CN100376688C - Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus and preparation method and use thereof - Google Patents
Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus and preparation method and use thereof Download PDFInfo
- Publication number
- CN100376688C CN100376688C CNB2006100106124A CN200610010612A CN100376688C CN 100376688 C CN100376688 C CN 100376688C CN B2006100106124 A CNB2006100106124 A CN B2006100106124A CN 200610010612 A CN200610010612 A CN 200610010612A CN 100376688 C CN100376688 C CN 100376688C
- Authority
- CN
- China
- Prior art keywords
- probe
- primer
- african horse
- horse sickness
- sickness virus
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention relates to a biological reagent designed and synthesized with a gene fragment of African horse sickness virus as a target, particularly to a reagent capable of detecting the African horse sickness virus, a preparation method and an application of the reagent. The present invention selects the specific conservative (among different virus) VP7 gene fragment of the African horse sickness virus as a target to design and synthesize primers and probes according to the characteristic of a VP7 gene and the design principle for primers and probes. The designed multiple pairs of primers and probes are selected for the optimum pairing to obtain the optimal primers and probes through a lot of reaction condition optimization, contrast tests and proof tests. The fluorescence quantitative PCR detecting reagent for the African horse sickness virus of the present invention comprises a pair of specific primers and a specific fluorescent probe, and the amplification target fragment is 69 bp long.
Description
Technical field
The present invention relates to a kind ofly design the synthetic biotechnological formulation for target, especially the reagent that can detect African horse sickness virus and the preparation method and the application of this reagent with the African horse sickness virus gene fragment.
Background technology
African horse sickness (African Horse Sickness, AHS) be by insect-borne, mainly infect a kind of acute of horse and other equus or subacute disease toxicity arthropod borne infection.This disease mainly occurs in Africa, has spread all over the Middle East afterwards and has invaded the Asia Desk region-by-region.With heating and subcutaneous connective tissue and pulmonary edema and visceral hemorrhage is feature, with region and seasonality (rainy season of spring and summer) Flow Behavior principal mode.Its harm mainly is to cause that horse, mule cause death, and the sick horse mortality ratio in new epidemic-stricken area is up to 95%.International Office of Epizootics (OIE) is defined as category-A zoonosis with this disease, and China also is defined as it animal one class transmissible disease that enters the territory.
African horse sickness virus (AHSV) belongs to Reoviridae (Reoviridae) Orbivirus (Orbivirus), the morphological structure of virus is a diplornavirus, form by 7 structural protein (VP1, VP2, VP3-VP7) and 10 double-stranded RNA fragments, the outside capsid protein of virion is made up of VP2 and VP5, inner capsid protein mainly is made up of VP3 and VP7, these four kinds of protein are conservative at 9 serotype camber of AHSV, and wherein VP7 is the most conservative.The inner capsid protein of minority is made up of VP1, VP4, VP6, and virus also has several Nonstructural Proteins.At present identified that AHSV has 9 serotypes that antigenicity is different, these viruses and other Orbivirus (blue tongue virus and deer epidemic hemorrhage) no cross reaction.
With the indirect ELISA of solubility AHSV antigen or reorganization VP7, be proved to be a kind of good method of the AHSV of detection group specificity antibody, be specially adapted to a large amount of investigation.Western blot test also is used to check AHS antibody, and this method is specially adapted to a small amount of serum inspection.There is report to show recently, with Nonstructural Protein NS3 is antigenic indirect ELISA, can will infect the animal of AHSV or separate with the animal of AHS living vaccine immunity and faunal region with the inactivated vaccine immunity of the virion preparation of purifying, this test method is further at present to be assessed.Complement-fixation reaction (CF) is used wider in the past, but some serum has anticomplementary action, and therefore, the use of CF at present reduces.Virus neutralization tests (VN) can be used to carry out serological typing, uses few in diagnosis and inspection and quarantine.
