CN100366752C - Method for deriving mulriple DNA sequences from atom destructurizing - Google Patents
Method for deriving mulriple DNA sequences from atom destructurizing Download PDFInfo
- Publication number
- CN100366752C CN100366752C CNB200510048240XA CN200510048240A CN100366752C CN 100366752 C CN100366752 C CN 100366752C CN B200510048240X A CNB200510048240X A CN B200510048240XA CN 200510048240 A CN200510048240 A CN 200510048240A CN 100366752 C CN100366752 C CN 100366752C
- Authority
- CN
- China
- Prior art keywords
- dna
- dna sequence
- nucleotide
- pcr amplification
- pcr
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
This invention relates to a method for deriving polymorphorous DNA sequences through atomic allosterism. The method comprises: designing primers, performing PCR to introduce dNTP having 32P or 35S, performing radioactive decay, performing second PCR, conducting DNA cloning, sequencing and analyzing. The method can derive large numbers of novel DNA sequences with multiple sites mutation. The mutated sites are controllable through adjusting the category of alpha site-specific dNTP, by which the contents of guanine and cytosine can also be controllably changed. The method has such advantages as high mutagenic effect, high directional tendency, high biosafety and no environmental damage. The method can be used to mutate any gene.
Description
Technical field
The present invention relates to a kind of method of utilizing atom destructurizing derived dna sequence polymorphism, belong to gene mutagenesis research field.
Background technology
Why " planting melon gets melon, plants beans and get beans "? more satisfactory answer has been made in the scientific discovery of eighties of last century--and biological proterties is by Gene Handling; A gene is the DNA of one section particular sequence; This DNA is rearranged in certain sequence by four kinds of Nucleotide (being A, T, G, C); As long as change the order of A, T, G, C among the DNA, just can change gene, making kind of a melon that goes out no longer is original melon, the beans of planting out also no longer are original beans.
Over past ten years, gene has become a kind of resource that is rich in commercial competitiveness.Eighties of last century nineties, the cotton seeds of Monsanto Company enters Chinese market, and what rely on is exactly isolated one section specific DNA sequence from bacillus thuringiensis.The mRNA that this segment DNA sequence is transcribed out can translate a kind ofly has the albumen of special toxic effect to lepidoptera pest, just can make it become " Insect Resistant Cotton " after changing it the genome of cotton over to.
At present why the mankind very are concerned about diversity of organism, more are the diversity of being concerned about gene wherein, come down to wish the diversity of the dna sequence dna that protection " God " is more created to us.The dna sequence dna of many a unique control biological characters just equals many portions and allows mankind's development opportunity of depending on for existence, and just equal the chance that many portions are made a good deal of money concerning the entrepreneur.
Whether isolated genes from biology not only need spend long time and very big manpower and materials, but also had by nature to contain the biotype of the gene of wanting of controlling oneself to limit.So people have concentrated one's gaze on the direction of making great efforts the diversity of creating biological and gene by mutagenesis.Under the natural condition, though various biology is also producing various variations (title spontaneous mutation) constantly, the frequency that morphs is very low.With the plant is that object is estimated, the occurrence rate of mutant plant is between 10
-3～10
-4If with the individual gene is that object is estimated, the mutation rate of gene is between 10
-5～10
-5Adopt the method for induced mutations, then can make the mutation rate of biological mutation rate and gene improve thousands of times.The method of induced mutations is divided by object and can be divided into two big classes at present:
One, at the mutagenesis (mainly containing two classes) of organism, organ, tissue
1, physical mutagenesis: utilize special ray (as gamma-rays, X ray, neutron, β ray, ionic fluid, laser, ultraviolet ray etc.) or envrionment conditions (as space, high pressure etc.) that seed, organ, tissue etc. are carried out mutagenesis.The advantage of utilizing ray mutagenesis is that aberration rate height, variation amplitude are bigger, and shortcoming is that lethality rate height, useful aberration rate are lower.Can not cause death though utilize space, high pressure etc. to carry out mutagenesis, useful aberration rate is also higher, is difficult to as usual method utilization.
