CN100366748C - High performance genetic transformation method of regeneration system through mediated by agrobacterium tumefaciens for embryo tip soybean - Google Patents
High performance genetic transformation method of regeneration system through mediated by agrobacterium tumefaciens for embryo tip soybean Download PDFInfo
- Publication number
- CN100366748C CN100366748C CNB2004100166126A CN200410016612A CN100366748C CN 100366748 C CN100366748 C CN 100366748C CN B2004100166126 A CNB2004100166126 A CN B2004100166126A CN 200410016612 A CN200410016612 A CN 200410016612A CN 100366748 C CN100366748 C CN 100366748C
- Authority
- CN
- China
- Prior art keywords
- embryo
- soybean
- plant
- gene
- point
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Breeding Of Plants And Reproduction By Means Of Culturing (AREA)
Abstract
The present invention discloses a system of high-efficiency mediated transformation of agrobacteria and a method for producing legume with genetic transformation. The method comprises the steps that: (a) the embryo tips of the legume contact root-nodule agrobacteris for 0.5 to 30 hours at 28 (+/-)2 DEG C; (b) the embryo tips, or the tissue of the embryo tips, or cells of the embryo tips of the legume, which carry marker genes, are selected; (c) the embryo tips, or the tissue of the embryo tips, or cells of the embryo tips of the legume of the step (b) are used for regenerating plants. The method of the present invention can conveniently and rapidly obtain a high transformation rate in low cost mode; the method is used for a basic operating system of soybean genetic engineering; the period is greatly reduced; the transformation rate is increased; the raw material obtaining is convenient.
Description
Technical field
The present invention relates to plant genetic engineering field.Relate more specifically in the soybean gene engineering, by agriculture bacillus mediated, utilize soybean embryo point regeneration system rapidly to carry out high-efficiency genetic transforming method.
Background technology
Soybean is a kind of important oil plant and albumen crop.The genetic transformation of soybean is one of difficult point of plant genetic engineering field always, since Hinchee and McCabe successfully obtain transfer-gen plant with two kinds of different methods soybean transformation respectively, though also, never have breakthrough progress in succession relevant in this respect report.Specifically, the most important is exactly that transformation efficiency does not significantly improve.
Be applied to the method that soybean heredity transforms at present and mainly contain agrobacterium tumefaciens-mediated transformation, particle bombardment ultrasonicly defeatedly helps agrobacterium co-cultivation, the vacuum filtration method, pollen tube introductory technique etc., but wherein obtain widespread use have only agrobacterium tumefaciens-mediated transformation and particle bombardment.Even these two kinds of methods also have certain limitation in application.The efficient conversion that how really to realize soybean remains the subject matter that everybody faces.
Thereby Agrobacterium tumefaciens mediated genetic transformation method is to utilize infect the method that characteristic import foreign gene Plant Genome of agrobacterium tumefaciens to plant.Because of its low copy, integrates complete, inheritance stability and be subjected to the goal gene molecular weight to limit little and be widely used in the genetic transformation of plant, its mechanism that infects to plant also is one of focus of current research.
Though dicotyledons is the natural host of Agrobacterium, just proved that by Pedersoni soybean can be used as the suitable host of Agrobacterium up to nineteen eighty-three.And the first of Agrobacterium success soybean transformation report also be by Hinchee etc. 1988 report.They filter out from more than 100 kinds to the best Peking of Agrobacterium reaction (this also be after frequent adopted kind), with the cotyledon is acceptor material, gus is a reporter gene, screening-gene is npt II, antibiotic-screening through the later stage obtains transfer-gen plant, transformation efficiency is 6%, and the later stage separating experiment has proved that also the external source fragment is that single copy is integrated in transfer-gen plant.This experiment has proved that directly Agrobacterium can mediate the genetic transformation of soybean.
The report of Agrobacterium-mediated Transformation soybean aspect afterwards is mostly based on the work of Hinchee.Twonsand and Thomas have obtained the transfer-gen plant of kind Pioneer9341 with similar methods, and its chief factors of success have 4 points:
1, the use of Syringylethanone because it can induce the activation of Agrobacterium Vir gene, promotes the integration of foreign DNA and Plant Genome;
2, culture temperature 18-28 ℃;
3, bacterial concentration is 10
8～3 * 10
9Individual/ml;
4, added Pyrrolidonecarboxylic acid in the regeneration culture medium.
Di etc. change BPMV (Bean Pool Mottle Virus) clothing albumen over to soybean by agrobacterium-mediated transformation, only have 5 quilts successfully to transform in 400 cotyledonary nodes.
Meurer etc. have groped the influence factor of Agrobacterium-mediated Transformation soybean cotyledon node, find that the cotyledonary node of crossing with supersound process contrasts conversion easily, and the changing effect of agrobacterium strains KYRT1 obviously are better than EHA105 and LBA4404.
As screening-gene, agrobacterium co-cultivation soybean transformation cotyledonary node frequency reaches 3% to Zhang etc. with the Bar gene.
