CN100366637C - Human interleukin 8 antagonist protein and preparation method thereof - Google Patents
Human interleukin 8 antagonist protein and preparation method thereof Download PDFInfo
- Publication number
- CN100366637C CN100366637C CNB2005100963734A CN200510096373A CN100366637C CN 100366637 C CN100366637 C CN 100366637C CN B2005100963734 A CNB2005100963734 A CN B2005100963734A CN 200510096373 A CN200510096373 A CN 200510096373A CN 100366637 C CN100366637 C CN 100366637C
- Authority
- CN
- China
- Prior art keywords
- rmhil
- protein
- cell
- pcr
- expression
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Abstract
The present invention discloses a recombination mutation human cell medium element 8 protein and a preparation method thereof. In the method, active site ELR mutations in natural human IL-8 genes are used as AAR for constructing antagonism protein genes rmhIL-8 which can be combined with receptors being competitive with natural IL-8; the antagonism protein genes rmhIL-8 are expressed with high efficiency in escherichia coli and are purified for obtaining rmhIL-8 proteins; the chemotaxis activity of IL-8 can be inhibited through the competitive combination of mutants to receptors for reaching the function for treating inflammation diseases. The human cell medium element 8 antagonist protein of the present invention possibly provides a new protein medicine for the treatment of acute inflammation and chronic inflammation.
Description
Technical field
The purifying of the expression of the gene clone, gene recombination, foreign gene that the invention belongs to the medical biotechnology field in prokaryotic cell prokaryocyte, target protein, human interleukin 8 antagonist protein are in external technology such as restraining effect to natural human interleukin 8 chemotactic activity, relate to a kind of anti-inflammatory medicaments albumen and preparation method thereof, particularly can with mutain of the competitive bind receptor of natural human interleukin 8 and preparation method thereof.
Background technology
1.IL-8 correlative study
(Interleukin-8 is a kind of chemokine that can activate neutrophilic granulocyte IL-8) to interleukin 8, is to find in the monocyte supernatant liquor that is activated at first, is named as IL-8 in 1989 one time world's cytokine meeting.IL-8 belongs to the C-X-C class chemokine of chemokine family, is produced by mononuclear macrophage, can induce multiple leukocyte chemotaxis motion.
1.1IL-8 structure and characteristics
(Interleukin-8 is a kind of chemokine that can activate neutrophilic granulocyte IL-8) to interleukin 8, is a kind of base-heparin binding proteins matter with endogenous leucocyte chemotaxis and reactivity effect.IL-8 is a kind of material with NCA of finding in the monocyte supernatant liquor that is activated at first, is named as IL-8 in 1989 one time world's cytokine meeting.IL-8 belongs to the C-X-C class chemokine of chemokine family, is produced by mononuclear macrophage, can induce multiple leukocyte chemotaxis motion.IL-8 has different isomer, reduces the amino acid of different numbers respectively at the N end.The at first synthetic IL-8 precursor protein of cell is I type IL-8 (99 peptides, 20 amino-acid residues of N end are formed highly hydrophobic signal peptide), again by the different sites of the direct enzymolysis IL-8 of different specific proteases precursor N end, produces the IL-8 of different molecular weight.The mature form of IL-8 has 4 kinds, promptly is made up of 72 (70%), 77 (17%), 70 (8%) and 69 (5%) amino-acid residues respectively.Wherein III type IL-8 is 72 peptides, and activity is the strongest, i.e. the ripe IL-8 of common indication.Its molecular weight has only 8Kd (SDS-PAGE), and (7-34 9-50), does not have glycosylation site, and iso-electric point (PI) is 8～8.5 to contain two essential disulfide linkage of activity.IL-8 is to trypsinase and Chymotrypsin sensitivity, and heat-resisting, acidproof, handles in 60 minutes for 70 ℃ and can not make it deactivation, keeps stable between pH2.4～9.0.Nucleus magnetic resonance proves with the X crystalline diffraction: the IL-8 in the solution is the homodimer that non covalent bond is connected, dimeric interface is based on the β lamella, the hydrogen bond that forms between Leu25, Val27, the Glu29 participates in dimeric stability, and αLuo Xuanjiegou also forms relevant with dimer with intersecting of β lamella.The ELR of IL-8 (Glu4-Leu5-Arg6) structure is relevant with short angiogenic effect with its activation neutrophil leucocyte, C-X-C chemokines such as the PF-4 of no ELR, IP-10 can not activate neutrophil leucocyte and have blood vessel formation against function, but, have the GRO of ELR structure but to suppress vasculogenesis.IL-8C end (Lys54～C end) is the site in conjunction with the poly-glycosamine of capillary vessel posterior vein endothelial cell surface, and the leukocyte adhesion that this combination can promote to roll in blood vessel surface is in endotheliocyte, and further passes blood vessel.
1.2IL-8 generation and adjusting
Many cells can both produce IL-8 after suitably stimulating, comprise mononuclear macrophage, lymphocyte, neutrophil leucocyte, eosinophilic granulocyte, medullary cell precursor, synovial cell, smooth muscle cell, endotheliocyte, epithelial cell, keratinocyte, chondrocyte, mesothelial cell, amnion cell, stellate cell, messangial cell and liver cell.Some tumor cell lines also can produce IL-8, for example: the large cell carcinoma cell of melanoma cell, fibrosarcoma cell, lung, osteosarcoma cell etc.
The generation that many different factors all can be induced IL-8.The inductor that can induce monocyte to produce IL-8 that people find the earliest is LPS, found afterwards that IL-1 β and TNF-α etc. also can induce some cells to produce IL-8, but LPS is the strongest to monocytic effect, and the effect of inducing IL-8 to express of IL-1 β and TNF-α is the strongest in most cell types.PHA can produce IL-8 by inducer T lymphocyte.Pulmonary alveolar macrophage and endotheliocyte stimulate through LPS also can express IL-8.Interleukin-17 induces epithelial cell, endotheliocyte and inoblast etc. to produce IL-8.In a word, dissimilar cell is inequality to the reaction of different inductors.
