CN100374572C - Expression system of in vitro culturing skeletal muscle - Google Patents
Expression system of in vitro culturing skeletal muscle Download PDFInfo
- Publication number
- CN100374572C CN100374572C CNB2005100843554A CN200510084355A CN100374572C CN 100374572 C CN100374572 C CN 100374572C CN B2005100843554 A CNB2005100843554 A CN B2005100843554A CN 200510084355 A CN200510084355 A CN 200510084355A CN 100374572 C CN100374572 C CN 100374572C
- Authority
- CN
- China
- Prior art keywords
- expression
- pex
- hismyc
- cell
- igf
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The present invention relates to an expression system for cultivating skeletal muscles in vitro, which comprises the steps of the construction of an expression carrier containing purpose genes, the transfection and the sieving of host cell groups by the expression carrier, the expression of the purpose genes in host cells, the separation and the purification of expression products, etc. The present invention is characterized in that the expression carrier with a myc10 detection label and a 6*his purification label is constructed on the basis of pcDNA3.0; a human matrix metalloproteinase 9(MMP-9) signal sequence is inserted into the expression carrier. Because the matrix metalloproteinase 9(MMP-9) signal sequence is inserted into the expression carrier of the present invention, the secretory volume of proteins is increased. Because QM7 cells are used as host cell expression proteins, the expression amount of proteins is increased. The present invention sieves a differential culture medium without serum suitable for differentiation of the QM7 cells, is beneficial to purification work in the later period because the cost of the culture medium is low, and lays a prior period foundation for large-scale production of PEX as a recombinant protein medicine.
Description
Technical field
The present invention relates to gene engineering technology field, relate in particular to a kind of foundation of skeletal muscle expression system of vitro culture.
Background technology
Lot of antibodies, recombinant protein medicine, cytokine etc. are because the formation that its activity depends on disulfide linkage, makes the important selection in recombinant protein is produced of animal cell culture expression system to keep glycosylation modified after its higher structure and the translation.Mammalian expression system mainly utilizes cells such as CHO, NS0 or Sp2/0, human embryo kidney (HEK)-293, COS and child hamster kidney BHK at present both at home and abroad.To compare gap bigger with bacterium, yeast expression system on the aspects such as simplicity of the amount of expressing, cost, operation, is difficult to meet the need of market fully, still has many critical bottleneck problems to need to be resolved hurrily.In the research of the expression vector Regulation Mechanism of Mammals expression system, people can obtain the high expression level of foreign gene by selecting different carriers, different enhanser and promotor, thereby make up new carrier for expression of eukaryon.On the other hand, Cottet and Corthesy (Cottet S, Corthesy B.Cellular processing limits the heterologousexpression of secretory component in mammalian cells.Eur J Biochem.1997,246 (1): 23-31.) find the simple output increase that proteic expression amount is not sufficient to cause recombinant protein that increases, because utilize the Mammals expression system to be mostly that pilot protein is secreted in the substratum, cell is used for proteic maturation and the excretory component is the bottleneck that influences its output.Therefore increase the output of recombinant protein, can not only rely on by improving means such as carrier, differentiate and the bottleneck problem of scavenger cell generation and secretory protein most important.Therefore the host cell problem of expression system is the root problem of the present mammalian cell expression system development of restriction, and the new host type that screening is better than above cell should become the key issue that this field emphasis solves.
QM7 belongs to Skeletal Muscle Cell system, be to separate (Moscovici, C., Moscovici from quail fibrosarcoma cell QT6, M.G., Jimenez, H.Lai, M.M.C., Hayman.M.J., and Vogt, P.Continuoustisssue culture cell lines derived from chemically induced tumors of Japanese quail.Cell11,95-103; Parker B.Antin and Char.Oradahl.Isolation and characterization of an AvianMyogenic cell line.Developmental Biology 1991,143,111-121.).One of characteristic of Skeletal Muscle Cell is in the high substratum of serum content, cell fission, propagation; In the substratum of low serum content, cell withdraws from the cell cycle fusion and forms myotube.Though QM7 nonmammalian cell, and it is closely similar.QM7 has the flourishing sarcoplasmic reticulum that is similar to endoplasmic reticulum, and can secrete a large amount of glycosylation extracellular matrixs, illustrates that it has perfect protein modified process systems.When carrying out cell cultures, the QM7 cell is molecular marker for increased proliferation in the substratum of 10% serum, and in the substratum of 0.5% serum, cytogamy forms thick myotube.Myotube still can continue synthetic foreign protein, and after transfection positive cells and negative cells merge, can utilize the latter's organoid synthetic proteins, and this characteristic also is it as one of advantage of expression system.
Further, though the QM7 cell can be differentiated to form myotube and survive the long period in the substratum that contains 0.5% serum, but the serum of concentration still can exert an influence to the subsequent purification and following drug development like this, and the screening of suitable serum free medium is most important.
Summary of the invention
The technical problem to be solved in the present invention is intended to overcome the deficiency of above-mentioned prior art, provide a kind of Skeletal Muscle Cell of vitro culture to carry out the supporting system that recombinant protein is produced, further, providing is that host cell carries out the supporting system that recombinant protein is produced with QM7.
Wherein, comprise that structure is beneficial to the carrier for expression of eukaryon of expression of recombinant proteins and detection; Screening is guiding recombinant protein excretory signal sequence effectively, has increased the secretory volume of target protein; Further, screening helps the serum-free differentiation media of QM7 cytodifferentiation and recombinant protein purification, and this serum free medium cost is low and be beneficial to later stage purifying work; Utilize expression system to express recombinant protein PEX, established the basis in early stage for PEX carries out scale operation as recombinant protein medicine with using value; Utilize the carrier for expression of eukaryon that makes up to express two kinds of known albumen that can mutually combine, checking QM7 expression system is used for the feasibility that Pull-Down detects.
The technical solution used in the present invention is:
A kind of expression system of in vitro culturing skeletal muscle, expression and the separation and purification of expression product, the steps such as activity detection of expression product of structure, expression vector transfection host cell group and screening, the goal gene that comprises the expression vector that contains goal gene in host cell, described expression vector is to be template with pcDNA3.0, and the C-terminal XhoI site of expressing protein merges the expression vector that myc10 peptide Detection of antigen label and 6 * his purification tag are arranged; And between the HindIII of its N end and BamH I site, insert people's matrix metalloproteinase 9 signal sequences shown in sequence 1, and described host cell is the QM7 cell.
Further, the carrier for expression of eukaryon that the present invention relates to is in order to express the protoheme spline structure territory (PEX) or the human insulin-like growth factor I (IGF-I) of matrix metalloproteinase MMP-2C-end.
The substratum of the host cell that the present invention relates to further, adopts the M199 serum-free differentiation media that contains 3 μ g/ml Regular Insulin.