Donaldson etc. are with soybean varieties cotyledonary node of short season of 12 of Agrobacterium-mediated Transformation, and infection rate can reach 92%, but has only obtained the transfer-gen plant of inheritance stability from kind Accolibri, and transformation efficiency is extremely low.
Can be found out that by above report the acceptor material that the Agrobacterium-mediated Transformation method adopts mostly is cotyledonary node greatly, this system is by usefulness aseptic seedling cotyledonary node reported first success regeneration plants such as Cheng.There is its peculiar advantage in this system with respect to other indefinite buds and somatocyte system: (a) can form the plant that takes root in 3 months; (b) regeneration plant that can not educate is few; (c) the explant source is wide, is not subjected to time limitation.But the plant mosaic of system's acquisition is many thus, and later stage screening operation amount is bigger.
In addition, Chee etc. once used 24 hours seed of water logging, removed a slice cotyledon, transformed with Agrobacterium then, had obtained transfer-gen plant, R
0For transformation efficiency is 0.07%, R
1In generation, have 10% to produce the seed that transforms again.Though this method is succinct, transformation efficiency is too low, and does not also see relevant report later on.
Also has a kind of ultrasonic auxiliary Agrobacterium-mediated Transformation method (Sonication-assisted Agrobacterium-mediated transformation, SAAT), the target tissue that adopts is embryonal suspension system, unmature subleaf, cotyledonary node etc., can find under the scanning electron microscope that the acceptor material surface that supersound process is crossed can form many apertures, make Agrobacterium pass through cells of superficial layer and enter deep layer and be more prone to, can significantly improve transformation efficiency.This method makes the acceptor material range extension of Agrobacterium-mediated Transformation method.
Particle bombardment is called the micropellet bombardment method again, adopts by the metal particle (gold or tungsten) of DNA bag quilt and is accelerated cell walls and the cytolemma that passes vegetable cell, and DNA can advance the Plant Genome from metal particle disengaging and random integration then.For the Agrobacterium method.Particle bombardment is subjected to the influence of acceptor material less, and transformation efficiency is high relatively, and easy and simple to handle, the degree of controllability height.But himself shortcoming is also arranged, be not higher than 10kb as the transfer DNA molecular weight, copy number height in Plant Genome easily causes gene silencing etc.
McCabe in reported first in 1988 utilize particle bombardment success soybean transformation bud meristematic tissue to obtain transfer-gen plant, but all be mosaic, after this report adopts this system to carry out the later stage screening by selecting to contain by the plant of transformant, has obtained non-chimeric transfer-gen plant.
Recently,
Deng having adopted a kind of new screening system, transform the stem apex of mature seed immersion after 24 hours by particle bombardment, directly obtained the non-chimeric transfer-gen plant of regenerated.In this system, its screening-gene is the ahas gene, this gene is to separate from Arabidopis thaliana, one sudden change is arranged near 653bp, the product of coding can cause plant to the imidazolone herbicide molecular, the special meristematic zone that is distributed in plant of energy, the activity of inhibition acetohydroxy acid synthetase (acetohydroxy acid synthase), and this enzyme is the phytosynthesis Isoleucine, and leucine and Xie Ansuan are necessary.So non-cell transformed all can not be grown, division.Use this system's transformation efficiency can reach 20.1%, and be non-mosaic, the later stage separation test shows stable being integrated in the Plant Genome of foreign gene.This is to it seems that so far being applied to soybean transforms best system.
Because particle bombardment does not resemble the restriction that is subjected to target tissue the agrobacterium co-cultivation, its report that is applied to other target tissues also occurs subsequently.The McMullen reported first is with particle bombardment transformant somatic embryo sexual cell group and obtained transfer-gen plant, and this system is able to fast development later on, becomes the means that adopt in most of laboratories.Yet, particle bombardment produces a plurality of copy numbers easily in the transfer-gen plant genome, thereby further cause the phenomenon of transgene silencing, and need the expensive relevant device of acquisition price, so those skilled in the art still preferably adopt plants such as agrobacterium-mediated transformation soybean transformation at present.
The somatic embryos of soybean regeneration system rapidly obtains regeneration plant first and is reported in nineteen eighty-three by Christianson.Its explant that adopts is a plumular axis, and the explant that report after this adopts mostly is unmature subleaf and complete rataria greatly.But what really can be applied to transform be the system that Finer etc. is set up, unmature subleaf is placed on contains 40mg/L 2, induce the body embryo on the MS substratum of 4-D, embryonal connective tissue can or contain low-levelly 2 at inducing culture in the succeeding transfer culture process, breeds on the fluid suspension culture base of 4-D.Histologic analysis shows that newborn embryo is distributed in old embryo surface, be easy to transform, but and screen in the liquid medium within, become efficiently owing to the screening medium contact with the high area that can breed embryo to make to screen like this, thereby can overcome chimeric problem.After this many laboratories all adopt this system to obtain non-chimeric transfer-gen plant.Wherein Stewart has reported that in 1996 its Bt gene imports soybean and obtained the transfer-gen plant of pest-resistant evil.