After being subjected to adequate stimulus, cell can be expressed IL-8mRNA soon.Use isotope-labeled oligonucleotide probe or IL-8cDNA probe and do Northern hybridization, find behind irriate, can detect specificity IL-8mRNA in the 1h.If before stimulating, handle endotheliocyte, can superpowerly induce the expression of IL-8mRNA with actidione.Illustrate that IL-8 genetic expression does not rely on the synthetic of some intracellular protein, but under a kind of control of aporepressor.Laminar flow hangs down shearing stress (back venule level) and acts on 1h after the Human umbilical vein endothelial cells of vitro culture, IL-8mRNA expresses and obviously increases simultaneously with the gene syncaryon factor (Nuclear-factor-genebinding in the cell, NF-к B) activation, the activation degree is relevant with action time.2h reaches peak value, begins during 3h to descend, and IL-8mRNA continues low the expression behind the 4h, presents IL-8mRNA with the shearing stress two-phase Changing Pattern of action time.Low shearing stress can be expressed IL-8 by inducing endothelial cell, may participate in generation, development and the prognosis process of diseases associated with inflammation and cardiovascular and cerebrovascular diseases.
1.3L-8 acceptor
IL-8 plays a role by acceptor.The IL-8 acceptor is all arranged on nearly all cell.There is not cross reaction between IL-8 and other neutrophil leucocyte chemotactic substances.Two kinds of high-affinity receptors (Kd=0.2～1.2nmol/L): CXCR1 (IL-8R α, IL-8R I or IL-8A) and CXCR2 (IL-8R β, IL-8RII or IL-8B) is arranged, both aminoacid sequences have 77% homology, all belong to gtp binding protein (G albumen) the associated receptor superfamily that 7 transmembrane domains are arranged.CXCR1 contains 350 amino acid, and its extracellular part has 5 glycosylation sites, a disulfide linkage and two free Cys sulfydryls, the about 40kD of molecular weight, 55～69kD after the glycosylation.CXCR2 contains 355 amino acid, has only 5 glycosylation sites, the about 59kD of molecular weight.CXCR1 combines with the IL-8 specificity, low with other C-X-C chemokine avidity, and CXCR2 also can high-affinity in conjunction with NAP-2, GRO-α, GRO-β etc., the heterogeneity of IL-8 receptors bind part depends on the acceptor molecule N-terminal, there is approaching free sulfhydryl groups on two conformations in the zone of receptors bind IL-8, and they are in conjunction with active necessary.Two kinds of IL-8R genes and an IL-8R pseudogene all are positioned at human chromosome 2q34-35.Also have the IL-8 of a kind of 39kD conjugated protein or claim that (Duffyantigenreceptorforchemokines DARC), also is that Duffy blood group antigen and mediation Plasmodium vivax enter erythrocytic molecule for the Duffy antigen receptor of chemokine on the erythrocyte membrane.Other C-C and C-X-C chemokine also can be in conjunction with this receptors, and can vie each other with IL-8.In the brain, the capillary vessel posterior vein endotheliocyte of kidney and spleen is all expressed DARC.
1.4IL-8 biologic activity
IL-8 selective induction neutrophil leucocyte, T lymphocyte and basophilic granulocyte chemotactic, and eosinophilic granulocyte and monocyte are not had chemotaxis.
IL-8 can strengthen the function of neutrophil leucocyte: induce neutrophil leucocyte to take off particle, the beta glucuronidase in the release particles, elastoser, myeloperoxidase, collagenase B, vitamins B
12Conjugated protein and lactoferrin; Stimulate the interior calcium ion of endochylema to increase fast; Induce respiratory burst to produce super oxidative ionic and hydrogen peroxide.When exogenous arachidonic acid is arranged, IL-8 with C5a, FMLP, PAF is the same can activate arachidonic acid in the neutrophil leucocyte-5-lipoxidase, discharges LTB
4(leukotriene B
4).IL-8 can stimulate neutrophil leucocyte to engulf the conditioning particle, and strengthens neutrophil leucocyte indirectly to the oidiomycetic growth-inhibiting effect of white.IL-8 can suppress the adhesion of neutrophil leucocyte pair cell factor activated endothelial cells individual layer, prevents the damaging action of neutrophil leucocyte to endotheliocyte; High dosage IL-8 then strengthens the ability that neutrophil adhesion does not activate endotheliocyte.IL-8 induces neutrophil leucocyte to express L and selects element, CD11a/CD18 and CD11b/CD18 molecule, promotes the cell adhesion endothelial cell monolayer and passes vessel wall.After neutrophil leucocyte heparin-binding or the heparin sulfate to the increased response of IL-8.
IL-8 has different reports to the chemotaxis of T cell: stronger 10 times than neutrophil leucocyte, equate or can not chemotactic T cell; T cell to the IL-8 reaction is activated T cell or little T cell.IL-8 can selectivity suppress IL-4 inductive B cell generation IgE.
IL-8 can induce the basophilic granulocyte chemotactic through GM-CSF or IL-3 processing, and an atopy inflammation and allergic asthma patient's periphery basophilic granulocyte strengthens the chemotactic response of IL-8.
IL-8 can induce IL-2 activated NK cell chemotaxis, induces the melanoma cell contact to move, and promotes the endotheliocyte chemotactic.IL-8 induces keratinocyte and melanocyte propagation and chemotactic.IL-8 can enter periphery from marrow by the stimulatory function hematopoietic cell, but suppresses the increment of marrow sample hemopoietic forebody cell.IL-8 also can generate by induction of vascular.
In vivo, local injection IL-8 can increase the permeability of blood vessel, induces neutrophil leucocyte, lymphocytic infiltration.Intradermal injection IL-8 causes blood plasma to ooze out with neutrophil leucocyte accumulating in the part, and that two kinds of reactions take place is fast, the time length is short, and anti-leucocyte integrin antibody suppresses these effects.IL-8 inductive Histological injury comprises that neutrophil leucocyte accumulates in blood vessel, grumeleuse forms and vascular damaged.
Animal intravenous injection IL-8 causes oligoleukocythemia immediately, is the neutrophil leucocyte mass formed by blood stasis of long period then, discharges from marrow with the neutrophil leucocyte in each stage.IL-8 inductive neutrophil leucocyte mass formed by blood stasis has vital role to anti-infectious non-specific protection in the body.The adhesion of neutrophil leucocyte and vascular endothelial cell can cause the whole body vascular effect equally: neutrophil leucocyte gathers, grumeleuse forms and vascular damaged.
