CN100364438C

CN100364438C - Use of astaxanthin-containing plants or parts of plants of the genus tagetes as animal feed

Info

Publication number: CN100364438C
Application number: CNB038242052A
Authority: CN
Inventors: R·弗拉赫曼; M·绍尔; C·R·朔普费尔; M·克勒布萨特尔; A-M·普法伊费尔; T·卢克; D·弗斯特
Original assignee: BASF SE; BASF Plant Science GmbH; SunGene GmbH
Current assignee: BASF SE; BASF Plant Science GmbH; SunGene GmbH
Priority date: 2002-08-20
Filing date: 2003-08-18
Publication date: 2008-01-30
Anticipated expiration: 2023-08-18
Also published as: CN1688206A; DE10238978A1

Abstract

The invention relates to the use of astaxanthin-containing plants or parts of plants of the genus Tagetes or astaxanthin-containing extracts of astaxanthin-containing plants or parts of plants of the genus Tagetes for oral administration to animals. The invention also relates to methods for producing animal feed preparations, to said animal feed preparations themselves, to a method for the pigmentation of animals or animal products, and to a method for producing pigmented animals and animal products.

Description

The plants of tagetes species of astaxanthin-containing or plant part are as the purposes of feed

The astaxanthin-containing extract that the present invention relates to the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or its part or astaxanthin-containing or its part is used to be administered orally in the purposes of animal, produce the method for animal feed goods, animal feed goods itself, make animal or animal product method of colouring, and relate to the method that produces painted animal or animal product.

Because its painted characteristic, astaxanthin is as the pigment in the animal nutrition, in particular for trout, salmon and shrimp culture.

Mainly produce astaxanthin at present by chemical synthesis process.Pass through to cultivate for example haematococcus pluvialis (Haematococcus pluvialis) of algae at present, perhaps also separate producing a small amount of natural astaxanthin subsequently with biological technique method by the hereditary microorganism of upward optimizing of fermenting.

By the synthesizing astaxanthin that separate to produce or natural astaxanthin is the chemistry that produces by the special preparation technology that is used for prolonging storage life or physically stable, and uses scope and bioavilability is produced the purposes that is used for separately according to expection.

WO 9201754 has described a kind of wild-type plant species summer adonis (Adonis aestivalis) of astaxanthin-containing.In addition, the document also discloses that the summer adonis petal of astaxanthin-containing and its extract as fish food, or as the purposes that is used to make the painted additive of fish in the fish food.

Yet, summer adonis is as being used to make the plant origin of the painted astaxanthin of fish to have such shortcoming in the prior art, be the output of astaxanthin-containing biomass the and therefore output of per unit cultivation region astaxanthin-containing vegetable material is very low, and therefore can only cultivate the astaxanthin-containing vegetable material of acquisition acceptable amount by expensive large tracts of land.This causes expensive in producing of corresponding pigment.

Therefore providing the colouring agent of the shortcoming that no longer has prior art is purpose of the present invention.

The plants of tagetes species of the plants of tagetes species that has been found that astaxanthin-containing as previously mentioned or its part or astaxanthin-containing or the astaxanthin-containing extract of its part can be used in and be administered orally in animal.

In preferred embodiments, the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or its part or astaxanthin-containing or its part is used to make animal painted and make corresponding animal product painted.

Think that preferably the plants of tagetes species of astaxanthin-containing is meant the plants of tagetes species that contains a certain amount of astaxanthin at least in part of plant.Astaxanthin can be with free form, exist with aliphatic acid diester or monoester form.Preferred plants of tagetes species is selected to sow: marigold (Tageteserecta), maidenhair (Tagetes patula) (these two kinds of plants of tagetes species are also referred to as pot marigold), spiceleaf marigold (Tagetes lucida), general woods marigold (Tagetes pringlei), Tagetespalmeri, little marigold (Tagetes minuta), lemon marigold (Tagetes lemmonii), Tagetes signata (Tagetes tenuifolia) or bell marigold (Tagetes campanulata) particularly preferably are marigold or maidenhair.

Think that preferably the part of plants of tagetes species of astaxanthin-containing is meant the plant part that contains a certain amount of astaxanthin at least in a part of this plant part.For example, preferred plant part is flower, capitulum (flower heads) or is floral leaf particularly preferably, is also referred to as petal.

Tagetes wild-type plant astaxanthin-containing not in spending, but contain carotenoid, as lutein and luteole.Yet, have been found that the ability that can give plants of tagetes species generation astaxanthin according to the present invention, for example pass through genetic modification.

In preferred embodiments, for example by causing that in compare with wild type the ketolase activity gives the ability that plants of tagetes species produces astaxanthin by the plants of tagetes species of genetic modification.

Think that the ketolase activity is meant the enzymatic activity of ketolase.

Think that ketolase is meant the protein that has in the enzymatic activity of the optional β that replaces of carotenoid-ionone ring place introducing ketone group.

Particularly, think that ketolase is meant to have the protein that beta carotene is changed into the enzymatic activity of canthaxanthin.

Therefore, think that the ketolase activity is meant the amount of the canthaxanthin of the amount of the beta carotene that transforms by the protein ketolase or formation in special time.

According to it is considered herein that term " wild type " is meant corresponding non-genetic modification Tagetes source plant.

Based on context, term " plant " can be considered to be meant the plants of tagetes species of Tagetes source plant (wild type) or genetic modification of the present invention, or both.

Preferably, think that " wild type " is meant for producing the ketolase activity, increasing, increase and reduce and content astaxanthin increases with reference to plant for hereinafter described ε-cyclase activity for beta cyclase hereinafter described is active for hereinafter described hydroxylase activity under each situation.

Tagetes is marigold, maidenhair, spiceleaf marigold, general woods marigold, Tagetes palmeri, little marigold or bell marigold with reference to plant, it particularly preferably is marigold, very particularly preferably be marigold L., accession number: TAG 72, strain Orangenprinz, can be from IPKGenebank, Corrensstr.3, D-06466 Gatersleben obtains.

The ketolase activity is preferably measured under the following conditions in the plants of tagetes species of genetic modification of the present invention and wild type or in reference to plant:

Measure ketolase activity in the vegetable material based on the method (J.Biol.Chem.272 (10): 6128-6135,1997) of Frazer etc.When having lipid (soybean lecithin) and detergent (sodium taurocholate), utilize the substrate beta carotene and utilize canthaxanthin to measure ketolase activity in the plant extracts.Can measure by HPLC from substrate/product ratio that ketolase is measured.

In this embodiment preferred, to compare with non-genetic modification wild type, the plants of tagetes species of genetic modification of the present invention has the ketolase activity, preferably has the ketolase activity in floral leaf, and therefore preferably can the express transgenic ketolase.

In another preferred embodiment, make in plants of tagetes species, to have the ketolase activity by the gene expression of nucleic acid that causes the coding ketolase.

In this embodiment preferred, preferably import the gene expression of the nucleic acid that causes the coding ketolase in the initial plant of Tagetes by the nucleic acid of the ketolase of will encoding.

By and large, any ketolase gene that is to say any nucleic acid of coding ketolase to can be used in this aspect.

All nucleic acid of mentioning in specification can be, for example, and RNA, DNA or cDNA sequence.

The genome ketolase sequence that contains introne for the eucaryon source, can not express under the situation that corresponding ketolase maybe can not be endowed the ability of expressing corresponding ketolase at the Tagetes host plant, preferably use the nucleotide sequence after having processed, for example corresponding cDNA.

The nucleic acid of coding ketolase is to be selected from following sequence with the example that can be used in the corresponding ketolase of the inventive method:

Haematococcus pluvialis is especially from haematococcus pluvialis Flotow em.Wille (accession number: X86782; Nucleic acid: SEQ ID NO:1, protein s EQ ID NO:2),

Haematococcus pluvialis, NIES-144 (accession number: D45881; Nucleic acid: SEQ ID NO:3, protein s EQ ID NO:4),

Orange Agrobacterium (Agrobacterium aurantiacum) (accession number: D58420; Nucleic acid: SEQ IDNO:5, protein s EQ ID NO:6),

Alcaligenes (Alicaligenes spec.) (accession number: D58422; Nucleic acid: SEQ ID NO:7, protein s EQ ID NO:8),

Paracoccus marcusii (accession number: Y15112; Nucleic acid: SEQ ID NO:9, protein s EQID NO:10),

Synechococcus belongs to (Synechocystis sp.) PC6803 strain (accession number: NP442491; Nucleic acid: SEQ IDNO:11, protein s EQ ID NO:12),

Slowly the knurl of taking root Pseudomonas (Bradyrhizobium sp.) (accession number: AF218415; Nucleic acid: SEQ ID NO:13, protein s EQ ID NO:14),

Nostoc (Nostoc sp.) PCC7120 strain (accession number: AP003592, BAB74888; Nucleic acid: SEQ ID NO:15, protein s EQ ID NO:16),

Point shape beads algae (Nostoc punctiforme) ATTC 29133, nucleic acid: Acc.No.NZ_AABC01000195, base-pair 55,604-55,392 (SEQ ID NO:81); Protein: Acc.No.ZP_00111258 (SEQ ID NO:82) (note) to inferring protein,

Point shape beads algae ATTC 29133, nucleic acid: Acc.No.NZ_AABC01000196, base-pair 140,571-139,810 (SEQ ID NO:83), protein: (SEQ ID NO:84) (do not have and explain), Synechococcus belongs to 8102 kinds of (Synechococcus) WH, nucleic acid: Acc.No.NZ_AABD01000001, base-pair 1,354,725-1,355,528 (SEQ ID NO:85), protein: Acc.No.ZP_00115639 (SEQ ID NO:86) (note) to inferring protein

Haematococcus pluvialis (accession number: AF534876, AAN03484; Nucleic acid: SEQ ID NO:97, protein s EQ ID NO:98),

Secondary coccus (Paracoccus) MBIC1143 kind, (accession number: D58420, P54972; Nucleic acid: SEQ ID NO:99, protein s EQ ID NO:100),

Orange shortwave monad (Brevundimonas aurantiaca) (accession number: AY166610, AAN86030; Nucleic acid: SEQ ID NO:101, protein s EQ ID NO:102),

Foam joint ball algae (Nodularia spumigena) NSOR10 (accession number: AY210783, AAO64399; Nucleic acid: SEQ ID NO:103, protein EQ ID NO:104) and

The unusual coccus of radiation hardness (Deinococcus radiodurans) R1 (accession number: E75561, AE001872; Nucleic acid: SEQ ID NO:105, protein: SEQ ID NO:106).

By will from the nucleotide sequence of the amino acid sequence of database or respective opposed translation and above-mentioned sequence and especially with sequence SEQ ID NO:2 and/or 16 comparison homogeneity, can easily find, for example find can be used in the ketolase of the inventive method and other natural example of ketolase gene from the known organism of multiple its genome sequence.

By hybridization technique in a manner known way, can also be easily from above-mentioned nucleotide sequence especially SEQ ID NO:2 and/or 16 from find other natural example of ketolase and ketolase gene from the known organic sequence of multiple its genome sequence.

Hybridization can be at gentle (low strict), or preferably carry out under strict (highly strict) condition.

This type of hybridization conditions is described in, Sambrook for example, J., Fritsch, E.F., Maniatis, T., Molecular Cloning (A Laboratory Manual), second edition, Cold Spring HarborLaboratory Press, 1989,9.31-9.57 page or leaf or Current Protocols in MolecularBiology, John Wiley ﹠amp; Sons, N.Y. (1989), 6.3.1-6.3.6.

For example, that the condition in the washing step can be selected from is low strict (50 ℃ with 2 * SSC) and highly strict (50 ℃, preferably at 65 ℃, with the condition and range of 0.2 * SSC) (pH 7.0 for 20 * SSC:0.3M natrium citricum, 3M sodium chloride) condition restriction.

In addition, the temperature in the washing step can rise to 65 ℃ stringent condition from the temperate condition of 22 ℃ of room temperatures.

Two parameter salinity and temperature can change simultaneously, and also one of these two parameters can be remained unchanged and only another change.In the crossover process, also can use denaturant, for example formamide or SDS.When having 50% formamide, hybridization is preferably carried out at 42 ℃.