Except agrobacterium tumefaciens mediated method and particle bombardment, also have some other method for transformation.For example, the protoplast regeneration system of Wei and Xu reported first soybean, this system that utilizes Huang Jianqiu etc. adopts improvement PEG method, pBI121 plasmid soybean transformation unmature subleaf protoplastis with band gus gene, transformation efficiency 1%～3% (per-cent that the callus of GUS stably express is arranged), but do not obtain transfer-gen plant.Chowrira is injected into DNA the terminal bud of 7～10 days seedling in containing the solution of lipofectin, electric shock transforms in ring electrode then, obtains transgenic seed under no screening conditions.
Summary of the invention
Purpose of the present invention just provides low, the method for soybean transformation simply, efficiently of a kind of cost.
In a first aspect of the present invention, a kind of fabaceous method that produces genetic transformation is provided, may further comprise the steps:
(a) leguminous plants embryo point is contacted 0.5-30 hour with agrobacterium tumefaciens at 28 ± 2 ℃, described agrobacterium tumefaciens contains the carrier that carries foreign gene and marker gene, thereby foreign gene and marker gene are integrated in leguminous plants embryo taper born of the same parents' the genome;
(b) select leguminous plants embryo point, its tissue or the cell that carries marker gene;
(c) the described leguminous plants embryo of step (b) point, its tissue or cell regeneration are become plant.
In another preference, described method also comprises step:
Whether (d) the regenerated plant is detected its marker gene exists.
In another preference, described leguminous plants embryo point prepares in order to the below method: seeds of leguminous plant under 28 ± 5 ℃, was soaked in sterilized water 24 ± 12 hours, take out the embryo point then from the seed of sprouting.
In another preference, described embryo point has plumular axis.
In another preference, described marker gene is the gus gene.
In another preference, described embryo point is the embryo point of handling through following pre-cultivation: containing on the MSB5 substratum of 2.5-4.5mg/L BAP, and 23～28 ℃ of temperature, illumination 30 ± 10 μ Em
-2s
-1, cultivate 12-36h in advance.
In another preference, described leguminous plants is selected from down group: soybean, peanut.
In another preference, be 6-26 hour the duration of contact in the step (a).
In a second aspect of the present invention, the method for a kind of improved agriculture bacillus mediated generation genetically engineered soybean plant is provided, its improvements are soybean embryo point as by the material of agroinfection.
In a third aspect of the present invention, provide the purposes of leguminous plants embryo point, as the infected material of agriculture bacillus mediated generation transfer-gen plant.
Description of drawings
Fig. 1 has shown the regeneration and the application in the soybean of agrobacterium tumefaciens (A.tumefaciens) mediation transforms thereof of embryo point.Wherein,
(a) be the embryo point of in being supplemented with the MSB5 substratum of 3.5mg/l BAP, cultivating 16 hours;
(b) be the embryo point of in the MSB5 substratum that is supplemented with 0.2mg/l BAP and 0.2mg/l IBA, cultivating 2 days;
(c) be the embryo point of in the MSB5 substratum that is supplemented with 0.2mg/l BAP and 0.2mg/l IBA, cultivating 12 days;
(d) an embryo point can bear six buds again;
(e) through after taking root, regeneration plant can normal growth;
(f) embryo point and Agrobacterium are cultivated the moment expression analysis of gus gene two days later altogether;
(g) recovery of embryo point recovery media was cultivated 5 days and was being selected the stably express analysis of gus gene after 1 week of growth on the substratum.Right for the embryo point that do not infect in contrast;
(h) embryo point recovery media recovered cultivation 5 days and was selecting the stably express analysis of gus gene behind 1 week of the growth back removal epidermis on the substratum;
(i) gus stable gene expression analysis behind the rip cutting embryo point, the right side is the contrast of non-infection;
(j) gus stable gene expression analysis behind the crosscut embryo point, the right side is the contrast of non-infection;
(k) transgenic seedling is growth and elongation on the 100mg/L substratum in kantlex concentration;
(1) transgenic seedling is taken root on root media smoothly;
(m) T
0For the GUS staining analysis of rotaring gene plant blade, the right side be the non-transgenic soybean leaves in contrast;
(m) T
0For the ripe photo of transfer-gen plant, the right side is the non-transgenic soybean.
Fig. 2 has shown T
0Southern engram analysis result for plant.Swimming lane A: total genomic dna HindIII complete digestion, use α then
32The gus probe of P-mark is hybridized.Swimming lane 1,3,4,5 is represented transgenic line 1,3,4,5 respectively.
Embodiment
The inventor is through extensive and deep discovering, the embryo point of soybean is a kind of material that is particularly suitable for genetic transformation.With the embryo point is material, by to the isoparametric optimization of infection time, can obtain very high genetic transformation efficiency.Finished the present invention on this basis.