Rat toe compression test proves that IL-8 is one of medium of sympathetic nerve pain.Except short inflammatory effector, IL-8 also has the growth regulating effect: promote rat cornea medium vessels nucleus formation, induce rabbit corneal capsule model to produce new blood vessel, start endothelial cell proliferation and increase neuron survival time etc.
1.5IL-8 the mechanism of action
After IL-8 and its receptors bind, the ligand-receptor mixture is by endocytosis, and acceptor recirculation then reappeared at surface of cell membrane rapidly in 60 minutes, and the recirculation of blocking its acceptor can cause the weakening of chemotactic response of IL-8 mediation.Activate acceptor coupling the G albumen, particularly G of Toxins, pertussis sensitivity after IL-8 and the receptors bind
α iAlbumen.G albumen is dissociated into G after converting GTP bonded form to
αWith G β
γTwo subunits.G β wherein
γBe in the position close with receptor complex, raise and activate phosphatidylinositols 3 kinases γ (PI3K-γ), the latter produces 3,4,5-triphosphoric acid phosphatidylinositols (PIP
3), PIP
3Activated protein kinase K (Akt) and GTP enzyme (GTPases) cause direct cell migration.If lack Phospholipase C β
2+3A kind of generation 1,4, the key enzyme of 5-InsP3 and triglyceride, the rising of IL-8 inductive extracellular Ca2 ion, protein kinase C phosphorylation, the displacement of p47 and the effects such as generation of super oxide anion will disappear, but can strengthen the chemotaxis of its mediation.In PI3K-γ knock out mice, by neutrophil leucocyte migration, the PIP of IL-8 mediation
3Generation, phosphorylation and the respiratory burst effects such as (extracellular Ca2 ionic concn fast rise) of Akt all weakened.These results all the surface cell chemotaxis effect of IL-8 mediation rely on by PI3K-γ and non-dependence approach carries out.
1.6IL-8 in disease generation, developing effect
More than 50 kind of chemokine and more than 20 kind of Chemokine Receptors have been found at present.But IL-8 has been a relatively active research field in chemotactic cytokine since finding always.According to incompletely statistics, the document of having delivered in the period of 1987～2000 that relates to chemotactic cytokine has more than 150000.Document relevant with IL-8 in it then has 1/5 more than, is about 2～10 times of other chemotactic cytokine.This phenomenon reflects a problem at least, and the participation of IL-8 is promptly arranged in the pathology generating process of various nonspecific inflammations extremely continually, and the IL-8 gene is easy to be subjected to the stimulation in the external world and be activated.
1.6.1IL-8 the effect in rheumatoid arthritis.
In the synovial tissue of rheumatoid arthritis patients and synovial membrane liquid, all exist a large amount of IL-8, and the albumen of IL-8 is compared obvious rising with the mRNA level with the joint of not getting involved in the joint of getting involved, and points out in the generation of IL-8 in rheumatoid arthritis, the evolution to play an important role.Can observe the arthritic initial pathological change of dosage and time-dependent manner to direct injection IL-8 in the rabbit joint cavity, comprise the gathering of neutrophil leucocyte in the joint cavity, this has proved that fully IL-8 plays an important role in the pathological change process of rheumatoid arthritis.Other research has confirmed that also IL-8 plays leading role at monocyte in the moving process of synovial tissue.
1.6.2IL-8 the effect in ischemical reperfusion injury.
Behind the of short duration ischemic again perfusion can cause the damage more serious than ischemic.Can produce a large amount of oxyradicals in the ischemical reperfusion injury, pathological manifestations is a large amount of neutrophil infiltration, has some evidences to show that oxyradical can regulate the generation of IL-8.In the myocardial reperfusion process, the IL-8 expression of gene occurs in before the tissue injury of neutrophil infiltration and mediation thereof.In ischemia-reperfusion lung injury, ischemic can induce IL-8 in partial expression, a large amount of neutrophil infiltration, pulmonary edema, causes the havoc of lung structure at last.In the ischemical reperfusion injury of brain, the concentration of IL-8 in pouring into the back 6 hours brain tissue homogenate of beginning more obviously raises, and the IL-8 level in the blood plasma does not have considerable change.In the ischemical reperfusion injury of liver, anti-IL-8 monoclonal antibody can obviously be blocked in the refilling process neutrophil leucocyte to the infiltration of liver, though liver cell still has the swelling phenomenon, but it is regularly arranged normally that cell is, cell wall structure is complete, be presented in the liver reperfusion injury process, IL-8 is the key factor of chemotactic neutrophil infiltration.
1.6.3IL-8 the effect in tumour
IL-8 has the effect of somatomedin in melanoma, liver and pancreas and colon cancer cell.Discover that IL-8 is an angiogenesis factor, reorganization IL-8 can mediate angiogenic activity in vivo at the chemotactic and the proliferation activity of external mediation endotheliocyte
[24.25]Activity and TNF-a that the IL-8 induction of vascular generates, aFGF, bFGF, angiogenin, angiotropin and VEGF etc. are suitable.Human tumor cell line can directly be expressed IL-8, IL-8 level in people's nonsmall-cell lung cancer of fresh separated obviously raises, this is relevant with the angiogenic activity of 42-80% in people's nonsmall-cell lung cancer tumor tissues, this shows that this angiogenesis factor of tumor cell secretion IL-8 may be very important to tumor neovasculature generation, and the latter is the prerequisite that tumour takes place, develops.Clinical study shows, in human breast carcinoma tissue IL-8 in the mRNA level apparently higher than people normal galactophore tissue
[28], the aggressive of the breast cancer cell line of high expression level IL-8 obviously strengthens.In K-1735, IL-8 expression level and their growth are closely related with invasion and attack
[29]
1.6.4IL-8 the pathological effect in pulmonary disorder
IL-8 plays an important role in pulmonary disorder.In the pulmonary disorder of bacterium or viral infection, because the expression that the product of bacterium or virus can be induced IL-8, thereby cause that neutrophil leucocyte is to the lung tissue chemotactic, cause inflammation at last and be reflected among respiratory distress syndrome (ARDS) patient, the content of IL-8 in bronchoalveolar lavage fluid obviously increases, and this points out in the generation of IL-8 at ARDS, the evolution and plays an important role.In addition, in patients' such as atopy pulmonary fibrosis, sarcoidosis, metal fume fever, Amianthosis bronchoalveolar lavage fluid, high-caliber IL-8 is arranged, bronchial epithelial cell generation IL-8 chronic asthma and Cysticfibrosis patient also raises, and prompting IL-8 is the important medium that causes that lung tissue pathology changes.
