate specificity (10) of (embodiment 19) enzyme

Be used as under the situation of amine component as carboxyl composition and peptide at the L-amino acid ester, detect oligopeptides and generate.2 μ l are partly added 100 μ l with embodiment 5 used identical enzymes contain the carboxyl composition shown in the 100mM table 13, in the 100mM borate buffer solution of amine component shown in the 150mM table 13 and 10mM EDTA (pH 9.0), make it 25 ℃ of reactions 3 hours.The growing amount that has shown multiple peptide in this reaction in the table 13.The result clearly shows enzyme of the present invention can not only generate dipeptides, can also be by peptide is generated the long-chain peptide as amine component.

Shown in above-mentioned embodiment 9-20, the enzyme of the present invention that is obtained by short steady bacillus strain FERM BP-18545 is determined has substrate specificity very widely.

Table 13

(*: because the solubleness of L-Ala-L-Ala-L-Ala-L-Ala-L-Ala is low, so the concentration of the carboxyl composition that uses in this reactive system is 10mM, the concentration of the amine component that uses is 15mM.Other condition identical with described in the foregoing description.All carboxyl compositions are all used hydrochloride)

(embodiment 20) compare the ability that the catalysis peptide generates with known enzyme

Enzyme of the present invention and known enzyme are compared the ability that the catalysis peptide generates.Sulfydryl endopeptidase described in carboxypeptidase y described in the EP 278787A1 and the EP 359399B1 (ficin, papoid, bromeline and Disken) is used as known enzyme, and its form with the enzyme of purifying is used (Sigma production).The enzyme of even purifying is used as the source of enzyme of the present invention among the embodiment 3.These enzymes are added in the reactive system with the proteinic amount shown in the table 14.Enzyme is added 100 μ l contain in the borate buffer solution (pH 9.0) of 100mM L-alanine methyl ester hydrochloride and 200mM L-glutaminate, make gains 25 ℃ of reactions.Note, used carboxypeptidase is dissolved in the 10mM acetate buffer (pH 5.0) that contains 1mM EDTA, contain 2mM EDTA and used sulfydryl endopeptidase is dissolved in, in the 10mM acetate buffer of 0.1M KCl and 5mM dithiothreitol (DTT) (pH 5.0).The ratio that has shown the L-alanyl-L-glutamine productivity of these enzymes in the table 14.

As a result,, and compare, in the district that adds carboxypeptidase or sulfydryl endopeptidase, observe the slight increase of productivity with the district that does not add enzyme even in the generation of the L-alanyl-L-glutamine that does not have also to observe under the situation of enzyme utmost point trace.On the contrary, observe high relatively L-alanyl-L-glutamine productivity in adding the district of enzyme of the present invention, the productivity of this productivity ratio carboxypeptidase y and sulfydryl endopeptidase is high about 5,000-100,000 times.As mentioned above, enzyme of the present invention is proved and has the high peptide productivity different with known enzyme in the prior art.In addition, enzyme of the present invention is the dimer with molecular weight of about 75,000.On the contrary, it is about 61,000 that the molecular weight of carboxypeptidase y has been reported as, and that the molecular weight of sulfydryl endopeptidase has been reported as is about 23,000-36,000.Therefore, as shown in the Examples, compare with the L-alanyl-L-glutamine productivity of carboxypeptidase y and sulfydryl endopeptidase, even the situation that the L-alanyl-L-glutamine survival rate of enzyme of the present invention also is higher than it when productivity is represented with every molal weight when representing with per unit weight.

Table 14

Enzyme	The add-on of enzyme (protein mg/ml)	L-Ala-L-Gln productivity (mM/min)	The ratio of L-Ala-L-Gln productivity/unit of enzyme weight
Enzyme	The add-on of enzyme (protein mg/ml)	L-Ala-L-Gln productivity (mM/min)	The ratio of L-Ala-L-Gln productivity/unit of enzyme weight	No enzyme	0	0.0006
Carboxypeptidase y	0.61	0.0257	0.0191	No enzyme	0	0.0006
Carboxypeptidase y	0.61	0.0257	0.0191	Ficin	2.60	0.0096	0.0017
Papoid	2.30	0.0106	0.0021	Ficin	2.60	0.0096	0.0017
Papoid	2.30	0.0106	0.0021	Bromeline	2.80	0.0062	0.0010
Chymopapain	3.60	0.0100	0.0013	Bromeline	2.80	0.0062	0.0010
Chymopapain	3.60	0.0100	0.0013	Enzyme of the present invention	0.02	4.4000	100.0

(embodiment 21) produce the L-alanyl-L-glutamine with the microorganism cells of Sphingobacterium sp.

In 500ml slope Kou Shi bottle, add 50mL every liter (L) and contain 5g glucose, 5g ammonium sulfate, the 1g potassium primary phosphate, the 3g dipotassium hydrogen phosphate, 0.5g sal epsom, the substratum of 10g yeast extract and 10g peptone (pH 6.2), (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to be used to cultivate Sphingobacterium sp. bacterial strain FERM BP-8124 in 15 minutes 115 ℃ of sterilizations, preservation mechanism address: Chuo Dai-6,1-1Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002).That inoculates 1 platinum loop cell then on this substratum contains 5g glucose at every liter (L), the 10g yeast extract, slant agar substratum (the agar: 20g/L of 10g peptone and 5g NaCl, pH 7.0) on, cultivated 24 hours Sphingobacterium sp. bacterial strain FERM BP-8124 (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst has speciallyyed permit biological sustenance center for 30 ℃, preservation mechanism address: Chuo Dai-6,1-1 Higashi1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002), at 30 ℃, 120 reciprocal/minute following concussions were cultivated 20 hours then.Then this nutrient solution of 1ml is added above-mentioned substratum (50mL/500ml slope Kou Shi bottle), cultivated 18 hours in 30 ℃.After cultivation is finished, by centrifugal from nutrient solution the separate microorganism cell, then it is suspended in the 0.1M borate buffer solution (pH 9.0) that contains 10mM EDTA, its concentration is 100g/L, in wet microorganism cells.In this microorganism cells suspension of 0.1ml, add 0.1ml then and contain 10mM EDTA, in the 100mM borate buffer solution of 200mM L-alanyl methyl ester hydrochloride and 400mM L-glutaminate (pH 9.0).0.2mL gained mixture was reacted 120 minutes at 25 ℃.The concentration of the L-alanyl-L-glutamine that produce this moment is 62mM.

(embodiment 22) are from the purifying of the enzyme of Sphingobacterium sp.

Following steps after centrifugal are on ice or 4 ℃ of enforcements.(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to cultivate Sphingobacterium sp. bacterial strain FERM BP-8124 according to the method identical with embodiment 21, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002), collect microorganism cells by centrifugal (10,000rpm, 15 minutes).Behind 20mM Tris-HCl damping fluid (pH 7.6) washing 2g microorganism cells, it is suspended in the 8ml same buffer, carry out ultrasonic degradation with 195W then and handled 45 minutes.Centrifugal then this ultrasonic degradation liquid (10,000rpm, 30 minutes) to remove cell debris, obtains ultrasonic degradation liquid supernatant.With 20mM Tris-HCl damping fluid (pH 7.6) to this ultrasonic degradation liquid supernatant dialysed overnight, then by ultracentrifugation (50,000rpm, 30 minutes) thus remove the soluble part that insoluble part obtains the supernatant liquor form.The soluble part adding that obtains is used in Tris-HCl damping fluid (pH 7.6) the equilibrated Q-Sepharose HP post (Amersham production) in advance, from non-absorbed portion, collected active part.With 20mM acetate buffer (pH 5.0) to this active part dialysed overnight, then by centrifugal (10,000rpm, 30 minutes) thus remove the part that insoluble part obtains the dialysis of supernatant liquor form.The part of this dialysis added use in advance in 20mM acetate buffer (pH 5.0) the equilibrated SP-Sepharose HP post (Amersham production), with the linear concentration gradient wash-out enzyme of the same buffer that contains 0-1M NaCl.

(embodiment 23) use enzyme part producing L-alanyl-L-glutamine

SP-Sepharose HP part (about 27U/ml) the adding 90 μ l of purifying among the 10 μ l embodiment 22 are contained 111mM L-alanine methyl ester hydrochloride, 222mM L-glutaminate and 11mMEDTA 111mM borate buffer solution (pH 9.0) in, make its 25 ℃ the reaction 120 minutes.As a result, in the district that adds enzyme, generate 73mM L-alanyl-L-glutamine.On the other hand, almost do not observe any generation of L-Ala-L-Gln in not adding the district of enzyme, enzyme concn only is about 0.07mM after 120 minutes and react.

The substrate specificity (11) of (embodiment 24) enzyme

Detection comes from Sphingobacterium sp. bacterial strain FERM BP-8124, and (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center, preservation mechanism address: ChuoDai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: the substrate specificity of enzyme on July 22nd, 2002).100 μ l are comprised multiple carboxyl composition shown in the table 15-1 to 15-4 that final concentration is 100mM and final concentration is the various kinds of amine composition of 150mM, the SP-Sepharose HP enzyme of purifying part among the embodiment 22 (adding 0.33 unit in the reaction solution) and the 100mM borate buffer solution (pH 9.0) of 10mM EDTA reacted 1.5 hours at 25 ℃.The growing amount that has shown multiple peptide in this reaction in the table 15.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard, and " tr " expression trace).In addition, when using L-Tyr-Ome, in reactive system, add Tween-80 to final concentration be 0.1%.In addition, all use hydrochloride for all carboxyl compositions.

Table 15-1

Table 15-2

Table 15-3

Table 15-4

All amino acid amides are all used hydrochloride.

The substrate specificity (12) of (embodiment 25) enzyme

Detection comes from Sphingobacterium sp. bacterial strain FERM BP-8124, and (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center, preservation mechanism address: ChuoDai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: the substrate specificity about the oligopeptides generation of enzyme on July 22nd, 2002).100 μ l are comprised the various kinds of amine composition shown in the table 16 that multiple carboxyl composition that final concentration is 100mM and final concentration be 150mM, and the SP-Sepharose HP enzyme of purifying part among the embodiment 22 (adding 0.33 unit in the reaction solution) and the 100mM borate buffer solution (pH 9.0) of 10mM EDTA reacted 1.5 hours at 25 ℃.The growing amount that has shown each oligopeptides in this reaction in the table 16.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard, and " tr " expression trace).In addition, all use hydrochloride for all carboxyl compositions.

Table 16

The substrate specificity (13) of (embodiment 26) enzyme

Adopt with embodiment 5 employed identical enzyme parts and further estimate substrate specificity.

100 μ l are comprised reaction soln with the 100mM borate buffer solution (pH 9.0) of each the carboxyl composition of final concentration shown in the table 17 and amine component and 10mM EDTA in the reaction times shown in 25 ℃ of reaction tables 17.The growing amount that has shown multiple peptide in this reaction in the table 17.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard, and " tr " expression trace).

(abbreviation)

H-Ala-Ome:L-alanine methyl ester hydrochloride

H-p-F-Phe-Ome:p-fluoro-L-phenylalanine methyl ester hydrochloride

H-Cl-F-Phe-Ome:p-chloro-L-phenylalanine methyl ester hydrochloride

H-p-NO ₂-Phe-Ome:p-nitro-L-phenylalanine methyl ester hydrochloride

H-t-Leu-Ome: uncle-L-leucine methyl ester hydrochloride

H-2-Nal-OMe:3-(2-naphthyl)-L-alanine methyl ester hydrochloride

H-Aib-Ome: α-An Jiyidingsuan methyl ester hydrochloride

H-N-Me-Ala-OMe:N-methyl-L-alanine methyl ester hydrochloride

H-CHA-Ome: β-cyclohexyl-L-alanine methyl ester hydrochloride

H-Ser (the tBu)-Ome:O-tertiary butyl-L-serine methyl ester hydrochloride

H-Asp (OtBu)-Ome:L-Aspartic Acid β-tertiary butyl ester α-methyl ester hydrochloride

H-Lys (Boc)-Ome:N-ε-uncle-butoxy carbonyl-L-lysine methyl ester hydrochloride

H-p-F-Phe-OH:p-fluoro-L-phenylalanine

H-Cl-F-Phe-OH:p-chloro-L-phenylalanine

H-p-NO ₂-Phe-OH:p-nitro-L-phenylalanine

The H-t-Leu-OH:tert-L-leucine

H-2-Nal-OH:3-(2-naphthyl)-L-L-Ala

The H-Gln-OH:L-glutamine

The H-Phe-OH:L-phenylalanine

H-Ser (the tBu)-OH:O-tertiary butyl-L-Serine

H-Asp (OtBu)-OH:L-Aspartic Acid β-tertiary butyl ester

H-Lys (Boc)-OH:N-ε-uncle-butoxy carbonyl-L-Methionin

The substrate specificity (14) of (embodiment 27) enzyme

Adopt the substrate specificity of enzyme part (the come from short steady bacillus) assessment identical about the oligopeptides generation with embodiment 5.To comprise final concentration each carboxyl composition and amine component as shown in Table 18,100 μ l reaction solns of the 100mM borate buffer solution (pH 9.0) of enzyme (Board Lot that adds in the reaction soln is shown in table 18) and 10mM EDTA were 25 ℃ of reactions 3 hours.The growing amount that has shown multiple oligopeptides in this reaction in the table 18.(generation of mark "+" expression peptide is confirmed but can not be by quantitatively owing to lack standard, and " tr " expression trace).Should be noted that for all carboxyl compositions and all use hydrochloride.

Table 18

The carboxyl composition	Amine component	Enzyme amount (unit)	The peptide that generates	(mM)
The carboxyl composition	Amine component	Enzyme amount (unit)	The peptide that generates	(mM)	Gly-OMe	L-Phe-L-Met	1.0	Gly-Phe-Met	13.3
L-Ala-OMe	L-Phe-L-Met	0.2	L-Ala-L-Phe-L-Met	+	Gly-OMe	L-Phe-L-Met	1.0	Gly-Phe-Met	13.3
L-Ala-OMe	L-Phe-L-Met	0.2	L-Ala-L-Phe-L-Met	+	L-Tyr-OMe	Gly-Gly-L-Phe-L-Met	1.0	L-Tyr-Gly-Gly-L-Phe-L-Met	2.7
L-Ala-OMe	Gly-Gly-L-Phe-L-Met	0.2	L-Ala-Gly-Gly-L-Phe-L-Met	+	L-Tyr-OMe	Gly-Gly-L-Phe-L-Met	1.0	L-Tyr-Gly-Gly-L-Phe-L-Met	2.7
L-Ala-OMe	Gly-Gly-L-Phe-L-Met	0.2	L-Ala-Gly-Gly-L-Phe-L-Met	+	Gly-OMe	Gly-L-Phe	0.1	Gly-L-Phe	17.3
L-Ala-OMe	Gly-L-Phe	0.1	L-Ala-Gly-L-Phe	+	Gly-OMe	Gly-L-Phe	0.1	Gly-L-Phe	17.3
L-Ala-OMe	Gly-L-Phe	0.1	L-Ala-Gly-L-Phe	+	D-Ala-OMe	Gly-L-Phe	0.1	D-Ala-Gly-L-Phe	Tr

(embodiment 28) come from the separation of the peptide-forming enzyme gene of short steady bacillus

Below, will the separation of peptide-forming enzyme gene have been described.(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to short steady bacillus strain FERM BP-8113, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: on July 8th, 2002) be used as microorganism.In the separation of gene, intestinal bacteria JM-109 is used as the host, and pUC118 is used as carrier.

(1) prepares the PCR primer according to the aminoacid sequence of determining

Based on, (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to come from short steady bacillus strain FERM BP-8113 according to the EdmanShi decomposition method by the digestion of lysyl endopeptidase, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: the determined aminoacid sequence of lysyl endopeptidase digestion product (SEQ ID NOs:1 and 2) that peptide-forming enzyme on July 8th, 2002) obtains, preparation has the mix primer of base sequence shown in SEQ ID NO:3 and the SEQ ID NO:4 respectively.

(2) preparation of microorganism cells

(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center will to lack steady bacillus strain FERM BP-8113, preservation mechanism address: Chuo Dai-6,1-1Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: on July 8th, 2002) (contain 50g/l glucose, 10g/l yeast extract, 10g/l peptone, 5g/l sodium-chlor and 20g/l agar at the CM2G nutrient agar, pH 7.0) on, cultivated 24 hours in 30 ℃.Inoculation 1 platinum loop gained microorganism cells in the 500ml slope Kou Shi bottle that contains 50ml CM2G liquid nutrient medium (the above-mentioned substratum except that agar) is then 30 ℃ of shaking culture.

(3) from microorganism cells, prepare chromosomal DNA

At first, with 50mL medium centrifugal (12,000rpm, 4 ℃, 15 minutes), collect microorganism cells.Then, adopt QIAGEN Genomic-Tip System (Qiagen),, from microorganism cells, obtain chromosomal DNA according to step described in its specification sheets.

(4) contain the dna fragmentation of the part of peptide-forming enzyme gene by PCR preparation

Adopt LA-Taq (Takara Shuzo production), pass through PCR method, acquisition contains and comes from short steady bacillus strain FERM BP-8113 (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center, preservation mechanism address: Dai-6,1-1 Higashi1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: the dna fragmentation of the part of peptide-forming enzyme gene on July 8th, 2002).Adopt the primer of the base sequence that contains SEQ ID NOs:3 and 4 then, (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to coming from short steady bacillus strain FERMBP-8113, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: chromosomal DNA on July 8th, 2002) carries out PCR.

Adopt Takara PCR Thermal Cycler PERSONAL (Takara Shuzo production), implement 30 round-robin PCR reactions by following condition.

94 ℃ 30 seconds

52 ℃ 1 minute

72 ℃ 1 minute

After the reaction, carry out 0.8% agarose electrophoresis with 3 μ l reaction solutions.As a result, confirm that the dna fragmentation that increases is about 1.5 kilobase (kb).

(5) by gene library clone peptide-forming enzyme gene

In order to obtain the total length peptide-forming enzyme gene, adopt the dna fragmentation that in the PCR step, increases to carry out Southern hybridization as probe.Molecular Cloning, 2nd edition has described the step that Southern is hybridized among the ColdSpring Harbor Press (1989).

About 1.5kb dna fragmentation by the amplification of PCR step separates by 0.8% agarose electrophoresis.Downcut the target band then, purifying DNA fragment.Adopt DIG High Prime (Boehringer-Mannheim production), according to step described in the specification sheets of test kit, with probe digoxin (digoxinigen) labeled dna fragment.

Behind the chromosomal DNA of the steady bacillus of weak point that is obtained in the step (3) of complete digestion present embodiment 28 (3), gained DNA was being carried out electrophoresis 37 ℃ of reactions 16 hours with Restriction Enzyme HindIII on 0.8% sepharose.Behind the electrophoresis, electrophoretic chromosomal DNA trace from the sepharose is comprised that then alkaline denaturation, neutralization and fixed handle on the nylon leaching film (Roche Diagnostics production) of positively charged.Adopt EASY HYB (Boehringer-Mannheim production) to implement hybridization.In 50 ℃, the filter prehybridization after 1 hour, is added the probe with digoxigenin labeled by above-mentioned preparation, in 50 ℃ of hybridization 16 hours.Subsequently, with the 2 * SSC that contains 0.1%SDS washing nozzle 20 minutes under room temperature.In addition, again by 0.1 * SSC, 65 ℃, 15 minutes, washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production), detect according to step described in the specification sheets of test kit pair band with probe hybridization.As a result, can detect band with about 3kb of probe hybridization.

Then, the chromosomal DNA for preparing in the step (3) with HindIII complete digestion present embodiment 28 (3).By 0.8% agarose gel electrophoresis, isolate the DNA of about 4kb, adopt Gene Clean II test kit (Funakoshi production) purify DNA then, then DNA is dissolved among the 10 μ l TE.Then 4 these products of μ l are mixed with pUC118 HindIII/BAP (Takara Shuzo production), adopt dna ligation kit Ver.2 (Takara Shuzo production) to carry out ligation.Mix 5 μ l ligation mixtures and 100 μ l escherichia coli jm109 competent cells (Toyobo production) thereby transformed into escherichia coli.The transformant that will obtain thus places on the suitable solid medium and produces chromosomal dna library then.