The present invention is the improvement invention of carrying out at existing agriculture bacillus mediated plant transgenic method, promptly in infecting step, with the sharp vegetable material of the embryo of leguminous plants (as soybean) as agroinfection, and to optimizing with the actual conditions of agroinfection embryo point.As for other steps, for example metainfective vegetable cell or tissue regeneration are become the process of plant, as broad as long with prior art.These steps have description in numerous documents, Trick HN for example, 1997Recent advances in soybeantransformation such as Dinkins RD, Plant Tissue Cult Biotechnol 3:9-26 and Olhoft PM, documents such as Somers DA2001L-Cysteine increases Agrobacterium-mediated T-DNA delivery into soybeancotyledonary-node cells.Plant Cell Rep 20:706-711.
As used herein, " leguminous plants " refers to belong on the plant classification plant of pulse family.Be applicable to that leguminous plants of the present invention is not particularly limited, representational leguminous plants comprises (but being not limited to): soybean, peanut.
With the soybean is example, and the inventive method generally includes following steps:
(1) obtains soybean embryo point
Usually, soybean seeds behind sterilization, is being fit to soak for some time (as 24 ± 12 hours, preferably 24 ± 6 hours) under the temperature (as 28 ± 5 ℃) of germinateing in sterilized water with seeds of leguminous plant, from the seed of sprouting, is taking out the embryo point then.
In addition, in preference,, can carry out pre-treatment to the embryo point in order further to improve the T-DNA transfer efficiency, for example containing on the MSB5 substratum of 2.5-4.5mg/L BAP, 23～28 ℃ of temperature, illumination 30 ± 10 μ Em
-2s
-1, cultivate 12-36h in advance.
(2) Agrobacterium is to the dip-dye of soybean embryo point
Will be with the agrobacterium tumefaciens (described agrobacterium tumefaciens contains the carrier that carries foreign gene and marker gene) of ordinary method preparation, contact for some time (as 0.5-30 hour with soybean embryo point down in the condition (as 28 ± 2 ℃) that is fit to infect, preferably 1-28 hour, more preferably 6-26 hour), thus foreign gene and marker gene are integrated in leguminous plants embryo taper born of the same parents' the genome.
In a preference, concrete reaction conditions is that the crown gall soil Agrobacterium bacterial strain EHA105 that will contain binary vector pCAMBIA2301 is cultured to OD on substratum
600=1.3, thalline is resuspended with the liquid nutrient medium of culturing embryo point through centrifugal back.Then, the embryo point bacterium liquid of putting into resuspended mistake was cultivated 20 hours on 28 ℃ of shaking tables.
(3) regeneration plant
The process of the embryo point regeneration plant of contaminating is not particularly limited available this area ordinary method.
For example, for the common cultivation of explant, recover to cultivate and the screening step for, a kind of preferred method for example is, transfers in culture medium (pH 5.8) altogether 25 ℃ of dark cultivations 5 days after metainfective embryo point can being blotted with aseptic filter paper.Transfer and on the recovery media of no selective agent, recovered 5-7 days, forward on the screening culture medium then and cultivate, wait for that resistant buds grows (when marker gene is resistant gene).
For resistant buds take root and transplant for, a kind of preferred method is to wait resistant buds to grow to 3-5 centimetre its cutting-out gone to root media, with long be transplanted to when enough strong grow in the controlled environment chamber in the soil solid.
In addition,, authentication method suitable in this area can be selected for use, for example when marker gene is the gus gene, the GUS staining analysis can be carried out according to the difference of marker gene.A kind of method is to get 2 days embryo point of common cultivation, 5 days embryo point of growth on recovery media, and the embryo point in one week of growth on screening culture medium, that resistant soybean blade of card in artificial growth is immersed in respectively in the X-Gluc solution and dyes,
In addition, when regeneration plant carried out Molecular Identification, the seedling leaf of desirable transplanting extracted total DNA, respectively gus gene was carried out PCR and identified, the blade of PCR positive plant carries out GUS dyeing and Southern hybridization analysis.
Major advantage of the present invention is:
(a) transformation efficiency height;
(b) draw materials conveniently;
(c) cycle shortens greatly;
(d) simple to operate, need not to add too much annexation;
(e) cost is low;
(f) need not special selective agent.
Below in conjunction with specific embodiment, further set forth the present invention.Should be understood that these embodiment only to be used to the present invention is described and be not used in and limit the scope of the invention.The experimental technique of unreceipted actual conditions in the following example, usually according to people such as normal condition such as Sambrook, molecular cloning: laboratory manual (New York:ColdSpring Harbor Laboratory Press, 1989) and " plant tissue culture handbook (Shanghai science tech publishing house, nineteen ninety publishes) described in condition, or the condition of advising according to manufacturer.
Embodiment 1
The foundation of soybean embryo point high-efficiency regeneration system
Soybean (Glycine max L) kind comprise close rich 35, close rich 39, east farming 42, east farming 163, east farming 211, the farming 10 of pacifying, the farming 14 of pacifying, the farming 16 of pacifying, black farming 37, black farming 40, Fen 45, Fen 50, the Shanxi loses 19.These kinds all are can buy on the market, for example can be available from Heilungkiang seeds company.