2.1 blocking-up IL-8 activity is to the treatment of diseases effect
2.2.1 the application of anti-IL-8 monoclonal antibody in diseases associated with inflammation
Acute respiratory distress syndrome (ARDS) is a kind of clinically more serious pulmonary disorder, and mortality ratio reaches 50%.Mukaida etc. give rabbit intravenous injection bacterial endotoxin (LPS), induce rabbit to produce symptom to very similar clinically ARDS, thereby make the animal model of ARDS.Utilize anti-IL-8 monoclonal antibody can prevent the generation of ARDS: the activity of the myeloperoxidase in the bronchoalveolar lavage fluid (representing the gathering of neutrophil leucocyte), protein concentration (representative leaks into the protein content in the alveolar) and lung wet/do than (representing the degree of pulmonary edema) and almost completely suppressed having accepted the rising behind the LPS by anti-IL-8 monoclonal antibody.Equally, anti-IL-8 monoclonal antibody has obviously improved in the survival rate of rabbit: 6-8 hour anti-IL-8 mab treatment group and has had only 30% rabbit death, and control group then has 70% rabbit death.This test explanation is in LPS inductive ARDS animal model, and IL-8 plays the important pathological effect, and anti-IL-8 monoclonal antibody can effectively be treated ARDS.
In LPS and IL-1 inductive arthritis model, anti-IL-8 monoclonal antibody can significantly reduce the infiltration of neutrophil leucocyte to joint cavity, and the amplitude of reduction was respectively 93% and 89% at 4 hours and 8 hours, can protect the joint cavity synovial membrane not to be damaged simultaneously.In the pleuritis animal model that intracellular toxin causes, can reduce the infiltration of neutrophil leucocyte to pleural space, the amplitude of reduction reaches 77%.
A kind of anti-IL-8 monoclonal antibody (IgG that is called the full-length human of ABX-IL8
2) be used for the treatment of chronic obstructive pulmonary disease (COPD) and entered clinical trial, the test-results of clinical II phase shows that it is safe that this antibody is applied to human body, human body is good to its tolerance, does not find obvious toxic and side effects.Patient COPD injects ABX-IL8 every other month one time, three months altogether, can improve patient's dyspneic symptom.Dyspneic symptom is from beginning to alleviate the bimestrial time of restraining effect two weeks after the injection for the first time.This test-results provides preliminary support for further studying this medicine.
In China, the emulsion that contains anti-IL-8 monoclonal antibody has entered clinical application, is obtaining curative effect preferably aspect the treatment psoriatic.
2.2.2 the application of anti-IL-8 monoclonal antibody in tumour
Because the effect of IL-8 in tumor growth, transfer be paid more and more attention in recent years, becomes one of research focus of oncotherapy so utilize anti-IL-8 monoclonal antibody to treat tumour.
Utilize the mice-transplanted tumor model of the antibody combined treatment mammary cancer of anti-IL-8 monoclonal antibody and EGF-R ELISA (EGFR), though anti-IL-8 monoclonal antibody is used the effect that does not have the obvious suppression Metastasis in Breast Cancer separately, but but can obviously strengthen the latter's antitumous effect with the antibody combined application of EGFR, improve the survival rate of tumor-bearing mice
[45]This effect of anti-IL-8 monoclonal antibody may be by in and the IL-8 that produces of tumour cell, thereby reduce the generation of IL-8 inductive metal matrix proteolytic enzyme (MMP), suppress the transfer of tumour.
With human melanoma cell is that A375SM (high expression level IL-8) and TXM-13 (moderate is expressed IL-8) distinguish subcutaneous vaccination in nude mouse, uses anti-IL-8 monoclonal antibody (abdominal injection a, week is 1mg altogether, divides three injections, treats for 3 weeks) then.Compare with control group, the tumor growth of treatment group has been subjected to obvious suppression.Simultaneously, anti-IL-8 monoclonal antibody also can obviously suppress the metastases that causes through the intravenous injection melanoma cell.Internal and external test shows that all anti-IL-8 monoclonal antibody by blocking-up IL-8, suppresses the expression of MMP-2, reduces invasion by tumor cells.In addition, external tubule forms the vascularization test that test confirms that anti-IL-8 monoclonal antibody can direct intervention umbilical vein endotheliocyte
[46]
Anti-IL-8 monoclonal antibody is in external not influence of growth to transitional cell bladder carcinoma cell line, if but with the transitional cell bladder carcinoma cell line subcutaneous vaccination in nude mouse, through treatment (100 μ g abdominal injections weekly) all around, anti-IL-8 monoclonal antibody can obviously suppress growth of tumor, IL-8 can obviously suppress expression, activity of MMP-2 and MMP-9 and transcribes by blocking-up, and this effect is by the expression of adjusting transcription factor NF-к B and transcribes realization.
2.3IL-8 the progress of receptor antagonist
External except monoclonal anti, suppressing IL-8 is to reduce its active another kind of effective means with combining of its acceptor.Since the ELR sequence of IL-8 molecule N end for receptors bind with to activate be essential, have report with the method for chemosynthesis with the ELR motif be mutated into behind the AAR can with the IL-8 receptors bind, but can not activated receptor.Up to now, the proteic report of still useless gene engineering expression IL-8 receptor antagonist.
Summary of the invention
The objective of the invention is to, provide a kind of and can compete bind receptor, thereby suppress IL-8 receptor antagonist albumen (rmhIL-8) of its biologic activity and preparation method thereof with natural IL-8 molecule.Human interleukin 8 antagonist protein of the present invention might provide a kind of new pharmaceutical grade protein for the treatment of acute and chronic inflammation.