The virus separation method is time-consuming, can not make quick diagnosis, and need select responsive host or cell for use.Therefore, that research is set up is special, responsive, can be to low levels AHSV virus infection, inapparent infection or continue the method that accurately detects with malicious host, significant in quarantine, diagnosis, molecule epidemic disease-ology research.The best method that detects the AHSV specific nucleic acid is reverse transcription-polymerase chain reaction (RT-PCR), it becomes one with hypersensitivity, high specific and high accuracy, being subject to the interference of neutralizing antibody in the clinical sample during unlike the cell cultures isolated viral, is the good detection method of research AHSV etiology and persistent infection.
Summary of the invention
The objective of the invention is to overcome the defective of prior art, a kind of fluorescence quantitative RT-PCR detection reagent for African horse sickness virus that utilizes African horse sickness virus VP7 gene order design synthetic, can detect African horse sickness virus quickly and accurately is provided.
Another object of the present invention provides the preparation method of this detection reagent.
A further object of the present invention provides the application of this detection reagent.
The present invention is that to select African horse sickness virus VP7 gene conservative fragments be target, according to the principle of the characteristics of VP7 gene and primer, probe design, design synthetic primer and probe.The many of design are carried out the best pairing screening experiment to primer and probe, obtain optimal primer and probe.
Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus of the present invention comprises a pair of Auele Specific Primer and a specificity fluorescent probe, and amplification target fragment length is 69bp, and primer and probe sequence are
Primer: AHSV-VP7-F:5 '-TGT CAC CGT TGA TGG AGT AAA TG-3 '
AHSV-VP7-R：5’-TTC ACT GGT GCA ATG GTA TTC C-3’
Probe: (FAM) 5 '-TGC GGC TGG AGA TGT CGT CGC-3 ' (TAMRA).
The preparation method of fluorescence quantitative RT-PCR detection reagent for African horse sickness virus of the present invention is made up of following steps:
One, selecting AHSV VP7 gene conservative fragments is target, and the amplification target nucleotides sequence of its gene fragment is classified as: TGTCACCGTTGATGGAGTAAATGTTGCGGCTGGAGATGTCGTCGCATGGAATACCA TTGCACCAGTGAA;
Two, according to the principle of the characteristics of VP7 gene and primer, probe design, use primer Express software and primer prere5.0 software, design primer and probe;
Three, the synthetic employing β of primer and probe-acetonitrile phosphorous acid amination synthesis method uses full-automatic dna synthesizer to carry out the synthetic of OligoDNA;
Four, the synthetic two ends fluorescent mark that carries out simultaneously of probe, the fluorescence report group of probe 5 ' end mark is FAM, the fluorescent quenching group of 3 ' end mark is TAMAR;
Five, will design that synthetic is many primer and probe will be carried out the best pairing screening experiment after, tentatively determine candidate's primer and probe;
Six,, simultaneous test preferred and proof test through a large amount of reaction conditions, from candidate's primer and probe, determine best primer and probe, and the detection application evaluation of a large amount of clinical samples of process, obtain best primer of aforesaid amplification efficiency and specificity and probe.
Real-time fluorescence quantitative RT-PCR combines PCR with fluoroscopic examination, overcome and needed shortcomings such as electrophoresis detection and each sample size that detects are few after time-consuming, the easy pollution of traditional reverse transcription-polymerase chain reaction, the amplification, can carry out detection by quantitative accurately to the AHSV in the sample, have advantages such as simple, easy to operate, visual result, susceptibility height, high specificity, good reproducibility, become the important method of pathogen detection.Advantage of the present invention and positively effect are:
1, this reagent is compared with conventional RT-PCR, that this method has is quick, special, responsive, can be quantitatively, can detect advantage such as a large amount of samples simultaneously.The African horse sickness virus fluorescence quantitative RT-RCR can or continue to be with malicious host accurately to detect to AHSV virus, the inapparent infection of low levels in the sample, is the good method that a kind of AHSV detects.
2, but the AHSV in the several samples such as this reagent pair cell culture, secretory product, blood, tissue carries out rapid detection, and sample is applied widely, does not have Biosafety hidden danger, advantage safe in utilization.