Get the soybean mature seed of smooth surface non-variegation spot, put into the encloses container that contains the chlorine that generates by 30%NaClO (clorox)+20%HCl reaction, take out after 2-6 hour and put to the sterilized water 28 ℃ and soak 24h.Then the cotyledon of the seed of sprouting is removed, get the embryo point of band plumular axis, be seeded to the substratum that contains different 6-phenmethyl aminopurines (BAP) concentration respectively and (adopt inorganic salts concentration (the Murashige T of conventional MS minimum medium, Skoog F 1962A revised medium for rapid growth and bioassayswith tobacco tissue cultures, Physiol Plant 15:473-497), and organic element composition (the Gamborg OL of all additional conventional B5 medium, Miller RA, Ojiama K 1968Nutrientrequirements of suspension cultures of soybean root cells, Exp Cell Res 50:151-158)), pH5.6-7.0, sucrose 30g/L, solid medium adds 0.6% agar, culture condition: 23～28 ℃ of temperature, illumination 30 μ Em
-2s
-1Illumination 16h.Go to the same base basal culture medium after 24 hours but BAP and indole-3-butyric acid (IBA) concentration is on the substratum of 0.2mg/L, the bud numbers on 4 week each explant of back statistics.
The result is as shown in table 1, proves that BAP 3.5mg/L is an optimum concn.
Table 1BAP concentration is to the influence (incubation time is 24h) of soybean embryo point regeneration bud
| Substratum BAP concentration (mg/L) | Embryo point regeneration bud number (bud number/stem apex) |
| 1.0 2.0 2.5 3.0 3.5 4.0 5.0 | 1.5 2.6 3.4 4.8 5.4 3.5 2.1 |
Agrobacterium is to the dip-dye of soybean embryo point
Picking contains the single colony inoculation of binary vector pCAMBIA2301 Agrobacterium EHA105 (available from Cambia company) in the 5ml YEP of kantlex 100mg/L concentration liquid nutrient medium, 28 ℃ of shaking table overnight incubation, bacterium liquid goes in the 50ml YEP kantlex 100mg/L substratum and shakes to OD then
600=1.3, thalline is resuspended in additional 6mg/l BAP of 1/2MSB5 liquid nutrient medium and 100 μ M Syringylethanones after 3000rpm is centrifugal 10 minutes, and OD600 is adjusted to 0.5.MSB5 substratum (BAP=3.5mg/L) go up to cultivate 24 hours embryo point in above-mentioned substratum 28 ℃ press table 2 incubation time and cultivate, forward to then on the common culture medium, by transfer enters soybean embryo point to T-DNA the influence of experimental infection time afterwards.
The result is as shown in table 2, shows that 0.5-30 hour infection time all can obtain effectively T-DNA transfer efficiency, and wherein 20 hours incubation time can obtain the transfer efficiency 78.2% of maximum T-DNA.
| Table 2 infection time shifts the influence that enters soybean embryo point to T-DNA | |||||
| Experiment numbers | Infection time (h) | The embryo point number that infects | The kalamycin resistance explant number that reclaims | Express the explant number of gus gene | The T-DNA transfer efficiency a(％) |
| 1 2 3 4 5 6 7 8 9 | 0.1 0.2 0.5 1.5 6 12 20 26 30 | 25 24 26 30 28 23 23 26 24 | 4 7 10 13 17 15 19 12 10 | 3 4 6 11 15 14 18 11 10 | 12.0 16.7 23.1 36.7 53.6 60.8 78.2 42.3 41.7 |
| aT-DNA transfer efficiency=(expressing the embryo point number of the explant number/infection of gus gene) * 100 | |||||
Embodiment 3
The common cultivation of explant, recovery are cultivated and screening
Metainfective embryo point is transferred to (1/2MSB5 (pH 5.8) on the common culture medium after on the aseptic filter paper bacterium liquid being blotted, 0.6% agarose, 6mg/l BAP, 100 μ M Syringylethanones), secretly cultivated 5 days, transfer to (1/2MSB5 on the recovery media after cleaning with sterilized water, 0.6% agarose, 0.2mg/LBAP, 0.2mg/l IBA, 300mg/L cephamycin) and glazing cultivated 5-7 days down.Culture condition: 25～28 ℃ of temperature, illumination 30 μ Em
-2s
-123～27 ℃ of culture temperature, illumination 16h.Recover to cultivate the back embryo point is transferred to cultivation (1/2MSB5,0.2mg/L BAP, 0.2mg/l IBA, 300mg/L cephamycin, 300mg/L Pyocianil, 100mg/L kantlex) on the screening culture medium, per 10 days subcultures once.
F among result such as Fig. 1, g, h, i is shown in the j.
Microscopically is observed, and finds that meristematic zone that gus gene moment is expressed in the tip of a root and embryo point expresses strongly, and stably express analysis revealed transgenic seedling can be born again from embryo point zone, and T-DNA reaches 78.2% to the transition frequency of explant.With reference to Fig. 1.