To achieve these goals, the technical scheme that the present invention takes is, utilizing the method for PCR to make the reactive site of natural IL-8 is that the ELR motif of N end sports AAR, make its kept lost with the ability of receptors bind activated receptor ability, thereby construct the receptor antagonist albumen of a kind of IL-8.Be characterized in that the activity of the natural IL-8 of energy competitive inhibition plays therapeutic action to diseases associated with inflammation.The IL-8 mutant gene that PCR method makes up obtains to efficiently express in intestinal bacteria, obtains rmhIL-8 albumen after purified.
Expression product is through splitting the purifying of bacterium, heating, SP ion chromatography post, and purity of protein can reach more than 95%.RmhIL-8 behind the purifying is at the external chemotactic that can suppress IL-8 inductive neutrophil leucocyte.RmhIL-8 can suppress the transfer of glycogen inductive neutrophil leucocyte to the abdominal cavity in the rat body.
The receptor antagonist albumen of IL-8 of the present invention, its preparation method are that PCR method is suddenlyd change to natural IL-8 gene, makes up the rmhIL-8 gene; The construction of prokaryotic expression vector and the expression of recombinant proteins that contain goal gene rmhIL-8; The evaluation of expression product; The purifying of recombinant protein; RmhIL-8 external to the inhibiting research of natural IL-8 chemotactic activity and in the rat body to the inhibiting research of IL-8 inductive neutrophil leucocyte chemotactic.
The receptor antagonist albumen (rmhIL-8) of IL-8 of the present invention, by with the IL-8 receptors bind, the chemotaxis of the natural IL-8 of emulative inhibition, thus a kind of new pharmaceutical grade protein might be provided for the treatment of acute and chronic inflammation.
Description of drawings
Fig. 1 is the result of gene order of the order-checking of pET-22b (+)-rmhIL-8;
Fig. 2 is PCR product agarose electrophoresis figure, 1 expression DNAmarker among the figure; 2 expression goal gene;
Fig. 3 is that the enzyme of pET-22b (+)-rmhIL-8 recombinant plasmid is cut qualification result figure; 1 expression DNAmarker among the figure; 2 expression pET-22b (+)-rmhIL-8;
Fig. 4 is the SDS-PAGE of rmhIL-8 expression product; 41 is peptide marker among the figure; 42 for before inducing; 43 induce after; 44 split the bacterium precipitation; 45 split the bacterium supernatant;
Fig. 5 is the supernatant of expressing after thalline splits the heating of bacterium product; Number in the figure 41 is peptide marker; Split the bacterium supernatant before 52 heating; 53 is 50 ℃ of heating 10min supernatants; 54 is 60 ℃ of heating 10min supernatants; 55 is 70 ℃ of heating 10min supernatants; 56 is 80 ℃ of heating 10min supernatants;
Fig. 6 is the SDS-PAGE of rmhIL-8 purified product; Wherein figure (A) is a picture behind the ArmhIL-8 purifying, the picture of figure (B) BWestern-blot, number in the figure 61, peptide marker, 62, heating back supernatant, 63, rmhIL-8 (non-reduced) behind the purifying, 64, rmhIL-8 (reduction) behind the purifying; 65, rmhIL-8 (non-reduced) behind the purifying, rmhIL-8 behind 66 purifying (reduction);
Fig. 7 is that rmhIL-8 is in external restraining effect to natural IL-8 chemotactic activity; Symbol among the figure ◆ the rmhIL-8, ▲ anti-TNF antibody that has nothing to do, the anti-IL-8 antibody of ■.
Fig. 8 is the interior restraining effect histogram to IL-8 inductive neutrophil leucocyte chemotactic of body.
For a more clear understanding of the present invention, the present invention is described in further detail for the embodiment that finishes below in conjunction with the contriver.
Embodiment
According to technical scheme of the present invention, IL-8 receptor antagonist albumen, selecting the reactive site of natural IL-8 molecule is that the ELR motif that N holds sports the AAR motif, constitutes IL-8 molecule mutant, it has the ability with the IL-8 receptors bind, but can not activate the IL-8 acceptor.Adopt PCR method clone rmhIL-8 gene, make up prokaryotic expression carrier, and in intestinal bacteria, obtain to efficiently express.Expression product is through the purifying of heating, SP ion chromatography post, and purity of protein can reach more than 95%.RmhIL-8 behind the purifying is at the external chemotactic that can suppress IL-8 inductive neutrophil leucocyte.RmhIL-8 can suppress the transfer of glycogen inductive neutrophil leucocyte to the abdominal cavity in the rat body.
Realize the receptor antagonist albumen (rmhIL-8) of IL-8 of the present invention, its preparation method carries out according to the following steps: the clone of 3.1rmhIL-8 gene and construction of prokaryotic expression vector
PCR reaction design of primers is as follows, and the NdeI restriction enzyme site is introduced 5 ' end primer, and the SalI restriction enzyme site is introduced 3 ' end primer:
P1 (5 ' end primer 2 9nt): 5 ' AGCATATGGCCGCGCGTTGTCAGTGCATA3 '
P2 (3 ' end primer 2 9nt): 5 ' AGGTCGACTTATGAGTTCTCAGCCCTCTT3 '
The pBV220-IL-8 plasmid is carried out pcr amplification by following condition.
The pcr amplification reaction pipe is formed:
PBV220-IL-8 (template DNA, 200ng/ml) 0.5 μ l
2.5mMdNTPslμl
25mMMgCl24μl
P1(20μM)0.5μl
P2(20μM)0.5μl
Taq enzyme (5.0U/ μ l) 0.5 μ l
10×PCRBuffer5μl
H
2O38μl
Amount to 50 μ l
The preparation of reaction tubes is all carried out in ice bath, in the process for preparation, and Xian Jiashui, template DNA and other reactive components, 95 ℃ of reaction 5min add the Taq enzyme again, carry out the PCR reaction then, and the loop parameter of pcr amplification is: 94 ℃, 60s (sex change); 55 ℃, 60s (annealing); 72 ℃, 60s (amplification) carries out 30 circulations, extends 15min in 72 ℃ again.Capable 2% agarose gel electrophoresis of PCR product, the dna fragmentation (Fig. 2) of visible expection size.
Prokaryotic expression carrier pET-22b (+) reclaims big fragment behind NdeI and SalI double digestion, the fragment of recovery and above-mentioned PCR product carry out ligation through the recovery product of same double digestion.Connect product transformed competence colibacillus cell BL21 (DE3), picking mono-clonal overnight incubation is extracted plasmid, cuts through enzyme and identifies the insertion fragment (Fig. 3) that obtains the expection size, and (Fig. 1) checks order.Correct plasmid called after pET-22b (+)-rmhIL-8 checks order.Engineering bacteria called after pET-22b (+)-rmhIL-8/BL21 (DE3).