Some typical hybridization and the washing step condition is following provides:

(1) hybridization conditions has, for example

(i) 65 ℃, 4 * SSC, or

(ii) 45 ℃, 6 * SSC, or

(iii) 68 ℃, 6 * SSC, 100mg/ml sex change fish sperm DNA, or

(iv) 68 ℃, 6 * SSC, 0.5%SDS, 100mg/ml sex change fragmentation salmon sperm dna, or

(v) 42 ℃, 6 * SSC, 0.5%SDS, 100mg/ml sex change fragmentation salmon sperm dna, 50% formamide, or

(vi) 42 ℃, 50% formamide, 4 * SSC, or

(vii) 42 ℃, 50% (volume/volume) formamide, 0.1% bovine serum albumin(BSA), 0.1% phenanthrene can, 0.1% polyvinylpyrrolidone, 50mM sodium phosphate buffer pH 6.5,750mM NaCl, the 75mM natrium citricum, or

(viii) 50 ℃, 2 * or 4 * SSC (temperate condition), or

(ix) 42 ℃, the 30-40% formamide, 2 * or 4 * SSC (temperate condition).

(2) washing step is 10 minutes under each situation, for example uses

(i) 50 ℃, 0.015M NaCl/0.0015M natrium citricum/0.1%SDS, or

(ii) 65 ℃, 0.1 * SSC, or

(iii) 68 ℃, 0.1 * SSC, 0.5%SDS, or

(iv) 42 ℃, 0.1 * SSC, 0.5%SDS, 50% formamide, or

(v) 42 ℃, 0.2 * SSC, 0.1%SDS, or

(vi) 65 ℃, 2 * SSC (temperate condition).

In the embodiment preferred of the genetically modified plant of Tagetes of the present invention, imported nucleic acid, the protein of these nucleic acid codings contains amino acid sequence SEQ ID NO:2 or by SEQ IDNO:2 is carried out amino acid replacement, insert or disappearance institute calling sequence, homogeneity at these sequences of amino acid levels and sequence SEQ ID NO:2 is at least 20%, be preferably at least 30%, more preferably be at least 40%, more preferably be at least 50%, more preferably be at least 60%, more preferably be at least 70%, more preferably be at least 80%, particularly preferably be at least 90%, and have the enzyme characteristic of ketolase.

Can comprise natural ketolase sequence, as mentioned above, by comparing from other organic sequence, or from sequence SEQ ID NO:2 by the manual change, the natural ketolase sequence that can find of the homogeneity of the synthetic ketolase sequence of having modified by amino acid replacement, insertion or disappearance for example.

In another the inventive method embodiment preferred, imported nucleic acid, the protein of these nucleic acid codings contains amino acid sequence SEQ ID NO:16 or by SEQ ID NO:16 is carried out amino acid replacement, insert or disappearance institute calling sequence, homogeneity at these sequences of amino acid levels and sequence SEQ IDNO:16 is at least 20%, be preferably at least 30%, more preferably be at least 40%, more preferably be at least 50%, more preferably be at least 60%, more preferably be at least 70%, more preferably be at least 80%, particularly preferably be at least 90%, and have the enzyme characteristic of ketolase.

Can comprise natural ketolase sequence, as mentioned above, by comparing from other organic sequence, or from sequence SEQ ID NO:16 by the manual change, the natural ketolase sequence that can find of the homogeneity of the synthetic ketolase sequence of having modified by amino acid replacement, insertion or disappearance for example.

Term " substitutes " and is considered to be meant by one or more amino acid in specification and exchanges one or more amino acid.Preferably, carry out defined conservative exchange, wherein the amino acid that is substituted has similar characteristic to original acid, and for example Glu exchanges to Asp, Gln exchange to Asn, Val exchange to Ile, Leu exchange to Ile, Ser exchange and is Thr.

Disappearance is to replace amino acid by direct key.Preferred disappearance position is the end of polypeptide and the connection between the different proteins domain.

Insertion is that amino acid is imported polypeptide chain, is to replace direct key by one or more amino acid in form.

Homogeneity between two protein is considered to be meant amino acid whose homogeneity in the full length protein under each situation, particularly by using from DNASTAR, inc.Madison, Wisconsin (USA) utilizes the Lasergene software of Clustal method to compare and homogeneity (the Higgins DG that calculates, Sharp PM., on microcomputer, carry out the multisequencing comparison of rapid sensitive, Comput Appl.Biosci.1989 Apr; 5 (2): 151-1), it is as follows that parameter is set:

Multiple ratio is to parameter:

Breach point penalty 10

Notch length point penalty 10

Compare parameter in pairs:

K-tuple (word/word length) 1

Breach point penalty 3

Window 5

Keep diagonal (Diagonals saved) 5

Thought accordingly at the protein that has at least 20% homogeneity with sequence SEQ ID NO:2 or 16 on the amino acid levels and to be meant when with its sequence and sequence SEQ ID NO:2 or 16 relatively the time, especially according to having the program logarithm that above-mentioned parameter is provided with, protein with at least 20% homogeneity.

For example, suitable nucleotide sequence can obtain by the reverse translation of carrying out peptide sequence according to genetic code.

For this respect, preferably use those and the special codon of marigold to select the codon of corresponding to frequent use.Can easily determine the codon selection based on the computer evaluation of other known of plants of tagetes species.

In particularly preferred embodiments, will contain in the nucleic acid importing plants of tagetes species of sequence SEQ ID NO:1.

In another particularly preferred embodiment, the nucleic acid that will contain sequence SEQ ID NO:15 imports in the plants of tagetes species.

In addition, all above-mentioned ketolase genes can produce from the nucleotide structure unit in a manner known way by chemical synthesis, for example pass through the fragment condensation of each overlapping complementary nucleic acid construction unit of double helix.For example, carry out the chemical synthesis of oligonucleotides in known manner by phosphoramidite method (Voet, Voet, second edition, Wiley Press New York, 896-897 page or leaf).The interpolation of synthetic oligonucleotide and utilize the archaeal dna polymerase Klenow fragment to carry out that breach is mended gentle coupled reaction and conventional cloning process is described in (1989) such as Sambrook, Molecular cloning:A laboratory manual, publishing house of cold spring harbor laboratory.

In the inventive method particularly preferred embodiment, use the genetically modified plant of Tagetes, have the highest ketolase expression rate in its petal.

This preferably realizes by expression ketolase gene under the control of flower specific promoter.For example,, with the functional above-mentioned nucleic acid that is connected of flower specific promoter, extensively describe hereinafter in the nucleic acid construct, be imported into plants of tagetes species for this respect.

As initial plant or the preferred especially plants of tagetes species of the genetically modified plant of the present invention, be preferably selected to sow: marigold, maidenhair (they are also referred to as pot marigold), spiceleaf marigold, general woods marigold, Tagetes palmeri, little marigold, lemon marigold, Tagetes signata or bell marigold particularly preferably are marigold or maidenhair.

In preferred embodiments, use to compare and have the hydroxylase activity that improved and/or the genetically modified plant of Tagetes of beta cyclase activity in addition with wild type.

Think that hydroxylase activity is meant the enzymatic activity of hydroxylase.

Think that hydroxylase is meant the protein that has in the enzymatic activity of the optional β that replaces of carotenoid-ionone ring place introducing hydroxyl.

Particularly, think that hydroxylase is meant to have beta carotene is changed into luteole, or canthaxanthin is changed into the protein of the enzymatic activity of astaxanthin.

Therefore, think that hydroxylase activity is meant the beta carotene that transforms by the protein hydroxylase or amount or the luteole of formation or the amount of astaxanthin of canthaxanthin in special time.

Therefore, compare hydroxylase activity with wild type and improve and to be meant and to compare the beta carotene that in special time, transforms with wild type or the amount of canthaxanthin increases, or the amount of luteole that forms or astaxanthin increases.

Preferably, this hydroxylase activity increase is at least 5% of wild type hydroxylase activity, more preferably is at least 20%, more preferably be at least 50%, more preferably be at least 100%, more preferably be at least 300%, even more preferably at least 500%, especially at least 600%.

Think that the beta cyclase activity is meant the enzymatic activity of beta cyclase.

Think that beta cyclase has the protein that the terminal linear residue of lycopene is converted into the enzymatic activity of β-ionone ring.

Particularly, think that beta cyclase is meant to have the protein that gamma carotene is converted into the enzymatic activity of beta carotene.

Therefore, think that the beta cyclase activity is meant in special time the amount of the gamma carotene that is transformed by the protein beta cyclase or the amount of the beta carotene that forms.

Therefore, when comparing with wild type that beta cyclase is active to be improved, the amount of the amount of the gamma carotene that is transformed by the protein beta cyclase or the beta carotene that forms is compared increase with wild type in special time.

Preferably, the increase of this beta cyclase activity is 5% of wild-type beta-cyclase activity at least, more preferably be at least 20%, more preferably be at least 50%, more preferably be at least 100%, more preferably be at least 300%, even more preferably at least 500%, especially at least 600%.

Genetically modified plant of the present invention and wild type or preferably measure under the following conditions with reference to hydroxylase activity in the plant:

(Biochim.Biophys.Acta 1391 (1998), 320-328) activity of method external test hydroxylase according to Bouvier etc.With ferredoxin, ferredoxin-NADP oxidoreducing enzyme, catalase, NADPH and beta carotene,, join in a certain amount of plant extracts with single-or two-galactosylglyceride.

Particularly preferably, according to Bouvier, Keller, d ' Harlingue and Camara (biosynthesis of lutein: from the molecule of the carotenoid hydroxylase enzymes of capsicum (Capsicum annuum L.) and functional characteristic (Biochim.Biophys.Acta 1391 (1998), and 320-328) method is measured hydroxylase activity under the following conditions:

External test carries out in the 0.250ml volume.Measure mixture and contain 50mM potassium phosphate (pH 7.6), 0.025mg spinach ferredoxin, the 0.5 ferredoxin-NADP of unit ⁺Spinach oxidoreducing enzyme, 0.25mM NADPH, 0.010mg beta carotene (being emulsifiable in the 0.1mg Tween 80), 0.05mM be single-and two-galactosylglyceride mixture (1: 1), 1 unit catalase, 200 single-and the plant extracts of two-galactosylglyceride (1: 1), 0.2mg bovine serum albumin(BSA) and different volumes.Reactant mixture was hatched 2 hours at 30 ℃.With organic solvent such as acetone or chloroform/methanol (2: 1), extractive reaction product and measure with HPLC.

Genetically modified plant of the present invention and wild type or preferably measure under the following conditions with reference to beta cyclase activity in the plant:

Activity according to Fraser and Sandmann (Biochem.Biophys.Res.Comm.185 (1) (1992) 9-15) method external test beta cyclase.With kaliumphosphate buffer (pH 7.6), lycopene, pimiento stroma protein, NADP as substrate ⁺, NADPH and ATP join in a certain amount of plant extracts.

Particularly preferably, according to Bouvier, d ' Harlingue and the Camara (analysis of molecules that the carotenoid cyclase suppresses; Arch.Biochem.Biophys.346 (1) (1997) 53-64) method is measured hydroxylase activity under the following conditions:

External test carries out in 250 μ l volumes.Measure plant extracts, 20nM lycopene, 250 μ g pimiento chromoplast stroma proteins, 0.2mM NADP that mixture contains 50mM potassium phosphate (pH 7.6), different amounts ⁺, 0.2mM NADPH and 1mM ATP.Before medium is hatched in adding, immediately NADP/NADPH and ATP are dissolved in the 10ml ethanol with the 1mg Tween 80.30 ℃ of reactions added chloroform/methanol (2: 1) cessation reaction after 60 minutes.The product of being extracted with the HPLC methods analyst.

Another kind utilizes the determination method of radioactive substrates to be described in Fraser and Sandmann (Biochem.Biophys.Res.Comm.185 (1) (1992) 9-15).

Can increase hydroxylase activity and/or beta cyclase activity in several ways, for example express and protein level by closing the inhibition regulatory mechanism, perhaps, increase the gene expression of the nucleic acid of the nucleic acid of coding hydroxylase or the beta cyclase of encoding by comparing with wild type.

Compare with wild type equally, can increase the gene expression of nucleic acid of the nucleic acid or the coding beta cyclase of coding hydroxylase in several ways, for example induce '-hydroxylase gene and/or beta cyclase gene or the nucleic acid of at least one coding hydroxylase or the nucleic acid of at least one coding beta cyclase are imported in the plants of tagetes species by one or more '-hydroxylase genes copies and/or beta cyclase gene copy be that is to say by activator.

The gene expression increase of the nucleic acid of coding hydroxylase and/or beta cyclase also is considered to be meant according to the present invention the manipulation to the expression of plants of tagetes species endogenous hydroxylase and/or beta cyclase.

For example, this can realize by the promoter DNA sequence of modifying coding hydroxylase and/or beta cyclase gene.For example, can realize that by dna sequence dna disappearance or insertion this kind causes the modification that the gene expression rate increases.

As mentioned above, may change the expression of endogenous hydroxylase and/or beta cyclase by the application exogenous irritant.This can that is to say by special physiological conditions by using foreign substance and be undertaken.