Compared with the prior art of the present invention have a following positively effect: inserted myc detection label and 6 * his purification tag in expression vector, be beneficial to the purifying and the detection of target protein; In above-mentioned expression vector, insert matrix metalloproteinase 9 (MMP-9) signal sequence, increased proteic secretory volume; Adopted the QM7 cell as host cell expression albumen, proteic expression amount is about 1.5-2.5 times of COS7; Further, filter out the serum-free differentiation media that is fit to the QM7 cytodifferentiation, promptly contain the M199 substratum of 3 μ g/ml Regular Insulin, this serum free medium cost is low and be beneficial to later stage purifying work; The signal sequence of MMP9 can guide SV40 large T antigen and mouse p53 albumen successfully to secrete to cell culture fluid, and these two kinds of albumen possess biological activity, the two combination that can interact has verified that the QM7 expression system is used for the feasibility that Pull-Down detects.
Further, the C-terminal fragment PEX of matrix metalloproteinase-2 (MMP-2) is adhesion molecule α
vβ
3The antagonistic activity fragment, has the effect (Brooks that suppresses blood vessel generation, antagonism tumour, P.C., Silletti, S., von Schalssha, T.L, et al.Disruption of angogenesis by PEX, a noncatalyticmetalloproteinase fragment with integrin binding activity.Cell, 92:391-400,1998), the blood vessel that suppresses tumour is considered to effective, the best means rationally of pharmacological agent tumour, so PEX might become the endogenous antitumor drug with potential application foreground.Further, PEX be matrix metalloproteinase 2 in the protoheme spline structure territory that C-terminal contains, be binding site (Brooks, the P.C. of multiple material, Silletti, S., von Schalssha, T.L, et al.Disruption of angiogenesis by PEX, anoncatalytic metalloproteinase fragment with integrin binding activity.Cell, Vol.92:391-400,1998.).This paper is related themes as PEX and carries out scale operation as recombinant protein medicine and established the basis in early stage.
Description of drawings
The primary structure of the pM9/PEX/hismyc carrier that makes up in a kind of expression system of in vitro culturing skeletal muscle that Fig. 1 represents the present invention relates to and the synoptic diagram of expressed peptide chain primary structure thereof.
Fig. 2 represents that the unlike signal peptide is for the SDS-PAGE electrophorogram that promotes PEX protein excretion effect in the expression system of in vitro culturing skeletal muscle of the present invention;
Fig. 3 represents that the unlike signal peptide is for the SDS-PAGE electrophorogram that promotes IGF-I protein excretion effect in the expression system of in vitro culturing skeletal muscle of the present invention.
Fig. 4 represents that expression system of in vitro culturing skeletal muscle of the present invention is used for the SDS-PAGE electrophorogram that Pull-Down detects.
Fig. 5 represents that expression system of in vitro culturing skeletal muscle of the present invention is used for the Western trace figure that Pull-Down detects.
Embodiment
Material therefor
The various DNA restriction enzymes that molecular cloning is used, Taq enzyme are New England Biolab product; The T4DNA ligase enzyme is available from Promega company.HRP enzyme mark goat anti-rabbit igg is available from Jackson company.ECL luminescence reagent box is available from Pharmacia company.
One, the structure of carrier
1.prGH/PEX/hismyc expression vector establishment
PIg/PEX/hismyc and prGH/PEX/hismyc are the expression vectors of the chicken PEX that makes up on the pcDNA3.0 basis.The C-terminal XhoI site of PEX merges the encoding sequence that myc10 peptide antigenic tag and 6 * his purification tag are arranged, and inserts the signal sequence of mouse immuning ball protein Ig light chain and rat growth hormone (rGH) between N end HindIII and the BamH I site respectively.
With RT-PCR respectively from rat pituitary and 11 age in days Embryo Gallus domesticus amplification rat growth hormone (rGH) signal peptide sequence and chicken MMP-2C terminal fragment PEX sequence.Rat growth hormone primer: justice: 5 '-GGCAAGCTT (Hind III) ACAGATCACTGAGTGG-3 ', antisense: 5 '-AGAGGATCCT (BamH I) GGACAAGGGCATG-3 '; The terminal PEX primer of chicken MMP-2C-: justice: 5 '-CGGATCC (BamHI) TCTGCAAGCACG-3 ', antisense: 5 '-CCTCTAGA (Xba I) GCAAGTCCTCTTCAGAAATCAGTTTT TG CTC GAG (Xho I) GCAACCCAACCAGTC.The PCR product of rat growth hormone signal peptide and PEX with about equimolecular than mixing as template, with the sense primer of rGH and the antisense primer pcr amplification of PEX the rGH signal peptide is connected with PEX, again with this product to be template add myc antigenic tag and 6Xhis purification tag with sense primer and primer 5 '-CTGGGCCC (Apa I) TAATGATGATGAT G ATGATGTCTAGA (Xba I) CAAGTCCTCTTCAG-3 ' of rGH at the C-of fusion rotein end PCR encoding sequence, after Hind III and Apa I enzyme were cut, the T4DNA polysaccharase connected the carrier for expression of eukaryon pcDNA3.0 (American I nvitrogen company) that the corresponding enzyme of packing into is cut.Transformed into escherichia coli DH5 α gets enzymolysis and identifies correct cloning and sequencing affirmation, and is standby with a large amount of extractions of Tip-500 (Qiagen company) and plasmid purification.
2.pIg/PEX/hismyc expression vector establishment
Synthetic its upstream primer of the secreting signal peptide of Ig κ chain is: 5 ' GGG AAG CTT CAC ACACAC ACA CAT GAG CGT GCC GAC ACA GGT CCT GGG TTT GCT GCTGCT ATG GC3 ' (containing the HindIII site); Downstream primer is 5 ' GAG GAT CCG GAT ATCACATCT CGC ATC TGTAAG CCATAG CAG CAG c3 ' (containing the BamHI site).Upstream primer becomes the double-stranded Ig of abbreviation with downstream primer through the sticking chain of annealing.Ig is connected with the prGH/PEX/hismyc that is cut by same enzyme after HindIII and BamH I enzyme are cut, and transformed into escherichia coli DH5 α selects positive colony, obtains the pIg/PEX/hismyc recombinant chou.
3, the structure of pM9/PEX/hismyc expression vector and evaluation
The signal sequence of people's matrix metalloproteinase 9 (MMP9) is 57bp (seeing sequence 1), and there is the NdeI site at CMV promotor place among the carrier pcDNA3.0/MMP9.Upstream primer designs in upstream, NdeI site: 5 ' CGC CAATAG GGA CTT TCC 3 '; Downstream primer is introduced the BamHI site at the signal sequence 3 ' end of MMP9: 5 ' CCG GAT CCT GGG GGC AGC AAA GCA GC 3 '.The PCR product is connected with the T4DNA ligase enzyme with the pIg/PEX/hismyc that is cut by same enzyme after NdeI and BamH I enzyme are cut, and transformed into escherichia coli DH5 α selects positive colony, obtains the pM9/PEX/hismyc recombinant chou.Enzyme is cut and is identified and order-checking.The structure of this carrier may further comprise the steps:
3.1PCR：
With MMP9-pcDNA3.0 is template, carries out PCR:
| ddH 2O DMSO 10 * Buffer (containing Mg2+) dNTP (10mM) upstream primer (100mM) downstream primer (100mM) Taq archaeal dna polymerase (5U/ μ l) dna profiling (100ng/ μ l) | 73.5μl 10.0μl 10.0μl 1μl 1μl 1μl 1μl 2.5μl |
| Total volume | 100μl |
PCR is reflected in the thermal cycler and carries out, 95 ℃ of pre-sex change 5mi0n, and the circulating reaction program is 94 ℃ of sex change 1min, 55 ℃ of annealing 1min; 72 ℃ are extended 1min, 30cycles, and after circulating reaction finished, 72 ℃, 10min fully extended, 4 ℃ of preservations.The electrophoresis observation result
3.2 restriction endonuclease digestion and the segmental recovery of purpose
Owing to introduce NdeI and BamH I restriction enzyme site during the MMP9 design of primers at two ends, thus can cut MMP9PCR product and carrier pIg/PEX/hismyc with NdeI and BamH I enzyme, and the cohesive end of cutting the back generation by enzyme with the purpose fragment cloning in the middle of carrier.