Its gene order is:
CATATGGCCGCGCGTTGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAG
TGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAACTTTCTGATGGAAGAGAGCTCTGTCTGGA
CCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGA ACTCATAAGTCGAC (referring to Fig. 1).
3.2 expression of recombinant proteins
Picking engineering bacteria list colony inoculation in 5mLLB nutrient solution (containing Amp100mg/L), 37 ℃ of shaking table overnight incubation, next day, the ratio with 1: 100 was transferred in the LB nutrient solution that contains Amp, cultivated 3h to logarithmic growth (OD in mid-term at 37 ℃ of shaking tables
600Be 0.4～0.6), adding final concentration is the IPTG of 1mmol/L, continues to cultivate 4h.Centrifugal collection thalline.
3.3 the evaluation of expression product
Analyze expression product and expression-form (Fig. 4) with Trcine-SDS-PAGE, and the immunogenicity of expression product is identified with the Western-Blot method.
3.3.1Tricine-SDS-PAGE
3.3.1.1 being formulated as follows shown in the table of electrophoretic buffer
| Damping fluid TrisTricinepHSDS (mol/L) is (%) (mol/L) |
| Anode buffer liquid 0.2-8.9*-negative electrode damping fluid 0.10.18.25**0.1 glue damping fluid 3.0-8.4*0.3 |
* use the HCl adjust pH, * * pH value is about 8.25.
3.3.1.2 being formulated as follows shown in the table of acrylamide stock solution
| The percentage ratio of the percentage ratio of single third-two third mixture lists third two third |
| 49.5％T，3％C481.5 49.5％T，6％C46.53.0 |
T wherein: the total concn of acrylamide; C: degree of crosslinking
3.3.1.3 the preparation of glue
Similar to general SDS-PAGE, according to the form below preparation separation gel and concentrated glue
| The component separation gel concentrates glue 16%T, 6%C6%T, 3%C |
| 49.5%T, 3%C acrylamide stock solution (ml)-0.48 49.5%T, 6%C acrylamide stock solution (ml) 3.3- |
| Glue damping fluid (ml) 3.31.00 urea (g)/glycerine (ml) 3.6/2.4-water (ml) 11.50 10% ammonium persulphates (μ l) 4025 TEMED (μ l) 4.02.5 cumulative volumes (ml) 10.043.03 |
3.3.1.4 electrophoresis process
Sample mixes with sample buffer and boils 2min, and the sheet glass of encapsulating is fixed on the electrophoresis apparatus, with 1% agarose edge sealing, pours the negative electrode damping fluid into, and application of sample is put into electrophoresis chamber, pours anode buffer liquid into, constant voltage 70V electrophoresis 5-7h, and dyeing, decolouring, glue are preserved.
3.3.2 immunoblotting reaction
After Tricine-SDS-PAGE finishes, press the Bio-Rad description of product, gel is near negative electrode one side, nitrocellulose membrane (NC film) is near anode one side, transfering buffering liquid (25mmol/LTris, 192mmol/LGlycine, 20% methyl alcohol), 100V constant voltage 1h, with albumen from the gel electrotransfer to the NC film, after electrotransfer finishes, take out the NC film, TBST (contains 0.02mol/LpH7.4TBS with washings, 0.4%Tween20) room temperature is washed 3 times, immerse 37 ℃ of 1h in the confining liquid (TBST that contains 2%BSA), washings (TBST) room temperature is washed 3 times, adds mouse-anti people IL-8mAb, hatches 1h for 37 ℃, the TBST room temperature is washed film 3 times, it is anti-to add sheep anti-mouse igg-AP two, hatches 1h for 37 ℃, and the TBST room temperature is washed film 3 times, wash 3 times with TBS again, the NC film immerses in the colour developing liquid, room temperature lucifuge colour developing 5min, distilled water flushing termination reaction.
3.4 the purifying of recombinant protein
Induce the back thalline to be suspended in 10mlSTE[50mmol/LTris.HCl (pH8.0) every gram, 1mmol/LEDTA, 100mmol/LNaCl] in, add N,O-Diacetylmuramidase (0.8mg/g thalline), stir after 20 minutes, add Sodium desoxycholate (DOC), continue stirring and become thickness, add 1mol/LMgCl by 1 gram thalline again until suspension
20.4ml, after stirring, adding 1mg/mlDNAaseI20 μ l by 1 gram thalline, the back room temperature that stirs is placed 30min and is digested.To split the bacterium product at 70 ℃ of heating 10min, and be cooled to 0 ℃ rapidly, the centrifugal 15min of 12000r/min gets supernatant (Fig. 5).A liquid (20mmol/L citrate buffer solution with 50 times of volumes, pH6.0) dialysis 12h, the centre is changed extracellular fluid dialysis one time, supernatant after the dialysis is crossed with the abundant equilibrated of A liquid and is crossed SP-SepharoseFF, and wash-out B liquid is 20mmol/L citrate buffer solution pH6.0,1mol/LNaCl, continuous gradient, a wash-out 4-5 column volume is collected the elution peak at 0.5mol/LNaCl place, carries out SDS-PAGE electrophoresis detection (Fig. 6).