In order to obtain the peptide-forming enzyme gene of total length, adopt above-mentioned probe, by colony hybridization screening chromosomal dna library.Molecular Cloning, 2nd edition has described the step of colony hybridization among the Cold SpringHarbor Press (1989).

The clone of chromosomal dna library is gone to nylon leaching film (nylon membrane that is used for bacterium colony and plaque hybridization, (Roche Diagnostics production)), comprise alkaline denaturation, neutralization and fixed processing then.Adopt EASY HYB (Boehringer-Mannheim production) to implement hybridization.In 37 ℃, the filter prehybridization after 1 hour, is added above-mentioned probe with digoxigenin labeled, in 50 ℃ of hybridization 16 hours.Subsequently, with the 2 * SSC that contains 0.1%SDS washing nozzle 20 minutes under room temperature.In addition, again by 0.1 * SSC, 65 ℃, 15 minutes, washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production),, the clone with the probe hybridization of mark is detected according to the explanation described in the specification sheets of test kit.The result confirms to have the probe hybridization of two clones and mark.

(6) come from the base sequence of the peptide-forming enzyme gene of short steady bacillus

The plasmid that e. coli jm109 contained is proved two clones with the probe hybridization of mark by adopting Wizard Plus Minipreps dna purification system (Promega productions) preparation by above-mentioned, determines with probe the part of hybridizing and the base sequence of neighbouring part to take place.Adopt CEQ DTCS-Quick Start Kit (Beckman-Coulter production), implement sequencing reaction according to step described in the specification sheets of test kit.In addition, adopt CEQ 2000-XL (Beckman-Coulter production) to implement electrophoresis.

The result confirms that the proteinic opening code-reading frame that coding comprises the internal amino acid sequence (SEQ ID NOs:1 and 2) of peptide-forming enzyme exists really.Therefore, opening code-reading frame is confirmed to be the gene of coding peptide-forming enzyme.The base sequence and the amino acid sequence corresponding that have shown the total length peptide-forming enzyme gene among the SEQ ID NO:5.With BLASTP the result of the homology analysis of gained opening code-reading frame is shown, have homology between two kinds of enzymes; It demonstrates on amino acid sequence level alpha-Amino acid ester hydrolase with Pasteur's bacillus aceticus (Acetobacter pasteurianus) and has 34% homology (referring to Appl.Environ.Microbiol.; 68 (1); 211-218 (2002)); and on amino acid sequence level, has 26% homology (referring to J.Bacteriol. with glutaryl-7ACA acyltransferase of side spore bacillus pumilus (Brevibacillus laterosporum); 173 (24), 7848-7855 (1991)).

(embodiment 29) come from the expression of peptide-forming enzyme gene in intestinal bacteria of short steady bacillus

With oligonucleotide described in SEQ ID NOs:7 and 8 as primer, by implementing increase target gene district on the promoter region of tryptophan operon on the chromosomal DNA of intestinal bacteria W3110 of PCR, the gained dna fragmentation is connected to pGEM-Teasy carrier (Promega production).Transform e. coli jm109 then in this connection liquid, select to contain the bacterial strain of target plasmid from the resistant strain of Ampicillin Trihydrate, the direction of insertion of the trp promotor of inserting in the described target plasmid is opposite with the direction of lac promotor.Then, will handle product (Takara production) with the EcoO109I/EcoRI of pUC19 and be connected by handle the dna fragmentation that comprises the trp promotor that this plasmid obtains with EcoO109I/EcoRI.Connect liquid transformed into escherichia coli JM109 with this then, from the resistant strain of Ampicillin Trihydrate, select to contain the bacterial strain of target plasmid.Then, will with HindIII/PvuII handle this plasmid and the dna fragmentation that obtains the dna fragmentation that comprises the rrnB terminator that obtains is connected with handle pKK223-3 (Amersham Pharmacia production) with HindIII/HincII.Connect liquid transformed into escherichia coli JM109 with this then, from the resistant strain of Ampicillin Trihydrate, select to contain the bacterial strain of target plasmid, this plasmid called after pTrpT.

(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to use short steady bacillus strain FERM BP-8113, preservation mechanism address: Chuo No ChuoDai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: chromosomal DNA on July 8th, 2002) is as template, oligonucleotide shown in the SEQ IDNO:9 and 10 is as primer, by the pcr amplification target gene.Handle this dna fragmentation with NdeI/PstI then, then the gained dna fragmentation is handled product with the NdeI/PstI of pTrpT and be connected.Connect liquid transformed into escherichia coli JM109 with this then, from the resistant strain of Ampicillin Trihydrate, select to contain the bacterial strain of target plasmid, this plasmid called after pTrpT_Gtg2.

The e. coli jm109 that will contain pTrpT_Gtg2 is in containing the LB substratum of 100mg/l Ampicillin Trihydrate, in 30 ℃ of pre-cultivations 24 hours.1ml gained nutrient solution is seeded in contains 50ml substratum (2g/l D glucose, 10g/l yeast extract, 10g/l casamino acids, 5g/l ammonium sulfate, 3g/l potassium primary phosphate, 1g/l dipotassium hydrogen phosphate, 0.5g/l magnesium sulfate heptahydrate, with the 100mg/l Ampicillin Trihydrate) 500ml slope Kou Shi bottle in, cultivated 24 hours at 25 ℃ then.It is the 0.44U/1ml nutrient solution that the L-alanyl-L-glutamine of nutrient solution generates activity, confirms the escherichia coli expression cloned genes.In addition, in the transformant that only imports pTrpT in contrast, find activity.

(prediction signal sequence)

When with the aminoacid sequence of SEQ ID NO:6 described in the Signal P v 1.1 programanalysis sequence tables (referring to Protein Engineering, Vol.12, No.1, pp.3-9,1999), the performance of prediction 1-22 amino acids is secreted semiotic function to the pericentral siphon with peptide, and estimates that mature protein is positioned at the downstream of 23 amino acids.

(excretory checking)

The e. coli jm109 that contains pTrpT_Gtg2 is in containing the LB substratum of 100mg/l Ampicillin Trihydrate, in 30 ℃ of pre-cultivations 24 hours.1ml gained nutrient solution is seeded in contains 50ml substratum (2g/l glucose, 10g/l yeast extract, 10g/l casamino acids, 5g/l ammonium sulfate, 3g/l potassium primary phosphate, 1g/l dipotassium hydrogen phosphate, 0.5g/l magnesium sulfate heptahydrate, with the 100mg/l Ampicillin Trihydrate) 500ml slope Kou Shi bottle in, final cultivate 24 hours at 25 ℃ then to obtain microorganism cells.

With 20 Grams Per Minute liter (g/dl) sucrose solutions, behind osmotic pressure ballistic method lysing cell, the cultured microorganism cell is divided into pericentral siphon part and kytoplasm part.The cracked microorganism cells that immerses in the 20g/dl sucrose solution is immersed 5mM MgSO ₄In the aqueous solution.With centrifugal supernatant called after pericentral siphon part (" Pe ").In addition, the centrifugal throw out is resuspended, carry out ultrasonic degradation then.With this resultant called after kytoplasm part (" Cy ").The activity of glucose-6-phosphate dehydrogenase (G6PD) (known being present in the kytoplasm) is used as the separated indicator of confirmation kytoplasm.By, comprising the 1mM G-6-P, 0.4mM NADP, 10mM MgSO4, and add an amount of enzyme in the reaction solution of 50mMTris-Cl (pH 8), under 30 ℃, carry out this detection, thereby detect the generation that the 340nm absorbancy detects NADPH then.

Fig. 4 has shown when the activity value that will separate the cell-free extract of preparation is decided to be 100%, the amount of enzyme in pericentral siphon part and the kytoplasm part.In pericentral siphon, do not find the glucose-6-phosphate dehydrogenase (G6PD) activity.This prompting pericentral siphon part is not sneaked in the kytoplasm part.Recovered about 60% Ala-Gln generation activity in pericentral siphon, as adopting Signal P v 1.1 programs from what aminoacid sequence doped, Ala-Gln generation enzyme is proved to be secreted to pericentral siphon.

(embodiment 30) produce the L-alanyl-L-glutamine with the microorganism cells of Sphingobacterium sp.

In 500ml slope Kou Shi bottle, add 50mL every liter (L) and contain 5g glucose, 5g ammonium sulfate, the 1g potassium primary phosphate, the 3g dipotassium hydrogen phosphate, 0.5g sal epsom, the substratum of 10g yeast extract and 10g peptone (pH 6.2), (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallyyed permit biological sustenance center in order to cultivate Sphingobacterium sp. bacterial strain FERM BP-8124 115 ℃ of sterilizations 15 minutes, preservation mechanism address: Chuo Dai-6,1-1Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002).Inoculation 1 platinum loop contains 5g glucose at every liter (L) on this substratum then, the 10g yeast extract, slant agar substratum (the agar: 20g/L of 10g peptone and 5g NaCl, pH 7.0) on, cultivated 24 hours Sphingobacterium sp. bacterial strain FERM BP-8124 (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst has speciallyyed permit biological sustenance center for 30 ℃, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: cell on July 22nd, 2002), at 30 ℃, 120 reciprocal/minute following concussions were cultivated 20 hours then.Then this nutrient solution of 1ml is added in the above-mentioned substratum (50mL/500ml slope Kou Shi bottle), cultivated 18 hours in 30 ℃.After cultivation is finished, by centrifugal from nutrient solution the separate microorganism cell, then it is suspended in the 0.1M borate buffer solution (pH 9.0) that contains 10mM EDTA, concentration is 100g/L, in wet microorganism cells.In this microorganism cells suspension of 0.1ml, add the 100mM borate buffer solution (pH 9.0) that 0.1ml contains 10mM EDTA, 200mM L-alanyl methyl ester hydrochloride and 400mM L-glutaminate then.0.2mL gained mixture was reacted 120 minutes at 25 ℃.The concentration of the L-alanyl-L-glutamine that produce this moment is 62mM.

(embodiment 31) are from the purifying of the enzyme of Sphingobacterium sp.

Following steps after centrifugal are on ice or 4 ℃ of enforcements.(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to cultivate Sphingobacterium sp. bacterial strain FERM BP-8124 according to the method identical with embodiment 21, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002), collect microorganism cells by centrifugal (10,000rpm, 15 minutes).After with 20mM Tris-HCl damping fluid (pH 7.6) washing 2g microorganism cells, it is suspended in the 8ml same buffer, carry out ultrasonic degradation with 195W then and handled 45 minutes.Centrifugal then this ultrasonic degradation liquid (10,000rpm, 30 minutes) to remove cell debris, obtains ultrasonic degradation liquid supernatant., remove insoluble part by ultracentrifugation (50,000rpm, 30 minutes) then, thereby obtain the soluble part of supernatant liquor form this ultrasonic degradation liquid supernatant dialysed overnight with 20mM Tris-HCl damping fluid (pH 7.6).The soluble part adding that obtains is used in Tris-HCl damping fluid (pH 7.6) the equilibrated Q-Sepharose HP post (Amersham production) in advance, from non-absorbed portion, collected active part then., remove insoluble part by centrifugal (10,000rpm, 30 minutes) then, thereby obtain the part of the dialysis of supernatant liquor form this active part dialysed overnight with 20mM acetate buffer (pH 5.0).The part adding of this dialysis is used in 20mM acetate buffer (pH 5.0) the equilibrated SP-Sepharose HP post (Amersham production) in advance, with the linear concentration gradient wash-out enzyme of the same buffer that contains 0-1M NaCl.

(embodiment 32) produce the L-alanyl-L-glutamine with active part

SP-Sepharose HP part (about 27U/ml) the adding 90 μ l of purifying among the 10 μ l embodiment 31 are contained 111mM L-alanine methyl ester hydrochloride, 222mM L-glutaminate and 11mMEDTA 111mM borate buffer solution (pH 9.0) in, make its 25 ℃ the reaction 120 minutes.As a result, in the district that adds enzyme, generate 73mM L-alanyl-L-glutamine.On the other hand, almost do not observe any generation of L-Ala-L-Gln in not adding the district of enzyme, enzyme concn only is about 0.07mM after 120 minutes and react.

(embodiment 33) come from the separation of the peptide-forming enzyme gene of Sphingobacterium sp.

The separation of peptide-forming enzyme gene is described below, (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center with Sphingobacterium sp. bacterial strain FERMBP-8124, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002) as microorganism.Adopt bacillus coli DH 5 alpha as the host, pUC118 implements gene isolation as carrier.

(1) preparation of microorganism

(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center with Sphingobacterium sp. bacterial strain FERM BP-8124, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: on July 22nd, 2002) go up in 25 ℃ of cultivations 24 hours at CM2G nutrient agar (contain 50g/l glucose, 10g/l yeast extract, 10g/l peptone, 5g/l sodium-chlor and 20g/l agar, pH 7.0).Inoculation 1 platinum loop gained microorganism cells in the 500ml slope Kou Shi bottle that contains 50ml CM2G liquid nutrient medium (the above-mentioned substratum except that agar) is cultivated 25 ℃ of concussions then.

(2) from microorganism cells, prepare chromosomal DNA

The 50ml nutrient solution is carried out centrifugal (12,000rpm, 4 ℃, 15 minutes), collect microorganism cells.Adopt Qiagen Genomic-Tip System (Qiagen) from microorganism cells, to obtain chromosomal DNA then.

(3) prepare probe dna fragment by PCR

Adopt LA-Taq (Takara Shuzo production), obtain comprising by PCR method and come from short steady bacillus strain FERM BP-8113 (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center, preservation mechanism address: Chuo Dai-6,1-1 Higashi1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation is passed on the date: the dna fragmentation of a peptide-forming enzyme gene part on July 8th, 2002).Adopt the primer of the base sequence that contains SEQ ID NOs:3 and 4 then, to (preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center available from short steady bacillus strain FERMBP-8113, preservation mechanism address: Chuo Dai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki 1-Chome, Japan, international preservation is passed on the date: chromosomal DNA on July 8th, 2002) is implemented the PCR reaction.

94 ℃ 30 seconds

52 ℃ 1 minute

72 ℃ 1 minute

After the reaction, carry out 0.8% agarose electrophoresis with 3 μ l reaction mixtures.The result confirms that the dna fragmentation that increases is about 1.5kb.

(4) by gene library clone peptide-forming enzyme gene

About 1.5kb dna fragmentation by the amplification of PCR step separates by 0.8% agarose electrophoresis.Downcut the target band then, purifying DNA fragment.Adopt DIG High Prime (Boehringer-Mannheim production), according to step described in the specification sheets of test kit, with probe digoxigenin labeled dna fragmentation.

Behind the chromosomal DNA of the Sphingobacterium sp. that is obtained in the step (2) of complete digestion present embodiment 33, it was being carried out 0.8% agarose gel electrophoresis 37 ℃ of reactions 16 hours with Restriction Enzyme SacI.Behind the electrophoresis, electrophoretic chromosomal DNA trace from the sepharose is comprised that then alkaline denaturation, neutralization and fixed handle on the nylon leaching film (Roche Diagnostics production) of positively charged.Adopt EASY HYB (Boehringer-Mannheim production) to hybridize.In 37 ℃, the filter prehybridization after 1 hour, is added the probe with digoxigenin labeled by above-mentioned preparation, in 37 ℃ of hybridization 16 hours.Subsequently, with the 2 * SSC that contains 0.1%SDS washing nozzle 20 minutes under room temperature.In addition, again with the 0.1 * SSC that comprises 0.1%SDS, 60 ℃, washed twice.

Then, the chromosomal DNA for preparing in the step (2) with SacI complete digestion present embodiment 33.Separate the DNA of about 3kb by 0.8% agarose gel electrophoresis, adopt Gene Clean II test kit (Funakoshi production) purify DNA then, then DNA is dissolved among the 10 μ l TE.Then with 4 these products of μ l and SacI under 37 ℃, reacted 16 hours, so that complete digestion, it is mixed with the pUC118 that uses alkaline phosphatase (intestinal bacteria C75) to handle, 37 ℃, 30 minutes and 50 ℃, 30 minutes, adopt dna ligation kit Ver.2 (Takara Shuzo production) to carry out ligation.Mix this ligation liquid of 5 μ l and 100 μ l bacillus coli DH 5 alpha competent cells (Takara Shuzo production) thereby transformed into escherichia coli.The transformant that will obtain thus places on the suitable solid medium and produces chromosomal dna library then.

The clone of chromosomal dna library is gone to nylon leaching film (nylon membrane that is used for bacterium colony and plaque hybridization, (Roche Diagnostics production)), comprise alkaline denaturation, neutralization and fixed processing then.Adopt EASY HYB (Boehringer-Mannheim production) to implement hybridization.In 37 ℃, the filter prehybridization after 1 hour, is added above-mentioned probe with digoxigenin labeled, in 50 ℃ of hybridization 16 hours.Subsequently, with comprising 0.1 * SSC of 1%SDS in 60 ℃ of washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production),, the clone with the probe hybridization of mark is detected according to the explanation described in the specification sheets of test kit.As a result, confirm to have the probe hybridization of 6 strain clones and mark.

(5) come from the base sequence of the peptide-forming enzyme gene of Sphingobacterium sp.

Adopt Wizard Plus Minipreps dna purification system (Promega productions) preparation plasmid that bacillus coli DH 5 alpha contained from be proved the above-mentioned six strain microorganism cellss with the probe hybridization of mark, thereby determine and the contiguous base sequence of probe hybridization.Adopt CEQDTCS-Quick Start Kit (Beckman-Coulter production), implement sequencing reaction according to step described in the specification sheets of test kit.In addition, adopt CEQ 2000-XL (Beckman-Coulter production) to implement electrophoresis.

As a result, find to exist the opening code-reading frame of coding peptide-forming enzyme.The base sequence and the amino acid sequence corresponding that have shown the total length peptide-forming enzyme gene that comes from Sphingobacterium sp. among the SEQ ID NO:11.The peptide-forming enzyme that comes from Sphingobacterium sp. has 63.5% homology (shown in the BLASTP program detects) with the peptide-forming enzyme that comes from the steady bacillus of above-mentioned weak point on amino acid sequence level.

(embodiment 34) come from the peptide-forming enzyme gene of Sphingobacterium sp. in colibacillary expression

(preservation mechanism: Independent Administrative Leged Industrial Technology Complex Inst speciallys permit biological sustenance center to adopt Sphingobacterium sp. bacterial strain FERM BP-8124, preservation mechanism address: ChuoDai-6,1-1 Higashi 1-Chome, Tsukuba-shi, Ibaraki-ken, Japan, international preservation date: chromosomal DNA on July 22nd, 2002) is as template, oligonucleotide is implemented PCR as primer described in the SEQ ID NOs:13 and 14, the amplified target gene.Handle this dna fragmentation with NdeI/XbaI, the dna fragmentation that obtains is handled product with the NdeI/XbaI of pTrpT be connected.Connect liquid transformed into escherichia coli JM109 with this then, from the resistant strain of Ampicillin Trihydrate, select to contain the bacterial strain of target plasmid, this plasmid called after pTrpT_Sm_aet.

Be seeded in by strain cell and contain 3ml substratum (2g/l glucose, 10g/l yeast extract, 10g/l casamino acids, 5g/l ammonium sulfate, 3g/l potassium primary phosphate, 1g/l dipotassium hydrogen phosphate, 0.5g/l magnesium sulfate heptahydrate a platinum loop, with the 100mg/l Ampicillin Trihydrate) common test tube in mode, the e. coli jm109 that will contain pTrpT_Sm_aet was cultivated 20 hours at 25 ℃.The L-alanyl-L-glutamine generates activity and is proved by escherichia coli expression for the cloned genes of 2.1U/1ml nutrient solution.In addition, in the transformant that only imports pTrpT in contrast, find activity.