1) restriction endonuclease digestion: following system digests 3-4h at 37 ℃
| 1 | 2 | ||
| ddH 2O MMP9PCR product 10×buffer(BamHI) BamH I NdeI Total volume | 36μl 5μl 5μl 2μl 2μl 50μl | ddH 2O pIg/PEX/hismyc 10×buffer(BamHI) BamH I NdeI Total volume | 36μl 5μl 5μl 2μl 2μl 50μl |
2) enzyme is cut back carrier and the segmental recovery of purpose
1%agarose prepares glue and separates the insertion fragment: fresh preparation 1%agarose glue, and above-mentioned enzyme to be cut product go up sample simultaneously, 75V electrophoresis 50 minutes cuts the gel that contains the purpose band under ultraviolet.
Reclaim dna fragmentation in the gel with Glassmilk:
After the gel that downcuts is weighed, press 1g ≈ 1ml and calculate, add 55 ℃ of dissolvings of sodium iodide reagent gel of 3 times of volumes, add 5-10 μ l glass milk and put room temperature 15 minutes, intermittently 2-3 minute mixing once.Centrifugal 10000 change, 2 minutes, abandon supernatant, with 300-500 μ l elution buffer washing precipitation 3 times, abandon supernatant for the last time after, centrifugal again 2 minutes, blot supernatant as far as possible.Add 15 μ l dd-H
2The O wash-out, 55 ℃ of water-baths 15 minutes, centrifugal, keep supernatant.Wash-out precipitates once more, and twice elutriant mixes, and gets 3 μ l electrophoresis and identifies.
3.3 the purpose fragment with being connected of carrier pIg/PEX/hismyc above-mentioned enzyme cut the back purifying MMP9DNA fragment (BamH I/NdeI) be connected with the T4DNA ligase enzyme with pIg/PEX/hismyc (BamH I/NdeI).
| ddH 2O pIg/PEX/hismyc(B/N) MMP9DNA(B/N) T4DNA ligase 10×buffer | 2μl 1μl 5μl 1μl 1μl |
| Total volume | 10μl |
Room temperature 3h, or 14-16 ℃ of connection spent the night and can be transformed.
3.4 the preparation of bacillus coli DH 5 alpha competent cell (inoue method)
1) gets-70 ℃ of frozen bacteriums and be inoculated on the agar plate, 37 ℃, be inverted and cultivate 16-20h with transfering loop;
2) picking polyclone bacterium colony from plate, to 250ml SOB, 225rpm, is cultured to bacterial density OD by 18 ℃
600=0.6;
3) ice bath 10min, centrifugal (4 ℃, 2500 * g 10min), abandons supernatant, and precipitation suspends ice bath 10min gently with the TB of 80ml precooling;
4) centrifugal (4 ℃, 2500 * g, 10min), precipitation suspends gently with the TB of 20ml precooling, it is 7% that adding DMSO makes its final concentration, ice bath 10min;
5) every 100 μ l packing ,-70 ℃ frozen standby.
3.5 the conversion of bacterium
1) prepared fresh or take out frozen competence bacteria, per 100 μ l competence bacterias add the 50-100ng plasmid DNA, ice bath 30 minutes.
2) 42 ℃ of heat-shockeds are 1 minute, insert in the ice immediately.
3) add 500 μ l SOC, 37 ℃, 225rpm cultivated 0.5 hour.
4) get an amount of shop dish, be inverted and be incubated at 37 ℃, 12-16h
3.6 the extraction of plasmid DNA and purifying
1) plasmid extracts (alkaline lysis) in a small amount
Choose a single bacterium colony and place 5ml LB (AMP+); → 37 ℃, 225rpm after the incubated overnight, collects thalline, centrifugal (6000rpm, 4 ℃, 3min); → abandon supernatant, precipitation adds the abundant mixing of Solution A 100 μ l, room temperature 3-5min; → Solution B 200 μ l slowly put upside down mixing, room temperature 3-5min (SolutionB, now with the current); → add Solution C 150 μ l, put upside down mixing, ice bath 5min; Centrifugal (16,000rpm, 4 ℃, 5min); → suct layer water in another Eppendorf pipe, add 2.0 times of volume dehydrated alcohols, mixing; → centrifugal (16,000rpm, 4 ℃, 5min); → abandon supernatant, add precooling 70% ethanol 1ml, centrifugal (16,000rpm, 4 ℃, 1min), to inhale and abandon supernatant, room temperature evaporates into dried, adds an amount of TE/Rnase (10 μ g/ml) 20-50 μ l ,-20 ℃ of preservations.
2) PEG method plasmid DNA purification
Application PEG method was carried out purifying before plasmid was used for transfection, to remove superhelix, improved transfection efficiency.
Purification process:
Plasmid DNA precipitation (250ml bacterium liquid) is dissolved with 400 μ l TE; → adding equal-volume (400 μ l) 13%PEG+0.8mol/L NaCl, mixing is placed 20min on ice; → centrifugal (16,000rpm, 4 ℃, 15min); → precipitation is washed with 70% ethanol, centrifugal (16,000rpm, 4 ℃, 1min); → inhale and abandon supernatant, air-dry, precipitation is dissolved with 400 μ l TE, and identifies with the 1%agarose electrophoresis.3.7 the evaluation of PEX expression vector pM9/PEX/hismyc
Connecting product transformed into escherichia coli DH5 α, coat on the dish of LB (containing penbritin) 1.5% agar, 37 ℃, be inverted overnight incubation.A small amount of plasmid for preparing institute's selected clone. the plasmid of reorganization is carried out the double digestion evaluation of HindIII and XbaI, 37 ℃ of 2hrs enzymes are cut capable 1% agarose gel electrophoresis of back sample, ultraviolet lamp is observed each clone down and is discharged the 0.6kb dna fragmentation, illustrate that pcDNA3.0 has inserted the foreign gene of 600bp, correct through order-checking proof insertion sequence, the MMP9 signal sequence is consistent with the single open reading frame of PEX.
| ddH 2O pM9/PEX/hismy | 4μl 4μl |
| HindIII XbaI 10×buffer(2#) | 0.5μl 0.5μl 1μl |
| Total volume | 10μl |
The synoptic diagram of the primary structure of pM9/PEX/hismyc carrier and expressed peptide chain primary structure thereof is seen Fig. 1.