2, chemomorphosis: utilize that special chemical mutagen changes DNA chemical structure (as with nitrous acid and alkylating agent etc.), mispairing when inducing DNA duplicates (as with base analogue 5-bromouracil, 2-aminopurine etc.), generation frameshit (as acridine compound, microbiotic etc.) when induce dna duplicates.The advantage of chemomorphosis is certain directional property tendency, aberration rate to be arranged also than higher, and shortcoming is that chemical mutagen mostly has carcinogenesis and more stable, contaminate environment.
Two, at the mutagenesis (also mainly containing two classes) of specific gene
1, external positional mutation: utilize archaeal dna polymerase method (Kunkel method) and PCR method etc., the mutational site is designed in the primer that duplicates of DNA, and then the expection that obtains on the predetermined position changes.The advantage of this method is that polarization is strong, and shortcoming is to be only applicable to clearly gene of gene order, and the type of the variation of making is subjected to the limitation of people's designed capacity.
2, external random mutation: utilize chemical mutagen, mutator strain, fallibility PCR to cause transgenation, or utilize gene recombination etc. to produce new gene.Utilizing the advantage of chemical mutagen, mutator strain, fallibility PCR mutagenesis is that variation type is many, and shortcoming is that chemical mutagen has carcinogenic danger, utilizes mutator strain, fallibility PCR to bring out, and degree of variation is not high.Utilize gene recombination, be subjected to people's limitation such as design, operational capability.
Summary of the invention
The objective of the invention is to avoid the defective of aforesaid method, and provide a kind of method of utilizing atom destructurizing derived dna sequence polymorphism, it promptly is object with the dna molecular, adopt mechanism by atom destructurizing induce dna structure variation, derive the different DNA of a large amount of sequences by section of DNA, create the diversity of gene.
The technical problem to be solved in the present invention provides a kind ofly to be utilized atom destructurizing that the section of DNA sequence is derived to be multiple not homotactic method, to it is characterized in that may further comprise the steps:
1. design of primers:, design the opposite Oligonucleolide primers of a pair of direction according to the nucleotide sequence of source DNA (or claim " female gene ", promptly one section is used to the multifarious DNA of derived sequence);
2. first round pcr amplification (polymerase chain reaction), i.e. α bit strip
32P or
35The introducing of the special dNTP of S: with the 1. middle source DNA of step is template, on purpose mixes the α bit strip in reaction substrate
32P or
35The special dNTP of S, the special dNTP in α position: normal dNTP=1: 30～1: 3, by the PCR reaction the special dNTP in α position to be introduced in the source DNA sequence, the primary template as the derived dna sequence polymorphism is also referred to as " first round pcr amplification product ";
3. radioactivity decay:,, place and carry out radioactivity decay under the cold condition that is lower than 4 ℃, time 〉=1 transformation period as the primary template of derived dna sequence polymorphism with the pcr amplification product of step in 2.;
4. second take turns pcr amplification: with the PCR product after the 3. middle decay of step is template, is reaction substrate with all normal dNTP, carries out second and takes turns pcr amplification, obtains " diversity dna sequence dna mixture ";
5. dna clone: 4. step second is taken turns pcr amplification product, and promptly diversity dna sequence dna mixture carries out single dna sequence dna clone, to obtain different " unique DNA " that sequence changes;
6. check order and analyze: different " unique DNA " of step in 5. carried out sequencing analysis; According to sequencing result, by molecular biology software analysis DNA variation situation, the function after the predicted gene variation.
Described a kind of method of utilizing atom destructurizing derived dna sequence polymorphism is characterized in that step 5. dna clone when operation, preferably earlier with PCR product purification test kit or take turns the PCR product by electrophoresis to second and carry out purifying, and then clones on dna vector.
The invention has the beneficial effects as follows: 1, efficient, the type of bringing out variation is many, the frequency height of variation; 2, localized proneness height by the kind that the special dNTP in α position in the reaction substrate is mixed in adjustment, can improve or reduce the content of bases G C among the DNA consciously, and this function and expression to regulatory gene is extremely important.3, biological safety height because of the nucleic that uses is few, not only a little less than the radioactivity, and easily thoroughly decays into non-radioactive substance, in the short period of time so can not form long-term hidden danger as base analogue.The present invention is applicable to any gene is carried out mutagenesis.