(prediction signal sequence)

When with the aminoacid sequence of SEQ ID NO:12 described in the Signal P v 1.1 programanalysis sequence tables (referring to Protein Engineering, Vol.12, No.1, pp.3-9,1999), the performance of prediction 1-20 amino acids is secreted semiotic function to the pericentral siphon with peptide, and estimates that mature protein is positioned at the downstream of 21 amino acids.

(confirmation of signal sequence)

Be seeded in by strain cell and contain 50ml substratum (2g/l glucose, 10g/l yeast extract, 10g/l casamino acids, 5g/l ammonium sulfate, 3g/l potassium primary phosphate, 1g/l dipotassium hydrogen phosphate, 0.5g/l magnesium sulfate heptahydrate a platinum loop, with the 100mg/l Ampicillin Trihydrate) common test tube in mode, the e. coli jm109 that will contain pTrpT_Sm_aet was cultivated 20 hours at 25 ℃.

Following steps after centrifugal are on ice or 4 ℃ of enforcements.After cultivation is finished, by centrifugal from nutrient solution the separate microorganism cell, with the 100mM phosphate buffered saline buffer (pH 7) washing after, it is suspended in the identical damping fluid.Then this microorganism cells is carried out ultrasonic degradation with 195W and handled 20 minutes, centrifugal then this ultrasonic degradation liquid (12,000rpm, 30 minutes) to remove cell debris, obtains soluble part.The soluble part adding that obtains is used in 100mM phosphate buffered saline buffer (pH 7) the equilibrated CHT-II post (Biorad production) in advance, used the 500mM phosphoric acid buffer with linear concentration gradient wash-out enzyme.The solution that the 2M ammonium sulfate of mixed active part and 5 times of volumes and 100mM phosphate buffered saline buffer are obtained, add and use in advance in 2M ammonium sulfate and the 100mM phosphoric acid buffer equilibrated Resource-PHE post (Amersham), with 0-2M ammonium sulfate with linear concentration gradient wash-out enzyme, thereby obtain active part solution.According to the result of these steps, confirmed by electrophoretic mode peptide-forming enzyme purifying equably.

When determining the aminoacid sequence of above-mentioned peptide-forming enzyme, obtain the aminoacid sequence of SEQ ID NO:15, as predicting that by Signal P v 1.1 programs mature protein is proved the downstream that is positioned at 21 amino acids by the EdmanShi decomposition method.

(embodiment 35) come from the separation of the peptide-forming enzyme gene of separating Vitrum AB soil bacillus IFO 12017

Below, will the separation of peptide-forming enzyme gene be described.Microorganism used therefor for separate Vitrum AB soil bacillus strain IFO 12017 (preservation mechanism: fermentation research institute, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, Japan).In gene isolation, intestinal bacteria JM-109 is used as the host, and pUC118 is used as carrier.

(1) preparation of microorganism

To separate Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, Japan) (contain 50g/l glucose, 10g/l yeast extract, 10g/l peptone, 5g/l sodium-chlor and 20g/l agar at the CM2G nutrient agar, pH 7.0) on, cultivated 24 hours in 25 ℃.Inoculation 1 platinum loop gained microorganism cells in the 500ml slope Kou Shi bottle that contains 50ml CM2G liquid nutrient medium (the above-mentioned substratum except that agar) is cultivated 25 ℃ of concussions then.

(2) from microorganism cells, prepare chromosomal DNA

With 50mL medium centrifugal (12,000rpm, 4 ℃, 15 minutes), collect microorganism cells.Then, adopt QIAGEN Genomic-Tip System (Qiagen),, from microorganism cells, obtain chromosomal DNA according to step described in its specification sheets.

(3) prepare probe dna fragment by PCR

Adopt LA-Taq (Takara Shuzo production), pass through PCR method, acquisition contains to come from separates Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, the dna fragmentation of the part of peptide-forming enzyme gene Japan).Adopt the primer of the base sequence that contains SEQ ID NOs:15 and 16 then, to available from separating Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, chromosomal DNA Japan) carries out PCR.About 1kb dna fragmentation by pcr amplification separates by 0.8% agarose electrophoresis.Downcut the target band then, the dna fragmentation that purifying obtains.Adopt DIG High Prime (Boehringer-Mannheim production), according to step described in the specification sheets of test kit, with this dna fragmentation of probe digoxigenin labeled.

(4) by gene library clone peptide-forming enzyme gene

In order to obtain the total length peptide-forming enzyme gene, adopt the dna fragmentation that increases in the above-mentioned PCR step to carry out Southern hybridization as probe.Molecular Cloning, 2nd edition has described the step that Southern is hybridized among the Cold Spring Harbor Press (1989).

By with Restriction Enzyme HindIII in 37 ℃ of reactions 16 hours and Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute is separated in complete digestion, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, Japan) behind the chromosomal DNA, it is carried out 0.8% agarose gel electrophoresis.Behind the electrophoresis, electrophoretic chromosomal DNA trace from the sepharose is comprised then that at the nylon leaching film (Roche Diagnostics production) of positively charged alkaline denaturation, neutralization and fixed handle.Adopt EASY HYB (Boehringer-Mannheim production) to hybridize.In 50 ℃, the filter prehybridization after 1 hour, is added the probe with digoxigenin labeled by above-mentioned preparation, in 50 ℃ of hybridization 16 hours.Subsequently, with the 0.1 * SSC that comprises 0.1%SDS, 60 ℃, washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production), detect according to step described in the specification sheets of test kit pair band with probe hybridization.As a result, can detect band with about 5kb of probe hybridization.

Then, separate Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, chromosomal DNA Japan) with the HindIII complete digestion.Separate the DNA of about 5kb by 0.8% agarose gel electrophoresis, adopt Gene Clean II test kit (Funakoshi production) purify DNA then, then it is dissolved among the 10 μ l TE.Then 4 these products of μ l are mixed with pUC118 HindIII/BAP (Takara Shuzo production), adopt dna ligation kit Ver.2 (Takara Shuzo production) to carry out ligation.Mix this ligation liquid of 5 μ l and 100 μ l e. coli jm109s (Takara Shuzo production), thus transformed into escherichia coli.The transformant that will obtain thus places on the suitable solid medium and produces chromosomal dna library then.

The clone of chromosomal dna library is gone to nylon leaching film (nylon membrane that is used for bacterium colony and plaque hybridization, (Roche Diagnostics production)), comprise alkaline denaturation, neutralization and fixed processing then.Adopt EASY HYB (Boehringer-Mannheim production) to implement hybridization.In 37 ℃, the filter prehybridization after 1 hour, is added above-mentioned probe with digoxigenin labeled, in 37 ℃ of hybridization 16 hours.Subsequently, with comprising 0.1 * SSC of 1%SDS in 60 ℃ of washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production), the clone with the probe hybridization of mark is detected according to the explanation described in the specification sheets of test kit.As a result, confirm to have the probe hybridization of 1 strain clone and mark.

(5) come from the base sequence of the peptide-forming enzyme gene of separating Vitrum AB soil bacillus strain IFO-12017

The plasmid that e. coli jm109 contained determines to take place with probe the contiguous base sequence of hybridization by the above-mentioned microorganism cells bacterial strain preparation that is proved with the probe hybridization of mark.Adopt CEQDTCS-Quick Start Kit (Beckman-Coulter production), implement sequencing reaction according to step described in the specification sheets of test kit.In addition, adopt CEQ 2000-XL (Beckman-Coulter production) to implement electrophoresis.

As a result, find to exist the opening code-reading frame of coding peptide-forming enzyme.Shown among the SEQ IDNO:17 in the sequence table to come from and separated Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, the base sequence of total length peptide-forming enzyme gene Japan), and amino acid sequence corresponding.

(embodiment 36) come from the expression of peptide-forming enzyme gene in intestinal bacteria of separating Vitrum AB soil bacillus strain IFO-12017

Vitrum AB soil bacillus strain IFO-12017 (preservation mechanism: fermentation research institute is separated in use, Osaka, preservation mechanism address: 2-17-85 Jusohonmachi, Yodogawa-ku, Osaka-shi, Japan) chromosomal DNA is as template, and the oligonucleotide shown in the SEQ ID NO:19 and 20 is as primer, by the pcr amplification target gene.Handle this dna fragmentation with NdeI/HindIII then, then the gained dna fragmentation is handled product with the NdeI/HindIII of pTrpT and be connected.Connect liquid transformed into escherichia coli JM109 with this then, from the resistant strain of Ampicillin Trihydrate, select to contain the bacterial strain of target plasmid, this plasmid called after pTrpT_Ph_aet.

Be seeded in by strain cell and contain 3ml substratum (2g/l glucose, 10g/l yeast extract, 10g/l casamino acids, 5g/l ammonium sulfate, 3g/l potassium primary phosphate, 1g/l dipotassium hydrogen phosphate, 0.5g/l magnesium sulfate heptahydrate a platinum loop, with the 100mg/l Ampicillin Trihydrate) common test tube in mode, the e. coli jm109 that will contain pTrpT_Ph_aet was cultivated 20 hours at 25 ℃.The L-alanyl-L-glutamine generates activity and is proved by escherichia coli expression for the cloned genes of 0.3U/1ml nutrient solution.In addition, in the transformant that only imports pTrpT in contrast, find activity.

(embodiment 37) are from the separation of the peptide-forming enzyme gene of Taxeobacter gelupurpurascens strain DSM Z11116

Below, will the separation of peptide-forming enzyme gene be described.Employed microorganism is Taxeobacter gelupurpurascens strain DSM Z a 11116 (preservation mechanism: DeutcheSammlung von Mikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg 1b, 38124Braunschweig, Germany).In gene isolation, intestinal bacteria JM-109 is used as the host, and pUC118 is used as carrier.

(1) preparation of microorganism

With Taxeobacter gelupurpurascens strain DSM Z 11116 (preservation mechanism: Deutche Sammlung von Mikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg1b, 38124 Braunschweig, Germany) go up in 25 ℃ of cultivations 24 hours at CM2G nutrient agar (contain 50g/l glucose, 10g/l yeast extract, 10g/l peptone, 5g/l sodium-chlor and 20g/l agar, pH 7.0).Inoculation 1 platinum loop gained microorganism cells in the 500ml slope Kou Shi bottle that contains 50ml CM2G liquid nutrient medium (the above-mentioned substratum except that agar) is cultivated 25 ℃ of concussions then.

(2) from microorganism cells, prepare chromosomal DNA

The 50mL nutrient solution is carried out centrifugal (12,000rpm, 4 ℃, 15 minutes), collect microorganism cells.Then, adopt QIAGEN Genomic-Tip System (Qiagen),, from microorganism cells, obtain chromosomal DNA according to step described in its specification sheets.

(3) prepare probe dna fragment by PCR

Adopt LA-Taq (Takara Shuzo production), pass through PCR method, acquisition contains and comes from Taxeobacter gelupurpurascens strain DSM Z 11116 (preservation mechanism: Deutche Sammlung von Mikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg1b, 38124 Braunschweig, the dna fragmentation of the part of peptide-forming enzyme gene Germany).Adopt the primer of the base sequence that contains SEQ ID NOs:21 and 16 then, to available from Taxeobacter gelupurpurascens strain DSM Z 11116 (preservation mechanism: Deutche Sammlung von Mikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg1b, 38124 Braunschweig, chromosomal DNA Germany) carries out PCR.To separate by 0.8% agarose electrophoresis by about 1kb dna fragmentation of pcr amplification.Downcut the target band then, the dna fragmentation that purifying obtains.Adopt DIG High Prime (Boehringer-Mannheim production), according to step described in the specification sheets of test kit, with this dna fragmentation of probe digoxigenin labeled.

(4) from gene library clone peptide-forming enzyme gene

Reacting 16 hours and complete digestion Taxeobactergelupurpurascens strain DSM Z 11116 (preservation mechanism: Deutche Sammlung vonMikroorganismen und Zellkulturen GmbH (German microorganism and cell culture preservation center) at 37 ℃ with Restriction Enzyme PstI, preservation mechanism address: Mascheroder Weg 1b, 38124Braunschweig, Germany) behind the chromosomal DNA, it is carried out 0.8% agarose gel electrophoresis.Behind the electrophoresis, electrophoretic chromosomal DNA trace from the sepharose is comprised then that at the nylon leaching film (Roche Diagnostics production) of positively charged alkaline denaturation, neutralization and fixed handle.Adopt EASY HYB (Boehringer-Mannheim production) to hybridize.In 50 ℃, the filter prehybridization after 1 hour, is added the probe with digoxigenin labeled by above-mentioned preparation, in 50 ℃ of hybridization 16 hours.Subsequently, with the 0.1 * SSC that comprises 0.1%SDS, 60 ℃, washed twice.

With HindIII complete digestion Taxeobacter gelupurpurascens strain DSM Z11116 (preservation mechanism: Deutche Sammlung von Mikroorganismen undZellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg 1b, 38124 Braunschweig, chromosomal DNA Germany).Separate the DNA of about 5kb by 0.8% agarose gel electrophoresis, adopt Gene Clean II test kit (Funakoshi production) purify DNA then, it is dissolved among the 10 μ l TE.Then 4 these products of μ l are mixed with pUC118 PstI/BAP (Takara Shuzo production), adopt dna ligation kit Ver.2 (Takara Shuzo production) to carry out ligation.Mix this ligation liquid of 5 μ l and 100 μ l e. coli jm109s (Takara Shuzo production) and transformed into escherichia coli.The transformant that will obtain thus places on the suitable solid medium and produces chromosomal dna library then.

The clone of chromosomal dna library is gone to nylon leaching film (nylon membrane that is used for bacterium colony and plaque hybridization, (Roche Diagnostics production)), comprise alkaline denaturation, neutralization and fixed processing then.Adopt EASY HYB (Boehringer-Mannheim production) to implement hybridization.In 37 ℃, the filter prehybridization after 1 hour, is added above-mentioned probe with digoxigenin labeled, in 37 ℃ of hybridization 16 hours.Subsequently, with the 0.1 * SSC that comprises 1%SDS in twice of 60 ℃ of washing nozzle.

(5) come from the base sequence of the peptide-forming enzyme gene of Taxeobacter gelupurpurascens strain DSM Z 11116

As a result, find to exist the opening code-reading frame of coding peptide-forming enzyme.Shown among the SBQ IDNO:22 in the sequence table and come from Taxeobacter gelupurpurascens strain DSM Z 11116 (preservation mechanism: Deutche Sammlung von Mikroorganismen undZellkulturen GmbH (German microorganism and cell culture preservation center), preservation mechanism address: Mascheroder Weg 1b, 38124 Braunschweig, the base sequence of total length peptide-forming enzyme gene Germany), and amino acid sequence corresponding.

(embodiment 38) come from the separation of the peptide-forming enzyme gene of extra large round bacteria strains A TCC 25205

Below, will the separation of peptide-forming enzyme gene be described.Used microorganism is extra large round bacteria strains A TCC 25205 (a preservation mechanism: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United States of America).In gene isolation, intestinal bacteria JM-109 is used as the host, and pUC118 is used as carrier.

(1) preparation of microorganism cells

With extra large round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the UnitedStates of America) (contains 50g/l glucose, 10g/l yeast extract, 10g/l peptone, 5g/l sodium-chlor and 20g/l agar at the CM2G nutrient agar, pH 7.0) on, cultivated 24 hours in 25 ℃.Inoculation 1 platinum loop gained microorganism cells in the 500ml slope Kou Shi bottle that contains 50ml CM2G liquid nutrient medium (the above-mentioned substratum except that agar) is cultivated 25 ℃ of concussions then.

(2) from microorganism cells, prepare chromosomal DNA

(3) prepare probe dna fragment by PCR

Adopt LA-Taq (Taka ra Shuzo production), pass through PCR method, acquisition contains and comes from extra large round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United Statesof America) the dna fragmentation of a part of peptide-forming enzyme gene.Adopt the primer of the base sequence that contains SEQID NOs:15 and 16 then, to available from extra large round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box1549, Manassas, VA 20110, the United States of America) chromosomal DNA carry out PCR.About 1kb dna fragmentation by pcr amplification separates by 0.8% agarose electrophoresis.Downcut the target band then, the dna fragmentation that purifying obtains.Adopt DIG HighPrime (Boehringer-Mannheim production), according to step described in the specification sheets of test kit, with this dna fragmentation of probe digoxigenin labeled.

(4) by gene library clone peptide-forming enzyme gene

Reacting 16 hours and complete digestion sea round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection at 37 ℃ with Restriction Enzyme HincII, preservation mechanism address: P.O.Box 1549, Manas sas, VA 20110, the United States of America) behind the chromosomal DNA, it is implemented 0.8% agarose gel electrophoresis respectively.Behind the electrophoresis, electrophoretic chromosomal DNA trace from the sepharose is comprised then that at the nylon leaching film (RocheDiagnostics production) of positively charged alkaline denaturation, neutralization and fixed handle.Adopt EASY HYB (Boehringer-Mannheim production) to hybridize.In 50 ℃, the filter prehybridization after 1 hour, is added the probe with digoxigenin labeled by above-mentioned preparation, in 50 ℃ of hybridization 16 hours.Subsequently, with the 0.1 * SSC that comprises 0.1%SDS, 60 ℃, washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production), detect according to step described in the specification sheets of test kit pair band with probe hybridization.As a result, in the PstI digestion product, detect the band with about 7k of probe hybridization, and in the HincII digestion product, detect the band with about 2k of probe hybridization.

With PstI or HincII complete digestion sea round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United States of America) chromosomal DNA.Isolate the DNA of about 7kb or 2kb by 0.8% agarose gel electrophoresis, adopt Gene CleanII test kit (Funakoshi production) purify DNA then, it is dissolved among the 10 μ l TE.Then 4 these products of μ l are mixed with pUC118 PstI/BAP (Takara Shuzo production) or pUC118HincII/BAP (Takara Shuzo production), adopt dna ligation kit Ver.2 (Takara Shuzo production) to carry out ligation.Mix this ligation liquid of 5 μ l and 100 μ l e. coli jm109s (Takara Shuzo production) respectively and transformed into escherichia coli.The transformant that will obtain thus places on the suitable solid medium and produces chromosomal dna library then.

The clone of chromosomal dna library is gone to nylon leaching film (nylon membrane that is used for bacterium colony and plaque hybridization, (Reche Diagnostics production)), comprise alkaline denaturation, neutralization and fixed processing then.Adopt EASY HYB (Boehringer-Mannheim production) to implement hybridization.In 37 ℃, the filter prehybridization after 1 hour, is added above-mentioned probe with digoxigenin labeled, in 37 ℃ of hybridization 16 hours.Subsequently, with comprising 0.1 * SSC of 1%SDS in 60 ℃ of washed twice.

(5) come from the base sequence of the peptide-forming enzyme gene of extra large round bacteria strains A TCC 25205

As a result, find to exist the opening code-reading frame of coding peptide-forming enzyme.Shown among the SEQ IDNO:24 in the sequence table and come from extra large round bacteria strains A TCC 25205 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA20110, the base sequence of total length peptide-forming enzyme gene the United States of America), and amino acid sequence corresponding.

(embodiment 39) come from the separation of the peptide-forming enzyme gene of Psycloserpens burtonensis strains A TCC 700359

Below, will the separation of peptide-forming enzyme gene be described.Microorganism used therefor is Psycloserpensburtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the UnitedStates of America).In isolated genes, intestinal bacteria JM-109 is used as the host, and pUC118 is as carrier.

(1) preparation of microorganism

With Psycloserpens burtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United States of America) goes up in 10 ℃ of cultivations 24 hours at CM2G nutrient agar (contain 50g/l glucose, 10g/l yeast extract, 10g/l peptone, 5g/l sodium-chlor and 20g/l agar, pH 7.0).Inoculation 1 platinum loop gained microorganism cells in the 500ml slope Kou Shi bottle that contains 50ml CM2G liquid nutrient medium (the above-mentioned substratum except that agar) is cultivated 10 ℃ of concussions then.