And, access endogenous hydroxylase and/or beta cyclase expression of gene altered or that increased by using in non-conversion plant non-existent adjusting albumen and this gene promoter interaction energy.

The chimeric protein that this kind conditioning agent can be made up of DNA-binding structural domain and transcription activator domain for example is described in the conditioning agent among the WO 96/06166.

In preferred embodiments, by with the nucleic acid of at least one coding hydroxylase or import the gene expression of the nucleic acid of the gene expression of the nucleic acid that increases the coding hydroxylase in the plants of tagetes species and/or coding beta cyclase by nucleic acid with at least one coding beta cyclase.

For this respect, can use any '-hydroxylase gene or any beta cyclase gene in principle, that is to say the nucleic acid of any coding hydroxylase and the nucleic acid of the beta cyclase of encoding arbitrarily.

Genome hydroxylase that contains introne or beta cyclase nucleotide sequence for the eucaryon source, do not have maybe can not be endowed under the situation of the ability of expressing corresponding hydroxylase or beta cyclase at host plant, preferably use the nucleotide sequence of processing through in advance, such as corresponding cDNA.

An example of '-hydroxylase gene is from haematococcus pluvialis (accession number AX038729, WO 0061764); (nucleic acid: SEQ ID NO:17, protein: the nucleic acid of coding hydroxylase SEQ ID NO:18).

Also can use hydroxylase with following accession number:

|emb|CAB55626.1、CAA70427.1、CAA70888.1、CAB55625.1、AF499108_1、

AF315289_1、AF296158_1、AAC49443.1、NP_194300.1、NP_200070.1、

AAG10430.1、CAC06712.1、AAM88619.1、CAC95130.1、AAL80006.1、

AF162276_1、AAO53295.1、AAN85601.1、CRTZ_ERWHE、

CRTZ_PANAN、BAB79605.1、CRTZ_ALCSP、CRTZ_AGRAU、

CAB56060.1、ZP_00094836.1、AAC44852.1、BAC77670.1、NP_745389.1、

NP_344225.1、NP_849490.1、ZP_00087019.1、NP_503072.1、NP_852012.1、

NP_115929.1、ZP_00013255.1

Particularly preferred in addition hydroxylase is hydroxylase (accession number the Y14809) (nucleic acid: SEQ ID NO:107 from tomato; Protein: SEQ ID NO.108).

The example of beta cyclase gene is:

Coding is from nucleic acid (accession number the X86452) (nucleic acid: SEQ ID NO:19, protein: SEQ ID NO:20) of the beta cyclase of tomato.

Also can use beta cyclase with following accession number:

S66350 lycopene beta cyclase (EC 5.5.1.-)-tomato

CAA60119 lycopene synthase [capsicum (Capsicum annuum)]

S66349 lycopene beta cyclase (EC 5.5.1.-)-common tobacco

CAA57386 lycopene cyclase [tobacco (Nicotiana tabacum)]

AAM21152 lycopene beta cyclase [sweet orange (Citrus sinensis)]

AAD38049 lycopene cyclase [grape fruit (Citrus x paradisi)]

AAN86060 lycopene cyclase [satsuma orange (Citrus unshiu)]

AAF44700 lycopene beta cyclase [sweet orange]

AAK07430 lycopene beta cyclase [John Burroughs carry receive adonis amurensis (Adonispalaestina)]

AAG10429 beta cyclase [marigold]

The AAA81880 lycopene cyclase

The AAB53337 lycopene beta cyclase

AAL92175 β-lycopene cyclase [palace lantern lily (Sandersonia aurantiaca)]

CAA67331 lycopene cyclase [daffodil (Narcissus pseudonarcissus)]

AAM45381 beta cyclase [marigold]

AAO18661 lycopene beta cyclase [corn (Zea mays)]

The lycopene beta cyclase [edible tomato (Lycopersiconesculentum)] that the AAG21133 chromoplast is special

AAF18989 lycopene beta cyclase [carrot (Daucus carota)]

ZP_001140 infers protein [the former green coccus in ocean (Prochlorococcus marinus) MIT9313 strain]

ZP_001050 infers protein [ocean former green coccus Maas moral subspecies CCMP1378 strain]

ZP_001046 infers protein [ocean former green coccus Maas moral subspecies CCMP1378 strain]

ZP_001134 infers protein [ocean former green coccus MIT9313 strain]

ZP_001150 infers protein [Synechococcus belongs to the WH8102 kind]

AAF10377 lycopene cyclase [the unusual coccus of radiation hardness (Deinococcusradiodurans)]

BAA29250 393aa length is inferred protein [Huo Shi fireball bacterium (Pyrococcus horikoshii)]

BAC77673 lycopene beta-single cyclase [marine products bacterium P99-3]

AAL01999 lycopene cyclase [Flavobacterium (Xanthobacter) Py2 kind]

ZP_000190 infers protein [the orange green der Pilz (Chloroflexus aurantiacus) that deflects]

ZP_000941 infers protein [Novosphingobium aromaticivorans]

AAF78200 lycopene cyclase [knurl of taking root slowly Pseudomonas ORS278]

BAB79602 crtY[reticulate millettia pantoea agglomerans (Pantoea agglomerans pv.Milletiae)]

CAA64855 lycopene cyclase [streptomyces griseus (Streptomyces griseus)]

AAA21262 lycopene cyclase [pantoea agglomerans (Pantoea agglomerans)]

C37802 crtY protein-Erwinia uredovora (Erwinia uredovora)

BAB79602 crtY[reticulate millettia pantoea agglomerans]

AAA64980 lycopene cyclase [pantoea agglomerans]

The AAC44851 lycopene cyclase

BAA09593 lycopene cyclase [secondary coccus MBIC1143 kind]

ZP_000941 infers protein [Novosphingobium aromaticivorans]

CAB56061 lycopene beta cyclase [Paracoccus marcusii]

BAA20275 lycopene cyclase [long bacillus rubidus (Erythrobacter longus)]

ZP_000570 infers protein [having a liking for thermophilic actinomycete (Thermobifida fusca)]

ZP_000190 infers protein [the orange green der Pilz that deflects]

AAK07430 lycopene beta cyclase [John Burroughs carry receive adonis amurensis]

CAA67331 lycopene cyclase [daffodil]

The AAB53337 lycopene beta cyclase

BAC77673 lycopene beta-single cyclase [marine products bacterium P99-3]

In addition, particularly preferred beta cyclase is from the special beta cyclase of tomato plastid (AAG21133) (nucleic acid: SEQ ID No.109; Protein: SEQ ID No.110).

Therefore, in this embodiment preferred, compare, in the preferred Tagetes genetically modified plants of the present invention, a '-hydroxylase gene and/or beta cyclase gene are arranged at least additionally with wild-type plant.

For example, genetically modified in preferred embodiments plant has the exogenous nucleic acid of at least a coding hydroxylase, or the endogenous nucleic acid of at least two kinds of coding hydroxylases, and/or the exogenous nucleic acid of at least a coding beta cyclase, or the endogenous nucleic acid of at least two kinds of coding beta cyclases.

Preferably, in above-mentioned embodiment preferred, as '-hydroxylase gene, the nucleic acid coding that uses contains amino acid sequence SEQ ID NO:18 or by this sequence being carried out amino acid replacement, insertion or lacking the protein of resulting sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ IDNO:18 is at least 30%, preferably be at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and this protein has the enzyme characteristic of hydroxylase.

For example, as mentioned above, by carrying out the homology comparison with SEQ ID.NO:18, can easily find other hydroxylase and '-hydroxylase gene from the known organism of several genes group sequence from the amino acid sequence of database or corresponding reverse translation nucleotide sequence.

For example, as mentioned above, by hybridization and round pcr in a manner known way, also can easily find other hydroxylase and '-hydroxylase gene from sequence SEQ ID NO:17 is initial from multiple organism from its genome sequence the unknown.

In another particularly preferred embodiment, nucleic acid is imported organism to increase hydroxylase activity, wherein the protein of nucleic acid coding contains the amino acid sequence of the hydroxylase of sequence SEQ ID NO:18.

For example, can obtain suitable nucleotide sequence according to the reverse translation of genetic code by peptide sequence.

For this respect, preferably use those to select the frequent codon that uses according to the special codon of plant.Select based on can determine codon fast to the computer evaluation of relevant other known of organism.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:17.

In above-mentioned embodiment preferred, as the beta cyclase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:20 or by this sequence being carried out amino acid replacement, insertion or lacking the protein of resulting sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ IDNO:20 is at least 30%, preferably be at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and this protein has the enzyme characteristic of beta cyclase.

For example, as mentioned above, by carrying out the homology comparison with SEQ ID.NO:20, can easily find other beta cyclase and beta cyclase gene from the known organism of several genes group sequence from the amino acid sequence of database or corresponding reverse translation nucleotide sequence.

For example, by hybridization and round pcr in a manner known way, also can be easily initial from finding other beta cyclase and beta cyclase gene from the multiple organism of its genome sequence the unknown from sequence SEQ ID NO:19.

In another particularly preferred embodiment, nucleic acid is imported organism to increase the beta cyclase activity, wherein the protein of nucleic acid coding contains the amino acid sequence of the beta cyclase of sequence SEQ ID NO:20.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:19.

In addition, all above-mentioned '-hydroxylase genes or beta cyclase gene can produce from the nucleotide structure unit in a manner known way by chemical synthesis, for example pass through the fragment condensation of each overlapping complementary nucleic acid construction unit of double helix.For example, carry out the chemical synthesis of oligonucleotides in known manner by phosphoramidite method (Voet, Voet, second edition, WileyPress New York, 896-897 page or leaf).The interpolation of synthetic oligonucleotide and utilize the archaeal dna polymerase Klenow fragment to carry out that breach is mended gentle coupled reaction and conventional cloning process is described in (1989) such as Sambrook, Molecular cloning:Alaboratory manual, publishing house of cold spring harbor laboratory.

In addition, in another embodiment preferred of this method, compare with wild type, plants of tagetes species has the ε-cyclase activity of reduction.

Think that ε-cyclase activity is meant the enzymatic activity of ε-cyclase.

Think that ε-cyclase is meant to have the protein that the terminal linear residue of lycopene is converted into the enzymatic activity of ε-ionone ring.

Therefore think that ε-cyclase particularly is meant to have the protein that lycopene is converted into the enzymatic activity of δ-carrotene.

Therefore, think that ε-cyclase activity is meant in special time the amount of the lycopene that is transformed by protein ε-cyclase or the amount of δ-carrotene of forming.

Therefore, when ε-cyclase activity is compared with wild type when reducing, in special time, compare the amount of the lycopene that transforms by protein ε-cyclase or the amount of δ-carrotene of forming reduces with wild type.

Based on different cell biology mechanism, think that preferably ε-the cyclase activity that reduces is meant part or whole basically function that suppresses or block ε-cyclase in plant cell, plant or its part, tissue, organ, cell or the seed.

For example, compare, can reduce ε-cyclase activity in the plant by the amount of ε-cyclase protein matter or the amount of ε-cyclase mRNA in the reduction plant with wild type.Therefore, compare with wild type, can be directly or the quantitative determination of the amount by measuring ε-cyclase protein matter in the plant of the present invention or ε-cyclase mRNA compare the ε-cyclase activity that has reduced with wild type.

The reduction of ε-cyclase activity comprises that ε-cyclase is reduced to and lacks ε-cyclase (that is to say and lack detectable ε-cyclase activity or lack the detectable ε-cyclase of immunology) basically fully on amount.Preferably, particularly preferably be to spend middle ε-cyclase activity (or amount of the amount of ε-cyclase protein matter or ε-cyclase mRNA) to compare reduction at least 5% in the plant with wild type, more preferably reduce at least 20%, more preferably reduce at least 50%, more preferably reduce by 100%.Particularly, " reduction " also be meant and lack ε-cyclase activity (or ε-cyclase protein matter or ε-cyclase mRNA) fully.

In the genetically modified plant of the present invention and wild type or preferably measure under the following conditions with reference to ε-cyclase activity in the plant:

According to Fraser and Sandmann (Biochem.Biophys.Res.Comm.185 (1) (1992) 9-15) method can external test ε-cyclase activity, during mensuration, will be as potassium phosphate (pH 7.6), lycopene, pimiento stroma protein, the NADP of buffer solution as substrate ⁺, NADPH and ATP join in a certain amount of plant extracts.