3, this fluorescence quantitative RT-RCR reagent except have specificity height, susceptibility by force, can carry out a large amount of sample detection simultaneously, have high flux property, can reduce the risk of RNA, cDNA or PCR product pollution.Quicker than conventional PCR, the electrophoretic analysis after need not to increase.Having overcome product that conventional RT-PCR and immunocapture RT-PCR produce must electrophoresis detection, time-consuming, insensitive and can not quantitative shortcoming.
4, compare with conventional PCR, quantitative fluorescent PCR is made quantitative, an objective estimation, determines the positive, feminine gender and suspicious.The CT value is 30.00 can be defined as positive and negative threshold value (cut-off).It is long and can't carry out the detection of the batch samples of isolated viral to the more important thing is that fluorescence quantitative RT-RCR is specially adapted to the shelf time.
5, the test kit of this reagent place composition can be made the qualitative and quantitative analysis result within 4 hours after receiving sample.This fluorescence quantitative RT-PCR kit is a kind of sensitivity and reliable method that detects AHSV in the clinical sample.
Embodiment
1, the structure of AHSV VP7 gene recombination plasmid
Translate " molecular cloning experiment guide " (third edition), Chinese science press, in January, 2003 according to Huang Peitang etc., the 1217th page to the 1259th page, carry out African horse sickness virus VP7 gene clone and order-checking, make up AHSV VP7 gene recombination plasmid, recombinant plasmid called after pBAD-VP7.
2, design primer and probe
It is target that the present invention selects AHSV VP7 gene conservative fragments, by the dna sequence dna of the conservative gene fragment VP7 gene of 9 serotype camber of AHSV of reporting among the GenBank and the African horse sickness virus AHSV gene DNA sequence of above-mentioned 1 clone and order-checking are carried out homology analysis relatively, selected AHSV VP7 gene conservative fragments (69bp), characteristics and primer according to the VP7 gene, the principle of probe design, design primer and probe, the synthetic employing β of primer and probe-acetonitrile phosphorous acid amination synthesis method, use full-automatic dna synthesizer to carry out the synthetic two ends fluorescent mark that carries out simultaneously of synthesising probing needle of OligoDNA, the fluorescence report group of probe 5 ' end mark is FAM, and the fluorescent quenching group of 3 ' end mark is TAMAR.After will designing synthetic is many, primer and probe being carried out the best pairing screening experiment, determine a pair of primer and a probe that amplification efficiency and specificity are best, amplification target fragment length is 69bp.
3, RNA extracts
African horse sickness virus RNA and standard substance prepare simultaneously.With reference to Huang Zhenxiang chief editor " medical virology basis and experimental technique ", Science Press's (nineteen ninety) 143-146 page or leaf is measured malicious valency earlier, calculates TCID with Reed and MuenchShi method
50Get 100 μ L virus stock solution useds, with reference to Lu Shengdong chief editor " Molecular Biology Lab's common technology ", Science Press (1999) 61-62 page or leaf, phenol/chloroform nucleic acid extraction process extracts RNA.Ultrapure water with no RNA enzyme dissolves total RNA, be diluted to be equivalent to 10000,1000,100,10,1, each reaction tubes of 0.1TCID50.Materials such as blood (anticoagulation), serum and cell tissue directly extract RNA.Fluorescence RT-PCR and conventional RT-PCR test RNA with batch extraction.
4, AHSV fluorescence quantitative RT-RCR
The AHSV fluorescence quantitative RT-RCR adopts 50 μ L volumetric reaction liquid, in 7000 type quantitative real time PCR Instruments, is undertaken by following reaction parameter: 42 ℃ of 30min reverse transcriptions; 95 ℃ of pre-sex change 5min; 95 ℃ of sex change 15sec, 60 ℃ of 1min, 40 circulations of increasing.
The concentration of primer and probe is accurately screened, to obtain minimum C
TValue and higher fluorescence intensity increased value (Δ Rn).During each the detection, set up water to replace 4 negative controls (or healthy tissues, cell negative control) of viral RNA sample; Set up be equivalent to 1000,100,10,1TCID
50Each 4 contrast of the FMDV standard of/every reaction tubes; Each sample detection is done 3 pipe parallel tests.Negative at 4 negative controls, when positive control is positive, whole test is effective, further result of determination.Each sample must be done a plurality of backups, to carry out stability, replica test.