(2) from microorganism cells, prepare chromosomal DNA

(3) prepare probe dna fragment by PCR

Adopt LA-Taq (Takara Shuzo production), pass through PCR method, acquisition contains and comes from Psycloserpens burtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United States of America) the dna fragmentation of a part of peptide-forming enzyme gene.Adopt the primer of the base sequence that contains SEQ ID NOs:15 and 16 then, to available from Psycloserpens burtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box 1549, Manassas, VA 20110, the United States of America) chromosomal DNA carry out PCR.About 1kb dna fragmentation by pcr amplification separates by 0.8% agarose electrophoresis.Downcut the target band then, the dna fragmentation that purifying obtains.Adopt DIG High Prime (Boehringer-Mannheim production), according to step described in the specification sheets of test kit, with this dna fragmentation of probe digoxigenin labeled.

(4) by gene library clone peptide-forming enzyme gene

In order to obtain the total length peptide-forming enzyme gene, adopt the dna fragmentation that in above-mentioned PCR step, increases to carry out Southern hybridization as probe.Molecular Cloning, 2nd edition has described the step that Southern is hybridized among the Cold Spring Harbor Press (1989).

Reacting 16 hours and complete digestion Psycloserpens burtonensis strains A TCC 700359 (preservation mechanism: American type culture collection at 37 ℃ with Restriction Enzyme EcoRI, preservation mechanism address: P.O.Box 1549, Manassas, VA20110, the United States of America) behind the chromosomal DNA, it is carried out 0.8% agarose gel electrophoresis.Behind the electrophoresis, electrophoretic chromosomal DNA trace from the sepharose is comprised then that at the nylon leaching film (Reche Diagnostics production) of positively charged alkaline denaturation, neutralization and fixed handle.Adopt EASY HYB (Boehringer-Mannheim production) to hybridize.In 50 ℃, the filter prehybridization after 1 hour, is added the probe with mark by above-mentioned preparation, in 50 ℃ of hybridization 16 hours.Subsequently, with the 0.1 * SSC that comprises 0.1%SDS, 60 ℃, washed twice.

Adopt DIG kit for detecting nucleic acid (Boehringer-Mannheim production), detect according to step described in the specification sheets of test kit pair band with probe hybridization.As a result, can detect band with about 7kb of probe hybridization.

With EcoRI complete digestion Psycloserpens burtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box1549, Manassas, VA 20110, the United States of America) chromosomal DNA.Separate the DNA of about 7kb by 0.8% agarose gel electrophoresis, adopt Gene Clean II test kit (Funakoshi production) purify DNA then, it is dissolved among the 10 μ l TE.Then 4 these products of μ l are mixed with pUC118 EcoRI/BAP (Takara Shuzo production), adopt dna ligation kit Ver.2 (Takara Shuzo production) to carry out ligation.Mix this ligation liquid of 5 μ l and 100 μ l e. coli jm109s (Takara Shuzo production) and transformed into escherichia coli.The transformant that will obtain thus places on the suitable solid medium and produces chromosomal dna library then.

Adopt DIG Nucleotide Detection Kit (Boehringer-Mannheim production), according to the clone of specification sheets detection with the probe hybridization of mark.As a result, confirm the probe hybridization of 1 strain clone and mark.

(5) come from the base sequence of the peptide-forming enzyme gene of Psycloserpens burtonensis strains A TCC 700359

The plasmid that e. coli jm109 contained determines to take place with probe the contiguous base sequence of hybridization by the above-mentioned microorganism cells bacterial strain preparation that is proved with the probe hybridization of mark.According to the described step of specification sheets, adopt CEQ DTCS-Quick Start Kit (Beckman-Coulter production) to carry out sequencing reaction.In addition, adopt CEQ 2000-XL (Beckman-Coulter production) to implement electrophoresis.

As a result, find to exist the opening code-reading frame of coding peptide-forming enzyme.Shown among the SEQ IDNO:31 in the sequence table and come from Psycloserpens burtonensis strains A TCC 700359 (preservation mechanisms: American type culture collection, preservation mechanism address: P.O.Box1549, Manassas, VA 20110, the base sequence of total length peptide-forming enzyme gene the United States of America), and amino acid sequence corresponding.

Industrial applicability

According to the present invention, provide by reducing such as the complicated synthetic method of introducing and eliminate protecting group, and can be easily, high productivity and produce at an easy rate the novel enzyme of peptide. Use endonuclease capable of the present invention to realize the efficient industrial production of peptide.

Sequence table

SEQ ID NO:3: synthetic primer 1

SEQ ID NO:4: synthetic primer 2

SEQ ID NO:5: the gene of coding peptide-forming enzyme

SEQ ID NO:7: the synthetic primer that is used to prepare pTrpT

SEQ ID NO:8: the synthetic primer that is used to prepare pTrpT

SEQ ID NO:9: the synthetic primer that is used to prepare pTrpT_Gtg2

SEQ ID NO:10: the synthetic primer that is used to prepare pTrpT_Gtg2

SEQ ID NO:11: the gene of coding peptide-forming enzyme

SEQ ID NO:13: the synthetic primer that is used to prepare pTrpT_Sm_aet

SEQ ID NO:14: the synthetic primer that is used to prepare pTrpT_Sm_aet

SEQ ID NO:15: the mix primer 1 that is used for Aet

SEQ ID NO:16: the mix primer 2 that is used for Aet

SEQ ID NO:19: the primer 1 that is used to make up the aet expression vector that comes from Pedobacter.

SEQ ID NO:20: the primer 2 that is used to make up the aet expression vector that comes from Pedobacter.

SEQ ID NO:21: the mix primer 3 that is used for Aet.

Sequence table

<110>AJINOMOTO CO.，LTD.

＜120〉novel peptide-forming enzyme gene

<130>PAMA-15377，PAMA-03030

<150>JP2002-218957

<151>2002-07-26

<150>JP2003-016765

<151>2003-01-24

<160>27

<170>PatentIn Ver.2.1

<210>1

<211>9

<212>PRT

＜213〉lack steady stalk bacterium

<220>

<223>Inventor：HARA，Seiichi

Inventor：YOKOZEKI，Kenzo

Inventor：ABE，Isao

Inventor：TONOUCHI，Naoto

Inventor：JOJIMA，Yasuko

<400>1

Leu Phe Thr Ala Ile Tyr Gln Pro Lys

1 5

<210>2

<211>9

<212>PRT

＜213〉lack steady stalk bacterium

<400>2

Thr Asn Val Thr Tyr Thr Met Pro Asp

1 5

<210>3

<211>20

<212>DNA

＜213〉composition sequence

<220>

＜223〉artificial sequence description: synthetic primer 1

<400>3

ttyacngcna thtaycarcc 20

<210>4

<211>23

<212>DNA

＜213〉composition sequence

<220>

＜223〉artificial sequence description: synthetic primer 2

<400>4

tcnggcatng trtangtnac rtt 23

<210>5

<211>2024

<212>DNA

＜213〉lack steady stalk bacterium

<220>

<221>CDS

<222>(61)..(1908)

＜223〉gene of encoded peptide synthetic enzyme

<400>5

atttcttaat aaaaactgaa atcttaatac atttatacta tcgtaaaatt tattgaacac 60

gtg aaa aaa tta aca tta aaa gta act cta ctt aca ctt ttg ttg gga 108

Val Lys Lys Leu Thr Leu Lys Val Thr Leu Leu Thr Leu Leu Leu Gly

1 5 10 15

agt aca gtt gga ttt gcg caa gat gca aaa gca gat tct gct tat gtg 156

Ser Thr Val Gly Phe Ala Gln Asp Ala Lys Ala Asp Ser Ala Tyr Val

20 25 30

cgc gac aat tac gaa aaa ata gaa caa gta att ccg atg cgc gat ggt 204

Arg Asp Asn Tyr Glu Lys Ile Glu Gln Val Ile Pro Met Arg Asp Gly

35 40 45

aca aag tta ttt aca gct att tat cag cca aaa gat aaa aca aaa caa 252

Thr Lys Leu Phe Thr Ala Ile Tyr Gln Pro Lys Asp Lys Thr Lys Gln

50 55 60

tat ccc gtt ttg tta aat cgt acg cct tat aca gtt gcg cct tat ggt 300

Tyr Pro Val Leu Leu Asn Arg Thr Pro Tyr Thr Val Ala Pro Tyr Gly

65 70 75 80

gta aat gaa tac aag aaa tcg tta gga aat ttt cct aca gaa atg cgc 348

Val Asn Glu Tyr Lys Lys Ser Leu Gly Asn Phe Pro Thr Glu Met Arg

85 90 95

gaa ggt ttt att ttt gtt tac caa gat gtg aga gga aaa tgg atg agc 396

Glu Gly Phe Ile Phe Val Tyr Gln Asp Val Arg Gly Lys Trp Met Ser

100 105 110

gaa ggc gaa ttt gaa gat gtt cga cct ata aat cct tca aaa agt aaa 444

Glu Gly Glu Phe Glu Asp Val Arg Pro Ile Asn Pro Ser Lys Ser Lys

115 120 125

aag gca att gac gaa agc aca gat aca ttt gat acg cta gaa tgg ctt 492

Lys Ala Ile Asp Glu Ser Thr Asp Thr Phe Asp Thr Leu Glu Trp Leu

130 135 140

gct aaa aac ttg aag aat tac acg aaa aaa gct gga att tat gga att 540

Ala Lys Asn Leu Lys Asn Tyr Thr Lys Lys Ala Gly Ile Tyr Gly Ile

145 150 155 160

tcg tat cct ggt ttt tat tcg aca atg agt ttg gtt aat tcg cat cca 588

Ser Tyr Pro Gly Phe Tyr Ser Thr Met Ser Leu Val Asn Ser His Pro

165 170 175

act cta aaa gcc gtt tcg cca caa gcg ccc gtt acc aat tgg ttt tta 636

Thr Leu Lys Ala Val Ser Pro Gln Ala Pro Val Thr Asn Trp Phe Leu

180 185 190

ggt gac gat ttt cat cat aat gga gtt tta ttc ttg aat gat tct ttc 684

Gly AsP Asp Phe His His Asn Gly Val Leu Phe Leu Asn Asp Ser Phe

195 200 205

tca ttt atg act ttt ttt ggt gta aaa cgt ccg caa cca att acg cca 732

Ser Phe Met Thr Phe Phe Gly Val Lys Arg Pro Gln Pro Ile Thr Pro

210 215 220

gat aaa ggt ccg aaa cgt ttt gaa tat cca ata aaa gat aat tat aga 780

Asp Lys Gly Pro Lys Arg Phe Glu Tyr Pro Ile Lys Asp Asn Tyr Arg

225 230 235 240

ttt tat gca agt ggc tct gta aaa gag ttg aaa gat aaa tat ttg caa 828

Phe Tyr Ala Ser Gly Ser Val Lys Glu Leu Lys Asp Lys Tyr Leu Gln

245 250 255

gat aat atc aag ttt tac aat gat tta ttt gcg cat cca gat tac gat 876

Asp Asn Ile Lys Phe Tyr Asn Asp Leu Phe Ala His Pro Asp Tyr Asp

260 265 270

caa ttt tgg caa gat cgt aat gtt tta cca cat tta act aac gtg caa 924

Gln Phe Trp Gln Asp Arg Asn Val Leu Pro His Leu Thr Asn Val Gln

275 280 285

cct gct gta atg acg gtt gga ggt ttt ttt gat gca gaa gat gtc tac 972

Pro Ala Val Met Thr Val Gly Gly Phe Phe Asp Ala Glu Asp Val Tyr

290 295 300

ggc gct ttc gaa acg tat aaa gca att gag aaa caa aat ccg aaa gca 1020

Gly Ala Phe Glu Thr Tyr Lys Ala Ile Glu Lys Gln Asn Pro Lys Ala

305 310 315 320

aca aat att atg gtt gcc gga cct tgg ttt cat ggt ggt tgg gtt cgt 1068

Thr Asn Ile Met Val Ala Gly Pro Trp Phe His Gly Gly Trp Val Arg

325 330 335

agc aac gga agt act ttt gga gat atg caa ttt gca tcg aat aca agt 1116

Ser Asn Gly Ser Thr Phe Gly Asp Met Gln Phe Ala Ser Asn Thr Ser

340 345 350

gag cat tat cag caa gaa ata gaa ttg cct ttt ttt aat tat tac tta 1164

Glu His Tyr Gln Gln Glu Ile Glu Leu Pro Phe Phe Asn Tyr Tyr Leu

355 360 365

aaa gat aaa ggt aat ttt aaa cca acc gaa gct aca att ttt att acg 1212

Lys Asp Lys Gly Asn Phe Lys Pro Thr Glu Ala Thr Ile Phe Ile Thr

370 375 380

gga tct aac gaa tgg aaa caa ttt gat gct tgg cca cca aaa aat gta 1260

Gly Ser Asn Glu Trp Lys Gln Phe Asp Ala Trp Pro Pro Lys Asn Val

385 390 395 400

aca aca caa aaa att tat ttg caa caa aat ggt aaa ata gct ttt aat 1308

Thr Thr Gln Lys Ile Tyr Leu Gln Gln Asn Gly Lys Ile Ala Phe Asn

405 410 415

aaa acc aat aca aca act act ttt gac gaa tat gtt gca gat cca aat 1356

Lys Thr Asn Thr Thr Thr Thr Phe Asp Glu Tyr Val Ala Asp Pro Asn

420 425 430

tct cca gtt cct tat tca gga gga gtt tta gaa act cgt tca aga gaa 1404

Ser Pro Val Pro Tyr Ser Gly Gly Val Leu Glu Thr Arg Ser Arg Glu

435 440 445

tat atg gtc gat gat caa cgc ttt gct tct act cgt cct gat gtt atg 1452

Tyr Met Val Asp Asp Gln Arg Phe Ala Ser Thr Arg Pro Asp Val Met

450 455 460

gtg tat caa tct gat att ttg aca gaa gat att acg ctt gct ggt cct 1500

Val Tyr Gln Ser Asp Ile Leu Thr Glu Asp Ile Thr Leu Ala Gly Pro

465 470 475 480

gtt atc aat cat tta gtg gtt tct act acg gga aca gac gct gat tat 1548

Val Ile Asn His Leu Val Val Ser Thr Thr Gly Thr Asp Ala Asp Tyr

485 490 495

gtt gta aaa ttg att gat gtt tat cct gaa aac acg cca aaa ttt aat 1596

Val Val Lys Leu Ile Asp Val Tyr Pro Glu Asn Thr Pro Lys Phe Asn

500 505 510

aac aaa tta atg gct gga tat caa aat ttg att cgt gca gaa att atg 1644

Asn Lys Leu Met Ala Gly Tyr Gln Asn Leu Ile Arg Ala Glu Ile Met

515 520 525

cgc gga aaa tat aga aat agt ttc tct aac ccc gaa gct atg gtt ccg 1692

Arg Gly Lys Tyr Arg Asn Ser Phe Ser Asn Pro Glu Ala Met Val Pro

530 535 540

aat aaa gaa aca aat gta acg tac acg atg cca gat gtt gga cat aca 1740

Asn Lys Glu Thr Asn Val Thr Tyr Thr Met Pro Asp Val Gly His Thr

545 550 555 560

ttt aag aaa gga cat cgc att atg att caa gtt cag aac agt tgg ttt 1788

Phe Lys Lys Gly His Arg Ile Met Ile Gln Val Gln Asn Ser Trp Phe

565 570 575

cct tta gca gat cgc aat ccg caa caa ttt atg aat gtt tac gaa gca 1836

Pro Leu Ala Asp Arg Asn Pro Gln Gln Phe Met Asn Val Tyr Glu Ala

580 585 590

act tct aaa gat tat tta aaa caa acg caa cga att tat cat act tct 1884

Thr Ser Lys Asp Tyr Leu Lys Gln Thr Gln Arg Ile Tyr His Thr Ser

595 600 605

tat atc gaa att ccg gta ttg aaa taacaaaaaa atccagctaa ttagctggat 1938

Tyr Ile Glu Ile Pro Val Leu Lys

610 615

tttttttata atgttacttt tcctattttt cctttatttc caactaaaat tacatatttt 1998

ttatcgggcg aaaccgtaca agtatg 2024

<210>6

<211>616

<212>PRT

＜213〉lack steady stalk bacterium

<400>6

Val Lys Lys Leu Thr Leu Lys Val Thr Leu Leu Thr Leu Leu Leu Gly

1 5 10 15

Ser Thr Val Gly Phe Ala Gln Asp Ala Lys Ala Asp Ser Ala Tyr Val

20 25 30

Arg Asp Asn Tyr Glu Lys Ile Glu Gln Val Ile Pro Met Arg Asp Gly

35 40 45

Thr Lys Leu Phe Thr Ala Ile Tyr Gln Pro Lys Asp Lys Thr Lys Gln

50 55 60

Tyr Pro Val Leu Leu Asn Arg Thr Pro Tyr Thr Val Ala Pro Tyr Gly

65 70 75 80

Val Asn Glu Tyr Lys Lys Ser Leu Gly Asn Phe Pro Thr Glu Met Arg

85 90 95

Glu Gly Phe Ile Phe Val Tyr Gln Asp Val Arg Gly Lys Trp Met Ser

100 105 110

Glu Gly Glu Phe Glu Asp Val Arg Pro Ile Asn Pro Ser Lys Ser Lys

115 120 125

Lys Ala Ile Asp Glu Ser Thr Asp Thr Phe Asp Thr Leu Glu Trp Leu

130 135 140

Ala Lys Asn Leu Lys Asn Tyr Thr Lys Lys Ala Gly Ile Tyr Gly Ile

145 150 155 160

Ser Tyr Pro Gly Phe Tyr Ser Thr Met Ser Leu Val Asn Ser His Pro

165 170 175

Thr Leu Lys Ala Val Ser Pro Gln Ala Pro Val Thr Asn Trp Phe Leu

180 185 190

Gly Asp Asp Phe His His Asn Gly Val Leu Phe Leu Asn Asp Ser Phe

195 200 205

Ser Phe Met Thr Phe Phe Gly Val Lys Arg Pro Gln Pro Ile Thr Pro

210 215 220

Asp Lys Gly Pro Lys Arg Phe Glu Tyr Pro Ile Lys Asp Asn Tyr Arg

225 230 235 240

Phe Tyr Ala Ser Gly Ser Val Lys Glu Leu Lys Asp Lys Tyr Leu Gln

245 250 255

Asp Asn Ile Lys Phe Tyr Asn Asp Leu Phe Ala His Pro Asp Tyr Asp

260 265 270

Gln Phe Trp Gln Asp Arg Asn Val Leu Pro His Leu Thr Asn Val Gln

275 280 285

Pro Ala Val Met Thr Val Gly Gly Phe Phe Asp Ala 6lu Asp Val Tyr

290 295 300

Gly Ala Phe Glu Thr Tyr Lys Ala Ile Glu Lys Gln Asn Pro Lys Ala

305 310 315 320

Thr Asn Ile Met Val Ala Gly Pro Trp Phe His Gly Gly Trp Val Arg

325 330 335

Ser Asn Gly Ser Thr Phe Gly Asp Met Gln Phe Ala Ser Asn Thr Ser

340 345 350

Glu His Tyr Gln Gln Glu Ile Glu Leu Pro Phe Phe Asn Tyr Tyr Leu

355 360 365

Lys Asp Lys Gly Asn Phe Lys Pro Thr Glu Ala Thr Ile Phe Ile Thr

370 375 380

Gly Ser Asn Glu Trp Lys Gln Phe Asp Ala Trp Pro Pro Lys Asn Val

385 390 395 400

Thr Thr Gln Lys Ile Tyr Leu Gln Gln Asn Gly Lys Ile Ala Phe Asn

405 410 415

Lys Thr Asn Thr Thr Thr Thr Phe Asp Glu Tyr Val Ala Asp Pro Asn

420 425 430

Ser Pro Val Pro Tyr Ser Gly Gly Val Leu Glu Thr Arg Ser Arg Glu

435 440 445

Tyr Met Val Asp Asp Gln Arg Phe Ala Ser Thr Arg Pro Asp Val Met

450 455 460

Val Tyr Gln Ser Asp Ile Leu Thr Glu Asp Ile Thr Leu Ala Gly Pro

465 470 475 480

Val Ile Asn His Leu Val Val Ser Thr Thr Gly Thr Asp Ala Asp Tyr

485 490 495

Val Val Lys Leu Ile Asp Val Tyr Pro Glu Asn Thr Pro Lys Phe Asn

500 505 510

Asn Lys Leu Met Ala Gly Tyr Gln Asn Leu Ile Arg Ala Glu Ile Met

515 520 525

Arg Gly Lys Tyr Arg Asn Ser Phe Ser Asn Pro Glu Ala Met Val Pro

530 535 540

Asn Lys Glu Thr Asn Val Thr Tyr Thr Met Pro Asp Val Gly His Thr

545 550 555 560

Phe Lys Lys Gly His Arg Ile Met Ile Gln Val Gln Asn Ser Trp Phe

565 570 575

Pro Leu Ala Asp Arg Asn Pro Gln Gln Phe Met Asn Val Tyr Glu Ala

580 585 590

Thr Ser Lys Asp Tyr Leu Lys Gln Thr Gln Arg Ile Tyr His Thr Ser

595 600 605

Tyr Ile Glu Ile Pro Val Leu Lys

610 615

<210>7

<211>40

<212>DNA

＜213〉composition sequence

<220>

＜223〉artificial sequence description: be the synthetic primer of preparation pTrpT

<400>7

gtatcacgag gccctagctg tggtgtcatg gtcggtgatc 40

<210>8

<211>40

<212>DNA

＜213〉composition sequence

<220>

<400>8

ttcggggatt ccatatgata ccctttttac gtgaacttgc 40

<210>9

<211>38

<212>DNA

＜213〉composition sequence

<220>

＜223〉artificial sequence description: be the synthetic primer of preparation pTrpT_Gtg2

<400>9

gggaattcca tatgaaaaaa ttaacattaa aagtaact 38

<210>10

<211>36

<212>DNA

＜213〉composition sequence

<220>

<400>10

gggggctgca gtacttgtac ggtttcgccc gataaa 36

<210>11

<211>1935

<212>DNA

＜213〉Sphingobacterium sp.