Embodiment 4
The taking root and transplant of resistant buds
Grow to 3-5 centimetre Deng resistant buds its cutting-out gone to root media (1/2MSB5,0.2mg/L BAP, 1.0mg/lIBA, the 300mg/L cephamycin, 300mg/L Pyocianil, 25mg/L kantlex), root is long be transplanted to when enough strengthening grow in the controlled environment chamber in the soil solid.
The result is shown in n among Fig. 1.
Embodiment 5
The GUS staining analysis
Get 2 days embryo point of common cultivation, 5 days embryo point of growth on recovery media, the embryo point in one week of growth on screening culture medium, that resistant soybean blade of card in artificial growth is immersed in X-Gluc solution respectively and (contains EDTA 10mmol/L, sodium phosphate buffer 100mmol/L, yellow prussiate of potash 0.5mmol/L, high-potassium ferricyanide 0.5mmol/L, 20% methyl alcohol (V/V) and 0.1%X-Gluc) in, see after 37 ℃ of a few hours and look into.
The result is shown in m among Fig. 1.
Embodiment 6
The Molecular Identification of resistant buds
Get that resistant soybean blade of card of phytotron growth, the extraction of DNA is carried out according to the cold phenol method of routine, method is as follows:, add 6mL and extract damping fluid (1M Tris-HCl (pH9.0), 50mM EDTA to powdery with the liquid nitrogen grinding material, 1%SDS), mixing adds isopyknic water-saturated phenol: chloroform again: primary isoamyl alcohol (25: 24: 1), mixing, in leaving standstill 1 hour on ice, shook up once every 10 minutes.12000rpm4 ℃ centrifugal 10 minutes, get supernatant, add isopyknic phenol: chloroform: primary isoamyl alcohol, left standstill on ice 5 minutes; Continue to use phenol: chloroform: primary isoamyl alcohol, till not having albumen between organic phase and the water.Add isopyknic chloroform: primary isoamyl alcohol (24: 1), centrifugal 10 minutes of 4 ℃ of 12000rpm get supernatant, add the high level salt solution (0.8M Trisodium Citrate, 1.2M NaCl) of 0.5 times of volume and the Virahol of 0.5 times of volume, mixing, put-70 ℃ 30 minutes.4 ℃ of 12000rpm removed supernatant in centrifugal 10 minutes, and precipitation is dissolved in 100 μ LddH
2Among the O, handle, use phenol again: chloroform: promptly obtain very pure genomic dna behind primary isoamyl alcohol extracting, the ethanol sedimentation, be dissolved in 100 μ LddH with RNAaseA
2O, the leakage of electricity swimming is also measured OD
260/ OD
280Be worth, determine quality and the concentration of total DNA; The dehydrated alcohol that adds 2.5 times of volumes is stored in-70 ℃, and time spent precipitation is got and is used for PCR in right amount and identifies or carry out enzyme and cut and do Southern hybridization.
PCR identifies
Two primers are respectively (CGACGGCCTGTGGGCATTCA and TGGTCGTGCACCATCAGCAC).
PCR reaction system: MgCl
2(10 *) 3 μ l, PCR reaction buffer (10 *) 3 μ l, dNTPs (each 2.5 μ M) 3 μ l, E61 (25 μ M) 0.5 μ l, E62 (25 μ M) 0.5 μ l, template (0.1 μ g/ μ l) 1 μ l, bovine serum albumin (10mg/ml) 0.3 μ l, Taq archaeal dna polymerase (5U/ μ l) 0.3 μ l adds water to 30 μ l at last.
PCR reaction conditions: 94 ℃ of pre-sex change 10 minutes; 94 ℃ of sex change are 40 seconds then, and 54 ℃ of renaturation 30 seconds were extended 30 seconds, 30 circulations totally; At last, 72 ℃ were extended 7 minutes.
The Southern engram analysis
(a) enzyme of genomic dna cut, electrophoresis and commentaries on classics film
Every sample is got 40 μ gDNA and is used Hind III respectively, treat the DNA complete degestion after, 0.8% agarose gel electrophoresis, cut unnecessary gel, 0.25M HCl soaks 20min, washing adds sex change liquid (1.5M NaCl, 0.5M NaOH), in room temperature jog sex change 45min, of short duration washing adds neutralizer (1.5M NaCl, 0.5MTris-HCl, pH7.0) in the room temperature and 30min.With 20 * SSC serves as to shift liquid, inhales the seal method with kapillary and changes film 12-16 hour, and DNA is transferred on the Hybond-XL film, and with sample hole site on the pencil mark, the of short duration rinsing of 6 * SSC, 80 ℃ of bakings are fixed 2 hours, and are standby.