Particularly preferably, according to Bouvier, d ' Harlingue and the Camara (analysis of molecules that the carotenoid cyclase suppresses; Arch.Biochem.Biophys.346 (1) (1997) 53-64) method is measured the genetically modified plant of the present invention and wild type or with reference to the activity of ε-cyclase in the plant:

External test carries out in the 0.25ml volume.Measure plant extracts, 20nM lycopene, 0.25mg pimiento stroma protein, 0.2mM NADP that mixture contains 50mM potassium phosphate (pH 7.6), different amounts ⁺, 0.2mM NADPH and 1mM ATP.Before hatching medium, adding immediately NADP/NADPH and ATP are dissolved in 0.01ml ethanol with the 1mg Tween 80.After 60 minutes, add chloroform/methanol (2: 1) cessation reaction 30 ℃ of reactions.Analyze the product of being extracted in the chloroform with HPLC.

Utilize the another kind of determination method of radioactive substrates to be described in Fraser and Sandmann (Biochem.Biophys.Res.Comm.185 (1) (1992) 9-15).Another kind of analytic approach is described in Beyer, Kr_ncke and the Nievelstein (mechanism of lycopene isomerase in the daffodil chromoplast/cyclase reaction; J.Biol.Chem.266 (26) (1991) 17072-17078).

Preferably reduce the activity of ε-cyclase in the plant by at least a following method:

A) import at least a double-stranded ε-cyclase RNA sequence, be also referred to as ε-cyclase-dsRNA hereinafter, or guarantee an expression cassette or a plurality of expression cassette of its expression.Comprise those wherein ε-cyclase-dsRNA at the method for ε-cyclase gene (that is to say genomic dna sequence) or ε-cyclase transcript (that is to say the mRNA sequence) such as promoter sequence

B) import at least a ε-cyclase antisense RNA sequence, be also referred to as ε-cyclase-antisense RNA hereinafter, or guarantee the expression cassette of its expression.Comprise those wherein ε-cyclase-antisense RNA at the method for ε-cyclase gene (that is to say genomic dna sequence) or ε-cyclase transcript (that is to say the RNA sequence).Also comprise α-different head (anomeric) nucleotide sequence

C) import the ε-cyclase antisense RNA of at least a and ribozyme combination or guarantee the expression cassette of its expression

D) import at least a ε-cyclase and have a mind to RNA sequence, be also referred to as ε-cyclase-have a mind to RNA hereinafter, inducing common inhibition, or import the expression cassette of guaranteeing its expression

E) import at least aly, perhaps import the expression cassette of guaranteeing its expression at ε-cyclase gene, RNA or protein DNA-or protein-binding factor

F) import at least a nucleic acid sequence that causes ε-cyclisation ribozyme degraded, perhaps import the expression cassette of guaranteeing its expression

G) import at least a construct to produce ε-cyclase gene afunction, such as producing the displacement of terminator codon or reading frame, for example by in ε-cyclase gene, producing insertion, disappearance, inversion or sudden change.Preferably, inserting described ε-cyclase gene or implanting needle by homologous recombination with target produces the mode of the sequence-specific nuclease of ε-cyclase gene sequence and knocks out sudden change.

Other known for those skilled in the art method also can be used in the content of the present invention to reduce ε-cyclase or its activity or function.For example, import ε-cyclase dominant (dominantnegative) variant or guarantee that the expression cassette of its expression may also be favourable.Each method can both cause the ε-amount of cyclase protein matter, the amount of mRNA and/or active the reduction in these methods.Also can these methods of applied in any combination.Additive method also is known for those skilled in the art and can comprises the transhipment that stops or suppress processing, ε-cyclase or its mRNA of ε-cyclase, suppressing ribosomes adheres to, suppress the RNA montage, induce ε-cyclase RNA-digestive enzyme and/or suppress the translation extension or the termination translation.

Various preferable methods can be described in by exemplary embodiment hereinafter:

A) import double-stranded ε-cyclase RNA sequence (ε-cyclase-dsRNA) with double-stranded RNA mode (" double-stranded RNA interference "; DsRNAi) method of carrying out gene regulation is known and is described in such as (2000) Plant Mol Biol43:401-415 such as Matzke MA; (1998) Nature 391:806-811 such as Fire A.; WO 99/32619; WO 99/53050; WO 00/68374; WO 00/44914; WO 00/44895; WO 00/49035 or WO 00/63364.Therefore be described in the step in the quoted passage reported and method specific reference in the application as a reference.

According to the present invention, think that " double stranded RNA sequence " is meant because complementary series, in theory as according to the base pairing rules of Watson and Crick and/or in fact as based on hybrid experiment, can be external and/or body in form one or more RNA sequence of double-stranded RNA structure.

The formation of the known double-stranded RNA structure of those skilled in the art is a kind of equilibrium state.Preferably, the ratio of duplex molecule and the corresponding form of unwinding was at least 1: 10, was preferably 1: 1, was 5: 1 particularly preferably, was most preferably 10: 1.

Think that double-stranded ε-cyclase RNA sequence or ε-cyclase-dsRNA preferably are meant to have the RNA molecule that contains the duplex structure zone and contain following nucleotide sequence in this zone:

A) with the intrinsic ε-cyclase of plant to the small part transcript identical and/or

B) identical with the intrinsic ε-cyclase of plant to the small part promoter sequence.

In the methods of the invention, in order to reduce ε-cyclase activity, preferably such RNA is imported plant, described RNA has the zone that contains duplex structure and contain following nucleotide sequence in this zone

Think that term " ε-cyclase transcript " is meant the part of transcribing of ε-cyclase gene, wherein except the sequence of coding ε-cyclase, also contain such as non-coding sequence, as UTRs.

Think the RNA of " with the intrinsic ε-cyclase of plant identical " to the small part promoter sequence preferably be meant with ε-cyclase promoter sequence that is to say the RNA sequence that corresponding RNA sequence is identical to the theoretical transcript of small part.

Think that intrinsic ε-cyclase " part " promoter sequence of the intrinsic ε-cyclase of plant " part " transcript or plant is meant the partial sequence from several base-pairs to the as many as full sequence in transcript or the promoter sequence.By those skilled in the art by the normal experiment optimal length of determining section sequence easily.

Usually, the length of partial sequence is at least 10 bases and maximum 2kb, be preferably at least 25 bases and maximum 1.5kb, particularly preferably be at least 50 bases and maximum 600 bases, very particularly preferably be at least 100 bases and maximum 500 bases, be most preferably at least 200 bases or at least 300 bases and maximum 400 bases.

Preferably, the mode that does not reduce with the activity that obtains high as far as possible specificity and other enzyme (not expecting its active reduction) is found out partial sequence.Therefore the partial sequence that is chosen in non-existent ε-cyclase part transcript in other activity and/or the ε-cyclase promoter sequence for ε-cyclase-dsRNA partial sequence is favourable.

Therefore, in particularly preferred embodiments, ε-cyclase-dsRNA contains the identical sequence of the part ε intrinsic with plant-cyclase transcript and contains 5 ' terminal or 3 ' end of the intrinsic coding ε-cyclase nucleic acid of plant.Especially, transcript 5 ' or 3 ' non-translational region are suitable for producing the selectivity duplex structure.

The invention further relates to double stranded rna molecule (dsRNA molecule), when it is imported plant (or its cell, tissue, organ or propagating materials), cause that ε-cyclase reduces.

(ε-cyclase-dsRNA) express, double stranded rna molecule preferably comprises for reducing ε-cyclase

A) contain at least a identical with at least a portion of " having a mind to " RNA-ε-cyclase transcript basically ribonucleotide acid sequence " having a mind to " RNA chain and

B) basically preferably fully and " antisense " RNA chain of " having a mind to " the chain complementation of the RNA a).

For transforming plant, preferably use the nucleic acid construct that is imported in the plant and in plant, is transcribed into ε-cyclase-dsRNA with ε-cyclase-dsRNA.

Therefore, the invention still further relates to and to be transcribed into following nucleic acid construct

B) basically preferably fully and " antisense " RNA chain of " having a mind to " the chain complementation of the RNA a).These nucleic acid constructs are also referred to as expression cassette or expression vector hereinafter.

About the dsRNA molecule, think that ε-cyclase nucleotide sequence or corresponding transcript preferably are meant the sequence according to SEQ ID NO:38 or its part.

" substantially the same " meaning is to compare with ε-cyclase target sequence, and the dsRNA sequence also can have insertion, disappearance and single point mutation, yet causes that still expression effectively reduces.Preferably, " having a mind to " chain of inhibition dsRNA and ε-cyclase gene to small part " is had a mind to " between the rna transcription basis or the homology between " antisense " chain and the ε-cyclase gene complementary strand is at least 75%, be preferably at least 80%, very particularly preferably be at least 90%, be most preferably 100%.

Reducing for causing that ε-cyclase is expressed effectively, is not to have 100% homogeneity between definitely necessary dsRNA and the ε-cyclase gene transcript.So owing to may have genetic mutation, polymorphism or evolutionary divergence, the method that the tolerance sequence departs from is favourable.Therefore, for example, it is possible utilizing dsRNA by a kind of organism ε-initial generation of cyclase sequence to suppress that ε in the another kind of organism-cyclase expresses.For this purpose, dsRNA preferably contains the sequence area of ε-cyclase gene transcript corresponding to conserved region.Can easily obtain described conserved region by the sequence comparison.

In addition, the dsRNA of " substantially the same " also can be defined as the nucleotide sequence that can hybridize (hybridizing 12-16 hour as 50 ℃ or 70 ℃) with a part of ε-cyclase gene transcript in 400mM NaCl, 40mM PIPES pH 6.4,1mM EDTA.

" complementary basically " meaning is meant with the complementary strand of " having a mind to " RNA chain and compares that " antisense " RNA chain also can have insertion, disappearance and single point mutation.Preferably, the homology between the complementary strand of " antisense " RNA chain and " having a mind to " RNA chain is at least 80%, is preferably at least 90%, very particularly preferably is at least 95%, is most preferably 100%.

In another embodiment, ε-cyclase-dsRNA comprises

A) contain at least a basically with ε-cyclase gene promoter region " have a mind to " the identical ribonucleotide acid sequence of this at least a portion of rna transcription " having a mind to " RNA chain and

B) basically preferably fully and " antisense " RNA chain of " having a mind to " the chain complementation of the RNA a).The corresponding nucleic construct that is preferably used for transforming plant comprises

A) identical with at least a portion of ε-cyclase gene promoter region basically " having a mind to " DNA chain and

B) basically preferably fully and " antisense " DNA chain of " having a mind to " the chain complementation of the DNA a).

Preferably, think that ε-cyclase promoter region is meant according to sequence SEQ ID NO:47 or its partial sequence.

Particularly,, particularly preferably use following partial sequence in order to produce the ε-cyclase-dsRNA sequence that reduces ε-cyclase activity for marigold:

SEQ ID NO:40: the fragment intentionally of ε-cyclase 5 '-stub area

SEQ ID NO:41: the antisense fragment of ε-cyclase 5 '-stub area

SEQ ID NO:42: the fragment intentionally of ε-cyclase 3 '-stub area

SEQ ID NO:43: the antisense fragment of ε-cyclase 3 '-stub area

The fragment intentionally of SEQ ID NO:47: ε-cyclase promoter

The antisense fragment of SEQ ID NO:48: ε-cyclase promoter

DsRNA can be made up of one or more polybribonucleotide chain.Obviously, in order to realize identical purpose, also can be with in multiple different the dsRNA molecule transfered cell or organism, wherein each dsRNA molecule all contains a kind of ribonucleotide acid sequence part defined above.

Can be by the independent RNA start of chain of two complementations or preferably form double-stranded dsRNA structure by the RNA start of chain of self complementation.In this case, " have a mind to " RNA chain and " antisense " RNA chain preferably with the form of oppositely " repetition " covalent bond each other.

For example, described in WO 99/53050, dsRNA also can include hairpin structure, by with catenation sequence (" joint "; Introne for example) connects " having a mind to " and " antisense " chain.The dsRNA structure of self complementation is preferred, and this is because they only need the complementary RNA chain of molar ratios such as expressing a RNA sequence and always contain.Preferably, catenation sequence is that introne is (for example from the introne of potato ST-LS1 gene; (1990) Mol Gen Genet220 (2) such as Vancanneyt GF: 245-250).

The nucleotide sequence of coding dsRNA can contain other element, for example transcription stop signals or polyadenylation signal.

Yet, if dsRNA at ε-cyclase promoter sequence, does not preferably contain transcription stop signals or polyadenylation signal.This can be in nucleus retention dsRNA and stop dsRNA in whole strain plant, distribute (" diffusion ").