<220>

<221>CDS

<222>(61)..(1917)

＜223〉peptide synthetase gene

<400>11

gaaaccaagt gtaaaattat aatttacacc aaagaatgta ctgaacaaat aattatctga 60

atg aaa aat aca att tcg tgc cta act tta gcg ctt tta agc gca agc 108

Met Lys Asn Thr Ile Ser Cys Leu Thr Leu Ala Leu Leu Ser Ala Ser

1 5 10 15

cag tta cat gct caa aca gct gcc gac tcg gct tat gtt aga gat cat 156

Gln Leu His Ala Gln Thr Ala Ala Asp Ser Ala Tyr Val Arg Asp His

20 25 30

tat gaa aag acc gaa gta gca att ccc atg cga gat ggg aaa aaa tta 204

Tyr Glu Lys Thr Glu Val Ala Ile Pro Met Arg Asp Gly Lys Lys Leu

35 40 45

ttt act gcg atc tac agt cca aaa gac aaa tcc aag aaa tat cca gtt 252

Phe Thr Ala Ile Tyr Ser Pro Lys Asp Lys Ser Lys Lys Tyr Pro Val

50 55 60

ttg ctc aat aga acg ccc tac acg gtt tca cct tat ggg cag aac gaa 300

Leu Leu Asn Arg Thr Pro Tyr Thr Val Ser Pro Tyr Gly Gln Asn Glu

65 70 75 80

tat aaa aaa agc ttg gga aac ttt ccc caa atg atg cgt gaa ggc tat 348

Tyr Lys Lys Ser Leu Gly Asn Phe Pro Gln Met Met Arg Glu Gly Tyr

85 90 95

att ttc gtt tac cag gat gtc cgt ggc aag tgg atg agc gaa ggt gat 396

Ile Phe Val Tyr Gln Asp Val Arg Gly Lys Trp Met Ser Glu Gly Asp

100 105 110

ttt gaa gat ata cgt ccg acc acg tac agc aaa gat aaa aaa gca atc 444

Phe Glu Asp Ile Arg Pro Thr Thr Tyr Ser Lys Asp Lys Lys Ala Ile

115 120 125

gat gaa agt acg gat acc tat gat gcg ctt gaa tgg tta cag aaa aat 492

Asp Glu Ser Thr Asp Thr Tyr Asp Ala Leu Glu Trp Leu Gln Lys Asn

130 135 140

ctc aaa aac tat aat ggc aaa gcc ggg ctc tat ggg att tcc tat cca 540

Leu Lys Asn Tyr Asn Gly Lys Ala Gly Leu Tyr Gly Ile Ser Tyr Pro

145 150 155 160

ggc ttc tat tct acc gtc gga ttg gtc aaa aca cac ccg agc ttg aag 588

Gly Phe Tyr Ser Thr Val Gly Leu Val Lys Thr His Pro Ser Leu Lys

165 170 175

gca gtc tcc cca cag gct ccc gta aca gac tgg tat atc ggc gac gac 636

Ala Val Ser Pro Gln Ala Pro Val Thr Asp Trp Tyr Ile Gly Asp Asp

180 185 190

ttc cac cat aat ggc gta ttg ttt ctt cag gat gca ttt aca ttc atg 684

Phe His His Asn Gly Val Leu Phe Leu Gln Asp Ala Phe Thr Phe Met

195 200 205

tca acc ttt ggt gtc cct cgt cca aaa ccc att aca ccg gat caa ttt 732

Ser Thr Phe Gly Val Pro Arg Pro Lys Pro Ile Thr Pro Asp Gln Phe

210 215 220

aag ggc aaa att cag atc aaa gaa gcc gat aaa tat aac ttt ttt gca 780

Lys Gly Lys Ile Gln Ile Lys Glu Ala Asp Lys Tyr Asn Phe Phe Ala

225 230 235 240

gaa gca gga aca gcg cgg gaa ctc aaa gaa aag tat ttt ggt gac tcc 828

Glu Ala Gly Thr Ala Arg Glu Leu Lys Glu Lys Tyr Phe Gly Asp Ser

245 250 255

gta caa ttt tgg aat gac ctg ttt aag cat ccc gac tat gat gat ttt 876

Val Gln Phe Trp Asn Asp Leu Phe Lys His Pro Asp Tyr Asp Asp Phe

260 265 270

tgg aaa tcg cgt gtg atc acg aat tct tta cag gag gta aaa cca gct 924

Trp Lys Ser Arg Val Ile Thr Asn Ser Leu Gln Glu Val Lys Pro Ala

275 280 285

gtg atg gtg gtt ggt ggt ttc ttt gac gcg gaa gat gct tat gga aca 972

Val Met Val Val Gly Gly Phe Phe Asp Ala Glu Asp Ala Tyr Gly Thr

290 295 300

ttt aag acc tac caa tcg att gag gat aaa agc aaa aaa aac aac tcg 1020

Phe Lys Thr Tyr Gln Ser Ile Glu Asp Lys Ser Lys Lys Asn Asn Ser

305 310 315 320

att tta gtc gcg gga cct tgg tat cat ggc ggt tgg gtt cgt gca gaa 1068

Ile Leu Val Ala Gly Pro Trp Tyr His Gly Gly Trp Val Arg Ala Glu

325 330 335

gga aac tat tta ggt gat atc caa ttt gag aaa aaa acc agt att act 1116

Gly Asn Tyr Leu Gly Asp Ile Gln Phe Glu Lys Lys Thr Ser Ile Thr

340 345 350

tat cag gaa caa ttt gaa caa cca ttt ttc aaa tat tac cta aaa gat 1164

Tyr Gln Glu Gln Phe Glu Gln Pro Phe Phe Lys Tyr Tyr Leu Lys Asp

355 360 365

gaa gga aac ttc gcc cct tcc gaa gct aac att ttt gtt tca ggc agc 1212

Glu Gly Asn Phe Ala Pro Ser Glu Ala Asn Ile Phe Val Ser Gly Ser

370 375 380

aac gaa tgg aaa cat ttc gaa cag tgg cca cca aaa aat gta gag aca 1260

Asn Glu Trp Lys His Phe Glu Gln Trp Pro Pro Lys Asn Val Glu Thr

385 390 395 400

aaa aaa cta tac ttc caa cct cag ggg aaa ctt gga ttt gac aaa gtt 1308

Lys Lys Leu Tyr Phe Gln Pro Gln Gly Lys Leu Gly Phe Asp Lys Val

405 410 415

caa cgt aca gat tcc tgg gat gaa tat gta aca gac cct aat aaa cct 1356

Gln Arg Thr Asp Ser Trp Asp Glu Tyr Val Thr Asp Pro Asn Lys Pro

420 425 430

gtt ccg cat caa ggt ggg gta att caa aac cga aca cgg gag tat atg 1404

Val Pro His Gln Gly Gly Val Ile Gln Asn Arg Thr Arg Glu Tyr Met

435 440 445

gta gat gat caa cgt ttc gcg gct agt cgc cct gat gtc atg gtt tat 1452

Val Asp Asp Gln Arg Phe Ala Ala Ser Arg Pro Asp Val Met Val Tyr

450 455 460

caa acg gaa ccg ttg acg gag gac ctg acg ata gta ggc cca atc aaa 1500

Gln Thr Glu Pro Leu Thr Glu Asp Leu Thr Ile Val Gly Pro Ile Lys

465 470 475 480

aac ttt ctc aaa gtt tct tca aca gga aca gac gcg gac tat gtt gtc 1548

Asn Phe Leu Lys Val Ser Ser Thr Gly Thr Asp Ala Asp Tyr Val Val

485 490 495

aaa ctg att gac gtt tat ccg aat gat gca gca agt tat caa gga aaa 1596

Lys Leu Ile Asp Val Tyr Pro Asn Asp Ala Ala Ser Tyr Gln Gly Lys

500 505 510

aca atg gct gga tat caa atg atg gta cgt ggt gag atc atg gcg ggg 1644

Thr Met Ala Gly Tyr Gln Met Met Val Arg Gly Glu Ile Met Ala Gly

515 520 525

aaa tac cga aat ggt ttc gat aaa gcg cag gcc ttg act cca ggt atg 1692

Lys Tyr Arg Asn Gly Phe Asp Lys Ala Gln Ala Leu Thr Pro Gly Met

530 535 540

gtc gaa aag gtg aat ttt gaa atg cca gac gtt gcg cat acc ttc aaa 1740

Val Glu Lys Val Asn Phe Glu Met Pro Asp Val Ala His Thr Phe Lys

545 550 555 560

aaa gga cat cgc att atg gtt cag gta caa aac tca tgg ttt ccg ctg 1788

Lys Gly His Arg Ile Met Val Gln Val Gln Asn Ser Trp Phe Pro Leu

565 570 575

gca gaa cga aat cca cag gtg ttt tta gca cct tat aca gct acc aaa 1836

Ala Glu Arg Asn Pro Gln Val Phe Leu Ala Pro Tyr Thr Ala Thr Lys

580 585 590

gct gat ttc cgc aaa gct acc caa cgt att ttt cac gat gtg aac aat 1884

Ala Asp Phe Arg Lys Ala Thr Gln Arg Ile Phe His Asp Val Asn Asn

595 600 605

gcc aca tac atc gaa ttt tct gtc ctc aaa gat tagcaggtaa attcgaaa 1935

Ala Thr Tyr Ile Glu Phe Ser Val Leu Lys Asp

610 615

<210>12

<211>619

<212>PRT

＜213〉Sphingobacterium sp.

<400>12

Met Lys Asn Thr Ile Ser Cys Leu Thr Leu Ala Leu Leu Ser Ala Ser

1 5 10 15

Gln Leu His Ala Gln Thr Ala Ala Asp Ser Ala Tyr Val Arg Asp His

20 25 30

Tyr Glu Lys Thr Glu Val Ala Ile Pro Met Arg Asp Gly Lys Lys Leu

35 40 45

Phe Thr Ala Ile Tyr Ser Pro Lys Asp Lys Ser Lys Lys Tyr Pro Val

50 55 60

Leu Leu Asn Arg Thr Pro Tyr Thr Val Ser Pro Tyr Gly Gln Asn Glu

65 70 75 80

Tyr Lys Lys Ser Leu Gly Asn Phe Pro Gln Met Met Arg Glu Gly Tyr

85 90 95

Ile Phe Val Tyr Gln Asp Val Arg Gly Lys Trp Met Ser Glu Gly Asp

100 105 110

Phe Glu Asp Ile Arg Pro Thr Thr Tyr Ser Lys Asp Lys Lys Ala Ile

115 120 125

Asp Glu Ser Thr Asp Thr Tyr Asp Ala Leu Glu Trp Leu Gln Lys Asn

130 135 140

Leu Lys Asn Tyr Asn Gly Lys Ala Gly Leu Tyr Gly Ile Ser Tyr Pro

145 150 155 160

Gly Phe Tyr Ser Thr Val Gly Leu Val Lys Thr His Pro Ser Leu Lys

165 170 175

Ala Val Ser Pro Gln Ala Pro Val Thr Asp Trp Tyr Ile Gly Asp Asp

180 185 190

Phe His His Asn Gly Val Leu Phe Leu Gln Asp Ala Phe Thr Phe Met

195 200 205

Ser Thr Phe Gly Val Pro Arg Pro Lys Pro Ile Thr Pro Asp Gln Phe

210 215 220

Lys Gly Lys Ile Gln Ile Lys Glu Ala Asp Lys Tyr Asn Phe Phe Ala

225 230 235 240

Glu Ala Gly Thr Ala Arg Glu Leu Lys Glu Lys Tyr Phe Gly Asp Ser

245 250 255

Val Gln Phe Trp Asn Asp Leu Phe Lys His Pro Asp Tyr Asp Asp Phe

260 265 270

Trp Lys Ser Arg Val Ile Thr Asn Ser Leu Gln Glu Val Lys Pro Ala

275 280 285

Val Met Val Val Gly Gly Phe Phe Asp Ala Glu Asp Ala Tyr Gly Thr

290 295 300

Phe Lys Thr Tyr Gln Ser Ile Glu Asp Lys Ser Lys Lys Asn Asn Ser

305 310 315 320

Ile Leu Val Ala Gly Pro Trp Tyr His Gly Gly Trp Val Arg Ala Glu

325 330 335

Gly Asn Tyr Leu Gly Asp Ile Gln Phe Glu Lys Lys Thr Ser Ile Thr

340 345 350

Tyr Gln Glu Gln Phe Glu Gln Pro Phe Phe Lys Tyr Tyr Leu Lys Asp

355 360 365

Glu Gly Asn Phe Ala Pro Ser Glu Ala Asn Ile Phe Val Ser Gly Ser

370 375 380

Asn Glu Trp Lys His Phe Glu Gln Trp Pro Pro Lys Asn Val Glu Thr

385 390 395 400

Lys Lys Leu Tyr Phe Gln Pro Gln Gly Lys Leu Gly Phe Asp Lys Val

405 410 415

Gln Arg Thr Asp Ser Trp Asp Glu Tyr Val Thr Asp Pro Asn Lys Pro

420 425 430

Val Pro His Gln Gly Gly Val Ile Gln Asn Arg Thr Arg Glu Tyr Met

435 440 445

Val Asp Asp Gln Arg Phe Ala Ala Ser Arg Pro Asp Val Met Val Tyr

450 455 460

Gln Thr Glu Pro Leu Thr Glu Asp Leu Thr Ile Val Gly Pro Ile Lys

465 470 475 480

Asn Phe Leu Lys Val Ser Ser Thr Gly Thr Asp Ala Asp Tyr Val Val

485 490 495

Lys Leu Ile Asp Val Tyr Pro Asn Asp Ala Ala Ser Tyr Gln Gly Lys

500 505 510

Thr Met Ala Gly Tyr Gln Met Met Val Arg Gly Glu Ile Met Ala Gly

515 520 525

Lys Tyr Arg Asn Gly Phe Asp Lys Ala Gln Ala Leu Thr Pro Gly Met

530 535 540

Val Glu Lys Val Asn Phe Glu Met Pro Asp Val Ala His Thr Phe Lys

545 550 555 560

Lys Gly His Arg Ile Met Val Gln Val Gln Asn Ser Trp Phe Pro Leu

565 570 575

Ala Glu Arg Asn Pro Gln Val Phe Leu Ala Pro Tyr Thr Ala Thr Lys

580 585 590

Ala Asp Phe Arg Lys Ala Thr Gln Arg Ile Phe His Asp Val Asn Asn

595 600 605

Ala Thr Tyr Ile Glu Phe Ser Val Leu Lys Asp

610 615

<210>13

<211>30

<212>DNA

＜213〉composition sequence

<220>

＜223〉artificial sequence description: be the synthetic primer of preparation pTrpT_Sm_aet

<400>13

gggaattcca tatgaaaaat acaatttcgt 30

<210>14

<211>29

<212>DNA

＜213〉composition sequence

<220>

<400>14

gctctagact aatctttgag gacagaaaa 29

<210>15

<211>17

<212>DNA

＜213〉artificial

<220>

＜223〉be used for the mix primer 1 of Aet

<400>15

gaygayttyc aycayaa 17

<210>16

<211>20

<212>DNA

＜213〉artificial

<220>

＜223〉be used for the mix primer 2 of Aet

<220>

<221>misc_feature

<222>(9)..(9)

＜223〉any base

<400>16

tgrtcrtcna ccatrtaytc 20

<210>17

<211>1974

<212>DNA

＜213〉separate Vitrum AB soil bacillus

<220>

<221>CDS

<222>(61)..(1935)