(b) probe mark:
PCR (CGACGGCCTGTGGGCATTCA and TGGTCGTGCACCATCAGCAC) is behind electrophoresis, rubber tapping purifying, and the PCR product of getting 25ng is as the template label probe.The mark of probe uses Prime-a-Gene Labeling System (Promega), marked body be 50 μ L (mix α-
32P-dCTP), 37 ℃ of temperature were bathed 1 hour.The probe of mark is with QIAquick Nucleotide Removal Kit (Takara company) purifying.
(c) prehybridization and hybridization
Commentaries on classics there is total DNA nylon membrane, immerses in the 10mL prehybridization solution 42 ℃ of prehybridization 2-4h in hybrid heater.With the probe after the sex change, all add in the above-mentioned prehybridization solution 42 ℃ of hybridization 24h.
Prehybridization solution: 50% (W/V) methane amide, 5 * SSC, 5 * Denhardt reagent, 1% (W/V) SDS, the milt DNA of 100 μ g/ml sex change.
(d) wash film and compressing tablet
Hybridization is poured out hybridization solution after finishing.Wash film according to following program:
1) 2 * SSC, 0.1%SDS room temperature washing twice, each 5min.
2) 0.2 * SSC, 0.1%SDS room temperature washing twice, each 5min
3) 0.2 * SSC, 42 ℃ of washed twice of 0.1%SDS, each 15min.
4) 2 * SSC, the of short duration rinsing of room temperature.
Film is placed on the paper handkerchief, to remove most of liquid.Film is wrapped up smooth being pressed under the X-ray sheet, additional intensifying screen ,-70 ℃ of times that exposure is suitable with preservative film.According to ordinary method towards X-ray sheet developing.
(e) remove probe from nylon membrane
500 milliliters of 0.05 * SSC/0.01M EDTA are heated to boiling, and clump is removed this liquid on the well heater, and add SDS to final concentration be 0.1%, film was soaked in wherein 15 minutes.Repeat above-mentioned steps., be placed on the stacker towel in the of short duration rinsing film of room temperature with 0.1 * SSC, to remove most of liquid on the striping.Film is sandwiched between two preservative films, is pressed under the X-ray sheet, check whether all probes all are removed.Film is dried, rise, deposit stand-by in room temperature with the loose bag of aluminium foil.
The result as shown in Figure 2, foreign gene has been integrated in the soybean gene group.
Experimental result to various soybean lines is summarized in table 3 (wherein, infection time is 20 hours).
| The soybean transformation efficiency of table 3 agrobacterium tumefaciens mediation | |||||
| Experiment numbers | Strain | The embryo point number that infects | The kalamycin resistance explant number that reclaims | The explant number of regeneration PCR positive plant | Transfer efficiency a (％) |
| 1 2 3 | Hefeng 35 Hefeng 35 Hefeng 35 | 55 43 39 | 42 37 32 | 5 4 4 | |
| Add up to | 137 | 111 | 13 | 11.7 | |
| 4 5 6 | Dongnong 42 Dongnong 42 Dongnong 42 | 32 29 65 | 28 26 59 | 2 3 4 | |
| Add up to | 126 | 113 | 9 | 8.0 | |
| 7 8 9 | Hefeng 39 Hefeng 39 Hefeng 39 | 35 34 40 | 33 30 38 | 3 6 7 | |
| Add up to | 109 | 101 | 16. | 15.8 | |
| aTransfer efficiency=(the explant number of the explant number/infection of regeneration PCR positive plant) * 100 | |||||
All quote in this application as a reference at all documents that the present invention mentions, just quoted as a reference separately as each piece document.Should be understood that in addition those skilled in the art can make various changes or modifications the present invention after having read above-mentioned teachings of the present invention, these equivalent form of values fall within the application's appended claims institute restricted portion equally.
Claims (8)
1. a fabaceous method that produces genetic transformation is characterized in that, may further comprise the steps:
(a) leguminous plants embryo point is contacted 0.5-30 hour with agrobacterium tumefaciens at 28 ± 2 ℃, described agrobacterium tumefaciens contains the carrier that carries foreign gene and marker gene, thereby foreign gene and marker gene are integrated in leguminous plants embryo taper born of the same parents' the genome;
(b) select leguminous plants embryo point, its tissue or the cell that carries marker gene;
(c) the described leguminous plants embryo of step (b) point, its tissue or cell regeneration are become plant.
2. the method for claim 1 is characterized in that, also comprises step:
Whether (d) the regenerated plant is detected its marker gene exists.
3. the method for claim 1 is characterized in that, described leguminous plants embryo point prepares in order to the below method: seeds of leguminous plant under 28 ± 5 ℃, was soaked in sterilized water 24 ± 12 hours, take out the embryo point then from the seed of sprouting.
4. method as claimed in claim 3 is characterized in that, described embryo point has plumular axis.
5. the method for claim 1 is characterized in that, described marker gene is the gus gene.
6. the method for claim 1 is characterized in that, described embryo point is the embryo point of handling through following pre-cultivation: containing on the MSB5 substratum of 2.5-4.5mg/L BAP, and 23～28 ℃ of temperature, illumination 30 ± 10 μ Em
-2s
-1, cultivate 12-36h in advance.