5, conventional RT-PCR
The upstream primer of conventional RT-PCR is identical with fluorescence quantitative RT-RCR with downstream primer, and amplification target fragment length is 69bp, increases according to a conventional method.Detect and use 3% agarose electrophoretic analysis, a 69bp specific band appears in positive amplification.
6, the specificity of AHSV fluorescence quantitative RT-RCR, susceptibility
Tissue sample and serum with BTV, EHD, BVD, AKAV and normal BHK21 cell, field acquisition horse carry out specific detection relatively.AHSV cell culture, artificial challenge animal tissues sample are carried out 10 times of serial dilutions, detect with conventional RT-PCR and fluorescence quantitative RT-RCR, relatively their susceptibility.
7, fluorescence quantitative RT-RCR stability and replica test
In assessment AHSV fluorescence quantitative RT-RCR detects group in the AHSV method and when the circulation ratio of test between group, stability, with being equivalent to 1000TCID
50Sample RNA, under same reaction conditions, carry out fluorescence quantitative RT-RCR repeatedly and detect, each sample of each test is done 6 parallel reaction tubess, repeats 12 times.
8, the calculating of the foundation of the preparation of standard positive control sample, typical curve and nucleic acid copy number
The above-mentioned 1 recombinant plasmid pBAD-VP7 that makes up, transformed into escherichia coli TOP10, LB substratum (containing Amp100 μ g/mL) propagation, alkaline lysis method of extracting, through the test kit purifying, plasmid concentration is quantitative with spectrophotometric instrumentation OD260.The calculating of template concentrations: when making absolute quantitation, preparation standard curve at first.Standard substance are carried out 10
-1, 10
-2, 10
-3, 10
-4～10
-7Dilution by after surveying OD and knowing the concentration of plasmid stoste (standard substance), can calculate the quantity of template in each PCR pipe.
For example, the long 4436bp of known pBAD/Thio TOPO carrier, the long 1056bp of AHSV VP7 gene fragment of insertion, the molecular-weight average of each base is 330, the about 180 μ g/mL of (every couple of base/bp is 660) plasmid stoste, A Fujiadeluo constant (particle number of every mol) is 6.02 * 10
23/ mol.The absolute template number of so per 2 μ L is: (180 μ g/mL * 2 μ L * 6.02 * 10
23/ mol)/[(4436+1056) bp * 660g/ (mol * bp)]=5.8 * 10
19In view of the above, 10
-4～10
-7The template molecule number of plasmid is 5.8 * 10
15～10
12Do fluorescence quantitative RT-RCR and detect, with copy number or TCID
50Logarithm be X-axis, C
TValue is made regression curve for Y-axis, obtains typical curve.
9, the screening of primer and probe and concentration thereof
Select the best concentration ratio of primer, probe, template, obtain the minimum C of fluorescence quantitative RT-RCR reaction
TValue and the highest Δ Rn improve amplification efficiency and susceptibility.Application contains segmental plasmid standard of purpose and AHSV cell toxicant, through serial dilution, and the test sample of preparation DNA and RNA different content.To the primer and the probe of design, select primer and the probe final concentration of 50nM, 100nM, 200nM, 300nM, 400nM and 500nM for use, adopt the optimum concn of preferred primer of matrix method and probe.
10, to the detection of AHSV sample
With fluorescence quantitative RT-RCR test samples such as AHSV cell culture, tissue, BTV17, EHDV, BVDV, normal BHK21 cell, horse tissue are detected.The C of positive is detected in the RNA dilution back of extracting
TValue all is less than or equal to 28.0, the C of negative control sample
TValue is tested high specificity all greater than 30.0.C
TIt is positive and negative threshold value that value 30.0 can be used as.C
TValue can be judged to feminine gender, C greater than 30.0
TValue is less than or equal to 28.0 can be judged to the positive, is suspicious between 28.0-30.0, must test again.Fluorescence quantitative RT-RCR detects the high specificity of AHSV, the susceptibility height, and repeatability is fine.