<223>

<400>17

aaacctatcc cgtattcagc aatcaattcc atatatttat ccttaaaaaa accttcctct 60

atg act cct ttc aaa tcg ttc tcc ttc att ttt ctc ttt att ttt acc 108

Met Thr Pro Phe Lys Ser Phe Ser Phe Ile Phe Leu Phe Ile Phe Thr

1 5 10 15

agt ctt tct gct tct gca caa cag tcc gac tct gct tat ata cgt cag 156

Ser Leu Ser Ala Ser Ala Gln Gln Ser Asp Ser Ala Tyr Ile Arg Gln

20 25 30

aac tat acc aaa ata gaa agg ctg atc cct atg cgg gat ggc att aag 204

Asn Tyr Thr Lys Ile Glu Arg Leu Ile Pro Met Arg Asp Gly Ile Lys

35 40 45

cta ttt aca gcc att tac atc ccc aaa gac aaa agc aag aag tat cct 252

Leu Phe Thr Ala Ile Tyr Ile Pro Lys Asp Lys Ser Lys Lys Tyr Pro

50 55 60

ttt atg ctc aac cgt act cct tat acc gtt tcg cct tat ggc gaa aac 300

Phe Met Leu Asn Arg Thr Pro Tyr Thr Val Ser Pro Tyr Gly Glu Asn

65 70 75 80

aat tat aaa aca agc ctt ggc ccc tct ccg ctc ttt ata aaa gaa ggc 348

Asn Tyr Lys Thr Ser Leu Gly Pro Ser Pro Leu Phe Ile Lys Glu Gly

85 90 95

ttt atc ttt gtt tat cag gat gta agg ggc aaa tgg atg agt gag gga 396

Phe Ile Phe Val Tyr Gln Asp Val Arg Gly Lys Trp Met Ser Glu Gly

100 105 110

aaa ttt gaa gac gta agg ccg caa ata gcc agc aag aaa cgc aaa acg 444

Lys Phe Glu Asp Val Arg Pro Gln Ile Ala Ser Lys Lys Arg Lys Thr

115 120 125

gat att gat gaa agc tcc gat act tat gat acg atc gac tgg ctg atc 492

Asp Ile Asp Glu Ser Ser Asp Thr Tyr Asp Thr Ile Asp Trp Leu Ile

130 135 140

agg aac att cct gga aac aac cgt aaa acc ggt att tac ggt atc tca 540

Arg Asn Ile Pro Gly Asn Asn Arg Lys Thr Gly Ile Tyr Gly Ile Ser

145 150 155 160

tac cca ggc ttt tat gct act gct gcc cta cca gat gcg cat cca tct 588

Tyr Pro Gly Phe Tyr Ala Thr Ala Ala Leu Pro Asp Ala His Pro Ser

165 170 175

tta aag gca gta tcg ccc cag gct ccg gtt acc gac tgg ttt ata ggc 636

Leu Lys Ala Val Ser Pro Gln Ala Pro Val Thr Asp Trp Phe Ile Gly

180 185 190

gat gat ttt cat cac aat ggc acc ttg ttc ctt gca gat atc ttt agc 684

Asp Asp Phe His His Asn Gly Thr Leu Phe Leu Ala Asp Ile Phe Ser

195 200 205

ttc tat tat acc ttc ggg gta ccg cga cct caa cca att acg ccc gac 732

Phe Tyr Tyr Thr Phe Gly Val Pro Arg Pro Gln Pro Ile Thr Pro Asp

210 215 220

aaa cgt cca aaa ccc ttt gat ttc ccg gtt aaa gac aac tac cgt ttt 780

Lys Arg Pro Lys Pro Phe Asp Phe Pro Val Lys Asp Asn Tyr Arg Phe

225 230 235 240

ttt ctt gaa ctg ggc ccc tta aaa aac atc acc aaa aaa tat tat ggc 828

Phe Leu Glu Leu Gly Pro Leu Lys Asn Ile Thr Lys Lys Tyr Tyr Gly

245 250 255

gat acc ata cga ttc tgg aat gat atc aat gcg cat acc aat tat gat 876

Asp Thr Ile Arg Phe Trp Asn Asp Ile Asn Ala His Thr Asn Tyr Asp

260 265 270

gcc ttc tgg aaa gcc cgt aac att acg ccg cat tta att ggt gta aaa 924

Ala Phe Trp Lys Ala Arg Asn Ile Thr Pro His Leu Ile Gly Val Lys

275 280 285

cct gca gtt ttg gta gtt ggc ggc ttc ttt gat gca gaa gac ctt tac 972

Pro Ala Val Leu Val Val Gly Gly Phe Phe Asp Ala Glu Asp Leu Tyr

290 295 300

ggt acg ctt aaa acc tat cag gcc atc gaa aaa caa aat cca tcc tca l020

Gly Thr Leu Lys Thr Tyr Gln Ala lle Glu Lys Gln Asn Pro Ser Ser

305 310 315 320

aaa aac aac ctc gtt atg ggc ccc tgg tac cat ggt ggc tgg gca aga 1068

Lys Asn Asn Leu Val Met Gly Pro Trp Tyr His Gly Gly Trp Ala Arg

325 330 335

agt acg gga agc agt ttc ggg gat att aat ttc gga cag cca acc agt 1116

Ser Thr Gly Ser Ser Phe Gly Asp Ile Asn Phe Gly Gln Pro Thr Ser

340 345 350

act tca tac cag caa aat gtt gag ttc cct ttc ttt atg caa tac ctc 1164

Thr Ser Tyr Gln Gln Asn Val Glu Phe Pro Phe Phe Met Gln Tyr Leu

355 360 365

aaa gag gca ccg gat gca aaa att gca gag gca acc att ttt atc act 1212

Lys Glu Ala Pro Asp Ala Lys Ile Ala Glu Ala Thr Ile Phe Ile Thr

370 375 380

ggc agc aat gaa tgg aag aaa ttt agc tcc tgg cca cct cag gat aca 1260

Gly Ser Asn Glu Trp Lys Lys Phe Ser Ser Trp Pro Pro Gln Asp Thr

385 390 395 400

gaa gaa aga aca tta tac ctg cag ccc aat ggc aaa ctg agc ttt gag 1308

Glu Glu Arg Thr Leu Tyr Leu Gln Pro Asn Gly Lys Leu Ser Phe Glu

405 410 415

aag gta cag cgg acc gac agc tgg gat gaa tat gta agt gat ccc aat 1356

Lys Val Gln Arg Thr Asp Ser Trp Asp Glu Tyr Val Ser Asp Pro Asn

420 425 430

tca cct gtc cct tat cag gat ggc ata caa acc agc aga acc cgg gaa 1404

Ser Pro Val Pro Tyr Gln Asp Gly Ile Gln Thr Ser Arg Thr Arg Glu

435 440 445

tat atg atc gat gac cag cgt ttt gcc tcg cgc aga ccg gat gta agg 1452

Tyr Met Ile Asp Asp Gln Arg Phe Ala Ser Arg Arg Pro Asp Val Arg

450 455 460

gta ttc caa aca gag ccc ctc agt tcc gac ctt aca ctt acc ggc ccg 1500

Val Phe Gln Thr Glu Pro Leu Ser Ser Asp Leu Thr Leu Thr Gly Pro

465 470 475 480

gta ttg gcc aaa ctg gtg gta tca acc aca ggt acg gat gca gat tat 1548

Val Leu Ala Lys Leu Val Val Ser Thr Thr Gly Thr Asp Ala Asp Tyr

485 490 495

gtg gta aaa ctg ata gat gta tat ccg gaa gat aca cca aat cct gta 1596

Val Val Lys Leu Ile Asp Val Tyr Pro Glu Asp Thr Pro Asn Pro Val

500 505 510

cct aac cct aaa aac ctg atc atg ggt ggt tac cag atg ctg gta cgc 1644

Pro Asn Pro Lys Asn Leu Ile Met Gly Gly Tyr Gln Met Leu Val Arg

515 520 525

ggc gag atc atg cgt gga aaa tac cgt aat agc ttt gaa aaa ccc gag 1692

Gly Glu Ile Met Arg Gly Lys Tyr Arg Asn Ser Phe Glu Lys Pro Glu

530 535 540

cct ttt gtt cct gga aca att aca aaa gta aac tat gcc ctt ccg gat 1740

Pro Phe Val Pro Gly Thr Ile Thr Lys Val Asn Tyr Ala Leu Pro Asp

545 550 555 560

gta gcc cat acc ttt aaa aaa ggc cac cgc atc atg atc cag gtc cag 1788

Val Ala His Thr Phe Lys Lys Gly His Arg Ile Met Ile Gln Val Gln

565 570 575

aat tca tgg ttt ccc ctg gcc gac cgg aat cca cag cag ttt atg gac 1836

Asn Ser Trp Phe Pro Leu Ala Asp Arg Asn Pro Gln Gln Phe Met Asp

580 585 590

att tac cag gcc gaa cct ggc gat ttc aga aaa gct acg cat agg atc 1884

Ile Tyr Gln Ala Glu Pro Gly Asp Phe Arg Lys Ala Thr His Arg Ile

595 600 605

ttc cac gat gta cac aat gca tct gca att acg gta aac gta ctg aaa 1932

Phe His Asp Val His Asn Ala Ser Ala Ile Thr Val Asn Val Leu Lys

610 615 620

cct taaaacggat gaaaccagta tattgtgcca tccttactt 1974

Pro

625

<210>18

<211>625

<212>PRT

＜213〉separate Vitrum AB soil bacillus

<400>18

Met Thr Pro Phe Lys Ser Phe Ser Phe Ile Phe Leu Phe Ile Phe Thr

1 5 10 15

Ser Leu Ser Ala Ser Ala Gln Gln Ser Asp Ser Ala Tyr Ile Arg Gln

20 25 30

Asn Tyr Thr Lys Ile Glu Arg Leu Ile Pro Met Arg Asp Gly Ile Lys

35 40 45

Leu Phe Thr Ala Ile Tyr Ile Pro Lys Asp Lys Ser Lys Lys Tyr Pro

50 55 60

Phe Met Leu Asn Arg Thr Pro Tyr Thr Val Ser Pro Tyr Gly Glu Asn

65 70 75 80

Asn Tyr Lys Thr Ser Leu Gly Pro Ser Pro Leu Phe Ile Lys Glu Gly

85 90 95

Phe Ile Phe Val Tyr Gln Asp Val Arg Gly Lys Trp Met Ser Glu Gly

100 105 110

Lys Phe Glu Asp Val Arg Pro Gln Ile Ala Ser Lys Lys Arg Lys Thr

115 120 125

Asp Ile Asp Glu Ser Ser Asp Thr Tyr Asp Thr Ile Asp Trp Leu Ile

130 135 140

Arg Asn Ile Pro Gly Asn Asn Arg Lys Thr Gly Ile Tyr Gly Ile Ser

145 150 155 160

Tyr Pro Gly Phe Tyr Ala Thr Ala Ala Leu Pro Asp Ala His Pro Ser

165 170 175

Leu Lys Ala Val Ser Pro Gln Ala Pro Val Thr Asp Trp Phe Ile Gly

180 185 190

Asp Asp Phe His His Asn Gly Thr Leu Phe Leu Ala Asp Ile Phe Ser

195 200 205

Phe Tyr Tyr Thr Phe Gly Val Pro Arg Pro Gln Pro Ile Thr Pro Asp

210 215 220

Lys Arg Pro Lys Pro Phe Asp Phe Pro Val Lys Asp Asn Tyr Arg Phe

225 230 235 240

Phe Leu Glu Leu Gly Pro Leu Lys Asn Ile Thr Lys Lys Tyr Tyr Gly

245 250 255

Asp Thr Ile Arg Phe Trp Asn Asp Ile Asn Ala His Thr Asn Tyr Asp

260 265 270

Ala Phe Trp Lys Ala Arg Asn Ile Thr Pro His Leu Ile Gly Val Lys

275 280 285

Pro Ala Val Leu Val Val Gly Gly Phe Phe Asp Ala Glu Asp Leu Tyr

290 295 300

Gly Thr Leu Lys Thr Tyr Gln Ala Ile Glu Lys Gln Asn Pro Ser Ser

305 310 315 320

Lys Asn Asn Leu Val Met Gly Pro Trp Tyr His Gly Gly Trp Ala Arg

325 330 335

Ser Thr Gly Ser Ser Phe Gly Asp Ile Asn Phe Gly Gln Pro Thr Ser

340 345 350

Thr Ser Tyr Gln Gln Asn Val Glu Phe Pro Phe Phe Met Gln Tyr Leu

355 360 365

Lys Glu Ala Pro Asp Ala Lys Ile Ala Glu Ala Thr Ile Phe Ile Thr

370 375 380

Gly Ser Asn Glu Trp Lys Lys Phe Ser Ser Trp Pro Pro Gln Asp Thr

385 390 395 400

Glu Glu Arg Thr Leu Tyr Leu Gln Pro Asn Gly Lys Leu Ser Phe Glu

405 410 415

Lys Val Gln Arg Thr Asp Ser Trp Asp Glu Tyr Val Ser Asp Pro Asn

420 425 430

Ser Pro Val Pro Tyr Gln Asp Gly Ile Gln Thr Ser Arg Thr Arg Glu

435 440 445

Tyr Met Ile Asp Asp Gln Arg Phe Ala Ser Arg Arg Pro Asp Val Arg

450 455 460

Val Phe Gln Thr Glu Pro Leu Ser Ser Asp Leu Thr Leu Thr Gly Pro

465 470 475 480

Val Leu Ala Lys Leu Val Val Ser Thr Thr Gly Thr Asp Ala Asp Tyr

485 490 495

Val Val Lys Leu Ile Asp Val Tyr Pro Glu Asp Thr Pro Asn Pro Val

500 505 510

Pro Asn Pro Lys Asn Leu Ile Met Gly Gly Tyr Gln Met Leu Val Arg

515 520 525

Gly Glu Ile Met Arg Gly Lys Tyr Arg Asn Ser Phe Glu Lys Pro Glu

530 535 540

Pro Phe Val Pro Gly Thr Ile Thr Lys Val Asn Tyr Ala Leu Pro Asp

545 550 555 560

Val Ala His Thr Phe Lys Lys Gly His Arg Ile Met Ile Gln Val Gln

565 570 575

Asn Ser Trp Phe Pro Leu Ala Asp Arg Asn Pro Gln Gln Phe Met Asp

580 585 590

Ile Tyr Gln Ala Glu Pro Gly Asp Phe Arg Lys Ala Thr His Arg Ile

595 600 605

Phe His Asp Val His Asn Ala Ser Ala Ile Thr Val Asn Val Leu Lys

610 615 620

Pro

625

<210>19

<211>38

<212>DNA

＜213〉artificial

<220>

＜223〉be used to make up the primer 1 of the aet expression vector that comes from Pedobacter

<400>19

gggaattcca tatgactcct ttcaaatcgt tctccttc 38

<210>20

<211>30

<212>DNA

＜213〉artificial

<220>

＜223〉be used to make up the primer 2 of the aet expression vector that comes from Pedobacter

<400>20

cccaagcttt taaggtttca gtacgtttac 30

<210>21

<211>17

<212>DNA

＜213〉artificial

<220>

＜223〉be used for the mix primer 3 of Aet

<220>

<221>misc_feature

<222>(9)..(9)

＜223〉any base

<400>21

athttygtnt aycarga 17

<210>22

<211>2018

<212>DNA

<213>Taxeobacter gelupurpurascens

<220>

<221>CDS

<222>(61)..(1995)