Two, eukaryotic cell transfection
Adopt conventional transfection method all can, the preferred method that adopts following transfecting eukaryotic cells: adopt liposome lipofectamine (GIBCO/BRL), 2 μ g plasmids mix formation DNA/ liposome complex with 10 μ l liposomes in the 1ml serum free medium, joining inoculation then has 3 * 10
5In the 35mm culture dish of QM7 (deriving from U.S. ATCC) cell.37 ℃ of CO
2Hatch in the incubator after 3-5 hour and change the perfect medium that contains serum.
Three, screening
For obtaining the clone of stable transfection, after the transfection 48 hours with cell with 10
5The density inoculation of/10cm culture dish, screening positive clone in the substratum that contains 400 μ g/ml G418.2-3 collects all positive colonies and forms POOL after week, obtain the proteic clone of stably express PEX.
Four, the purifying of target protein
Because constructed carrier has the His label, can carry out the PEX protein purification easily with Ni-NTA.Purification process is as follows: the proteic QM7 cell 3 * 10 of the stably express PEX after the pM9/PEX/hismyc transfection
5Density is inoculated in the 35mm culture dish, behind the cell remittance sheet, changes M199 (Gibco company) the serum-free differentiation media 1.5ml culturing cell that contains 3 μ g/ml Regular Insulin; Collect supernatant every day, renew bright division culture medium, collected supernatant 3ml, centrifugal removal cell in continuous two days altogether.The centrifugal supernatant of abandoning behind adding Ni-NTA agrose (Qiagen company) the 50 μ l room temperatures vibration 2h in the supernatant, precipitation is given a baby a bath on the third day after its birth with washing lotion and is added 150mM imidazoles elutriant 100 μ l vibration 1min all over the back, centrifugal absorption supernatant is SDS-PAGE and is analyzed, and the result shows that there is the purpose fragment at the 26KD place.The purifying amount is about 3 μ g in the 3ml supernatant.
Five, the detection of target protein
Because constructed carrier has myc10 peptide antigenic tag, can carry out the PEX Protein Detection easily with the Western trace.Method of protein detection is as follows: get above-mentioned PEX purified product 3 μ l, carry out the Western trace to confirm that purified product is a target protein.Method is the same.Can detect the positive band of about 26KD, the molecular weight of the PEX secretory protein of deriving with theory coincide.
Six, the biological activity determination of target protein PEX
The fresh kind of egg of buying soaked 3-5 minute in 40 ℃ 0.1% bromogeramine solution, and eggshell surface solution is dried with clean gauze in the sterilization back, places 37.5 ℃, 60-70% humidity hatching (stir every day 3 times, do not make the eggshell attached water).Hatch and after 3 days egg is shelled, the chicken embryo moves in the plate and to continue to cultivate. when shelling with 75% alcohol disinfecting otch and finger, the air chamber end is last, dental burr on kind of egg, in 1/3 place cutting eggshell, form the otch of 2-3CM, the both hands thumb stretches into incision and opens kind of eggshell and shell membrane gently, make the chicken embryo fall into plate, the assurance vitelline membrane does not upwards injure white shell membrane, causes chicken embryo death in order to avoid cause vitelline membrane to destroy.Continue to cultivate dosing in the 5th day and (get glass fiber filter paper, beat the disk of d=2mm d=3mmd=5mm d=8mm different size with punch tool, autoclaving is added in chorioallantoic membrane vascular arborization place, and every concentration that drips behind the purifying is 30ng/ μ l PEX protein solution 5 μ l; Control group adds 1 * PBS, 5 μ l.Repeat administration is 1 time behind the 24h, observes after 48 hours and photograph.
After the administration the 48th hour, open filter paper, (10 times) observations and photographic recording under dissecting microscope.The control group angiogenic growth is normal; The experimental group angiogenic growth is obstructed, and shows as blood vessel blocking.This shows that the PEX albumen of 150ng purifying has the effect of obvious suppression vasculogenesis in vivo, confirms that QM7 can compare perfect modification to recombinant protein, the expressed proteins biologically active.
The implementation result example
Implementation result example 1, MMP-9 signal sequence promote the secretory volume of target protein
1.1 the structure of expression vector
1.1.1pIGF-I/hismyc the structure of expression vector
With human insulin-like growth factor (human insulin-like growth factor I, cDNA IGF-I) is a template, upstream primer 5 ' GGA AGC TTA TGG GAA AAA TCA GCA G3 ' (containing the HindIII site); Downstream primer is 3 ' (containing the XhoI site) of 5 ' CGC TCG AGA GCT GAC TTG GCA GGC.Amplification PCR products is cut with HindIII and XhoI enzyme, enzyme is cut product (about 350bp) be connected with the prGH/PEX/hismyc that is cut by same enzyme, transformed into escherichia coli DH5 α selects positive colony, obtains the pIGF-I/hismyc recombinant chou.PIGF-I/hismyc is cut by HindIII and Xho I enzyme, and sample carries out 1% agarose gel electrophoresis, and ultraviolet lamp is observed the fragment that each clone discharges 350bp down, illustrates that pcDNA3.0 has inserted the foreign gene of 350bp, and is correct through order-checking proof insertion sequence.
1..1.2prGH/IGF-I/hismyc, the structure of pIg/IGF-I/hismyc, pM9/IGF-I/hismyc expression vector
With pIGF-I/hismyc is template, 3 ' (containing the BamHI site) of upstream primer 5 ' CGG GAT CCT CGG ACC GGAGAC GCT CTG; Downstream primer is 3 ' (containing the XhoI site) of 5 ' CGC TCG AGA GCTGAC TTG GCA GGC.Amplification PCR products is cut with BamHI and XhoI enzyme, enzyme is cut product (about 210bp) to be connected with prGH/PEX/hismyc, the pIg/PEX/hismyc, the pM9/PEX/hismyc that are cut by same enzyme respectively, transformed into escherichia coli DH5 α, select positive colony, obtain prGH/IGF-I/hismyc, pIg/IGF-I/hismyc, pM9/IGF-I/hismyc recombinant chou.
After prGH/IGF-I/hismyc, pIg/IGF-I/hismyc, pM9/IGF-I/hismyc are cut by BamHI and Xho I enzyme, sample carries out 1% agarose gel electrophoresis, ultraviolet lamp is observed each clone down and is discharged the 210bp fragment, illustrate that pcDNA3.0 has inserted the foreign gene of 210bp, correct through order-checking proof insertion sequence.