11, AHSV fluorescence quantitative RT-RCR stdn reagent and trace routine
11.1 test kit is formed (50 μ l reaction * 50 times): according to above-mentioned 1～10 test-results, the reaction conditions that, simultaneous test preferred according to reaction conditions and proof test are determined is formulated as follows the test kit component:
| Solution I (TrizoL) | 50ml |
| Solution II (trichloromethane) | 10ml |
| Solution III (Virahol) | 25ml |
| Solution IV (75% ethanol) | 50ml |
| Solution V (2 * single stage method RT-PCR mixed solution contains primer and probe) | 1.25ml |
| Solution VI (RT enzyme, 200U/ μ l) | 25μl |
| Solution VII (Taq archaeal dna polymerase, 5U/ μ l) | 50μl |
| Solution VIII (Rnase inhibitor, 40U/ μ l) | 50μl |
| Solution I X (DEPC-H 2O) | 20ml |
| Solution X (positive RNA of AHSVV or cDNA) | 50μl |
| Solution XI (negative RNA of AHSVV or cDNA) | 50μl |
| Solution XII (quantitatively uses standard substance, 10 8Individual copy μ l) | 25μl |
11.2 working method
11.2.1 total RNA extracts
(1) get 1ml-1.5ml tissue sample grinding supernatant liquor or liquid sample and put in the 1.5ml eppendorf pipe, 12000rpm, 4 ℃, centrifugal 5min abandons supernatant liquor.
(2) add the 1ml solution I, the mixing that fully vibrates is put room temperature 5min, thoroughly cracking.
(3) add 200 μ l solution II, carefully cover cap, the quick oscillation 15sec that exerts oneself, room temperature is placed 3min.
(4) 12000rpm, 4 ℃, centrifugal 15min.
(5) carefully draw the upper strata water, be transferred in the new 1.5ml eppendorf pipe, add 500 μ, 1 solution III, mixing, room temperature is placed 10min.
(6) 13000rpm, 4 ℃, centrifugal 10min abandons supernatant liquor.
(7) add 1000 μ l solution IV, the mixing that fully vibrates, 12000rpm, 4 ℃, centrifugal 5min.Carefully fill clear liquid with.As seen milky white coloring agent sample RNA precipitation is arranged at the pipe bottom.
(8) carefully open pipe lid, the RNA that natural drying at room temperature sinks to the bottom.
(9) get 11 μ l solution I X and insert the semiarid RNA of sinking to the bottom, dissolving RNA.Can be directly used in reverse transcription or-70 ℃ of preservations are standby.
11.2.2 reaction component preparation
(1) get one 200 μ l optics PCR reaction tubes, the reaction cumulative volume is 50 μ l, adds following reactants in reaction tubes:
(2) quantitative
On demand standard substance are diluted back production standard curve, at least 7 extent of dilution.
(3) set up contrast
Positive control and negative control are respectively established 2 pipes.
11.2.3 amplification
By following parameter reaction conditions is set:
| Reaction parameter | Reverse transcription | Pre-sex change | PCR | |
| Sex change | Annealing/extension | |||
| Time | 30min | 5min | 15sec | 1min |
| Temperature | 42℃ | 95℃ | 95℃ | 60℃ |
11.2.4 interpretation of result and judgement
(1) interpretation of result condition enactment
Directly read detected result.Baseline and threshold setting principle are adjusted according to the noise of instrument situation, are as the criterion with the vertex of threshold line just above normal negative sample amplification curve.
(2) quality control standard
---negative control does not have the Ct value, and does not have amplification curve, is sea line always.
---the Ct value of positive control should be less than 28.0, and typical amplification curve occurs, and 2 positive control amplification curves overlap substantially, particularly near Threshold (fluorescence threshold value).Otherwise it is invalid that experiment this time is considered as.
---the standard substance amplification curve of quantitative usefulness: typical amplification curve occurs, the exponential region is more obvious, 7 some tool favorable linearity scopes, and platform area is compiled in together, and relation conefficient is more than 0.99.