3.5 external inhibiting research to the IL-8 chemotactic activity
Getting Freshman venous blood adds in the anticoagulant heparin pipe, on carefully being added on 2 parts the liquid level of PMN cellular segregation liquid after Hank ' s liquid mixes at 1: 1, with 1000-1500rpm centrifugal 20 minutes, collect the cell on the interface, put into the test tube that contains Hank ' s liquid 4-5ml, fully behind the mixing, with 1500-2000rpm centrifugal 10 minutes.Draw supernatant liquor, precipitation is used with quadrat method repetitive scrubbing twice, promptly gets required cell, and cell suspension is contained in the RPMI-1640 nutrient solution of 5%BSA in 1ml, detects cell viability.With same nutrient solution cell is made into 3 * 106/ml again and is used for the chemotactic test immediately.96 hole chemotactic plates, its thickness 10 μ m, aperture 3 μ m.The peripheral blood PMN (neutrophil leucocyte) of fresh separated regulates its concentration to 10
6Individual/ml.The upper strata adds the cell suspension of 20 μ l, lower floor adds 29 μ l samples (with the rmhIL-8 of the RPMI-1640 serial dilution that contains 5%BSA and 10ng/mlIL-8, concentration is respectively 0,0.01,0.1,1,10and100 μ g/ml), anti-IL-8 neutrality monoclonal antibody is as positive control, and the irrelevant antibody of anti-TNF is as negative control.37 ℃ of CO
2After incubator was placed 2h, the cell on lower floor's face was observed in the Jim Sa liquid dyeing of the fixing back of 70% methyl alcohol, calculates lower floor's cell count with 400 * observation by light microscope.(promptly chemotactic arrives the ratio (Fig. 7) of the cell count (negative control group) of film lower surface to chemotactic activity to the cell count of film lower surface and random migration for chemotaticindex, CI) expression with chemotactic index.
3.6 chemotactic inhibition test in the body
15 rats are divided into 3 groups at random, instillation 10ml in rats in test groups abdominal cavity contains the PBS (pH7.2) of 0.1% (w/v) oyster glycogen (sigma) and 50 μ g/mlrnhIL-8, positive controls rat abdominal cavity instillation 10ml contains the PBS of the anti-IL-8 neutrality monoclonal antibody of 0.1% (w/v) oyster glycogen and 50 μ g/ml, and negative control group rat abdominal cavity instillation 10ml only contains the PBS of 0.1% (w/v) oyster glycogen.Behind the 4h, put to death rat, collect peritoneal exudate, counting neutrophil leucocyte content (Fig. 8).
Claims (3)
1. human interleukin 8 antagonist protein, it is characterized in that, select the reactive site ELR in the natural human IL-8 gene to sport AAR, structure can be competed the antagonist protein gene rmhIL-8 of bind receptor with natural IL-8, and in intestinal bacteria, obtain to efficiently express, obtain rmhIL-8 albumen after purified, its gene order is:
CATATGGCCGCGCGTTGTCAGTGCATAAAGACATACTCCAAACCTTTCCACCCCAAATTTATCAAAGAACTGAGAGTGATTGAGAGTGGACCACACTGCGCCAACACAGAAATTATTGTAAAACTTTCTGATGGAAGAGAGCTCTGTCTGGACCCCAAGGAAAACTGGGTGCAGAGGGTTGTGGAGAAGTTTTTGAAGAGGGCTGAGAACTCATAAGTCGAC。
2. realize the preparation method of the described human interleukin 8 antagonist protein of claim 1, it is characterized in that, carry out according to the following steps:
1) structure of people rmhIL-8 expression vector
Obtain people rmhIL-8 gene by the PCR reaction, simultaneously the NdeI restriction enzyme site is introduced 5 ' end primer, the SalI restriction enzyme site is introduced 3 ' end primer, and the plasmid that contains the natural IL-8 gene of people is carried out pcr amplification, and design PCR primer is as follows:
Primere15’AGCATATGGCCGCGTGTCAGTGCATAAAG3’
Primere25’AGGTCGACTTATGAGTTCTCAGCCCTCTT3’
The preparation of pcr amplification reaction pipe is all carried out in ice bath, in the process for preparation, and Xian Jiashui, template DNA and other reactive components, 95 ℃ of reaction 5min add the Taq enzyme again, carry out the PCR reaction then, and the loop parameter of pcr amplification is: 94 ℃, the 60s sex change; 55 ℃, 60s annealing; 72 ℃, 60s extends, and carries out 30 circulations, extends 15min in 72 ℃ again; The PCR product carries out 2% agarose gel electrophoresis, the dna fragmentation of visible expection size;
Plasmid pET-22b (+) reclaims big fragment behind NdeI and SalI double digestion, the fragment of recovery and above-mentioned PCR product carry out ligation through the recovery product of same double digestion; Connect product transformed competence colibacillus cell BL21, picking mono-clonal overnight incubation is extracted plasmid, cuts through enzyme and identifies the insertion fragment that obtains the expection size, checks order, and the result is consistent with expection; Plasmid called after pET-22b (+)-rmhIL-8 after the reorganization;
2) rmhIL-8 Recombinant Protein Expression
The e. coli bl21 that will contain recombinant plasmid pET-22b (+)-rmhIL-8 is inserted activation jolting overnight incubation in the LB substratum in 37 ℃, m seq, be inoculated in the LB substratum in 1: 100 ratio after, continue 37 ℃ of cultivation 3h to logarithmic growth later stage, OD
650nm=0.4 o'clock, add IPTG, 1mmol/L cultivates 4h, collects thalline;
3) evaluation of expression product
To the evaluation Western-blot of expression product, behind Tricine-SDS-PAGE separation expression product, change film, add mouse-anti people IL-8 monoclonal antibody respectively and resist as one, the sheep anti-mouse antibody of alkaline phosphatase AP mark is anti-as two, the substrate colour developing;
4) purifying of recombinant protein
Induce the back thalline to be suspended among the 10mlSTE every gram, the prescription of STE is: the Tris.HCl of 50mmol/LpH8.0,1mmol/LEDTA, 100mmol/LNaCl, add the N,O-Diacetylmuramidase of 0.8mg/g thalline, stir after 20 minutes, add Sodium desoxycholate DOC, continue to stir and become thickness until suspension, 1 gram thalline adding 1mol/LMgCl
20.4ml the back that stirs adds 1mg/mlDNAaseI20 μ l, the back room temperature that stirs is placed 30min and is digested; To split the bacterium product at 70 ℃ of heating 10min, and be cooled to 0 ℃ rapidly, the centrifugal 15min of 12000r/min gets supernatant;
With the 20mmol/L citrate buffer solution of 50 times of volumes, the A liquid of pH6.0, dialysis 12h, the centre is changed extracellular fluid dialysis one time, and the supernatant after the dialysis is crossed with the abundant equilibrated of A liquid and is crossed SP-SepharoseFF, wash-out B liquid is 20mmol/L citrate buffer solution pH6.0,1mol/LNaCl, continuous gradient, 4～5 column volumes of wash-out, the target protein peak elutes when 0.5mol/LNaCl, collect the purpose peak, carry out the Tricine-SDS-PAGE electrophoresis detection, promptly obtain rmhIL-8 albumen.