<223>

<400>22

ctgaatgtct gctgacgaat tggaactaca ttaggctcgt tcttcaccta cccttccact 60

atg ccc tac tct ttc ccg aaa gtt gcc gcc ctg agt ggc cta ctg gtg 108

Met Pro Tyr Ser Phe Pro Lys Val Ala Ala Leu Ser Gly Leu Leu Val

1 5 10 15

gcc ggt tta tcc ggt gcc cac gcc caa act cct gtt acc tat ccg ctg 156

Ala Gly Leu Ser Gly Ala His Ala Gln Thr Pro Val Thr Tyr Pro Leu

20 25 30

gct tct gag gct gaa aaa gcg cag ctg gcg gtg gta cta gcc gat acg 204

Ala Ser Glu Ala Glu Lys Ala Gln Leu Ala Val Val Leu Ala Asp Thr

35 40 45

gct tac atc aag gag cgc tat acc aaa aca gaa tat cag att ccg atg 252

Ala Tyr Ile Lys Glu Arg Tyr Thr Lys Thr Glu Tyr Gln Ile Pro Met

50 55 60

cgc gat ggg gtg aag ttg tac acc att gtg tac gcg ccc aac gat gcc 300

Arg Asp Gly Val Lys Leu Tyr Thr Ile Val Tyr Ala Pro Asn Asp Ala

65 70 75 80

aac aag gta aag tac cct att ctg ctc aac cgt acc cct tac gct att 348

Asn Lys Val Lys Tyr Pro Ile Leu Leu Asn Arg Thr Pro Tyr Ala Ile

85 90 95

ggc ccc tac ggc ccc ggc aaa tac aag ctc aac ctg ggc ccc agc agc 396

Gly Pro Tyr Gly Pro Gly Lys Tyr Lys Leu Asn Leu Gly Pro Ser Ser

100 105 110

acg atg atg cat gag gga tac atc ttc gcc tac cag gat gtg cgt ggg 444

Thr Met Met His Glu Gly Tyr Ile Phe Ala Tyr Gln Asp Val Arg Gly

115 120 125

cga tat atg tcg gaa gga gag ttt gtg gat gtg cgc ccc gaa aag gac 492

Arg Tyr Met Ser Glu Gly Glu Phe Val Asp Val Arg Pro Glu Lys Asp

130 135 140

atg cac aaa ggc aag aac gac atc gat gaa ggc acc gac acc tac gat 540

Met His Lys Gly Lys Asn Asp Ile Asp Glu Gly Thr Asp Thr Tyr Asp

145 150 155 160

acc att gag tgg ctt ctg aag cac ggg ccc aag aat aac ggc cgc gta 588

Thr Ile Glu Trp Leu Leu Lys His Gly Pro Lys Asn Asn Gly Arg Val

165 170 175

ggc cag tgg ggc atc tcc tac ccc ggc tac tat acc gct act ggc cta 636

Gly Gln Trp Gly Ile Ser Tyr Pro Gly Tyr Tyr Thr Ala Thr Gly Leu

180 185 190

ctg agc cgc cac aag gcc cta aag gca tcc tca ccg cag gcc cct att 684

Leu Ser Arg His Lys Ala Leu Lys Ala Ser Ser Pro Gln Ala Pro Ile

195 200 205

gcc gac tgg ttc tgg gac gat ttt cac cac aac ggc gcg ttc ttc ctg 732

Ala Asp Trp Phe Trp Asp Asp Phe His His Asn Gly Ala Phe Phe Leu

210 215 220

ccg cac gct ttc aac ttc ctg gcc tcc ttt ggg ctg gcc cgc ccc cag 780

Pro His Ala Phe Asn Phe Leu Ala Ser Phe Gly Leu Ala Arg Pro Gln

225 230 235 240

ccc acg cct acc ggc aac ccc ggc ttc aag cac ggc acc ccc gat ggc 828

Pro Thr Pro Thr Gly Asn Pro Gly Phe Lys His Gly Thr Pro Asp Gly

245 250 255

tac gat ttt ttc ctg aag atg ggt ccg ctg aaa aac gct gat gcc aac 876

Tyr Asp Phe Phe Leu Lys Met Gly Pro Leu Lys Asn Ala Asp Ala Asn

260 265 270

tac tac aaa ggc aaa gtg gcc ttc tgg aac gaa atg gcc agc cac ccc 924

Tyr Tyr Lys Gly Lys Val Ala Phe Trp Asn Glu Met Ala Ser His Pro

275 280 285

aac tac gac gaa ttc tgg cag gcc cgt aac cta cgc ccc cac ctc aag 972

Asn Tyr Asp Glu Phe Trp Gln Ala Arg Asn Leu Arg Pro His Leu Lys

290 295 300

aac ctc aac aaa ggc acc gcg gtg ctc acg gtt ggt ggc ttc aat gat 1020

Asn Leu Asn Lys Gly Thr Ala Val Leu Thr Val Gly Gly Phe Asn Asp

305 310 315 320

gcc gag gac ctg ttt ggc gcc ctg aaa acc tac gaa agc arc gag aag 1068

Ala Glu Asp Leu Phe Gly Ala Leu Lys Thr Tyr Glu Ser Ile Glu Lys

325 330 335

caa aac ccc ggc atg cgc aac ggc ctc gtg atg ggg ccg tgg gta cac 1116

Gln Asn Pro Gly Met Arg Asn Gly Leu Val Met Gly Pro Trp Val His

340 345 350

ggt ggc tgg gcc cgc ggc act ggc gaa atg gta ggc aat gtg gcc tac 1164

Gly Gly Trp Ala Arg Gly Thr Gly Glu Met Val Gly Asn Val Ala Tyr

355 360 365

ggc gag tcg ccg tcg ttg tat tac cag aag cag att gaa gcg ccg ttc 1212

Gly Glu Ser Pro Ser Leu Tyr Tyr Gln Lys Gln Ile Glu Ala Pro Phe

370 375 380

ttc aaa tca tat ctg aag gat ggc aaa cct gcc gct acc ccc gag gct 1260

Phe Lys Ser Tyr Leu Lys Asp Gly Lys Pro Ala Ala Thr Pro Glu Ala

385 390 395 400

acc atc ttt gaa agc ggc acc aac cgc tgg cgc agc ttc gaa acc tgg 1308

Thr Ile Phe Glu Ser Gly Thr Asn Arg Trp Arg Ser Phe Glu Thr Trp

405 410 415

ccg ccc aaa gaa gcc aaa gag cgc act ttg tac ttt cag tcg gcc ggg 1356

Pro Pro Lys Glu Ala Lys Glu Arg Thr Leu Tyr Phe Gln Ser Ala Gly

420 425 430

aaa atc ggc ttc gag aag cct gcc agt ggc cta gag tac gac cag ttc 1404

Lys Ile Gly Phe Glu Lys Pro Ala Ser Gly Leu Glu Tyr Asp Gln Phe

435 440 445

ctc agc gac ccg gct cac cca gtg cct ttc acc gaa gct acg gct acg 1452

Leu Ser Asp Pro Ala His Pro Val Pro Phe Thr Glu Ala Thr Ala Thr

450 455 460

ggc atg acc cgc gag tac atg acc gac gac cag cgc ttc gcc agc cgc 1500

Gly Met Thr Arg Glu Tyr Met Thr Asp Asp Gln Arg Phe Ala Ser Arg

465 470 475 480

cgc ccc gac gtg ctg acc tac cag acc gaa gcg ctt acc gag gac atg 1548

Arg Pro Asp Val Leu Thr Tyr Gln Thr Glu Ala Leu Thr Glu Asp Met

485 490 495

acg ctg gct ggc cct atc gag gcg ctg ttg cag gta gcc acc acc ggc 1596

Thr Leu Ala Gly Pro Ile Glu Ala Leu Leu Gln Val Ala Thr Thr Gly

500 505 510

acc gat gcc gac tgg gta gtg aag att att gat gtg tac ccc gac gat 1644

Thr Asp Ala Asp Trp Val Val Lys Ile Ile Asp Val Tyr Pro Asp Asp

515 520 525

acg ccc aac aac ccc agc acg aac ccc gcc gtg aaa ctg ggc ggc tac 1692

Thr Pro Asn Asn Pro Ser Thr Asn Pro Ala Val Lys Leu Gly Gly Tyr

530 535 540

cag cag atg gtt cgc tcc gag gtg atg cgc ggt cgt ttc cgc aac agc 1740

Gln Gln Met Val Arg Ser Glu Val Met Arg Gly Arg Phe Arg Asn Ser

545 550 555 560

ttc tcc aag ccc gaa gcc ttt gta ccg gaa cag gta acg gcc gtg ccc 1788

Phe Ser Lys Pro Glu Ala Phe Val Pro Glu Gln Val Thr Ala Val Pro

565 570 575

ttc acg gtg cag gac ctg tgc cac acc ttc cgg aaa gga cac cgc ctg 1836

Phe Thr Val Gln Asp Leu Cys His Thr Phe Arg Lys Gly His Arg Leu

580 585 590

atg gtg cag gtg caa agc agc tgg ttc ccg att gtt gac cgc aac ccg 1884

Met Val Gln Val Gln Ser Ser Trp Phe Pro Ile Val Asp Arg Asn Pro

595 600 605

cag acc ttc gta ccc aat att ttc gag gcc gat gag aag gat ttc cag 1932

Gln Thr Phe Val Pro Asn Ile Phe Glu Ala Asp Glu Lys Asp Phe Gln

610 615 620

gcc gcc acg cat cgg ctg tac cat tcg ccg gcg cat agc tcg cag ctc 1980

Ala Ala Thr His Arg Leu Tyr His Ser Pro Ala His Ser Ser Gln Leu

625 630 635 640

acg ttg cgc gtt ctg taggccactc taaacaggct cgg 2018

Thr Leu Arg Val Leu

645

<210>23

<211>645

<212>PRT

<213>Taxeobacter gelupurpurascens

<400>23

Met Pro Tyr Ser Phe Pro Lys Val Ala Ala Leu Ser Gly Leu Leu Val

1 5 10 15

Ala Gly Leu Ser Gly Ala His Ala Gln Thr Pro Val Thr Tyr Pro Leu

20 25 30

Ala Ser Glu Ala Glu Lys Ala Gln Leu Ala Val Val Leu Ala Asp Thr

35 40 45

Ala Tyr Ile Lys Glu Arg Tyr Thr Lys Thr Glu Tyr Gln Ile Pro Met

50 55 60

Arg Asp Gly Val Lys Leu Tyr Thr Ile Val Tyr Ala Pro Asn Asp Ala

65 70 75 80

Asn Lys Val Lys Tyr Pro Ile Leu Leu Asn Arg Thr Pro Tyr Ala Ile

85 90 95

Gly Pro Tyr Gly Pro Gly Lys Tyr Lys Leu Asn Leu Gly Pro Ser Ser

100 105 110

Thr Met Met His Glu Gly Tyr Ile Phe Ala Tyr Gln Asp Val Arg Gly

115 120 125

Arg Tyr Met Ser Glu Gly Glu Phe Val Asp Val Arg Pro Glu Lys Asp

130 135 l40

Met His Lys Gly Lys Asn Asp Ile Asp Glu Gly Thr Asp Thr Tyr Asp

145 150 155 160

Thr Ile Glu Trp Leu Leu Lys His Gly Pro Lys Asn Asn Gly Arg Val

165 170 175

Gly Gln Trp Gly Ile Ser Tyr Pro Gly Tyr Tyr Thr Ala Thr Gly Leu

180 185 190

Leu Ser Arg His Lys Ala Leu Lys Ala Ser Ser Pro Gln Ala Pro Ile

195 200 205

Ala Asp Trp Phe Trp Asp Asp Phe His His Asn Gly Ala Phe Phe Leu

210 215 220

Pro His Ala Phe Asn Phe Leu Ala Ser Phe Gly Leu Ala Arg Pro Gln

225 230 235 240

Pro Thr Pro Thr Gly Asn Pro Gly Phe Lys His Gly Thr Pro Asp Gly

245 250 255

Tyr Asp Phe Phe Leu Lys Met Gly Pro Leu Lys Asn Ala Asp Ala Asn

260 265 270

Tyr Tyr Lys Gly Lys Val Ala Phe Trp Asn Glu Met Ala Ser His Pro

275 280 285

Asn Tyr Asp Glu Phe Trp Gln Ala Arg Asn Leu Arg Pro His Leu Lys

290 295 300

Asn Leu Asn Lys Gly Thr Ala Val Leu Thr Val Gly Gly Phe Asn Asp

305 310 315 320

Ala Glu Asp Leu Phe Gly Ala Leu Lys Thr Tyr Glu Ser Ile Glu Lys

325 330 335

Gln Asn Pro Gly Met Arg Asn Gly Leu Val Met Gly Pro Trp Val His

340 345 350

Gly Gly Trp Ala Arg Gly Thr Gly Glu Met Val Gly Asn Val Ala Tyr

355 360 365

Gly Glu Ser Pro Ser Leu Tyr Tyr Gln Lys Gln Ile Glu Ala Pro Phe

370 375 380

Phe Lys Ser Tyr Leu Lys Asp Gly Lys Pro Ala Ala Thr Pro Glu Ala

385 390 395 400

Thr Ile Phe Glu Ser Gly Thr Asn Arg Trp Arg Ser Phe Glu Thr Trp

405 410 415

Pro Pro Lys Glu Ala Lys Glu Arg Thr Leu Tyr Phe Gln Ser Ala Gly

420 425 430

Lys Ile Gly Phe Glu Lys Pro Ala Ser Gly Leu Glu Tyr Asp Gln Phe

435 440 445

Leu Ser Asp Pro Ala His Pro Val pro Phe Thr Glu Ala Thr Ala Thr

450 455 460

Gly Met Thr Arg Glu Tyr Met Thr Asp Asp Gln Arg Phe Ala Ser Arg

465 470 475 480

Arg Pro Asp Val Leu Thr Tyr Gln Thr Glu Ala Leu Thr Glu Asp Met

485 490 495

Thr Leu Ala Gly Pro Ile Glu Ala Leu Leu Gln Val Ala Thr Thr Gly

500 505 510

Thr Asp Ala Asp Trp Val Val Lys Ile Ile Asp Val Tyr Pro Asp Asp

515 520 525

Thr Pro Asn Asn Pro Ser Thr Asn Pro Ala Val Lys Leu Gly Gly Tyr

530 535 540

Gln Gln Met Val Arg Ser Glu Val Met Arg Gly Arg Phe Arg Asn Ser

545 550 555 560

Phe Ser Lys Pro Glu Ala Phe Val Pro Glu Gln Val Thr Ala Val Pro

565 570 575

Phe Thr Val Gln Asp Leu Cys His Thr Phe Arg Lys Gly His Arg Leu

580 585 590

Met Val Gln Val Gln Ser Ser Trp Phe Pro Ile Val Asp Arg Asn Pro

595 600 605

Gln Thr Phe Val Pro Asn Ile Phe Glu Ala Asp Glu Lys Asp Phe Gln

610 615 620

Ala Ala Thr His Arg Leu Tyr His Ser Pro Ala His Ser Ser Gln Leu

625 630 635 640

Thr Leu Arg Val Leu

645

<210>24

<211>1931

<212>DNA

＜213〉extra large round bacteria

<220>

<221>CDS

<222>(29)..(1888)

<223>

<400>24

cccaaagcat taacaaaata atttagtc atg aaa cac tgttac aaa ctt ctg 52

Met Lys His Cys Tyr Lys Leu Leu

1 5

gtc ttt tac aca tta ttt ttg atg acc aca aac tgg gct tta tca caa 100

Val Phe Tyr Thr Leu Phe Leu Met Thr Thr Asn Trp Ala Leu Ser Gln

10 15 20

gcc att aat gga tat gat aag gca gcc tat gac att cct atg cga gat 148

Ala Ile Asn Gly Tyr Asp Lys Ala Ala Tyr Asp Ile Pro Met Arg Asp

25 30 35 40

gga gtt cac ctt cac acc atc gtc tat agc ccc aaa gat tta tcg cag 196

Gly Val His Leu His Thr Ile Val Tyr Ser Pro Lys Asp Leu Ser Gln

45 50 55

ccc tat cct ata ttg atg caa agg aca cct tac agc gcc ggc cct tat 244

Pro Tyr Pro Ile Leu Met Gln Arg Thr Pro Tyr Ser Ala Gly Pro Tyr

60 65 70

ggt cct gga aat atg aaa aat aag ctt ggc cct tct cag ttt tta atg 292

Gly Pro Gly Asn Met Lys Asn Lys Leu Gly Pro Ser Gln Phe Leu Met

75 80 85

aac gat ggc tat ata ttt gtt tac cag gat gta aga ggg cgg tgg atg 340

Asn Asp Gly Tyr Ile Phe Val Tyr Gln Asp Val Arg Gly Arg Trp Met

90 95 100

tcg gaa gga tcc tat gac aac atg cgc cct acc cta tcc aaa tca gaa 388

Ser Glu Gly Ser Tyr Asp Asn Met Arg Pro Thr Leu Ser Lys Ser Glu

105 110 115 120

aga aat tcc aac caa ata gac gaa agc aca gac acc tat gat acc ata 436

Arg Asn Ser Asn Gln Ile Asp Glu Ser Thr Asp Thr Tyr Asp Thr Ile

125 130 135

gaa tgg ttg ctc gcc aat atc aaa aat cac aat gaa aaa gta ggc cta 484

Glu Trp Leu Leu Ala Asn Ile Lys Asn His Asn Glu Lys Val Gly Leu

140 145 150

tgg gga atc agc tat ccc gga ttt tat agt gct gca gcc ctt cct ttt 532

Trp Gly Ile Ser Tyr Pro Gly Phe Tyr Ser Ala Ala Ala Leu Pro Phe

155 160 165

gcc cat cca aac ctg aaa gcc gtt tcc cct caa gca ccc ata ggg gat 580

Ala His Pro Asn Leu Lys Ala Val Ser Pro Gln Ala Pro Ile Gly Asp

170 175 180

ttt tac ttt gat gat ttt cat cat aac ggt gct tac tta tta agt tat 628

Phe Tyr Phe Asp Asp Phe His His Asn Gly Ala Tyr Leu Leu Ser Tyr

185 190 195 200

tgg ttg gcc act tct gtt ttc ggc tac caa aaa gac ggc cct aca cag 676

Trp Leu Ala Thr Ser Val Phe Gly Tyr Gln Lys Asp Gly Pro Thr Gln

205 210 215

gaa gca tgg tat ggc atg gtg aat ccg gaa aca aat gac ggc tat cag 724

Glu Ala Trp Tyr Gly Met Val Asn Pro Glu Thr Asn Asp Gly Tyr Gln

220 225 230

ttt ttt atg gat atg ggg cca tta aaa aat gcc gat aaa tgg tat ggt 772

Phe Phe Met Asp Met Gly Pro Leu Lys Asn Ala Asp Lys Trp Tyr Gly

235 240 245

gaa gac aat ttt ttc tgg caa caa ctt aaa aac aat cct gat tac aac 820

Glu Asp Asn Phe Phe Trp Gln Gln Leu Lys Asn Asn Pro Asp Tyr Asn

250 255 260

gct ttc tgg caa aag aga agt att attcct cac tta aaa gaa gtg aag 868

Ala Phe Trp Gln Lys Arg Ser Ile Ile Pro His Leu Lys Glu Val Lys

265 270 275 280

cct gca gtt tta acc gtt ggg ggc tgg ttt gat gca gaa gat ctc tat 916

Pro Ala Val Leu Thr Val Gly Gly Trp Phe Asp Ala Glu Asp Leu Tyr

285 290 295

gga cca ctt aca att tat aaa acc att gaa aaa aat aat cct gag acc 964

Gly Pro Leu Thr Ile Tyr Lys Thr Ile Glu Lys Asn Asn Pro Glu Thr

300 305 310

tac aat acc att gtc atg ggc cct tgg tcc cac gga gat tgg tca agg 1012

Tyr Asn Thr Ile Val Met Gly Pro Trp Ser His Gly Asp Trp Ser Arg

315 320 325

gaa cct gga tca cag gtc att tca aat att tat ttt ggt gat tct atc 1060

Glu Pro Gly Ser Gln Val Ile Ser Asn Ile Tyr Phe Gly Asp Ser Ile

330 335 340

tcc aca tgg tat caa aaa aat ata gaa cgt gtt ttt ttc aat cat ttt 1108

Ser Thr Trp Tyr Gln Lys Asn Ile Glu Arg Val Phe Phe Asn His Phe

345 350 355 360

cta aaa gaa tcc gaa aat agc aat cct gcc ctt cct gaa gcc tac atg 1156

Leu Lys Glu Ser Glu Asn Ser Asn Pro Ala Leu Pro Glu Ala Tyr Met

365 370 375

ttt gat acc gga aaa cat aaa tgg gaa aaa ttt gac gat tgg cct cct 1204

Phe Asp Thr Gly Lys His Lys Trp Glu Lys Phe Asp Asp Trp Pro Pro

380 385 390

aaa gaa agc caa tgg aaa agc ttt tac ttt caa gag aaa gga gag tta 1252

Lys Glu Ser Gln Trp Lys Ser Phe Tyr Phe Gln Glu Lys Gly Glu Leu

395 400 405

act gag gta aca cct gag gga aat agg ttt act acc tat gtc tca gac 1300

Thr Glu Val Thr Pro Glu Gly Asn Arg Phe Thr Thr Tyr Val Ser Asp

410 415 420

ccc tct aat cct gtc ccc tat agt caa gat att aaa cta aac ttc act 1348

Pro Ser Asn Pro Val Pro Tyr Ser Gln Asp Ile Lys Leu Asn Phe Thr

425 430 435 440

ccg aga aaa tac atg gcc gat gac cag cga ttt gca gcc aga aga ccg 1396

Pro Arg Lys Tyr Met Ala Asp Asp Gln Arg Phe Ala Ala Arg Arg Pro

445 450 455

gac gta ctg acc ttt acg agc gaa gta tta agt caa gac atg acg ctt 1444

Asp Val Leu Thr Phe Thr Ser Glu Val Leu Ser Gln Asp Met Thr Leu

460 465 470

gcg ggg gaa gtc atg gca aac tta aaa gtt gcc act tca caa act gat 1492

Ala Gly Glu Val Met Ala Asn Leu Lys Val Ala Thr Ser Gln Thr Asp

475 480 485

gct gat tgg gta gtt aaa atc atc gat ata ttt ccc gga gat cag cca 1540

Ala Asp Trp Val Val Lys Ile Ile Asp Ile Phe Pro Gly Asp Gln Pro

490 495 500

aat cat gcc tat gtt tta gat ggg gtg gac atg ggc aat tac cac cta 1588

Asn His Ala Tyr Val Leu Asp Gly Val Asp Met Gly Asn Tyr His Leu

505 510 5l5 520

atg gtt cgt tca gag gta att aga ggg agg tat aga gaa agt ttt gag 1636

Met Val Arg Ser Glu Val Ile Arg Gly Arg Tyr Arg Glu Ser Phe Glu

525 530 535

ttt cct aaa ccc ttt gtt cct gat caa atc act gct gtt gat ttc agg 1684

Phe Pro Lys Pro Phe Val Pro Asp Gln Ile Thr Ala Val Asp Phe Arg

540 545 550

tta caa gat ctt ttc cat act ttc aaa aag ggg cataaa att caa ata 1732

Leu Gln Asp Leu Phe His Thr Phe Lys Lys Gly His Lys Ile Gln Ile

555 560 565

caa ata caa agt act tgg ttt ccc cta att gat cga aat ccc caa aaa 1780

Gln Ile Gln Ser Thr Trp Phe Pro Leu Ile Asp Arg Asn Pro Gln Lys

570 575 580

tat gta caa aac ata ttt gaa gct gag gaa gcc gat ttt gtc aaa gcc 1828

Tyr Val Gln Asn Ile Phe Glu Ala Glu Glu Ala Asp Phe Val Lys Ala

585 590 595 600

acc cat agg gtt ttt cat aca gaa aag ttt gcc agc aaa att gaa gta 1876

Thr His Arg Val Phe His Thr Glu Lys Phe Ala Ser Lys Ile Glu Val

605 610 615

atg gtt ctt cct tagaattaga atggtttaaa attactattt gtagcagaag ata 1931

Met Val Leu Pro

620

<210>25

<211>620

<212>PRT

＜213〉extra large round bacteria

<400>25

Met Lys His Cys Tyr Lys Leu Leu Val Phe Tyr Thr Leu Phe Leu Met

1 5 10 15

Thr Thr Asn Trp Ala Leu Ser Gln Ala Ile Asn Gly Tyr Asp Lys Ala

20 25 30

Ala Tyr Asp Ile Pro Met Arg Asp Gly Val His Leu His Thr Ile Val

35 40 45

Tyr Ser Pro Lys Asp Leu Ser Gln Pro Tyr Pro Ile Leu Met Gln Arg

50 55 60

Thr Pro Tyr Ser Ala Gly Pro Tyr Gly Pro Gly Asn Met Lys Asn Lys

65 70 75 80

Leu Gly Pro Ser Gln Phe Leu Met Asn Asp Gly Tyr Ile Phe Val Tyr

85 90 95

Gln Asp Val Arg Gly Arg Trp Met Ser Glu Gly Ser Tyr Asp Asn Met

100 105 110

Arg Pro Thr Leu Ser Lys Ser Glu Arg Asn Ser Asn Gln Ile Asp Glu

115 120 125

Ser Thr Asp Thr Tyr Asp Thr Ile Glu Trp Leu Leu Ala Asn Ile Lys

130 135 140

Asn His Asn Glu Lys Val Gly Leu Trp Gly Ile Ser Tyr Pro Gly Phe

145 150 155 160

Tyr Ser Ala Ala Ala Leu Pro Phe Ala His Pro Asn Leu Lys Ala Val

165 170 175

Ser Pro Gln Ala Pro Ile Gly Asp Phe Tyr Phe Asp Asp Phe His His

180 185 190

Asn Gly Ala Tyr Leu Leu Ser Tyr Trp Leu Ala Thr Ser Val Phe Gly

195 200 205

Tyr Gln Lys Asp Gly Pro Thr Gln Glu Ala Trp Tyr Gly Met Val Asn

210 215 220

Pro Glu Thr Asn Asp Gly Tyr Gln Phe Phe Met Asp Met Gly Pro Leu

225 230 235 240

Lys Asn Ala Asp Lys Trp Tyr Gly Glu Asp Asn Phe Phe Trp Gln Gln

245 250 255

Leu Lys Asn Asn Pro Asp Tyr Asn Ala Phe Trp Gln Lys Arg Ser Ile

260 265 270

Ile Pro His Leu Lys Glu Val Lys Pro Ala Val Leu Thr Val Gly Gly

275 280 285

Trp Phe Asp Ala Glu Asp Leu Tyr Gly Pro Leu Thr Ile Tyr Lys Thr

290 295 300

Ile Glu Lys Asn Asn Pro Glu Thr Tyr Asn Thr Ile Val Met Gly Pro

305 310 315 320

Trp Ser His Gly Asp Trp Ser Arg Glu Pro Gly Ser Gln Val Ile Ser

325 330 335

Asn Ile Tyr Phe Gly Asp Ser Ile Ser Thr Trp Tyr Gln Lys Asn Ile

340 345 350

Glu Arg Val Phe Phe Asn His Phe Leu Lys Glu Ser Glu Asn Ser Asn

355 360 365

Pro Ala Leu Pro Glu Ala Tyr Met Phe Asp Thr Gly Lys His Lys Trp

370 375 380

Glu Lys Phe Asp Asp Trp Pro Pro Lys Glu Ser Gln Trp Lys Ser Phe

385 390 395 400

Tyr Phe Gln Glu Lys Gly Glu Leu Thr Glu Val Thr Pro Glu Gly Asn

405 410 415

Arg Phe Thr Thr Tyr Val Ser Asp Pro Ser Asn Pro Val Pro Tyr Ser

420 425 430

Gln Asp Ile Lys Leu Asn Phe Thr Pro Arg Lys Tyr Met Ala Asp Asp

435 440 445

Gln Arg Phe Ala Ala Arg Arg Pro Asp Val Leu Thr Phe Thr Ser Glu

450 455 460

Val Leu Ser Gln Asp Met Thr Leu Ala Gly Glu Val Met Ala Asn Leu

465 470 475 480

Lys Val Ala Thr Ser Gln Thr Asp Ala Asp Trp Val Val Lys Ile Ile

485 490 495

Asp Ile Phe Pro Gly Asp Gln Pro Asn His Ala Tyr Val Leu Asp Gly

500 505 510

Val Asp Met Gly Asn Tyr His Leu Met Val Arg Ser Glu Val Ile Arg

515 520 525

Gly Arg Tyr Arg Glu Ser Phe Glu Phe Pro Lys Pro Phe Val Pro Asp

530 535 540

Gln Ile rhr Ala Val Asp Phe Arg Leu Gln Asp Leu Phe His Thr Phe

545 550 555 560

Lys Lys Gly His Lys Ile Gln Ile Gln Ile Gln Ser Thr Trp Phe Pro

565 570 575

Leu Ile Asp Arg Asn Pro Gln Lys Tyr Val Gln Asn Ile Phe Glu Ala

580 585 590

Glu Glu Ala Asp Phe Val Lys Ala Thr His Arg Val Phe His Thr Glu

595 600 605

Lys Phe Ala Ser Lys Ile Glu Val Met Val Leu Pro

610 615 620

<210>26

<211>2036

<212>DNA

<213>Psycloserpens burtonensis

<220>

<221>CDS

<222>(61)..(1992)