(3) result describes and judges
---feminine gender
The Ct value should or not have amplification curve greater than 30.0, does not have African horse sickness virus in the expression sample.
---the positive
The Ct value is smaller or equal to 28.0, and typical amplification curve occurs, has African horse sickness virus in the expression sample.
---effective principle
The Ct value is reformed in 28.0～30.0 sample suggestion.The Ct value of reforming as a result is greater than 30.0 or do not have the amplification curve person is negative, otherwise positive.
---quantitatively: make quantitatively according to typical curve.
Claims (3)
1. a fluorescence quantitative RT-PCR detection reagent for African horse sickness virus is characterized in that comprising a pair of Auele Specific Primer and a specificity fluorescent probe, and amplification target fragment length is 69bp, and primer and probe sequence are:
Primer: AHSV-VP7-F:5 '-TGT CAC CGT TGA TGG AGT AAA TG-3 '
AHSV-VP7-R：5’-TTC ACT GGT GCA ATG GTA TTC C-3’
Probe: FAM 5 '-TGC GGC TGG AGA TGT CGT CGC-3 ' TAMRA.
2. according to the preparation method of the described fluorescence quantitative RT-PCR detection reagent for African horse sickness virus of claim 1, it is characterized in that forming by following steps:
(1), select African horse sickness virus special and between each C-type virus C relatively the conservative fragments of conservative VP7 gene order be target, the amplification target nucleotides sequence of its gene fragment is classified as:
TGTCACCGTTGATGGAGTAAATGTTGCGGCTGGAGATGTCGTCGCATGGAATACCATTGCACCAGTGAA；
(2), according to the principle of the characteristics of VP7 gene and primer, probe design, design primer and probe;
(3), the synthetic employing β-acetonitrile phosphorous acid amination synthesis method of primer and probe, use full-automatic dna synthesizer to carry out the synthetic of OligoDNA;
(4), the synthetic two ends fluorescent mark that carries out simultaneously of probe, the fluorescence report group of probe 5 ' end mark is FAM, the fluorescent quenching group of 3 ' end mark is TAMRA;
(5), will design that synthetic is many primer and probe will be carried out the best pairing screening experiment after, tentatively determine candidate's primer and probe;
(6),, simultaneous test preferred and proof test through a large amount of reaction conditions, from candidate's primer and probe, determine best primer and probe, and the detection application evaluation of a large amount of clinical samples of process, obtain best primer of amplification efficiency as claimed in claim 1 and specificity and probe.
3. the application of the described fluorescence quantitative RT-PCR detection reagent for African horse sickness virus of claim 1 in preparation African horse sickness virus fluorescence quantitative RT-RCR stdn test kit.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100106124A CN100376688C (en) | 2006-01-06 | 2006-01-06 | Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus and preparation method and use thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2006100106124A CN100376688C (en) | 2006-01-06 | 2006-01-06 | Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus and preparation method and use thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1840699A CN1840699A (en) | 2006-10-04 |
| CN100376688C true CN100376688C (en) | 2008-03-26 |
Family
ID=37029891
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2006100106124A Expired - Fee Related CN100376688C (en) | 2006-01-06 | 2006-01-06 | Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus and preparation method and use thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100376688C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN112831611A (en) * | 2021-03-22 | 2021-05-25 | 爱若维生物科技(苏州)有限公司 | Primer, amplification reaction liquid, kit and detection method for African horse sickness LAMP detection |
| CN113136457A (en) * | 2021-04-29 | 2021-07-20 | 泰山学院 | On-site rapid extraction and detection kit for African horse sickness virus nucleic acid |
| CN113388702A (en) * | 2021-07-20 | 2021-09-14 | 青岛海关技术中心 | African horse sickness virus RNA qualitative standard sample, application and preparation method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005049851A2 (en) * | 2003-11-14 | 2005-06-02 | University Of Utah Research Foundation | Methods, articles, and compositions for identifying oligonucleotides |