Description of drawings
The status that phosphodiester bond shown in Figure 1 occupies in dna structure
α shown in Figure 2-
32P-dNTP (triphosphate deoxy-nucleotide)
S shown in Figure 3 replaces the dNTP of double covalence oxygen
The dNTP of S substituted hydroxy oxygen shown in Figure 4
Know-why of the present invention is that the phosphodiester bond among the DNA occupies very in dna structure Consequence, any variation meeting that this position takes place produces material impact such as figure to the DNA configuration Shown in 1.
32No longer be P after the P decay, but become sulphur (S). With certain α-32P-dNTP such as Fig. 2 Shown in do the substrate of dna replication dna, be introduced in a certain DNA chain by PCR, treat the P decay Become behind the S again take normal dNTP all as substrate to copy (amplification) this dna fragmentation, will Produce mispairing in the position that becomes S. Our experiment shows, if introduce α-32P-dATP, meeting There is base transition to take place, i.e. A → G, T → C; If introducing α-32P-dCTP, can cause C → T, G → A.
35No longer be S after the S decay, but become chlorine (Cl). The replaceable triphosphoric acid deoxidation nuclear of S Double covalence oxygen on the thuja acid α position and hydroxyl oxygen shown in Fig. 3,4, introduce α-35The S-triphosphate deoxy-nucleotide,35Will cause because S is different from the atomic radius of O pairing before the S decay Inaccurate, and then produce sequence variations; And work as35After S decays into Cl, will cause bigger The dna structure variation, and then bring out the variation of sequence. Our experiment also shows, introduce α-35S-Base transition result on the desired location also can appear in triphosphate deoxy-nucleotide.
32The half-life of P is about 14 days,35The half-life of S is about 87 days, can be feeding behaviour Provide plenty of time, the Isoforms after obtaining quickly to decay again. Raw material because of feeding To be with on the α position32P or35The special dNTP of S, utilization rate is relatively high when dna replication dna. In addition Because the nucleic that uses is few, not only a little less than the radioactivity, and easily thoroughly decline in the short period of time outward, Become non-radioactive substance, so can not form long-term hidden danger.
Embodiment
Embodiment 1: with onion Ace-AMPl gene (357bp) is template, introducing α-
32P-dATP
1. design of primers: onion Ace-AMPl gene clone on the pUC19 plasmid vector, is gone out the PCR primer according to its sequences Design--upstream primer is 5 '-TAA GGT A
CC ATG GTTCGC GTT GTA TC-3 ' (containing restriction enzyme site NcoI), downstream primer are 5 '-TCC TGCCGC ATT
GAA TTCTTG G-3 ' (containing restriction enzyme site EcoRI), theoretical amplification of DNA fragments length is 357bp;
2. α-
32The introducing of P-dATP (being first round PCR): with step 1. in source DNA is template, in reaction substrate dNTP, mix α-
32P-dATP, make α-
32P-dATP: normal dATP=1: 15, carry out 35 circulations by 94 ℃ of 1min, 55 ℃ of 0.5min, 72 ℃ of 1min, finish first round PCR reaction;
3. radioactivity decay: the pcr amplification product of step in 2. placed-20 ℃ of 7 transformation period of decay;
4. second take turns PCR: with step 3. in PCR product after the decay is template, be that reaction substrate carries out second and takes turns pcr amplification with normal dNTP;
5. dna clone: 4. step second is taken turns the PCR product and carried out purifying through ethanol sedimentation, cut through enzyme then and produce relevant jointing, gather in the crops required dna fragmentation, clone in plasmid vector by electrophoretic separation;
6. check order and analyze: 21 mono-clonals of picked at random step in are 5. delivered match Parkson company sequencing analysis.Dna sequence analysis is the result show: have 20 nucleotide variation has taken place among 21 clones, wherein, there is 1 clone that the variation of 8 positions has taken place, 2 variations that 7 positions take place, 3 variations that 6 positions take place, 2 variations that 5 positions take place, 3 variations that 4 positions take place, the variation of 3 positions has taken place in 2 clones, and the variation of 2 positions has taken place in 5 clones, variation and 1 base deletion of 2 positions taken place in 1 clone, and the variation of 1 position takes place 1 clone.The base mispairing rate of not introducing isotopic PCR clone is 0.Allosteric derived dna sequence variations mainly occurs on base A or the T position, and is converted to main (seeing sequence table 1) with A → G, T → C base.