3. the preparation method of human interleukin 8 antagonist protein as claimed in claim 2 is characterized in that, described pcr amplification reaction pipe consists of:
200ng/ml pBV220-IL-8 0.5μl
2.5mM dNTPs 1μl
25mM MgCl
2 4μl
20μMP1 0.5μl
20μMP2 0.5μl
5.0U/ul Taq enzyme 0.5 μ l
10×PCR Buffer 5μl
H
2O 38μl
Amount to 50 μ l.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100963734A CN100366637C (en) | 2005-11-17 | 2005-11-17 | Human interleukin 8 antagonist protein and preparation method thereof |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2005100963734A CN100366637C (en) | 2005-11-17 | 2005-11-17 | Human interleukin 8 antagonist protein and preparation method thereof |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1789284A CN1789284A (en) | 2006-06-21 |
| CN100366637C true CN100366637C (en) | 2008-02-06 |
Family
ID=36787430
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2005100963734A Expired - Fee Related CN100366637C (en) | 2005-11-17 | 2005-11-17 | Human interleukin 8 antagonist protein and preparation method thereof |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100366637C (en) |
Families Citing this family (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| NZ589251A (en) * | 2010-11-12 | 2014-07-25 | Pacific Edge Ltd | Novel marker for detection of bladder cancer |
| CN113956347B (en) * | 2021-12-13 | 2023-05-26 | 青岛瑞斯凯尔生物科技有限公司 | IL-8 mutants and uses thereof |
Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO1997000601A2 (en) * | 1995-06-20 | 1997-01-09 | Chiron Corporation | Polypeptides with interleukin-8 receptor binding |
| US5871723A (en) * | 1995-06-06 | 1999-02-16 | The Regent Of The University Of Michigan | CXC chemokines as regulators of angiogenesis |
| WO2001032879A2 (en) * | 1999-11-02 | 2001-05-10 | Bayer Aktiengesellschaft | Method for producing recombinant interleucin-8 and interleucin-8 muteins |
| WO2005054285A1 (en) * | 2003-12-04 | 2005-06-16 | Protaffin Biotechnologie Ag | Gag binding proteins |
-
2005
- 2005-11-17 CN CNB2005100963734A patent/CN100366637C/en not_active Expired - Fee Related
Patent Citations (4)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US5871723A (en) * | 1995-06-06 | 1999-02-16 | The Regent Of The University Of Michigan | CXC chemokines as regulators of angiogenesis |
| WO1997000601A2 (en) * | 1995-06-20 | 1997-01-09 | Chiron Corporation | Polypeptides with interleukin-8 receptor binding |
| WO2001032879A2 (en) * | 1999-11-02 | 2001-05-10 | Bayer Aktiengesellschaft | Method for producing recombinant interleucin-8 and interleucin-8 muteins |
| WO2005054285A1 (en) * | 2003-12-04 | 2005-06-16 | Protaffin Biotechnologie Ag | Gag binding proteins |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1789284A (en) | 2006-06-21 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4680997B2 (en) | Chimeric protein inhibiting angiogenesis and use thereof | |
| Lucas et al. | Mapping the lectin-like activity of tumor necrosis factor | |
| US20030186889A1 (en) | Diagnostic and medicament for analysing the cell surface proteome of tumour and inflammatory cells and for treating tumorous and inflammatory diseases, preferably using a specific chemokine receptor analysis and the chemokine receptor-ligand interaction | |
| JP6267190B2 (en) | Composition for preventing or treating cachexia | |
| CN103118699B (en) | Use of interleukin-22 in treating viral hepatitis | |
| CN106432509B (en) | A kind of 21 fusion protein of recombinant human fibroblast growth factor and its preparation method and application for treating metabolic disease | |
| CN107969127A (en) | APOA-1 fused polypeptides and compositions related and method | |
| CN102370979B (en) | Building method for autovaccine by aiming at human TNF(Tumor Necrosis Factor)-alpha molecule | |
| CN104083755A (en) | Interleukin 37 containing drug, preparation method and application thereof | |
| Rudolph et al. | Chemokine expression and regulation of angiogenesis in rheumatoid arthritis | |
| CN101434651B (en) | Recombinant thymosin beta 4 two repeat protein and preparation thereof | |
| CN102584976B (en) | A kind of human serum amyloid A 1 and its preparation method and application | |
| CN106581643A (en) | Application of interleukin 37 as medicine to treatment for osteoarthritis and arthrolithiasis | |
| CN110090295A (en) | Purposes of the Ephrin-B1 in the drug of preparation treatment inflammatory bowel disease | |
| CN100366637C (en) | Human interleukin 8 antagonist protein and preparation method thereof | |
| CN103524628B (en) | Recombinant ganoderma lucidum immunoregulatory protein, human serum albumin fusion protein, and preparation method and application thereof | |
| CN104721811B (en) | Application of the polypeptide in preventing and treating glioma medicine is prepared | |
| US20240041988A1 (en) | Use of elapidae postsynaptic neurotoxin in the treatment of over expression of inflammatory cytokines related diseases | |
| CN109666074A (en) | A kind of purposes of chemokine receptors CXCR5 | |
| CN102241776B (en) | RANKL-TNF (Receptor Activator of Nuclear Factor Kappa-B Ligand-Tumour Necrosis Factor) sample region fusion protein and preparation method and application thereof | |
| CN101265482A (en) | Recombination tumor chalone-tumor putrescence factor secretion type eukaryon expression vector and its preparation method and use | |
| CN100390202C (en) | Fusion protein of tumour new-born blood vessel-specific bonding polypeptide and recombinant human Tum-5, and its preparation method | |
| WO2020224529A1 (en) | ANTI-TNF-α HUMANIZED MONOCLONAL ANTIBODY TCX060 HAVING LOW IMMUNOGENICITY AND LOW ADCC/CDC FUNCTION, AND USE THEREOF | |
| CN1994465B (en) | CCR5 autogenous polypeptide vaccine and preparation method thereof | |
| CN113667015A (en) | Antibodies targeting PSGL-1 protein and uses thereof |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20080206 Termination date: 20191117 |