If desire imports a cell or plant together with two chains of dsRNA, can for example implement in the following manner:

A) with the carrier transformant or the plant that contain two kinds of expression cassettes,

B) use two kinds of carrier cotransformation cells or plant, a kind of carrier contains the expression cassette with " having a mind to " chain, and another kind of carrier contains the expression cassette with " antisense " chain.

C) the different plant lines hybridization of two strains, a strain contains the expression cassette with " having a mind to " chain, and another strain contains the expression cassette with " antisense " chain.

The formation of RNA two strands can be in the extracellular or is initial in cell.

In vivo or externally all can synthesize dsRNA.Therefore, the dna sequence dna of coding dsRNA can be placed at expression cassette under at least one hereditary control element (for example promoter) control.Polyadenylation is optional, and is same, and the element of initial translation neither exist.Preferably, the expression cassette of ε-cyclase dsRNA is present on transformation construct or the conversion carrier.

In particularly preferred embodiments, by under the functional control of flower specific promoter, particularly preferably be under the described promoter of sequence SEQ ID NO:28 or its functional equivalent are partly controlled, from the initial expression of expression construct dsRNA.

Therefore, preferably will the encode expression cassette of ε-cyclase-dsRNA " antisense " and/or " having a mind to " chain or the expression cassette of coding dsRNA self complementary strand is inserted into conversion carrier and uses following method that carrier is imported in the plant cell.For the inventive method, stable to be inserted into genome be favourable.

Can be with dsRNA so that can there be the amount of a copy to import in each cell at least.Higher as required amount (for example each cell at least 5,10,100,500 or 1000 copies) can cause more high efficiency reduction.

B) the antisense RNA sequence (ε-cyclase-antisense RNA) of importing ε-cyclase

Reduce certain method of protein by " antisense " technology and repeatedly be described in plant (Sheehy etc. (1988) Proc Natl Acad Sci USA 85:8805-8809; US 4,801, and 340; (1990) FEBS Lett 268 (2) such as Mol JN: 427-430).The cell mRNA of antisense RNA molecule and the coding ε-cyclase that will be reduced and/or genomic DNA hybridization or combine.This can suppress transcribing and/or translating of ε-cyclase.In a usual manner by the stable two strands of formation or under the situation that is genomic DNA, by hybridizing in the zanjon that antisense nucleic acid molecule is incorporated into genomic DNA double-stranded DNA spiral with special interaction.

According to the basepairing rule of Watson and Crick, utilize the nucleotide sequence of this ε-cyclase of coding, for example, can access ε-cyclase-antisense RNA according to the nucleotide sequence of SEQ ID NO:38.The full length mRNA complementation that ε-cyclase-antisense RNA can be transcribed with ε-cyclase, can be confined to the code area complementation or only by forming with the complementary oligonucleotides of the coding of mRNA or non-coding sequence part.For example, this oligonucleotides can with the regional complementarity that contains ε-cyclase translation initiation part.ε-cyclase-antisense RNA length can be for example 5,10,15,20,25,30,35,40,45 or 50 nucleotides, but also may be longer and contain at least 100,200,500,1000,2000 or 5000 nucleotides.In the context of the inventive method, ε-cyclase-antisense RNA preferably is expressed in the target cell with recombination form.

In particularly preferred embodiments, antisense RNA particularly preferably is under the control of the described promoter of SEQ ID NO:28 or its functional equivalent part by the initial expression of expression construct under the functional control of flower specific promoter.

Described expression cassette can be the part of transformation construct or conversion carrier, perhaps can import by cotransformation.

In the embodiment that is more preferably, can be by complementary with ε-cyclase gene control region (for example ε-cyclase promoter and/or enhancer) and suppress the expression of ε-cyclase with the nucleotide sequence of dna double spiralization triple-helix structure, thus transcribing of ε-cyclase gene reduced.Corresponding method (Helene C (1991) Anticancer Drug Res 6 (6): 569-84 has been described; (1992) Ann NY Acad Sci 660:27-36 such as Helene C; Maher LJ (1992) Bioassays 14 (12): 807-815).

In another embodiment, ε-cyclase-antisense RNA can be a α-different nucleic acid.This type of α-different nucleic acid molecules and complementary RNA form special double-stranded crossbred, and be wherein opposite with the β-nucleic acid of routine, its two chain directions parallel ((1987) Nucleic Acids Res15:6625-6641 such as Gautier C).

C) import the ε-cyclase-antisense RNA that combines with ribozyme

Advantageously, above-mentioned antisense strategy can combine with the ribozyme method.Catalysis RNA molecule or ribozyme can be designed and be applicable to any purpose target RNA and at special site fracture phosphodiester backbone, this can functional inactivation target RNA (Tanner NK (1999) FEMS Microbiol Rev23 (3): 257-275).Ribozyme self is not modified as a result, but other targets RNA molecule that can rupture in a similar manner, this has just given the characteristic of its enzyme.Ribozyme sequence is integrated with " antisense " RNA and given these " antisenses " RNA this kind of enzyme sample RNA cutting characteristic clearly, and therefore increased the efficient of its inactivation target RNA.The generation and the purposes (especially seeing (1988) Nature 334:585-591 such as Haseloff) of corresponding ribozyme " antisense " RNA molecule have been described; Haselhoff and Gerlach (1988) Nature 334:585-591; (1992) EMBO J11 (4): 1525-1530 such as Steinecke P; (1996) Mol Gen Genet.250 (3) such as de Feyter R: 329-338).

In this kind mode, ribozyme (" hammerhead shape " ribozyme for example; Haselhoff and Gerlach (1988) Nature 334:585-591) can be used in catalytic cutting with the ε-cyclase mRNA that is reduced, thereby and stop its translation.The ribozyme technology can improve the efficient of antisense strategy.The method that expression is used for reducing the ribozyme of some protein is described in (EP 0 291 533, EP 0 321 201, EP 0 360 257).Describe ribozyme in the plant cell equally and expressed ((1992) EMBO J 11 (4): 1525-1530 such as Steinecke P; (1996) Mol Gen Genet.250 (3) such as de Feyter R: 329-338).For example, described in " Steinecke P; ribozyme; Methods in Cell Biology 50; editors such as Galbraith, Academic Press, Inc. (1995); 449-460 page or leaf ", by the secondary structure of ribozyme and target RNA being calculated and can being determined suitable target sequence and ribozyme ((1992) Plant Mol Biol.18 (2): 353-361 such as Bayley CC by its interaction; (1994) Mol Gen Genet.242 (6) such as Lloyd AM and Davis RW: 653-657).For example, can make up tetrahymena (Tetrahymena) the L-19 IVS RNA derivative (also see US 4,987,071 and US 5,116,742) in zone with the ε-cyclase mRNA complementation that suppresses with desire.In addition, by also can determine this type of ribozyme (Bartel D and Szostak JW (1993) Science 261:1411-1418) from different ribozyme library screening methods.

D) import ε-cyclase and have a mind to RNA sequence (ε-cyclase-have a mind to RNA) to induce common inhibition

Express the common inhibition that ε-cyclase RNA sequence (or its part) can cause corresponding ε-cyclase gene to have a mind to direction.Can reduce or close its expression with the expression of RNA intentionally of endogenous ε-cyclase gene homology, describe similar manner (Jorgensen etc. (1996) the Plant Mol Biol 31 (5): 957-973 that is used for the antisense method; Goring etc. (1991) Proc Natl Acad SciUSA 88:1770-1774; Smith etc. (1990) Mol Gen Genet 224:447-481; Napoli etc. (1990) Plant Cell 2:279-289; (1990) Plant Cell 2:291-99 such as Van der Krol).In this article, the construct that is imported can be represented will reduce whole or homeologous gene only.May not need translation.Described this technology has been applied to plant ((1990) Plant Cell 2:279-289 such as Napoli for example, US 5,034, in 323).

Preferably, utilize basically with coding ε-cyclase to the identical sequence of small part nucleotide sequence, for example according to the nucleotide sequence of SEQ ID NO:38, realize suppressing altogether.Preferably, to such an extent as to selection ε-cyclase-translation of ε-cyclase or its part can not take place in RNA intentionally.Therefore, for example, can select 5 '-non-translational region or 3 '-non-translational region, the ATG initiation codon of perhaps also can deleting or suddenly change.

E) implanting needle is to ε-cyclase gene, RNA or protein DNA-or protein-binding factor

Utilize specific DNA-binding factor, for example utilize the zinc finger transcription factor type factor, also may reduce ε-cyclase and express.These factors are incorporated into the endogenous target gene genome sequence and list, and preferably are incorporated into control region, and cause that expression reduces.Correlation technique ((2001) J Biol Chem 276 (31): the 29466-78 such as Dreier B that produces the corresponding factor has been described; (2000) J Mol Biol303 (4): 489-502 such as Dreier B; (2000) Proc Natl Acad Sci USA97 (4): 1495-1500 such as Beerli RR; (2000) J Biol Chem 275 (42): 32617-32627 such as Beerli RR; Segal DJ and Barbas CF 3rd. (2000) Carr Opin Chem Biol 4 (1): 34-39; KangJS and Kim JS (2000) J Biol Chem 275 (12): 8742-8748; (1998) Proc Natl Acad Sci USA 95 (25): 14628-14633 such as Beerli RR; (1997) Proc NatlAcad Sci USA 94 (8): 3616-3620 such as Kim JS; Klug A (1999) J Mol Biol 293 (2): 215-218; (1998) Adv Drug Deliv Rev 30 (1-3): 23-31 such as Tsai SY; (2000) Proc Natl Acad Sci USA 97 (8): 3930-3935 such as Mapp AK; (1997) Int JBiochem Cell Biol 29 (12): 1371-1387 such as Sharrocks AD; (2000) J Biol Chem275 (43) such as Zhang L: 33850-33860).

Utilize any purpose fragment of ε-cyclase gene can select these factors.Preferably, this part is in promoter region.Yet, suppressing for gene, this part also can be positioned at coding extron or introne zone.

In addition, the factor of inhibition ε-cyclase self also can transfered cell.These protein-binding factors can be for example fit (aptamer) (Famulok M and Mayer G (1999) Curr TopMicrobiol Immunol 243:123-36) or antibody or antibody fragment or single-chain antibody.Preparation to these factors is described ((1992) Biotechnology (N Y) 10 (7): 790-794 such as Owen M; (1997) Curr Opin Biotechnol 8 (4): 411-416 such as Franken E; Whitelam (1996) Trend Plant Sci 1:268-272).

F) import nucleic acid sequence and the expression construct that causes ε-cyclisation ribozyme degraded

By virus expression systems is imported plant, induce special ε-cyclisation ribozyme degraded can realize that also ε-cyclase expression reduces (Amplikon; (1999) Plant J20 (3) such as Angell SM: 357-362).Use the viral vectors nucleotide sequence that has homology with the ε-cyclase transcript that will reduce, these systems are also referred to as " VIGS " (gene silencing of virus induction) import plant.Close then and transcribe, infer that this passes through the plant defense mechanism mediation at virus.Corresponding techniques and method ((2001) Plant J 25 (2): 237-45 such as Ratcliff F has been described; Fagard M and Vaucheret H (2000) Plant Mol Biol 43 (2-3): 285-93; (1998) Proc Natl Acad Sci USA 95 (22): 13079-84 such as Anandalakshmi R; Ruiz MT (1998) Plant Cell10 (6): 937-46).

Preferably, utilize basically with coding ε-cyclase for example realize the minimizing of VIGS-mediation to the identical sequence of small part nucleotide sequence according to the nucleotide sequence of SEQ ID NO:1.

G) import the construct that produces ε-cyclase gene afunction or function reduction

Those skilled in the art know in a large number the method about genome sequence can be modified by specificity.Particularly, these methods for example comprise producing by the target reorganization and knock out sudden change, for example produce terminator codon, reading frame displacement etc. (Hohn B and Puchta H (1999) Proc NatlAcad Sci USA 96:8321-8323) or utilize such as sequence-specific recombinase or ribozyme (as follows) produces the target disappearance or sequence is reverse.

Also can realize the reduction of ε-cyclase quantity, function and/or activity by (for example by intermolecular homologous recombination method) in the sequence that nucleotide sequence (for example desire in the methods of the invention be inserted into nucleotide sequence) target is inserted into coding ε-cyclase.In the context of the present embodiment, preferably use contain at least a portion ε-cyclase gene sequence or flanking sequence and therefore can be in target cell specifically with the DNA construct of these sequences reorganization, thereby disappearance, add or substitute at least one nucleotides so that the functional reduction of ε-cyclase gene or the mode removed fully change ε-cyclase gene.This changes also can be at ε-cyclase gene controlling element (for example promoter), thereby coded sequence is remained unchanged, and stops or reducing and express (transcribe and/or translate).In conventional homologous recombination, 5 ' of the sequence of being inserted-and/or the 3 '-distolateral wing contain other have sufficient length and with ε-cyclase gene corresponding sequence (A and B) homology so that can produce the nucleotide sequence (A ' or B ') of homologous recombination.This length arrives (Thomas KR and Capecchi MR (1987) Cell 51:503 within several thousand base scopes in a hundreds of base usually; Strepp etc. (1998) Proc Natl Acad Sci USA95 (8): 4368-4373).For homologous recombination, use method described below to select the successfully clone of reorganization with the recombinant precursor transformed plant cells and based on resulting inactivation ε-cyclase.