Embodiment 2: with wheat specific dna sequence (301bp) is template, introducing α-
32P-dATP
1. design of primers: one section specific dna sequence from wheat is cloned on the DGEM-T plasmid vector, going out the PCR primer according to its sequences Design--forward primer E-AG is that 5 '-CCCGGG CAG GTA ATT CAG-3 ', complementary strand primer M-CG are 5 '-TCG CGG CCG AGG TTAACA-3 ', and theoretical amplification of DNA fragments length is 301bp;
2. α-
32The introducing of P-dATP (being first round PCR): with step 1. in source DNA is template, in reaction substrate dNTP, mix α-
32P-dATP, make α-
32P-dATP: normal dATP=1: 15, carry out 35 circulations by 94 ℃ of 1min, 62 ℃ of 1min, 72 ℃ of 1min, finish first round PCR reaction;
3. radioactivity decay: just the pcr amplification product of step in 2. places-20 ℃ of 7 transformation period of decay;
4. second take turns PCR: with step 3. in PCR product after the decay is template, be that reaction substrate carries out second and takes turns pcr amplification with normal dNTP;
5. 4. dna clone second takes turns step after the purified test kit of PCR product carries out purifying, is cloned on the pGEM-T carrier;
6. check order and analyze: the picked at random step 9 clones in 5. send precious biotech firm sequencing analysis.The result shows: variation has all taken place in 9 clones, wherein 1 mispairing that 11 positions take place, 1 the mispairing of 10 positions and the base deletion of 1 position have taken place, 2 mispairing that 10 different positionss take place, 1 mispairing that 8 positions take place, 1 mispairing that 7 positions take place; 2 mispairing that 6 different positionss take place, 1 mispairing that 5 positions take place.The mispairing of the no any position of contrast takes place.The position of base mispairing is A and T, and the mispairing rule becomes C for the A mispairing becomes G, T mispairing, and the base conversion (seeing sequence table 2) of A → G, T → C promptly takes place.
Embodiment 3: with wheat specific dna sequence (301bp) is template, introducing α-
32P-dCTP
Step is mixed in reaction substrate dNTP in 2. be α-
32P-dCTP, other step is with embodiment 2; 6. step checks order and analyze: the picked at random step 10 clones in 5. send precious biotech firm sequencing analysis.The result shows: 10 clones have 9 mispairing that desired location takes place, wherein: 1 mispairing that 5 positions take place; 1 mispairing that 4 positions take place; 2 the mispairing of 2 different positionss and the disappearance of 1 base have taken place; 5 mispairing that 1 different positions takes place.The mispairing of the no any position of contrast.The position of duplicating the mispairing generation is base C and G, and the rule of mispairing becomes A for the C mispairing becomes T, G mispairing, and the base conversion (seeing sequence table 3) of G → A, C → T promptly takes place.
Embodiment 4: with wheat specific dna sequence (301bp) is template, introducing α-
35S-dATP
Step is mixed in reaction substrate dNTP in 2. be α-
35S-dATP, step 3. radiation decay becomes 1 transformation period, and other step is with embodiment 2; 6. step checks order and analyze: the picked at random step 16 clones in 5. send precious biotech firm sequencing analysis.The result shows: have 8 to change among 16 clones, wherein: 12 mispairing have taken place, and 71 mispairing only takes place.