1.1.3IGF-I the structure of propetide expression vector pIGF-Ipre/hismyc
CDNA with IGF-I is a template, upstream primer 5 ' GGAAGC TTATGG GAAAAATCAGCA G 3 ' (containing the HinIII site); Downstream primer is 3 ' (containing the XhoI site) of 5 ' GCC TCG AGC ATC CTG TAGTTC TTG TTT CC.Amplification PCR products is cut with HindIII and XhoI enzyme, enzyme is cut product (about 460bp) to be connected with the pIg/PEX/hismyc that is cut by same enzyme, transformed into escherichia coli DH5 α, select positive colony, obtain the pIGF-Ipre/hismyc recombinant chou, insert 48 amino acid whose signal peptides of fragment coding and 70 amino acid whose mature peptides and 35 amino acid whose E-DOMAIN.
PIGF-Ipre/hismyc is cut by HindIII and Xho I enzyme, and sample carries out 1% agarose gel electrophoresis, and ultraviolet lamp is observed the fragment that each clone discharges about 460bp down, illustrates that pcDNA3.0 has inserted the foreign gene of 460bp, and is correct through order-checking proof insertion sequence.
1.1.4prGH/IGF-Ipre/hismyc, the structure of pIg/IGF-Ipre/hismyc, pM9/IGF-Ipre/hismyc expression vector
With pIGF-I/hismyc is template, 3 ' (containing the BamHI site) of upstream primer 5 ' CGG GAT CCT CGG ACC GGA GACGCT CTG; Downstream primer is 3 ' (containing the XhoI site) of 5 ' GCC TCG AGC ATC CTG TAGTTC TTG TTT CC.Amplification PCR products is cut with BamHI and XhoI enzyme, enzyme is cut product (about 315bp) to be connected with prGH/PEX/hismyc, the pIg/PEX/hismyc, the pM9/PEX/hismyc that are cut by same enzyme respectively, transformed into escherichia coli DH5 α, select positive colony, obtain prGH/IGF-Ipre/hismyc, pIg/IGF-Ipre/hismyc, pM9/IGF-Ipre/hismyc recombinant chou.
PrGH/IGF-Ipre/hismyc, pIg/IGF-Ipre/hismyc and pM9/IGF-Ipre/hismyc are cut by BamHI and Xho I enzyme, sample carries out 1% agarose gel electrophoresis, ultraviolet lamp is observed each clone down and is all discharged the 315bp fragment, illustrate that pcDNA3.0 has inserted the foreign gene of 315bp, correct through order-checking proof insertion sequence.
1.2RT-PCR goal gene mRNA expression level in the sxemiquantitative cell
1.2.1 PEX mRNA expression level in the transient transfection QM7 cell
6h behind expression vector prGH/PEX/hismyc, the pIg/PEX/hismyc of PEX and the pM9/PEX/hismyc transient transfection QM7 cell, extract cell total rna, cDNA with reverse transcription is a template, the primer that adds PEX and GAPDH in the reaction system simultaneously carries out pcr amplification, amplified production is through 1% agarose gel electrophoresis analysis, specific band all occurs at nearly 500bp and 600bp place, the molecular weight size with GAPDH and PEX conforms to respectively.The PCR product purity is higher, does not have obvious non-specific band.Utilization AlphaImager
TMThe AlphaEase of 2200 gel imaging systems control
TMThe content that PEX fragment and internal reference GAPDH product are compared in the density scan sxemiquantitative is taken a picture, carried out to the stand alone software bag.The result shows after three kinds of carrier transfections that the ratio of PEX and GAPDH optical density(OD) does not have difference in the 6h QM7 cell, illustrates that the mRNA level of PEX does not have difference behind the expression vector transient transfection of the PEX that has the unlike signal sequence.
1.2.2 the mRNA expression level of IGF-I in the QM7 cell behind the transient transfection
6h behind expression vector pIGF-I/hismyc, the prGH/IGF-I/hismyc of IGF-I, pIg/IGF-I/hismyc and the pM9/IGF-I/hismyc transient transfection QM7 cell, extract cell total rna, cDNA with reverse transcription is a template, the primer that adds IGF-I and GAPDH in the reaction system simultaneously carries out pcr amplification, amplified production is through 1% agarose gel electrophoresis analysis, specific band all occurs at nearly 500bp and 200bp place, conform to molecular weight size respectively with GAPDH and IGF-I.The PCR product purity is higher, does not have obvious non-specific band.Utilization AlphaImager
TMThe AlphaEase of 2200 gel imaging systems control
TMThe density scan sxemiquantitative is taken a picture, carried out to the stand alone software bag relatively to the content of IGF-I fragment and internal reference and GAPDH product.The result shows after three kinds of carrier transfections that the ratio of IGF-I and GAPDH optical density(OD) does not have difference in the 6h QM7 cell, illustrates that the mRNA level of IGF-I does not have difference behind the different carriers transient transfection.
1.2.3 the mRNA expression level of IGF-Ipre in the QM7 cell behind the transient transfection
6h behind expression vector pIGF-Ipre/hismyc, the prGH/IGF-Ipre/hismyc of IGF-Ipre, pIg/IGF-Ipre/hismyc and the pM9/IGF-Ipre/hismyc transient transfection QM7 cell, extract cell total rna, cDNA with reverse transcription is a template, the primer that adds IGF-Ipre and GAPDH in the reaction system simultaneously carries out pcr amplification, amplified production is through 1% agarose gel electrophoresis analysis, specific band all occurs at nearly 500bp and 300bp place, conform to molecular weight size respectively with GAPDH and IGF-Ipre.The PCR product purity is higher, does not have obvious non-specific band.Utilization AlphaImager
TMThe AlphaEase of 2200 gel imaging systems control
TMThe density scan sxemiquantitative is taken a picture, carried out to the stand alone software bag relatively to the content of IGF-Ipre fragment and internal reference and GAPDH product.The result shows after three kinds of carrier transfections that the ratio of IGF-Ipre and GAPDH optical density(OD) does not have difference in the 6h QM7 cell, illustrates that the mRNA level of IGF-Ipre does not have difference behind the different carriers transient transfection.
1.3 mensuration protein content
1.3.1 the proteic detection of PEX in the cells and supernatant
48h behind expression vector prGH/PEX/hismyc, the pIg/PEX/hismyc of PEX and pM9/PEX/hismyc and the carrier pcDNA3.0 transient transfection QM7 cell, after getting cell culture medium 5 μ l SDS-PAGE electrophoresis, carry out the Western hybridization analysis with PEX antibody, the result (shows carrier: band 1, pM9/PEX as shown in Figure 2 among the figure; Band 2, pIg/PEX; Band 3, prGH/PEX; Band 4 pcDNA3.0), all can detect the positive band of about 26KD in the cell culture medium after the transfection of three kinds of PEX carriers, the molecular weight of the PEX secretory protein of deriving with theory coincide, and does not detect band in the substratum of empty carrier transfection.Wherein the bar band signal with pM9/PEX/hismyc is the strongest, points out three kinds of signal peptides all can effectively guide the PEX protein excretion, and the signal peptide pilot protein excretory of MMP9 is most effective.