In another preferred embodiment, by the raising recombination efficiency that combines with the method that promotes homologous recombination.Described these class methods, and comprised and for example express RecA protein, perhaps handled with the PARP inhibitor.Have been found that and utilize the PARP inhibitor can increase intrachromosomal homologous recombination in the tobacco plant ((1995) Plant J 7:203-210 such as Puchta H).By using these inhibitor, the efficient of homologous recombination rate and transgenic sequence disappearance can further improve in the special dna double chain fracture back recombinant precursor of induced sequence.Can use multiple PARP inhibitor.These inhibitor preferably include for example 3-aminobenzamide, 8-hydroxy-2-methyl quinazoline-4-one (NU1025), 1,11b-dihydro-[2H] chromene-[4,3,2-de] isoquinolin-3-ketone (GPI 6150), 5-aminoisoquinoline ketone, 3,4-dihydro-5-[4-(1-piperidyl) butoxy]-1-(2H) isoquinolines, or be described in material among WO 00/26192, WO 00/29384, WO 00/32579, WO 00/64878, WO 00/68206, WO 00/67734, WO 01/23386 and the WO 01/23390.

Other suitable method is that non-sense mutation is imported endogenous labelled protein plasmagene, for example by the RNA/DNA oligonucleotides being imported method (Zhu etc. (2000) the Nat Biotechnol18 (5): 555-558) of plant, perhaps knock out sudden change (Koncz etc. by producing such as T-DNA mutagenesis, PlantMol.Biol.1992,20 (5): 963-976).Just known " chimeric prosthetic (chimeraplasty) " also can produce point mutation (Cole-Strauss etc. (1999) NuclAcids Res 27 (5): 1323-1330 by the DNA-RNA heterozygote; Kmiec (1999) Gene therapy American Scientist87 (3): 240-247).

The dsRNAi method, by have a mind to the common inhibition of RNA and " VIGS " (" gene silencing of virus induction ") be also referred to as " PTGS " (PTGS) or " transcriptional gene silencing " (TGS).Since to the labelled protein plasmagene that will reduce and transgene expression intentionally or the demand of the homology between the dsRNA nucleotide sequence be lower than antisense method such as classics, so the PTGS/TGS method is particularly advantageous.Therefore, using labelled protein nucleotide sequence from species also can effectively reduce the expression of homology labelled protein in another species and not need separates and the structure explanation the labelled protein homologue that wherein exists.This has greatly reduced workload.

In the inventive method particularly preferred embodiment, compare with wild type and to reduce ε-cyclase activity by the following method:

A) with at least a double-stranded ε-cyclase RNA sequence guarantee an expression cassette of its expression or a plurality of expression cassette import plant and/or

B) with at least a ε-cyclase antisense RNA sequence or guarantee that the expression cassette of its expression imports plant.

In embodiment very particularly preferably, compare with wild type by with at least a double-stranded ε-cyclase RNA sequence or guarantee an expression cassette of its expression or a plurality of expression cassette imports plant and reduces ε-cyclase activity.

In preferred embodiments, use the genetically modified plant that in it is spent, has minimum ε-cyclase expression rate.

This by to spend special mode, particularly preferably is to reduce ε-cyclase activity in the special mode of floral leaf to realize preferably.

In above-mentioned particularly preferred embodiment, this is by spending under the specific promoter control or also being more preferably to transcribe ε-cyclase-dsRNA sequence under the control of floral leaf specific promoter to realize.

In another preferred embodiment, the plant of being cultivated is compared with wild type and also has at least a following activity rising that is selected from addition: the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid-synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, prenyl diphosphate ester-Δ isomerase activity, Mang ox base-bisphosphate synthase activity, the farnesyl diphosphate synthase activity, Mang ox base Mang ox bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtISO activity, active and the MinD activity of FtsZ.

Think that the HMG-CoA reductase activity meaning is meant the HMG-CoA reductase (enzymatic activity of (3-hydroxy-3-methylglutaryl-coenzyme A reductase).

Think that the HMG-CoA reductase meaning is meant to have the protein that 3-hydroxy-3-methyl glutaryl coenzyme-A is converted into this enzymatic activity of mevalonic acid.

Therefore, think that the HMG-CoA reductase activity meaning is meant the amount of the 3-hydroxy-3-methyl glutaryl coenzyme-A that is transformed by protein HMG-CoA reductase in special time, or the amount of the mevalonic acid that forms.

Therefore, have the HMG-CoA reductase activity of comparing raising with wild type, promptly compare in special time the amount of the 3-hydroxy-3-methyl glutaryl coenzyme-A that transforms by protein HMG-CoA reductase or the amount of the mevalonic acid that forms increases with wild type.

Preferably, the HMG-CoA reductase activity is compared with wild type HMG-CoA reductase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.Think that the HMG-CoA reductase activity meaning is meant the enzymatic activity of HMG-CoA reductase.Genetically modified plant of the present invention and wild type or preferably measure under the following conditions with reference to HMG-CoA reductase activity in the plant:

In mortar, add liquid nitrogen and carry out extracting from 1: 1 to 1: 20 extraction buffer solution by the powerful grinding freezing vegetable material of homogenate and with ratio.Described ratio depends on obtainable enzymatic activity in the vegetable material, so that the mensuration of enzymatic activity and quantitatively can be in linear measures range.Generally, extract buffer solution and can contain 50mM HEPES-KOH (pH 7.4), 10mM MgCl ₂, 10mM KCl, 1mMEDTA, 1mM EGTA, 0.1% (v/v) Triton X-100,2mM EACA, 10% glycerine, 5mM KHCO ₃Before the extraction, add 2mM DTT and 0.5mM PMSF immediately.

Can measure HMG-CoA reductase activity (Schaller for example, Grausem, Benveniste, Chye, Tan, Song and Chua, Plant Physiol.109 (1995), 761-770 according to disclosed description; Chappell, Wolf, Proulx, Cuellar and Saunders, Plant Physiol.109 (1995) 1337-1343).Plant tissue can be at cold buffer solution (100mM potassium phosphate (pH 7.0), 4mM MgCl ₂, 5mM DTT) in carry out homogenate and extracting.With homogenate centrifugal 15 minutes of 4 ℃ of 10 000g.Subsequently with supernatant once more with the centrifugal 45-60 of 100 000g minute.Measure in the supernatant and HMG-CoA reductase activity in the microsomal fraction sediment (being resuspended in after 100mM potassium phosphate (pH 7.0) and the 50mM DTT).With every part of solution and suspension (protein content is equivalent to about 1-10 μ g in the suspension) in 30 ℃ contain 3mM NADPH and 20 μ M ( ¹⁴C) in the 100mM kaliumphosphate buffer (pH 7.0) of HMG-CoA (58 μ Ci/ μ M), volume of ideal is 26 μ l, hatches 15-60 minute.Add 5 μ l mevalonolactones (1mg/ml) and 6N HCl cessation reaction.After the adding, with mixture incubated at room 15 minutes.Formed in saturated potassium phosphate solution of 125 μ l (pH 6.0) and the 300 μ l ethyl acetate quantitative reactions by adding ( ¹⁴C) mevalonic acid.Mixture is fully mixed also centrifugal.By measuring the scintillation measuring radioactivity.

(E)-and 4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, be also referred to as lytB or IspH, be considered to the enzymatic activity that the meaning is meant (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase.

Think that (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase meaning is meant to have the protein that (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate is converted into the enzymatic activity of prenyl diphosphate ester and dimethyl-allyl bisphosphate.

Therefore, think that (E)-4-hydroxy-3-methyl but-2-ene base-the bisphosphate reductase activity meaning is meant the amount of (the E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate that is transformed by protein (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase in special time, or the prenyl diphosphate ester that forms and the amount of dimethyl-allyl bisphosphate.

Therefore, when comparing (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity with wild type and improve, compare the amount of (the E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate that in special time, transforms with wild type, or the amount of prenyl diphosphate ester that forms and dimethyl-allyl bisphosphate increases by protein (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase.

Preferably, (E)-base-the bisphosphate reductase activity is compared increases by 5% at least for 4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity and wild type (E)-4-hydroxy-3-methyl but-2-ene, more preferably be at least 20%, more preferably be at least 50%, more preferably be at least 100%, more preferably be at least 300%, being more preferably increases by 500% at least, and especially at least 600%.

Genetically modified plant of the present invention and wild type or preferably measure under the following conditions with reference to (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity in the plant:

Can measure (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity by immunology detection.The generation of specific antibody is by Rohdich and the colleague (Rohdich that describes thereof, Hecht, G_rtner, Adam, Krieger, Amslinger, Arigoni, Bacher and Eisenreich: to the metabolism of the research of non-mevalonic acid terpenes biosynthesis pathway: IspH (LytB) albumen, Natl.Acad.Natl.Sci.USA 99 (2002), 1158-1163).Mensuration about catalytic activity, Altincicek and colleague (Altincicek thereof, Duin, Reiehenberg, Hedderich, Kollas, Hintz, Wagner, Wiesner, Beck and Jomaa: in the isoprenoid biosynthesis, the final step of LytB albumen catalysis 2-C-methyl D-erythrite-4-phosphate approach; FEBS Letters 532 (2002) 437-440) describe a kind of vitro system tracking (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate and be reduced into prenyl diphosphate ester and dimethyl-allyl bisphosphate.

Think that the active meaning of 1-deoxidation-D-wood sugar-5-phosphate synthase is meant the enzymatic activity of 1-deoxidation-D-wood sugar-5-phosphate synthase.

Think that 1-deoxidation-D-wood sugar-5-phosphate synthase meaning is meant to have the protein that ethoxy-ThPP and glyceraldehyde 3-phosphate is converted into the enzymatic activity of 1-deoxidation-D-wood sugar-5-phosphoric acid.

Therefore, think that the active meaning of 1-deoxidation-D-wood sugar-5-phosphate synthase is meant the ethoxy-ThPP that transformed by protein 1-deoxidation-D-wood sugar-5-phosphate synthase and/or the amount of glyceraldehyde 3-phosphate in special time, or the amount of the 1-deoxidation-D-wood sugar-5-phosphoric acid that forms.

Therefore, when comparing the active raising of 1-deoxidation-D-wood sugar-5-phosphate synthase with wild type, compare the ethoxy-ThPP that in special time, transforms and/or the amount of glyceraldehyde 3-phosphate with wild type, or the amount of the 1-deoxidation-D-wood sugar-5-phosphoric acid that forms increases by protein 1-deoxidation-D-wood sugar-5-phosphate synthase.

Preferably, 1-deoxidation-D-wood sugar-5-phosphate synthase is active compares with wild type 1-deoxidation-D-wood sugar-5-phosphate synthase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, 1-deoxidation-D-wood sugar-5-phosphate synthase activity is preferably measured under the following conditions:

The reactant mixture (50-200 μ l) of measuring D-1-deoxy-D-xylulose sugar-5-phosphate synthase activity (DXS) contains 100mM Tris-HCl (pH 8.0), 3mM MgCl ₂, 3mM MnCl ₂, 3mM ATP, 1mM thiamine bisphosphate, 0.1% polysorbate60,1mM potassium fluoride, 30 μ M (2- ¹⁴C) pyruvic acid (0.5 μ Ci), 0.6mM DL-3-glyceraldehyde phosphate.Plant extracts was hatched in reaction solution 1-2 hour in 37 ℃.Subsequently, be heated to 80 ℃ of 3 minutes cessation reactions.Leave after the heart 5 minutes with per minute 13 000, the evaporation supernatant is resuspended in 50 μ l methyl alcohol with residue, be applied to the TLC plate carry out thin-layer chromatography (silica gel 60, Merck is Darmstadt) and in normal propyl alcohol/ethyl acetate/water (6: 1: 3; V/v/v) separate in.Radiolabeled D-1-deoxy-D-xylulose sugar-5-phosphoric acid (or D-1-deoxy-D-xylulose sugar) and (2- ¹⁴C) pyruvic acid separates.Use scintillation counter to carry out quantitatively.This method has been described in Harker and Bramley (FEBS Letters 448 (1999) 115-119).In addition, the fluorimetry of mensuration DXS synthase activity is described (Analytical Biochemistry 296 (2001) 101-105) by Querol and colleague thereof.