Sequence table 1: onion DNA introducing α-
32Make a variation behind the P-dATP
Ace-ampl is the original DNA sequence, and hb01 and hbw20 are the mutagenized dna sequence
ace-ampl ccatggttcgcgttgtatctttacttgcagcatcgaccttcatactgttgattatgataa
hb01 ccatggttcgcgttgtatctttacttgcagcatcgaccttcatactgttgattacggtaa
hbw20 ccatggttcgcgttgtatctttacttgcagcatcggccttcatactgttgattatgataa
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
ace-ampl tcagcagtccgtatgcaaatagtcagaacatatgcccaagggttaatcgaattgtgacac
hb01 tcagcagcccgtatgcaaatagtcagcacatatgcccaagggttaatcgaattgtgacac
hbw20 tcagcagtccgtacgcaaacagtcagaacatatgcccaagggttaatcgaattgtgacac
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
ace-ampl cctgtgtggcctacggactcggaagggcaccaatcgccccatgctgcagagccctgaacg
hb01 cctgtgtggcctacggactcggaagggcaccagtcgccccatgctgcagagccctgaacg
hbw20 cctgtgtggcctacggactcggaagggcaccaatcgccccatgccgcagagccctgaacg
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
ace-ampl atctacggtttgtgaatactagaaacctacgacgtgctgcatgccgctgcctcgtagggg
hb01 atctacggtttgtgaatactagaaacctacgacgtgctgcatgccgctgcctcgtagggg
hbw20 atctacggtttgtgaatsctaggaacctacgacgtgctgcatgccgctgcctcgtagggg
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
ace-ampl tagtgaaccggaaccccggtctgagacgaaaccctagatttcagaacattcctcgtgatt
hb01 tagtgaaccggaaccccggtctgggacgaaaccctggatttcggaacattcctcgtgatt
hbw20 tagtgaaccggaaccccggtctgagacgaaaccctagatttcagaacattcctcgcgatt
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
ace-ampl gtcgcascacctttgttcgtcccttctggtggcgtccaagaattc
hb01 gtcgcaacacctttgttcgtcccttctggtggcgtccaagaattc
hbw20 gtcgcaacacctttgttcgtcccttctggtggcgtccaagaattc
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
Sequence table 2: wheat DNA introducing α-
32Make a variation behind the P-dATP
Hhs019 is the original DNA sequence, and hhs107 and hhs108 are the mutagenized dna sequence
hhs019 cccgggcaggtaattcagagaaagagcccccacagatgatagggtatgcggaggaaaaca
hhs107 cccgggcaggtaattcagagaaagagcccccacagatgataggatatgtggaggagaaca
hhs108 cccgggcaggtaattcagagaaagagcccccacaggtgatagggtatgcggaggaaaaca
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
hhs019 atgcggtgttcttcgggacggtcgacgctgactacatggtccatcttgagtcattgcagt
hhs107 atgcggtgttcttcgggacggtcgacgttgactacatggtccatcttgagtcattgcagt
hhs108 atgcggtgttcttcgggacggtcgacgctgactacatggtccatcttgggtcattgcagt
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
hhs019 tcaggaaacttcccaagacaaccatcggttcttactatcatccattcgaagctgtctatg
hhs107 tcaggaaacttcccaagacaactatcggttcttactatcatccattcgaagctgtctatg
hhs108 tcaggaaacttctcaagacaaccatcggttcttactatcatccattcgaagctgtctatg
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
hhs019 ctccaggtactagaatgccttttacattgtggatatatataacaaaaaccgagttttttc
hhs107 ctccaggtactagaatgccttttacattgtggatatatataacaaaaaccgagttttttc
hhs108 ctccaggtactagaatgccttttacattgtggatatatataacaaaaaccgagttttttc
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
hhs019 ttcttacataattggcttattatatgttgttcacattctttcgtgttaacctcggccgcg
hhs107 ttcttacataattggcttattatatattgttcacattctttcgtgttaacctcggccgcg
hhs108 ttcttacataattggcttattatatgttgtttacattctttcgtgttaacctcggccgcg
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
Sequence table 3: wheat DNA introducing α-
32Make a variation behind the P-dCTP
T2 is the original DNA sequence, and hhs028 and hhs025 are the mutagenized dna sequence
t2(ck) cccgggcaggtaattcagagaaagagcccccacagatgatagggtatgcggaggaaaaca
hhs028 cccgggcaggtaattcagagaaagagcccccacagatgatagggtatgcggaggaaaaca
hhs025 cccgggcaggtaattcagaaaaagagcccccacagatgatagggtatgcggaggaaaaca
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
t2(ck) atgcggtgttcttcgggacggtcgacgctgactacatggtccatcttgagtcattgcagt
hhs028 atgcggtgctcttcgggacggtcgacgctgactacatggtccatcttgagtcattgcagt
hhs025 atgcggtattcttagggacggtcgacgctgactacatggtccatcttgggtcattgcagt
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
t2(ck) tcaggaaacttcccaagacaaccatcggttcttactatcatccattcgaagctgtctatg
hhs028 ttaggaaacttcccaagacaaccatcggttcttactatcatccattcgaagctgtctatg
hhs025 tcaggaaacttcccaagacaaccatcggttcttactatcatccattcgaagctgtctatg
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
t2(ck) ctccaggtactagaatgccttttacattgtggatatatataacaaaaaccgagttttttc