7. the method for claim 1 is characterized in that, described leguminous plants is selected from down group: soybean, peanut.
8. the method for claim 1 is characterized in that, be 6-26 hour the duration of contact in the step (a).
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100166126A CN100366748C (en) | 2004-02-27 | 2004-02-27 | High performance genetic transformation method of regeneration system through mediated by agrobacterium tumefaciens for embryo tip soybean |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2004100166126A CN100366748C (en) | 2004-02-27 | 2004-02-27 | High performance genetic transformation method of regeneration system through mediated by agrobacterium tumefaciens for embryo tip soybean |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1661021A CN1661021A (en) | 2005-08-31 |
| CN100366748C true CN100366748C (en) | 2008-02-06 |
Family
ID=35010571
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2004100166126A Expired - Fee Related CN100366748C (en) | 2004-02-27 | 2004-02-27 | High performance genetic transformation method of regeneration system through mediated by agrobacterium tumefaciens for embryo tip soybean |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100366748C (en) |
Families Citing this family (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN104206269B (en) * | 2013-06-05 | 2016-12-28 | 中国科学院上海生命科学研究院 | Soybean transgene strain mixing rooting method |
| CN106978435A (en) * | 2016-01-18 | 2017-07-25 | 中国科学院上海生命科学研究院 | A kind of method for the transgenosis frequency for improving soybean |
| CN106636196B (en) * | 2017-02-21 | 2019-11-19 | 辽宁省农业科学院大连生物技术研究所 | A kind of peanut method of optimization, efficient mediated by agriculture bacillus |
| CN110358791A (en) * | 2019-08-15 | 2019-10-22 | 江苏省农业科学院 | Mung bean genetic transforming method |
Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000042207A2 (en) * | 1999-01-14 | 2000-07-20 | Monsanto Technology Llc | Soybean transformation method |
-
2004
- 2004-02-27 CN CNB2004100166126A patent/CN100366748C/en not_active Expired - Fee Related
Patent Citations (1)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2000042207A2 (en) * | 1999-01-14 | 2000-07-20 | Monsanto Technology Llc | Soybean transformation method |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1661021A (en) | 2005-08-31 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| CN101948867B (en) | Agrobacterium-mediated jatropha curcas gene transformation method | |
| CN101457235B (en) | Method for converting lucerne by vacuum penetrating aided agrobacterium-mediation | |
| CN102220277B (en) | Method for building high-efficiency regenerating and transforming system of Oryza sativaL. subsp. japonica 11 | |
| CN102296086B (en) | Agrobacterium tumefaciens-mediated barley mature embryo callus transformation method | |
| CN104059937B (en) | One protein deriving from Herba Medicaginis and the new application of encoding gene thereof | |
| CN103444524B (en) | Method for quickly building genetic transformation regeneration system of grapes | |
| CN106480163B (en) | A method of joint apple callus cell culture and genetic transformation identify apple disease-resistant gene | |
| CN100575494C (en) | A kind of composition that is used for the conversion of plant direct gene | |
| CN102586317B (en) | Method for transforming and cultivating citrus transgenic plant by agrobacterium-mediated leaf | |
| CN101186926A (en) | Modified method for transforming gramineous crop by agrobacterium mediation flower-dipping method | |
| CN102191269B (en) | Non tissue culture gene transferring method by using half of peanut seed as acceptor | |
| Chen et al. | Agrobacterium-mediated genetic transformation of peanut and the efficient recovery of transgenic plants | |
| CN100366748C (en) | High performance genetic transformation method of regeneration system through mediated by agrobacterium tumefaciens for embryo tip soybean | |
| CN102492721A (en) | Sesame genetic transformation method mediated by agrobacterium | |
| CN110305894B (en) | Rapid and efficient catalpa bungei genetic transformation method | |
| CN102499075A (en) | Method for preparation of soybean composite explants and method for preparation of rapidly transgenic soybean plants by using the same | |
| CN107058382A (en) | The preparation method of transgenosis coniferous tree plant | |
| CN1597969A (en) | Double T-DNA carrier and its application in cultivating of non selecting sign transgene rice | |
| CN1324141C (en) | Method for cultivating transgenic plant without selective marker and its special expression vector | |
| CN106636099A (en) | Citrus fruit specificity promoter and application | |
| CN102286527A (en) | Genetic transformation method for DREB (Dehydration Responsive Element Binding) gene transformation Anthurium | |
| CN114149996B (en) | Application of GhAIL6 gene in promoting cotton embryogenic callus formation | |
| CN113528535B (en) | Orphan gene PpDRO for improving stress resistance of plants and application thereof | |
| CN101979602B (en) | Method for ultrasonic-assisted agrobacterium tumefaciens-mediated in planta genetic transformation of plants | |
| CN104871972B (en) | The high frequency regenerating system method for building up that effectively control watermelon adventitious bud water stainization phenomenon occurs |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080206 Termination date: 20180227 |
|
| CF01 | Termination of patent right due to non-payment of annual fee |