Think that 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity meaning is meant the enzymatic activity of 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase.

Think that 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase meaning is meant to have 1-deoxidation-D-wood sugar-5-phosphoric acid is converted into the protein of the enzymatic activity of beta carotene.

Therefore, think that 1-deoxidation-D-wood sugar-the 5-phosphoric acid reduction isomerase activity meaning is meant the amount of the 1-deoxidation-D-wood sugar-5-phosphoric acid that is transformed by protein 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase in special time, or the amount of the prenyl diphosphate ester that forms.

Therefore, when comparing 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity with wild type and improve, compare the amount of the 1-deoxidation-D-wood sugar-5-phosphoric acid that in special time, transforms with wild type, or the amount of the prenyl diphosphate ester that forms increases by protein 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase.

Preferably, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity is compared with wild type 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity is preferably measured under the following conditions:

The activity of D-1-deoxy-D-xylulose sugar-5-phosphoric acid reduction isomerase (DXR) is containing 100mMTris-HCl (pH 7.5), 1mM MnCl ₂, 0.3mM NADPH and 0.3mM 1-deoxy-D-xylulose-4-phosphoric acid buffer solution in measure, wherein 1-deoxy-D-xylulose-4-phosphoric acid can zymetology synthesize, (Kuzuyama for example, Takahashi, Watanabe and Seto:Tetrahedon letters39 (1998) 4509-4512).Add plant extracts and begin reaction.Reaction volume is generally 0.2 to 0.5ml; Hatched 30-60 minute for 37 ℃.Between incubation period, use the oxidation of photometer tracking and measuring NADPH at the 340nm place.

Think that prenyl diphosphate ester Δ-isomerase activity meaning is meant the enzymatic activity of isopentene group-bisphosphate Δ-isomerase.

Think that isopentene group-bisphosphate Δ-isomerase meaning is meant to have the protein that the prenyl diphosphate ester is converted into the enzymatic activity of dimethyl-allyl phosphate.

Therefore, think that isopentene group-bisphosphate Δ-isomerase activity meaning is meant the amount of the prenyl diphosphate ester that is transformed by isopentene group-bisphosphate Δ-isomerase in special time or the amount of the dimethyl-allyl phosphate that forms.

Therefore, when comparing isopentene group-bisphosphate Δ-isomerase activity with wild type and improve, compare the amount of the prenyl diphosphate ester that in special time, transforms with wild type or the amount of the dimethyl-allyl phosphate that forms increases by protein isopentene group-bisphosphate Δ-isomerase.

Preferably, isopentene group-bisphosphate Δ-isomerase activity is compared with wild type isopentene group-bisphosphate Δ-isomerase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, isopentene group-bisphosphate Δ-isomerase activity is preferably measured under the following conditions:

According to can measure the active (Fraser of isopentene group-bisphosphate isomerase (IPP isomerase) by the Fraser and the disclosed method of working together thereof, R_mer, Shipton, Mills, Kiano, Misawa, Drake, Sehuch and Bramley: the transgene tomato plant of extra phytoene synthase is expressed in assessment in the fruit specific mode; Proc.Natl.Acad.Sci.USA 99 (2002), 1092-1097, and it is based on Fraser, Pinto, Holloway and Bramley, Plant Journal 24 (2000), 551-558).For enzymatic determination, use 0.5 μ Ci (1- ¹⁴C) IPP (isopentenyl pyrophosphate ester) (56mCi/mmol, Amersham plc) is containing 1mM DTT, 4mM MgCl as substrate ₂, 6mM MnCl ₂, 3mM ATP, 0.1% polysorbate60,1mM potassium fluoride 0.4M Tris-HCl (pH 8.0) in volume be that about 150-500 μ l is hatched.Extract is mixed (for example with 1: 1 ratio) with buffer solution and hatched at least 5 hours at 28 ℃.Subsequently, add about 200 μ l methyl alcohol and hatch at 37 ℃ and carried out acid hydrolysis in about 1 hour by adding concentrated hydrochloric acid (final concentration is 25%).Then, use benzinum (mixing) to carry out twice and repeat extracting (each 500 μ l) with 10% diethyl ether.The use scintillation counter is measured the radioactivity in each upper strata phase (hyperphase).The short incubation period of using 5 minutes can be measured the specific enzymes activity because the formation of short reaction time inhibitory reaction accessory substance (see L ü tzow and Beyer: isopentene group in the daffodil chromoplast-bisphosphate Δ-isomerase and with the relation of phytoene synthase complex; Biochim.Biophys.Acta 959 (1988), 118-126).

Think that Mang ox base-bisphosphate synthase activity meaning is meant the enzymatic activity of Mang ox base-bisphosphate synthase.

Think that the Mang ox base-bisphosphate synthase meaning is meant to have the protein that prenyl diphosphate ester and dimethyl-allyl phosphate is converted into the enzymatic activity of Mang ox base-bisphosphate.

Therefore, think that the Mang ox base-bisphosphate synthase activity meaning is meant the prenyl diphosphate ester that transformed by protein Mang ox base-bisphosphate synthase and/or the amount of dimethyl-allyl phosphate in special time, or the amount of the Mang ox base-bisphosphate that forms.

Therefore, when comparing Mang ox base-bisphosphate synthase activity with wild type and improve, compare the prenyl diphosphate ester that in special time, transforms and/or the amount of dimethyl-allyl phosphate with wild type, or the amount of the Mang ox base-bisphosphate that forms increases by protein Mang ox base-bisphosphate synthase.

Preferably, Mang ox base-bisphosphate synthase activity is compared with wild type Mang ox base-bisphosphate synthase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, Mang ox base-bisphosphate synthase activity is preferably measured under the following conditions:

Can be determined at 50mM Tris-HCl (pH 7.6), 10mMMgCl after adding plant extracts ₂, 5mM MnCl ₂, 2mM DTT, 1mM ATP, 0.2% Tween-20,5 μ M ( ¹⁴C) activity of the Mang ox base-bisphosphate synthase (GPP synthase) among IPP and the 50 μ M DMAPP (dimethylallylpyrophosphate ester) is (according to Bouvier, Suire, d ' Harlingue, Backhaus and Camara: the molecular cloning of Mang ox base-bisphosphate synthase and the compartmentation that monoterpene synthesizes in plant cell, Plant Journal 24 (2000) 241-252).Hatch for 37 ℃, after 2 hours, with the product dephosphorylation (according to Koyama, Fuji and Ogura: the enzymatic hydrolysis of polyisoprene pyrophosphate, Methods Enzymol.110 (1985), 153-155) also mix determination method analysis (Dogbo with TLC and radioactivity, Bardat, Quennemet and Camara: the metabolism of plastid terpenoid: synthetic by the external inhibition phytoene of phenethyl pyrophosphate (phenethyl pyrophosphate) derivative, FEBS Letters 219 (1987) 211-215).

Think that the farnesyl diphosphate synthase activity meaning is meant the enzymatic activity of farnesyl diphosphate synthase.

Think that the farnesyl diphosphate synthase meaning is meant to have the protein that Mang ox base bisphosphate and prenyl diphosphate ester is converted into the enzymatic activity of farnesyl diphosphate.

Therefore, the farnesyl diphosphate synthase activity is the Mang ox base bisphosphate that transformed by protein farnesyl bisphosphate synthase in special time and the amount of prenyl diphosphate ester, or the amount of the farnesyl diphosphate that forms.

Therefore, when comparing the raising of farnesyl diphosphate synthase activity with wild type, compare the amount of basic bisphosphate of the Mang ox that in special time, transforms and prenyl diphosphate ester with wild type, or the amount of the farnesyl diphosphate that forms increases by protein farnesyl bisphosphate synthase.

Preferably, the farnesyl diphosphate synthase activity is compared with wild type farnesyl diphosphate synthase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, the farnesyl diphosphate synthase activity is preferably measured under the following conditions:

According to the method for Joly and Edwards can measure farnesylpyrophosphate synthase (FPP synthase) activity (Journal of Biological Chemistry 268 (1993), 26983-26989).In view of the above, at 10mM HEPES (pH 7.2), 1mM MgCl ₂, 1mM dithiothreitol (DTT), 20 μ M Mang oxen base pyrophosphate and 40 μ M (1- ¹⁴C) measure enzymatic activity in isopentenyl pyrophosphate ester (4Ci/mmol) buffer solution.Reactant mixture is hatched at 37 ℃; Add 2.5N HCl (in 70% ethanol that contains 19 μ g/ml farnesol) cessation reaction.Then by carrying out acid hydrolysis hydrolysis product in 30 minutes at 37 ℃.Add the 10%NaOH neutralise mixt, and carry out extracting by vibrating with hexane.Utilizing scintillation counter to measure every part of hexane mixes to measure radioactivity.

In addition, after plant extracts and radiolabeled IPP hatched, (Silica-Gel SE60 Merck) can reaction product isolated by thin-layer chromatography in benzene/methyl alcohol (9: 1).The radiolabeled product of wash-out and measure radioactivity (according to Gaffe, Bru, Causse, Vidal, Stamitti-Bert, Carde and Gallusci: a kind of tomato farnesylpyrophosphate gene LEFPS1 of high expressed during the fruit early development; Plant Physiology 123 (2000) 1351-1362).

Think that the Mang ox base Mang ox base bisphosphate synthase activity meaning is meant the enzymatic activity of Mang ox base Mang ox base bisphosphate synthase.

Think that the Mang ox base Mang ox base bisphosphate synthase meaning is meant to have the protein that farnesyl diphosphate and prenyl diphosphate ester is converted into the enzymatic activity of Mang ox base Mang ox base bisphosphate.

Therefore, think that the Mang ox base Mang ox base bisphosphate synthase activity meaning is meant the farnesyl diphosphate that transformed by protein Mang ox base Mang ox base bisphosphate synthase and/or the amount of prenyl diphosphate ester in special time, or the amount of the Mang ox that forms base Mang ox base bisphosphate.

Therefore, when comparing the raising of Mang ox base Mang ox base bisphosphate synthase activity with wild type, compare the farnesyl diphosphate that in special time, transforms and/or the amount of prenyl diphosphate ester with wild type, or the amount of the Mang ox that forms base Mang ox base bisphosphate increases by protein Mang ox base Mang ox base bisphosphate synthase.

Preferably, Mang ox base Mang ox base bisphosphate synthase activity is compared with wild-type activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, Mang ox base Mang ox base bisphosphate synthase activity is preferably measured under the following conditions:

Can measure the activity (Biochim.Biophys.Acta 920 (1987), 140-148: by affinity chromatography from capsicum chromoplast purifying isopentenyl pyrophosphate ester isomerase and Mang ox base Mang ox base pyrophosphate synthase) of Mang ox base Mang ox base pyrophosphate synthase (GGPP synthase) according to Dogbo and the described method of Camara.Therefore, plant extracts is joined buffer solution (50mM Tris-HCl (pH 7.6), the 2mM MgCl that cumulative volume is approximately 200 μ l ₂, 1mM MnCl ₂, 2mM dithiothreitol (DTT), (1- ¹⁴C) IPP (0.1 μ Ci, 10 μ M), 15 μ M DMAPP, GPP or FPP) in.Hatch 1-2 hour (or longer) at 30 ℃.Add 0.5ml ethanol and 0.1ml 6N HCl cessation reaction.37 ℃ hatched 10 minutes after, with 6N NaOH neutralization reaction mixture, mixes with 1ml water and vibrates and carry out extracting with the 4ml ether.Utilize scintillation counter to measure radioactivity in a ether phase (as 0.2ml).In addition, after the acid hydrolysis, but by the radiolabeled prenol of vibration extracting in ether and by HPLC (25cm Spherisorb ODS-1 post, 5 μ m; With methanol (90: 10; V/v) with 1ml/ minute flow velocity wash-out) separate, and by monitoring radioactivity quantitative (Wiedemann, Misawa and Sandmann :) from the purifying and the enzymatic property of Mang ox base Mang ox base pyrophosphate synthase behind expression in escherichia coli of having a liking for summer spore Erwinia (Erwiniauredovora).

Think that the active meaning of phytoene synthase is meant the enzymatic activity of phytoene synthase.

Think that the phytoene synthase meaning is meant to have the protein that the terminal linear residue of lycopene is converted into the enzymatic activity of β-ionone ring.

Particularly, think that the phytoene synthase meaning is meant to have the protein that Mang ox base Mang ox base bisphosphate is converted into the enzymatic activity of phytoene.