hhs028 ctccaggtactagaatgccttttacattgtggatatatataacgaaaaccgagttttttc
hhs025 ctccaggtactagaatgtcttttacattgtggatatatataacaaaaaccgagttttttc
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
t2(ck) ttcttacataattggcttattatatgttgttcacattctttcgtgttaacctcggccgcg
hhs028 ttcttacataattggcttattatatgttgttctcattctttcgtgttaacctcggccgcg
hhs025 ttcttacataattggcttattatatgttgttcacattctttcgtgttaacctcggccgcg
＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊＊
Claims (2)
1. method of utilizing atom destructurizing derived dna sequence polymorphism is characterized in that step is as follows:
1. design of primers: the nucleotide sequence according to source DNA designs the opposite Oligonucleolide primers of a pair of direction;
2. first round pcr amplification (polymerase chain reaction), i.e. α bit strip
32P or
35The introducing of the special triphosphate deoxy-nucleotide of S: with the 1. middle source DNA of step is template, on purpose mixes the α bit strip in reaction substrate
32P or
35The special triphosphate deoxy-nucleotide of S, the special triphosphate deoxy-nucleotide in α position: normal triphosphate deoxy-nucleotide=1: 15, by the PCR reaction the special triphosphate deoxy-nucleotide in α position is introduced in the source DNA sequence, as the primary template of derived dna sequence polymorphism;
3. radioactivity decay: with the pcr amplification product of step in 2., as the primary template of derived dna sequence polymorphism, place and carry out radioactivity decay under the cold condition that is lower than 4 ℃, the time is 1-7 transformation period;
4. second take turns pcr amplification: with the PCR product after the 3. middle decay of step is template, is reaction substrate with all normal triphosphate deoxy-nucleotides, carries out second and takes turns PCR, obtains " diversity dna sequence dna mixture ";
5. dna clone: 4. step second is taken turns pcr amplification product, carry out single dna sequence dna clone, to obtain different " unique DNA " that sequence changes;
6. check order and analyze: different " unique DNA " of step in 5. carried out sequencing analysis; According to sequencing result, by molecular biology software analysis DNA variation situation, the function after the predicted gene variation.
2. according to a kind of method of utilizing atom destructurizing derived dna sequence polymorphism described in the claim 1, it is characterized in that step 5. dna clone when operation, earlier with the pcr amplification product purification kit or take turns pcr amplification product by electrophoresis to second and carry out purifying, and then clone on dna vector.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200510048240XA CN100366752C (en) | 2005-12-28 | 2005-12-28 | Method for deriving mulriple DNA sequences from atom destructurizing |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB200510048240XA CN100366752C (en) | 2005-12-28 | 2005-12-28 | Method for deriving mulriple DNA sequences from atom destructurizing |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1916180A CN1916180A (en) | 2007-02-21 |
| CN100366752C true CN100366752C (en) | 2008-02-06 |
Family
ID=37737243
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB200510048240XA Expired - Fee Related CN100366752C (en) | 2005-12-28 | 2005-12-28 | Method for deriving mulriple DNA sequences from atom destructurizing |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100366752C (en) |
Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1998041653A1 (en) * | 1997-03-18 | 1998-09-24 | Novo Nordisk A/S | An in vitro method for construction of a dna library |
| WO2001046476A1 (en) * | 1999-12-23 | 2001-06-28 | Maxygen, Inc. | Alteration of hydrolase genes and screening of the resulting libraries for the ability to catalyze specific reactions |
| US6303313B1 (en) * | 1990-01-11 | 2001-10-16 | Stratagene | Method for generating libraries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
-
2005
- 2005-12-28 CN CNB200510048240XA patent/CN100366752C/en not_active Expired - Fee Related