-
2006
- 2006-01-06 CN CNB2006100106124A patent/CN100376688C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2005049851A2 (en) * | 2003-11-14 | 2005-06-02 | University Of Utah Research Foundation | Methods, articles, and compositions for identifying oligonucleotides |
Non-Patent Citations (2)
| Title |
|---|
| 狂犬病毒、伪狂犬病毒、马瘟病毒、牛病毒性腹泻/粘膜病病毒和传染性牛鼻气管炎病毒的保存期试验. 王乐元等.中国兽药杂志，第35卷第4期. 2001 * |
| 用胶固补体吸收试验诊断非洲马瘟. 郑志刚.中国畜牧兽医，第5期. 1975 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1840699A (en) | 2006-10-04 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN100359022C (en) | Fluorescence quantitative PCR detection reagent for Asf virus and preparation method and use thereof | |
| Streck et al. | An updated TaqMan real-time PCR for canine and feline parvoviruses | |
| CN100359023C (en) | Multiple RT-PCR identification and detection reagent for animal vesicular disease and preparation method and use thereof | |
| CN102140551B (en) | General real-time fluorescent RT (Reverse Transcription)-PCR (Polymerase Chain Reaction) method and kit for detecting porcine reproductive and respiratory syndrome virus | |
| Yin et al. | Establishment and application of a TaqMan-based one-step real-time RT-PCR for the detection of novel goose-origin astrovirus | |
| CN106048094A (en) | Wild porcine pseudorabies strain and gene-deleted strain dual real-time fluorescence quantification PCR detection kit, primers and probe | |
| CN106834549A (en) | The cross primer amplification immune chromatography test paper of detection pseudorabies virus street strain is combined the primer and probe groups and kit of method | |
| CN1840700A (en) | Fluorescence quantitative RT-PCR detection reagent for PPR virus and preparation method and use thereof | |
| CN100376688C (en) | Fluorescence quantitative RT-PCR detection reagent for African horse sickness virus and preparation method and use thereof | |
| CN103725793A (en) | Multiple fluorescent quantitative RT-PCR (reverse transcriptase-polymerase chain reaction) method for detecting PRRSV (porcine reproductive and respiratory syndrome virus) and application thereof | |
| CN109593883A (en) | Kit of the pig circular ring virus multiple real time fluorescence PCR detection primer to, probe and preparation | |
| Sun et al. | Development and evaluation of a sensitive and quantitative assay for hirame rhabdovirus based on quantitative RT-PCR | |
| CN101724712B (en) | Animal insect-borne disease multi-RT-PCR distinguishing and detecting reagent as well as preparation method and application | |
| Chen et al. | Development and application of a dual ERA method for the detection of Feline Calicivirus and Feline Herpesvirus Type I | |
| CN100385015C (en) | Fluorescence quantitative RT-PCR detection reagent for West Nile virus and preparation method and use thereof | |
| CN103352088A (en) | Primer pair, probe, reagent kit and method for detecting avian influenza virus H7 subtype | |
| CN105779650A (en) | Triple fluorescent quantitative PCR primer, probe and kit for identifying pseudorabies virus strains | |
| CN1840701A (en) | Fluorescence quantitative RT-PCR detection reagent for Nipah virus and preparation method and use thereof | |
| CN109234457A (en) | A kind of nano PCR method detecting Canine parvovirus infection | |
| CN104388593B (en) | Taqman Real-time PCR (polymerase chain reaction) kit for detecting porcine circovirus | |
| CN102154511B (en) | Preparation method and application of reagent for detecting novel type A H1N1 2009 influenza virus with one-step method | |
| CN102329889B (en) | Primer and probe and method for detecting poxvirus muris | |
| CN102876814B (en) | Real-time fluorescence RT-HDA (Reverse Transcriptase-Helicase-Dependent Isothermal Amplification) kit and primer for detecting foot-and-mouth disease virus | |
| CN102816865B (en) | H1N1, PRRSV and CSFV quadruple detection kit | |
| Cao et al. | Establishment of a reverse transcription real-time quantitative PCR method for Getah virus detection and its application for epidemiological investigation in Shandong, China |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080326 Termination date: 20100208 |