1.3.2 the proteic detection of IGF-I in the cells and supernatant
48h behind four kinds of expression vector pIGF-I/hismyc, prGH/IGF-I/hismyc, pIg/IGF-I/hismyc and the pM9/IGF-I/hismyc of people IGF-I and the carrier pcDNA3.0 transient transfection QM7 cell, get cell culture medium 5 μ l and carry out the Western hybridization analysis with myc antibody, the result (shows carrier: band 1, pcDNA3.0 as shown in Figure 3 among the figure; Band 2, prGH/IGF-I/hismyc; Band 3, pIg/IGF-I/hismyc; Band 4, pM9/IGF-I/hismyc; Band 5 pIGF-I/hismyc), all can detect the positive band of about 7.7KD in the cell culture medium after the transfection of IGF-I carrier, consistent with theoretical value.Do not detect band in the substratum of empty carrier transfection.Wherein the bar band signal with pM9/IGF-I/hismyc is the strongest, and secondly the bar band signal of prGH/IGF-I/hismyc points out four kinds of signal peptides all can effectively guide the IGF-I protein excretion, and the signal peptide pilot protein excretory of MMP9 is most effective.
1.3.3 the proteic detection of IGF-Ipre in the cells and supernatant
Get that the cell culture medium 5 μ l of 48h carry out the Western hybridization analysis with myc antibody behind four kinds of carrier pIGF-Ipre/hismyc, prGH/IGF-Ipre/hismyc, pIg/IGF-Ipre/hismyc and pM9/IGF-Ipre/hismyc of people IGF-I propetide and the carrier pcDNA3.0 transient transfection QM7 cell, the result shows all can detect in the cell culture medium after the transfection of IGF-Ipre carrier positive band about about 14.9KD, consistent with the molecular weight of prediction.Wherein also the bar band signal with pM9/IGF-Ipre/hismyc is the strongest.Do not detect band in the substratum of empty carrier transfection.
In sum, at first with merging the PEX expression vector transient transfection QM7 cell that above unlike signal sequence is arranged, relatively the secernment efficiency of three kinds of signal sequences screens best guiding foreign protein excretory signal sequence.The Western hybridization analysis shows that three kinds of signal peptides all successfully guide the PEX protein excretion in cell conditioned medium, have the carrier signal of MMP-9 signal peptide the strongest with fusion.For the validation signal sequence guides other foreign protein excretory versatility, expression vector transfection QM7 cell with IGF-I and IGF-I propetide and unlike signal sequence, Western hybridization detects the secernment efficiency that they guide IGF-I and IGF-I propetide, and the result is identical with PEX.Because 6h after the transfection, RT-PCR detects the mRNA level of foreign gene in the cell, the result shows that the carrier mRNA level that merges the unlike signal sequence does not have difference, and the difference of recombinant protein content is that the secernment efficiency difference is caused really in the prompting supernatant, is not that the difference of expression amount causes.Above result shows that three kinds of signal peptides all can successfully guide different foreign protein secretions, and wherein the signal peptide of MMP-9 guiding foreign protein secernment efficiency is the highest.
The superiority of implementation result example 2, QM7 expression system
2.1 the comparison of QM7 and COS7 expression system behind the transient transfection
2.1.1 the comparison of protein content in two kinds of cells and supernatant
48h behind pM9/PEX/hismyc, pM9/IGF-I/hismyc and pM9/IGF-Ipre/hismyc carrier transient transfection COS7 and the QM7 cell, get culture supernatant and carry out the ELISA protein quantification, the result shows that three kinds of proteic content are respectively in the QM7 supernatant: PEX, 2.4mg/L; IGF-I, 4.3mg/L; IGF-I propetide 3.7mg/L.Three kinds of proteic content are respectively in the COS7 supernatant: PEX, 1.6mg/L; IGF-I, 2.6mg/L; IGF-I propetide 2.2mg/L.Protein yield is approximately 1.5 times of COS7 in the QM7 supernatant.
2.2.2 the comparison of protein content in two kinds of cell pyrolysis liquids
48h behind pM9/PEX/hismyc, pM9/IGF-I/hismyc and pM9/IGF-Ipre/hismyc carrier transient transfection COS7 and the QM7 cell, get cell pyrolysis liquid and carry out the ELISA protein quantification, the result shows that three kinds of proteic content are respectively in the QM7 cell pyrolysis liquid: PEX, 0.9mg/L; IGF-I, 1.4mg/L; IGF-I propetide 1.3mg/L.Three kinds of proteic content are respectively in the COS7 supernatant: PEX, 1.95mg/L; IGF-I, 2.4mg/L; IGF-I propetide 2.0mg/L.Protein content all is higher than COS7 in the COS7 cell pyrolysis liquid.
2.2 the comparison of the QM7 of stably express PEX and COS7 clone
2.2.1Western trace testing goal albumen
QM7 behind the pM9/PEX/hismyc carrier transient transfection and COS7 cell obtain the clone of stably express PEX with the G418 screening, cell converges sheet and changes 48h behind the substratum, after getting cell culture medium 5 μ lSDS-PAGE electrophoresis, carry out the Western hybridization analysis with PEX antibody, all can detect the positive band of about 26KD in two kinds of cell culture mediums, the molecular weight of the PEX secretory protein of deriving with theory coincide.The PEX content of QM7 is apparently higher than COS7.
2.2.2ELISA detect PEX content
QM7 behind the pM9/PEX/hismyc carrier transient transfection and COS7 cell obtain the cell POOL of positive colony with G418 screening, and cell converges sheet and changes 48h behind the substratum, adopts ELISA to detect the proteic content of PEX in the cell culture medium.The about 3.6mg/L of QM7 cell conditioned medium protein content; The about 1.6mg/L of COS7 cell conditioned medium protein content.
In sum, expressing quantity is higher than QM7 and protein secretion is lower than QM7 in the COS7 cell, may be because there is the bottleneck problem of protein excretion.The key of removing this bottleneck problem is the screening of new host cell type.By with the relatively discovery of COS7 expression system, QM7 pilot protein excretory efficient is higher than COS7, is used for the ripe and excretory component of albumen in the prompting QM7 cell and is better than COS7.
The optimization of implementation result example 3, QM7 cytodifferentiation culture condition
This paper prepared insulin-containing 3 μ g, 5 μ g/ml the M199 substratum, contain the M199 tradition division culture medium of 0.5% serum and be used for the CHO-S-SFM II serum free medium that Chinese hamster ovary celI is cultivated.Compare their influences from morphology and biochemical two aspects to the QM7 differentiation.The Giemsa coloration result shows, the M199 substratum of insulin-containing 3 μ g, 5 μ g/ml and the M199 substratum that contains 0.5% serum all can promote cytodifferentiation to merge to form myotube, the time do not have marked difference mutually and on the differentiation degree.Creatine kinase CK is the distinctive enzyme of myocyte, increases increased activity with differentiation degree, and detected result shows that CK is active consistent with the morphological indexes variation.The M199 substratum that further confirms insulin-containing can promote cytodifferentiation.The short cell differentiation of substratum that contains 3 μ g/ml Regular Insulin does not have significant difference with the substratum that contains 5 μ g/ml Regular Insulin, therefore can select the serum-free differentiation media culturing cell that contains 3 μ g/ml Regular Insulin for use, thereby make subsequent purification work simple, prevented simultaneously the pollution of foreign protein again, for cell provides the culture system of optimizing as expression system.