<223>

<400>26

catattcgta aaatagctat aagtttttgt aaatttagtc aatcaaaattttaaatgtaa 60

atg aag act ctt ttt aaa ttg ttg ctc cta ttt gta ttt gtt cta acg 108

Met Lys Thr Leu Phe Lys Leu Leu Leu Leu Phe Val Phe Val Leu Thr

1 5 10 15

tct tgt aat aag gcc aac aaa gac gct act gaa att gtg aaa acc gaa 156

Ser Cys Asn Lys Ala Asn Lys Asp Ala Thr Glu Ile Val Lys Thr Glu

20 25 30

gta gaa gat act tac gtt aaa gat aat tat aac aaa caa gag gtg act 204

Val Glu Asp Thr Tyr Val Lys Asp Asn Tyr Asn Lys Gln Glu Val Thr

35 40 45

att gaa atg cgc gat ggt ata aaa ctt cac acg acc att tat tca cca 252

Ile Glu Met Arg Asp Gly Ile Lys Leu His Thr Thr Ile Tyr Ser Pro

50 55 60

aaa gat gaa agt cag acc tat cct att tta atg atg aga aca cca tat 300

Lys Asp Glu Ser Gln Thr Tyr Pro Ile Leu Met Met Arg Thr Pro Tyr

65 70 75 80

agt tct caa cct tat ggt gac aat gag ttt aag acg aaa att ggt cct 348

Ser Ser Gln Pro Tyr Gly Asp Asn Glu Phe Lys Thr Lys Ile Gly Pro

85 90 95

aat gtt cat tta atg aaa gaa ggg aat att gtt gtg tat caa gat gta 396

Asn Val His Leu Met Lys Glu Gly Asn Ile Val Val Tyr Gln Asp Val

100 105 110

cga ggt cgt tgg atg agt gaa ggt gtc tat gat aat atg cgt gct tat 444

Arg Gly Arg Trp Met Ser Glu Gly Val Tyr Asp Asn Met Arg Ala Tyr

115 120 125

atc cca aat aaa aca gag gat tct caa att gat gag gca tca gac act 492

Ile Pro Asn Lys Thr Glu Asp Ser Gln Ile Asp Glu Ala Ser Asp Thr

130 135 140

tat gac acg att gac tgg ctg gta aat aac gta gaa aat aat aac ggg 540

Tyr Asp Thr Ile Asp Trp Leu Val Asn Asn Val Glu Asn Asn Asn Gly

145 150 155 160

aat gtt ggt act tgg gga att tca tat cct ggt ttt tat gct aca tat 588

Asn Val Gly Thr Trp Gly Ile Ser Tyr Pro Gly Phe Tyr Ala Thr Tyr

165 170 175

tct act ata gac gca cac cca gct tta aaa gca gca tcg cct caa gcg 636

Ser Thr Ile Asp Ala His Pro Ala Leu Lys Ala Ala Ser Pro Gln Ala

180 185 190

tgt att gga gat ttc ttt ttt gac gat ttt cat cat aat ggt gct ttt 684

Cys Ile Gly Asp Phe Phe Phe Asp Asp Phe His His Asn Gly Ala Phe

195 200 205

tta tta agt tat ttt aga gca gtg tct tta ttt ggt acg aca aaa gat 732

Leu Leu Ser Tyr Phe Arg Ala Val Ser Leu Phe Gly Thr Thr Lys Asp

210 215 220

aaa cct aca gat tct gct tgg tat aag ttt cca gaa atg aaa aca caa 780

Lys Pro Thr Asp Ser Ala Trp Tyr Lys Phe Pro Glu Met Lys Thr Gln

225 230 235 240

gat caa tat caa ttt ttt ctt gat gct gga cct tta agt aat ttg aac 828

Asp Gln Tyr Gln Phe Phe Leu Asp Ala Gly Pro Leu Ser Asn Leu Asn

245 250 255

aag tat ttc caa tat gac aca cca gac gac aca tct gta tcc aag tct 876

Lys Tyr Phe Gln Tyr Asp Thr Pro Asp Asp Thr Ser Val Ser Lys Ser

260 265 270

gat agg ata gat gat gtg ttt tgg aaa gaa att gta gag cat cca aac 924

Asp Arg Ile Asp Asp Val Phe Trp Lys Glu Ile Val Glu His Pro Asn

275 280 285

tac gat acg ata tgg aaa tct aaa ggt tta att caa aac cta aaa gat 972

Tyr Asp Thr Ile Trp Lys Ser Lys Gly Leu Ile Gln Asn Leu Lys Asp

290 295 300

att aag cca agt gta gcg aca atg att gtg gga ggg tta ttt gat gcc 1020

Ile Lys Pro Ser Val Ala Thr Met Ile Val Gly Gly Leu Phe Asp Ala

305 310 315 320

gaa gat tta tat ggg cca ttt gaa act tat aaa acg ata gaa aaa cat 1068

Glu Asp Leu Tyr Gly Pro Phe Glu Thr Tyr Lys Thr Ile Glu Lys His

325 330 335

aat cct gat aat tat aat att atg gtt ttt ggg cct tgg gat cat ggt 1116

Asn Pro Asp Asn Tyr Asn Ile Met Val Phe Gly Pro Trp Asp His Gly

340 345 350

cgt tgg gct agg agt gac gtt aaa aat tat gtt gga aat tat ttc ttc 1164

Arg Trp Ala Arg Ser Asp Val Lys Asn Tyr Val Gly Asn Tyr Phe Phe

355 360 365

gga gat tct ata tct cta aaa ttt caa cgt gat gtt gaa acg aag ttt 1212

Gly Asp Ser Ile Ser Leu Lys Phe Gln Arg Asp Val Glu Thr Lys Phe

370 375 380

ttt aat cat ttt tta aaa gga aaa ggc gac aag aac tca ggg tta cca 1260

Phe Asn His Phe Leu Lys Gly Lys Gly Asp Lys Asn Ser Gly Leu Pro

385 390 395 400

gaa gca tat gta ttt gat tct ggt aaa aag gaa tgg agt agc ttt gac 1308

Glu Ala Tyr Val Phe Asp Ser Gly Lys Lys Glu Trp Ser Ser Phe Asp

405 410 415

agc tgg cct cca aag caa gca gaa aaa caa gcc atg tat ctt aat gcc 1356

Ser Trp Pro Pro Lys Gln Ala Glu Lys Gln Ala Met Tyr Leu Asn Ala

420 425 430

aac caa gag cta tca gat tca aaa aaa gga aat act agt gag aca ttt 1404

Asn Gln Glu Leu Ser Asp Ser Lys Lys Gly Asn Thr Ser Glu Thr Phe

435 440 445

gtt agt gat tta aaa cgc cct gta cct tat tcc gaa gat att aaa aca 1452

Val Ser Asp Leu Lys Arg Pro Val Pro Tyr Ser Glu Asp Ile Lys Thr

450 455 460

gtt ttc aca cca cga aaa tac atg aca gac gat cag cgt ttt gca gca 1500

Val Phe Thr Pro Arg Lys Tyr Met Thr Asp Asp Gln Arg Phe Ala Ala

465 470 475 480

cga cgt cct gat gtt ctt ata ttt gag acc gat att ctt gag gaa gat 1548

Arg Arg Pro Asp Val Leu Ile Phe Glu Thr Asp Ile Leu Glu Glu Asp

485 490 495

ata acc tta gct ggt gat att tta gcg cag ctt aat gtg tca act aca 1596

Ile Thr Leu Ala Gly Asp Ile Leu Ala Gln Leu Asn Val Ser Thr Thr

500 505 510

ggg aca gat gca gat tgg att gtc aaa ata gta gat gtt cat cca gca 1644

Gly Thr Asp Ala Asp Trp Ile Val Lys Ile Val Asp Val His Pro Ala

515 520 525

gat gct gag gag caa aaa gaa ggt atg caa gac cat tta tca atg agt 1692

Asp Ala Glu Glu Gln Lys Glu Gly Met Gln Asp His Leu Ser Met Ser

530 535 540

aat tat cat ttg atg gtg agg agt gaa gtg atg cgc ggt cgt ttt aga 1740

Asn Tyr His Leu Met Val Arg Ser Glu Val Met Arg Gly Arg Phe Arg

545 550 555 560

aat agt ttt gaa aac cca gag cca ttt gtg cca aac caa cca aca gat 1788

Asn Ser Phe Glu Asn Pro Glu Pro Phe Val Pro Asn Gln Pro Thr Asp

565 570 575

gtc aat atc aag tta caa gat gta cat cat aca ttt aaa aaa ggt cac 1836

Val Asn Ile Lys Leu Gln Asp Val His His Thr Phe Lys Lys Gly His

580 585 590

aaa tta caa gtg caa gtt cag agt acg tgg ttt cca ctt att gat ttg 1884

Lys Leu Gln Val Gln Val Gln Ser Thr Trp Phe Pro Leu Ile Asp Leu

595 600 605

aac ccg caa aca ttt gtg cct aat att tat aaa gca aaa gaa agc gat 1932

Asn Pro Gln Thr Phe Val Pro Asn Ile Tyr Lys Ala Lys Glu Ser Asp

610 615 620

ttt aaa acc caa aca cat tcg gtt ttt aac gat tct aaa att gag ttt 1980

Phe Lys Thr Gln Thr His Ser Val Phe Asn Asp Ser Lys Ile Glu Phe

625 630 635 640

acg gtt ttg aaa taagagtaga tgactaaatt tgccaaggta gatttagtct tttt 2036

Thr Val Leu Lys

<210>27

<211>644

<212>PRT

<213>Psycloserpens burtonensis

<400>27

Met Lys Thr Leu Phe Lys Leu Leu Leu Leu Phe Val Phe Val Leu Thr

1 5 10 15

Ser Cys Asn Lys Ala Asn Lys Asp Ala Thr Glu Ile Val Lys Thr Glu

20 25 30

Val Glu Asp Thr Tyr Val Lys Asp Asn Tyr Asn Lys Gln Glu Val Thr

35 40 45

Ile Glu Met Arg Asp Gly Ile Lys Leu His Thr Thr Ile Tyr Ser Pro

50 55 60

Lys Asp Glu Ser Gln Thr Tyr Pro Ile Leu Met Met Arg Thr Pro Tyr

65 70 75 80

Ser Ser Gln Pro Tyr Gly Asp Asn Glu Phe Lys Thr Lys Ile Gly Pro

85 90 95

Asn Val His Leu Met Lys Glu Gly Asn Ile Val Val Tyr Gln Asp Val

100 105 110

Arg Gly Arg Trp Met Ser Glu Gly Val Tyr Asp Asn Met Arg Ala Tyr

115 120 125

Ile Pro Asn Lys Thr Glu Asp Ser Gln Ile Asp Glu Ala Ser Asp Thr

130 135 140

Tyr Asp Thr Ile Asp Trp Leu Val Asn Asn Val Glu Asn Asn Asn Gly

145 150 155 160

Asn Val Gly Thr Trp Gly Ile Ser Tyr Pro Gly Phe Tyr Ala Thr Tyr

165 170 175

Ser Thr Ile Asp Ala His Pro Ala Leu Lys Ala Ala Ser Pro Gln Ala

180 185 190

Cys Ile Gly Asp Phe Phe Phe Asp Asp Phe His His Asn Gly Ala Phe

195 200 205

Leu Leu Ser Tyr Phe Arg Ala Val Ser Leu Phe Gly Thr Thr Lys Asp

210 215 220

Lys Pro Thr Asp Ser Ala Trp Tyr Lys Phe Pro Glu Met Lys Thr Gln

225 230 235 240

Asp Gln Tyr Gln Phe Phe Leu Asp Ala Gly Pro Leu Ser Asn Leu Asn

245 250 255

Lys Tyr Phe Gln Tyr Asp Thr Pro Asp Asp Thr Ser Val Ser Lys Ser

260 265 270

Asp Arg Ile Asp Asp Val Phe Trp Lys Glu Ile Val Glu His Pro Asn

275 280 285

Tyr Asp Thr Ile Trp Lys Ser Lys Gly Leu Ile Gln Asn Leu Lys Asp

290 295 300

Ile Lys Pro Ser Val Ala Thr Met Ile Val Gly Gly Leu Phe Asp Ala

305 310 315 320

Glu Asp Leu Tyr Gly Pro Phe Glu Thr Tyr Lys Thr Ile Glu Lys His

325 330 335

Asn Pro Asp Asn Tyr Asn Ile Met Val Phe Gly Pro Trp Asp His Gly

340 345 350

Arg Trp Ala Arg Ser Asp Val Lys Asn Tyr Val Gly Asn Tyr Phe Phe

355 360 365

Gly Asp Ser Ile Ser Leu Lys Phe Gln Arg Asp Val Glu Thr Lys Phe

370 375 380

Phe Asn His Phe Leu Lys Gly Lys Gly Asp Lys Asn Ser Gly Leu Pro

385 390 395 400

Glu Ala Tyr Val Phe Asp Ser Gly Lys Lys Glu Trp Ser Ser Phe Asp

405 410 415

Ser Trp Pro Pro Lys Gln Ala Glu Lys Gln Ala Met Tyr Leu Asn Ala

420 425 430

Asn Gln Glu Leu Ser Asp Ser Lys Lys Gly Asn Thr Ser Glu Thr Phe

435 440 445

Val Ser Asp Leu Lys Arg Pro Val Pro Tyr Ser Glu Asp Ile Lys Thr

450 455 460

Val Phe Thr Pro Arg Lys Tyr Met Thr Asp Asp Gln Arg Phe Ala Ala

465 470 475 480

Arg Arg Pro Asp Val Leu Ile Phe Glu Thr Asp Ile Leu Glu Glu Asp

485 490 495

Ile Thr Leu Ala Gly Asp Ile Leu Ala Gln Leu Asn Val Ser Thr Thr

500 505 510

Gly Thr Asp Ala Asp Trp Ile Val Lys Ile Val Asp Val His Pro Ala

515 520 525

Asp Ala Glu Glu Gln Lys Glu Gly Met Gln Asp His Leu Ser Met Ser

530 535 540

Asn Tyr His Leu Met Val Arg Ser Glu Val Met Arg Gly Arg Phe Arg

545 550 555 560

Asn Ser Phe Glu Asn Pro Glu Pro Phe Val Pro Asn Gln Pro Thr Asp

565 570 575

Val Asn Ile Lys Leu Gln Asp Val His His Thr Phe Lys Lys Gly His

580 585 590

Lys Leu Gln Val Gln Val Gln Ser Thr Trp Phe Pro Leu Ile Asp Leu

595 600 605

Asn Pro Gln Thr Phe Val Pro Asn Ile Tyr Lys Ala Lys Glu Ser Asp

610 615 620

Phe Lys Thr Gln Thr His Ser Val Phe Asn Asp Ser Lys Ile Glu Phe

625 630 635 640

Thr Val Leu Lys

Claims

1. coding is selected from (C) and protein DNA (O), and wherein said protein has the aminoacid sequence as giving a definition:

(C) aminoacid sequence of forming by the 21-619 amino acids residue of SEQ ID NO:12, or

(O) aminoacid sequence of forming by SEQ ID NO:12.

2. recombinant DNA that comprises according to the DNA of claim 1.

3. transformant that comprises according to the recombinant DNA of claim 2.

4. method of producing peptide-forming enzyme comprises:

In substratum, be suitable for producing under the condition of peptide-forming enzyme, cultivate according to the transformant of claim 3 one period and

In substratum and/or transformant, accumulate peptide-forming enzyme.

5. method of producing dipeptides comprises:

In substratum, be suitable in culture producing under the condition of peptide-forming enzyme, cultivate according to the transformant of claim 3 one period and

Culture is mixed with carboxyl composition and amine component,, synthesize dipeptides by by the coded promoted enzyme catalysis of peptide-forming enzyme of described DNA.

6. according to the method for the production dipeptides of claim 5, wherein said cell is the microorganism that is generated the ability of dipeptides by carboxyl composition and amine component that has that belongs to Sphingobacterium.

7. according to the method for the production dipeptides of claim 5 or 6, wherein said cell is isolating from described culture.

8. according to the method for the production dipeptides of claim 5 or 6, wherein said cell is treated microorganism cells product.

9. be selected from (c) and DNA (o), wherein said DNA has the base sequence as giving a definition:

(c) base sequence of forming by the 121-1917 bit base of SEQ ID NO:11, or

(o) base sequence of forming by the 61-1917 bit base of SEQ ID NO:11.

10. recombinant DNA that comprises according to the DNA of claim 9.

11. transformant that comprises according to the recombinant DNA of claim 10.

12. a method of producing peptide-forming enzyme comprises:

In substratum, be suitable for producing under the condition of peptide-forming enzyme, cultivate according to the transformant of claim 11 one period and

In substratum and/or transformant, accumulate peptide-forming enzyme.

13. a method of producing dipeptides comprises:

In substratum, be suitable in culture producing under the condition of peptide-forming enzyme, cultivate according to the transformant of claim 11 one period and

14. according to the method for the production dipeptides of claim 13, wherein said cell is the microorganism that is generated the ability of dipeptides by carboxyl composition and amine component that has that belongs to Sphingobacterium.

15. according to the method for the production dipeptides of claim 13 or 14, wherein said cell is isolating from described culture.

16. according to the method for the production dipeptides of claim 13 or 14, wherein said cell is treated microorganism cells product.