Patent Citations (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US6303313B1 (en) * | 1990-01-11 | 2001-10-16 | Stratagene | Method for generating libraries of antibody genes comprising amplification of diverse antibody DNAs and methods for using these libraries for the production of diverse antigen combining molecules |
| WO1998041653A1 (en) * | 1997-03-18 | 1998-09-24 | Novo Nordisk A/S | An in vitro method for construction of a dna library |
| WO2001046476A1 (en) * | 1999-12-23 | 2001-06-28 | Maxygen, Inc. | Alteration of hydrolase genes and screening of the resulting libraries for the ability to catalyze specific reactions |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1916180A (en) | 2007-02-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| Boyer et al. | Phylogeny and genetic variance in terrestrial Microcoleus (cyanophyceae) species based on sequence analysis of the 16s rrna gene and associated 16s–23s its region 1 | |
| Berube et al. | Emergence of trait variability through the lens of nitrogen assimilation in Prochlorococcus | |
| Koch et al. | Comparative evolutionary analysis of chalcone synthase and alcohol dehydrogenase loci in Arabidopsis, Arabis, and related genera (Brassicaceae) | |
| Kapitonov et al. | Molecular paleontology of transposable elements in the Drosophila melanogaster genome | |
| Koukalova et al. | Fall and rise of satellite repeats in allopolyploids of Nicotiana over c. 5 million years | |
| Seutin et al. | Evolution of the WANCY region in amniote mitochondrial DNA. | |
| Lundqvist et al. | Induction of eceriferum mutants in barley by ionizing radiations and chemical mutagens | |
| Kakani et al. | Assessment of genetic diversity in Trigonella foenum-graecum based on nuclear ribosomal DNA, internal transcribed spacer and RAPD analysis | |
| Lang et al. | Phylogeny of Castanea (Fagaceae) based on chloroplast trn TLF sequence data | |
| Thakur et al. | Identification and characterization of SSR, SNP and InDel molecular markers from RNA-Seq data of guar (Cyamopsis tetragonoloba, L. Taub.) roots | |
| Ma et al. | Assembly and comparative analysis of the first complete mitochondrial genome of Acer truncatum Bunge: a woody oil-tree species producing nervonic acid | |
| Ladik et al. | The beginnings of cancer in the cell: an interdisciplinary approach | |
| Gillam et al. | Site-specific mutagenesis using synthetic oligodeoxyribonucleotide primers: II. In vitro selection of mutant DNA | |
| Barbier et al. | Phylogenetic relationships of annual and perennial wild rice: probing by direct DNA sequencing | |
| Dong et al. | Evolutionary directions of single nucleotide substitutions and structural mutations in the chloroplast genomes of the family Calycanthaceae | |
| Graham et al. | Evolutionary significance of an unusual chloroplast DNA inversion found in two basal angiosperm lineages | |
| Wendt et al. | Engineering natural competence into the fast-growing cyanobacterium Synechococcus elongatus strain UTEX 2973 | |
| Chen et al. | Effects of sulfamethoxazole on coupling of nitrogen removal with nitrification in Yangtze Estuary sediments | |
| Smith | Can green algal plastid genome size be explained by DNA repair mechanisms? | |
| Song et al. | Comparison of the microsatellite distribution patterns in the genomes of euarchontoglires at the taxonomic level | |
| CN100366752C (en) | Method for deriving mulriple DNA sequences from atom destructurizing | |
| Bower et al. | Internal repetition and intraindividual variation in the rDNA ITS1 of the Anopheles punctulatus group (Diptera: Culicidae): multiple units and rates of turnover | |
| Coryell et al. | Molecular analysis of hprt mutations generated in Chinese hamster ovary EM9 cells by uranyl acetate, by hydrogen peroxide, and spontaneously | |
| Geleta et al. | Phylogenetics and taxonomic delimitation of the genus Guizotia (Asteraceae) based on sequences derived from various chloroplast DNA regions | |
| Gornung et al. | 5S ribosomal RNA genes in six species of Mediterranean grey mullets: genomic organization and phylogenetic inference |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| C17 | Cessation of patent right | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080206 Termination date: 20131228 |