Implementation result example 4, QM7 expression system can be used for Pull-Down and detect
The detection of albumen interphase interaction is extremely important for the research protein function, and this depends on proteic structure and biological activity.In order to verify that the QM7 expression system is used for the feasibility that Pull-Down detects, we are with coding SV40 large T antigen and the proteic carrier transfection of mouse p53 QM7 cell, utilize in the Pull-Down technology for detection cell conditioned medium the two in conjunction with situation.
Material and method:
1. vector construction
1.1p53-his-pcDNA3 structure
(Matchmaker yeast two-hybrid system Clontech) is template, and upstream primer is 5 ' CGGGATCC (BamH I) CTGTCACCGAGACCCC 3 ' with the plasmid pVA3 of yeast two-hybrid; Downstream primer is that 5 ' CGTCTAGA (XbaI) GTCTGAGTCAGGCCCC 3 ' carries out pcr amplification, the PCR product encoding murine p53 albumen (a.a.72-390) that obtains.The PCR product is connected with the pM9/PEX/hismyc carrier that same enzyme is cut with BamH I and XbaI enzyme cutting, obtains p53/his/pcDNA3, and the coding C-terminal merges the mouse p53 albumen of 6xHis.
1.2T-myc-pcDNA3 structure
(Matchmaker yeast two-hybrid system Clontech) is template, and upstream primer is 5 ' CGGGATCC (BamH I) GTGGAACTGATGAATGGGAGC3 ' with the plasmid pTD1 of yeast two-hybrid; Downstream primer is 5 ' GGCTCGAG (XhoI) TGTTTCAGGTTCAGGGGGAG3 ', carries out pcr amplification, the PCR product coding SV40 large T antigen (a.a.86-708) that obtains.The PCR product is cut with BamH I and XhoI enzyme, is connected with the pM9/PEX/hismyc carrier that same enzyme is cut, and obtains T/hismyc/pcDNA3.Be template again with T/hismyc/pcDNA3, utilize the upstream primer and primer 5 ' GCGGGCCC (ApaI) TATCTAGA (XbaI) CAAGTCCTCTTCAG3 ' of large T antigen, carrying out the product of pcr amplification cuts with BamH I and ApaI enzyme, be connected with the pM9/PEX/hismyc carrier that same enzyme is cut, obtain T/myc/pcDNA3, the coding C-terminal merges the SV40 large T antigen of myc.
2.Pull-Down detect
P53/his/pcDNA3 and T/myc/pcDNA3 be transfection and cotransfection QM7 cell respectively, and liposome lipofectamine (GIBCO/BRL) is adopted in gene transfection.48h collecting cell supernatant after the transfection, centrifugal 15000r, 4oC, 10min removes cell precipitation, get in the 1ml supernatant and to add the centrifugal supernatant of abandoning behind Ni-NTA agrose (QIAGEN) the 20ul room temperature vibration 2h, precipitation is given a baby a bath on the third day after its birth with washing lotion and is added imidazoles elutriant 40ul vibration 1min all over the back, and centrifugal absorption supernatant is SDS-PAGE and is analyzed and the Western trace.One anti-is the rabbit anti-serum of anti-myc (diluting at 1: 1000), incubated at room 1hr, and II resists (HRP-Goat﹠amp; Rabit1: 40000 dilutions), incubated at room 1h.After TTBS washes film, add ECL chemical illuminating reagent (Pharmacia company), exposure, punching.
The result:
1.SDS-PAGE detect
After SDS-PAGE result shows that the cell conditioned medium of p53/his/pcDNA3 and T/myc/pcDNA3 cotransfection QM7 and Ni-NTA agrose are hatched, the albumen that two kinds of molecular weight about 35KD and 70KD are arranged in the elutriant, the molecular weight with p53 and large T antigen conforms to respectively; After the cell conditioned medium of p53/his/pcDNA3 transfection QM7 and Ni-NTA agrose are hatched, the albumen that has only the 35KD molecular weight is arranged in the elutriant, conform to the p53 molecular weight; After the cell conditioned medium of T/myc/pcDNA3 transfection QM7 and Ni-NTA agrose are hatched, there is not the albumen of these two kinds of molecular weight in the elutriant.The result (shows carrier: band 1, T/myc/pcDNA3 as shown in Figure 4 among the figure; Band 2, p53/his/pcDNA3 and T/myc/pcDNA3; Band 3, p53/his/pcDNA3).
2.Western engram analysis
Western trace result shows the albumen that can detect the about 70KD of molecular weight in the elutriant after the cell conditioned medium of p53/his/pcDNA3 and T/myc/pcDNA3 cotransfection QM7 and Ni-NTA agrose are hatched, conforms to the molecular weight of the large T antigen of expection; P53/his/pcDNA3 and T/myc/pcDNA3 there is no the positive protein band after the cell conditioned medium of transfection QM7 and Ni-NTA agrose are hatched respectively in its elutriant.The result (shows carrier: band 1, T/myc/pcDNA3 as shown in Figure 5 among the figure; Band 2, p53/his/pcDNA3 and T/myc/pcDNA3; Band 3, p53/his/pcDNA3).
In sum, known SV40 large T antigen can with mouse p53 protein binding (Li, B.and S.Fields.1993.Identification of mutations in p53 that affect its binding to SV40large T antigen by using the yeast twohybrid system.FASEB J.7:957-963.), the plasmid that this experiment makes up makes p53 PROTEIN C end merge 6xHis, and large T antigen C end merges the myc label.Thereby therefore can combine the albumen as bait with Ni-NTA agrose because p53 PROTEIN C end merges 6xHis, large T antigen is a prey albumen.After SDS-PAGE result shows that the cell conditioned medium of p53/his/pcDNA3 and T/myc/pcDNA3 cotransfection QM7 and Ni-NTA agrose are hatched, the albumen that two kinds of molecular weight about 35KD and 70KD are arranged in the elutriant, the molecular weight with p53 and large T antigen conforms to respectively; Western trace result shows that at the 70KD place positive band is arranged.When above result confirms with QM7 as host cell, the signal sequence of MMP9 can guide SV40 large T antigen and mouse p53 albumen successfully to secrete to cell culture fluid, and it possesses biological activity, the two combination that can interact has verified that the QM7 expression system is used for the feasibility that Pull-Down detects.
Sequence table
＜110〉Beijing Inst of Tumor Prevention and Treatment
＜120〉a kind of expression system of in vitro culturing skeletal muscle
<130>ZBC1F050229
<160>1
<210>1
<211>57
<212>DNA
＜213〉people
<400>1
atgagcctct ggcagcccct ggtcctggtg ctcctggtgc tgggctgctg ctttgct 57
Claims (6)
1. expression system of in vitro culturing skeletal muscle, expression and the activity of the separation and purification of expression product, the expression product step that detect of structure, expression vector transfection host cell group and screening, the goal gene that mainly comprises the expression vector that contains goal gene in host cell, it is characterized in that described expression vector is is masterplate with pcDNA3.0, the C-terminal XhoI site of expressing protein merges the expression vector that myc10 peptide Detection of antigen label and 6 * his purification tag are arranged; And between the HindIII of its N end and BamH I site, insert people's matrix metalloproteinase 9 signal sequences shown in sequence 1, and described host cell is a skeletal muscle QM7 cell.
2. a kind of expression system of in vitro culturing skeletal muscle according to claim 1 is characterized in that described carrier for expression of eukaryon is in order to express the protoheme spline structure territory of matrix metalloproteinase-2C end.
3. a kind of expression system of in vitro culturing skeletal muscle according to claim 1 is characterized in that described carrier for expression of eukaryon is in order to the expressing human insulin-like growth factor I.
4. according to claim 1 or the described a kind of expression system of in vitro culturing skeletal muscle of 2 arbitrary claims, it is characterized in that when transfection host cell and purifying target protein, use the serum-free differentiation media that contains 3～5 μ g/ml Regular Insulin to cultivate host cell.
5. a kind of expression system of in vitro culturing skeletal muscle according to claim 4 is characterized in that described serum-free differentiation media is the M199 substratum.
6. a kind of expression system of in vitro culturing skeletal muscle according to claim 4 is characterized in that when transfection host cell and purifying target protein, uses the serum-free M199 division culture medium that contains 3 μ g/ml Regular Insulin to cultivate host cell.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100843554A CN100374572C (en) | 2005-07-19 | 2005-07-19 | Expression system of in vitro culturing skeletal muscle |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100843554A CN100374572C (en) | 2005-07-19 | 2005-07-19 | Expression system of in vitro culturing skeletal muscle |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1724677A CN1724677A (en) | 2006-01-25 |
| CN100374572C true CN100374572C (en) | 2008-03-12 |
Family
ID=35924308
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100843554A Expired - Fee Related CN100374572C (en) | 2005-07-19 | 2005-07-19 | Expression system of in vitro culturing skeletal muscle |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100374572C (en) |
Families Citing this family (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN101003794B (en) * | 2007-01-11 | 2010-05-19 | 厦门大学 | Method for constructing recombined adenovirus in PEX outer secretion type of human and application |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998009657A2 (en) * | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | Method for recombinant adeno-associated virus-directed gene therapy |
| CN1270225A (en) * | 1999-04-12 | 2000-10-18 | 丽珠集团丽宝生物化学制药有限公司 | Electrotransfer technique of Epo gene |
| CN1280012A (en) * | 1999-07-09 | 2001-01-17 | 北京医科大学心血管(基础)研究所 | Electric pulse transfer technology of IFN gene |
| WO2002027006A1 (en) * | 2000-09-26 | 2002-04-04 | Crucell Holland B.V. | Adenoviral vectors for gene delivery in skeletal muscle cells or myoblasts |
-
2005
- 2005-07-19 CN CNB2005100843554A patent/CN100374572C/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998009657A2 (en) * | 1996-09-06 | 1998-03-12 | Trustees Of The University Of Pennsylvania | Method for recombinant adeno-associated virus-directed gene therapy |
| CN1270225A (en) * | 1999-04-12 | 2000-10-18 | 丽珠集团丽宝生物化学制药有限公司 | Electrotransfer technique of Epo gene |
| CN1280012A (en) * | 1999-07-09 | 2001-01-17 | 北京医科大学心血管(基础)研究所 | Electric pulse transfer technology of IFN gene |
| WO2002027006A1 (en) * | 2000-09-26 | 2002-04-04 | Crucell Holland B.V. | Adenoviral vectors for gene delivery in skeletal muscle cells or myoblasts |
Non-Patent Citations (1)
| Title |
|---|
| 灭活CVB1在离体骨骼肌细胞中基因转移的研究. 陈国俊等.中山医科大学学报，第21卷第4S期. 2000 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1724677A (en) | 2006-01-25 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN102027123B (en) | The restructuring of end user's cell expression system produces reliable human protein | |
| CN106282216A (en) | A kind of preparation method of recombinant long-acting chicken interferon α | |
| CN103911383B (en) | Be suitable for transformation human acid fibroblast growth factor gene that domestic natural silk gland expresses and expression system and application | |
| ES2306505T3 (en) | CLONICAL C3A CELL LINE EXEMPT FROM SERUM AND USE PROCEDURES. | |
| CN108753837A (en) | The construction method and sgRNA of a kind of hyperlipidemia or rabbit model | |
| CN100374572C (en) | Expression system of in vitro culturing skeletal muscle | |
| CN111454990B (en) | Human jugular auxiliary nerve ganglionic tumor immortalized cell strain and application thereof | |
| CN107446022B (en) | Polypeptide PIP-14 capable of antagonizing RNA binding activity of PARP1 protein and application thereof | |
| CN103214579B (en) | Animal fusion recombinant interferon | |
| CN1824775A (en) | Preparation technology of recombination human blood vessel inhibitor K1-3 and its application in medicine for treating tumour | |
| CN105463018A (en) | Method for regulating GLUT2 (glucose transporter 2) expression in chicken intestines through transcription factor CDXA | |
| CN106701902A (en) | FOXR2 gene and application of expression product to diagnosis and treatment of liver cancer | |
| CN109306007A (en) | Anti- porcine reproductive and respiratory syndrome virus nsp4 protein gene engineered antibody and application | |
| CN102719521B (en) | Gelucystine/L-glutamic acid is oppositely turned the application of xCT inhibitor in liver cancer treatment | |
| CN101955942A (en) | DNA (Deoxyribonucleic Acid) molecule for encoding pig alpha-interferon and recombinant colibacillus as well as application thereof | |
| CN104611343A (en) | Isolated antiviral natural immune protein TRIM32 (tripartite motif 32) for carps and antiviral activity | |
| CN112641924B (en) | Medicine for treating thyroid cancer and preparation method and application thereof | |
| CN104450781B (en) | A kind of cell line of overexpression CIAPIN1 albumen and its preparation method and application | |
| CN103387605B (en) | A kind of RTN4B polypeptides, its monoclonal antibody, the hybridoma cell strain for generating monoclonal antibody and their preparation and application | |
| CN102481337A (en) | Compositions And Methods Modulating Mg29 For The Treatment Of Diabetes | |
| CN101015683B (en) | Application of human RTN4B protein in preparation of medicine for healing wound | |
| CN101891824B (en) | Vascular targeting soluble fusion protein TrxHis-hDlll-RGD | |
| CN105396136A (en) | Application of CCN1(Cyr61) to treatment of diseases related to skin injuries and atrophoderma | |
| CN101890153A (en) | Method for treating chronic liver diseases by using hepatocyte nuclear factor-4alpha (HNF4alpha) | |
| CN104531691A (en) | Primers for obtaining genes of bovine interferon alpha and preparation method for recombinant bovine interferon alpha |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080312 Termination date: 20120719 |