Therefore, think that the active meaning of phytoene synthase is meant the amount of the Mang ox base Mang ox base bisphosphate that is transformed by the protein phytoene synthase in special time, or the amount of the phytoene that forms.

Therefore, when comparing the active raising of phytoene synthase with wild type, compare the amount of the Mang ox base Mang ox base bisphosphate that in special time, transforms with wild type by the protein phytoene synthase, or the increase of the amount of the phytoene that forms.

Preferably, think that phytoene synthase is active and compare with wild type phytoene synthase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, the phytoene synthase activity is preferably measured under the following conditions:

Can measure the active (Fraser of phytoene synthase (PSY) by the Fraser and the disclosed method of working together thereof, Romer, Shipton, Mills, Kiano, Misawa, Drake, Schuch and Bramley: the transgene tomato plant is expressed the assessment of extra phytoene synthase in the fruit specific mode, and Proc.Natl.Acad.Sci.USA 99 (2002), 1092-1097, it is based on Fraser, Pinto, Holloway and Bramley, Plant Journal 24 (2000) 551-558).For enzyme assay, with ( ³H) (15mCi/mM, AmericanRadiolabeled Chemicals St.Louis) are containing 1mM DTT, 4mMMgCl as substrate to Mang ox base Mang ox base pyrophosphate ₂, 6mM MnCl ₂, 3mM ATP, 0.1% polysorbate60,1mM potassium fluoride 0.4MTris-HCl (pH 8.0) in carry out.Plant extracts is mixed with buffer solution, is that 500 μ l are hatched with 295 μ l buffer solutions and extract with cumulative volume for example.Hatched at least 5 hours at 28 ℃.Then, with twice (each 500 μ l) vibration of chloroform extracting phytoene.In course of reaction, use methanol (95: 5; V/v) on silica plate, utilize TLC to separate formed radiolabeled phytoene.(by heating several iodine crystal) can identify phytoene on silica plate under rich iodine environment.With the phytoene standard items as reference.Amount by scintillation counter determination method detection of radioactive labels product.In addition, utilize also quantitative phytoene (Fraser, the Albrecht and Sandmann: develop the precursor of high performance liquid chromatography system of HPLC that radioactivity seeker is housed to be used for separating radiolabeled carrotene and forming in specific enzymatic reaction; J.Chromatogr.645 (1993) 265-272).

Think that the active meaning of phytoene desaturase is meant the enzymatic activity of phytoene desaturase.

Think that the phytoene desaturase meaning is meant to have the protein that phytoene is converted into phytofluene and/or phytofluene is converted into the enzymatic activity of sigma carotene (zeta-carrotene).

Therefore, think that the active meaning of phytoene desaturase is meant phytoene or the amount of phytofluene or the amount of phytofluene that forms or sigma carotene that is transformed by the protein phytoene desaturase in special time.

Therefore, when comparing the active raising of phytoene desaturase with wild type, compare phytoene or the amount of phytofluene or the amount increase of phytofluene that forms or sigma carotene that in special time, transforms with wild type by the protein phytoene desaturase.

Preferably, think that phytoene desaturase is active and compare with wild type phytoene desaturase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, the phytoene desaturase activity is preferably measured under the following conditions:

By with radiolabeled ( ¹⁴C) phytoene mixes unsaturated carrotene and can measure the activity of phytoene desaturase (PDS) (as R_mer, Fraser, Kiano, Shipton, Misawa, Schuch and Bramley report: provitamin A contains heavily in the assessment transgene tomato plant; Nature Biotechnology 18 (2000) 666-669).Can be as the phytoene (Fraser of synthesizing radioactive mark as described in the Fraser, De la Rivas, Mackenzie, Bramley: phycomyces blakesleeanus (Phycomyces blakesleanus) CarB mutant: their purposes in measuring phytoene desaturase; Phytochemistry 30 (1991), 3971-3976).Can with contain 10mM MgCl ₂In the cumulative volume of 1ml, hatch the plastid film of target tissue with the 100mM MES buffer solution (pH 6.0) of 1mM dithiothreitol (DTT).Add be dissolved in the acetone ( ¹⁴C) phytoene (each situation hatch next time about 100 000 the fission/minute), wherein acetone concentration is no more than 5% (v/v).In the dark mixture was hatched about 6-7 hour 28 ℃ of vibrations.Subsequently, separate also quantitatively with three extracting pigments of about 5ml benzinum (mixing) and with the HPLC method with 10% ether.

In addition, can such as Fraser etc. report measure the activity (Fraser of phytoene desaturase, Misawa, Linden, Yamano, Kobayashi and Sandmann: expression in escherichia coli, purifying and reactivation reorganization have a liking for summer spore Erwinia phytoene desaturase, Journal ofBiological Chemistry 267 (1992), 19891-19895).

Think that the active meaning of sigma carotene desaturase is meant the enzymatic activity of sigma carotene desaturase.

Think that the sigma carotene desaturase meaning is meant to have the protein that sigma carotene is converted into neurosporene and/or neurosporene is converted into the enzymatic activity of lycopene.

Therefore, think that the active meaning of sigma carotene desaturase is meant the sigma carotene that transformed by protein sigma carotene desaturase or the amount of neurosporene in special time, or the neurosporene that forms or the amount of lycopene.

Therefore, when comparing the active raising of sigma carotene desaturase with wild type, compare the sigma carotene that in special time, transforms or the amount of neurosporene with wild type, or the amount of neurosporene that forms or lycopene increases by protein sigma carotene desaturase.

Preferably, think that the sigma carotene desaturase is active and compare with wild type sigma carotene desaturase activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, sigma carotene desaturase activity is preferably measured under the following conditions:

Can in 0.2M potassium phosphate (pH 7.8, the about 1ml of buffer solution volume), measure the analysis of sigma carotene desaturase (ZDS desaturase).Breitenbach and colleague thereof disclose the analytic approach of measuring, and (Takaichi and Sandmann: the higher plant type of expression and purifying is from the catalysis characteristics of the sigma carotene desaturase of capsicum for Breitenbach, Kuntz; European Journal ofBiochemistry.265 (1): 376-383, in October, 1999).Every kind of assay determination mixture contains 3mg and is suspended in phosphatid ylcholine, 5 μ g sigma carotenes or neurosporene, 0.02% butylated hydroxytoluene, 10 μ l decyl plastoquinones (1mM methyl alcohol is stored liquid) and plant extracts in the 0.4M kaliumphosphate buffer (pH 7.8).The volume of plant extracts is adjusted to the active amount that exists of ZDS desaturase so that may carry out quantitatively in linear measurement range.Generally when being in about 28 ℃, dark hatched about 17 hours by thermal agitation (200 rev/mins).By adding 4ml acetone 10 minutes extracting carotenoid of vibration 50 ℃ the time.In this mixture, carotenoid is transferred to benzinum phase (containing 10% ether).Under nitrogen, evaporation ether/benzinum phase is dissolved in 20 μ l again with carotenoid and utilizes the HPLC method to separate with quantitative.

Think that the active meaning of crtlSO is meant the enzymatic activity of crtlSO albumen.

Think that the crtlSO albumen meaning is meant to have 7,9,7 ', 9 '-four-cis-lycopene is converted into the protein of the enzymatic activity of alltrans-lycopene.

Therefore, think that the active meaning of crtlSO is meant in special time by 7,9 of protein b-cyclase conversion, the amount of the amount of 7 ', 9 '-four-cis-lycopene or the alltrans-lycopene of formation.

Therefore, when comparing with wild type that crtlSO is active to be improved, compare with wild type in special time by crtlSO albumen transform 7,9, the amount of 7 ', 9 '-four-cis-lycopene, or the amount of the alltrans-lycopene that forms increases.

Preferably, crtlSO is active to compare with wild type crtlSO activity, improve at least 5%, more preferably improve at least 20%, more preferably improve at least 50%, more preferably improve at least 100%, more preferably improve at least 300%, even more preferably improve at least 500%, especially improve at least 600%.

In genetically modified plant of the present invention and wild type or in reference to plant, the crtlSO activity is preferably measured under the following conditions:

Think that the active meaning of FtsZ is meant the physiologically active of FtsZ albumen.

Think the FtsZ albumen meaning be meant have promote cell division and plastid division is active and with the protein of microtubular protein homology.

Think that the active meaning of MinD is meant the physiologically active of MinD protein.

Think that the MinD protein meaning is meant the protein that has multi-function action in cell division.It is the relevant ATP enzyme of a kind of film and can demonstrates oscillating movement from a utmost point to another utmost point in cell.

And the activity increase of the enzyme of non-mevalonate pathway can cause the further increase of purpose keto-acid carotenoid (ketocarotenoid) end-product.The example is 4-cytidine diphosphate (CDP) (diphosphocytidyl)-2-C-methyl D-erythrite synthase; 4-cytidine diphosphate (CDP)-2-C-methyl D-erythrite kinases and 2-C-methyl D-erythrite-2; 4-ring bisphosphate synthase.By modifying the gene expression of corresponding gene, can improve the activity of described enzyme.Change by the concentration that antibody and corresponding engram technology can detect the respective egg white matter with standard mode.HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/FtsZ/MinD； For example by expressing and protein level is closed restricted regulatory mechanism, or the gene expression of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid by increasing coding HMG-CoA reductase and/or coding ( E )-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase and/or coding 1-deoxidation-D-wood sugar-5-phosphate synthase and/or coding 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase and/or coding isopentene group-bisphosphate Δ-isomerase and/or coding Mang ox base-bisphosphate synthase and/or coding farnesyl diphosphate synthase and/or coding Mang ox base Mang ox base bisphosphate synthase and/or coding phytoene synthase and/or coding phytoene desaturase and/or coding sigma carotene desaturase and/or coding crtlSO albumen and/or the nucleic acid of coding FtsZ albumen and/or the MinD protein of encoding.

The gene expression of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of the nucleic acid of coding HMG-CoA reductase and/or coding ( E )-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase and/or coding 1-deoxidation-D-wood sugar-5-phosphate synthase and/or coding 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase and/or coding isopentene group-bisphosphate Δ-isomerase and/or coding Mang ox base-bisphosphate synthase and/or coding farnesyl diphosphate synthase and/or coding Mang ox base Mang ox base bisphosphate synthase and/or coding phytoene synthase and/or coding phytoene desaturase and/or coding sigma carotene desaturase and/or coding crtlSO albumen and/or coding FtsZ albumen and/or coding MinD protein is compared with wild type to be improved; For example induce HMG-CoA reductase gene and/or ( E )-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene and/or 1-deoxidation-D-wood sugar-5-phosphate synthase gene and/or 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene and/or isopentene group-bisphosphate Δ-isomerase gene and/or Mang ox base-bisphosphate synthase gene and/or farnesyl diphosphate synthase gene and/or Mang ox base Mang ox base bisphosphate synthase gene and/or phytoene synthase gene and/or phytoene desaturase gene and/or sigma carotene delta 8 desaturase genes and/or crtlSO gene and/or Fts gene and/or MinD gene by activating son; HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/Fts/MinD,HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/FtsZ/MinD。

HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/FtsZ/MinD、HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/FtsZ/MinD。

For example, this can be achieved by modifying corresponding promoter DNA sequence.For example disappearance or the insertion by dna sequence dna can realize that this kind causes the modification that the gene expression rate improves.

In preferred embodiments; HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/FtsZ/MinD,HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-Δ-/-/////ζ-/crtlSO/FtsZ/MinD。

Therefore; Basically, can use arbitrary HMG-CoA reductase gene or (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene or 1-deoxidation-D-wood sugar-5-phosphate synthase gene or 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene or isopentene group-bisphosphate Δ-isomerase gene or Mang ox base-bisphosphate synthase gene or farnesyl diphosphate synthase gene or Mang ox base Mang ox base bisphosphate synthase gene or phytoene synthase gene or phytoene desaturase gene or sigma carotene delta 8 desaturase genes or crtlSO gene or FtsZ gene or MinD gene.

When host plant can not be expressed the respective egg white matter, in the time of maybe can not being endowed the ability of expressing the respective egg white matter, in the genome HMG-CoA reductase sequence that contains introne in eucaryon source or (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase sequence or 1-deoxidation-D-wood sugar-5-phosphate synthase sequence or 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase sequence or isopentene group-bisphosphate Δ-isomerase sequence or Mang ox base-bisphosphate synthase sequence or farnesyl diphosphate synthase sequence or Mang ox base Mang ox base bisphosphate synthase sequence or phytoene synthase sequence or phytoene desaturase sequence or sigma carotene desaturase sequence or crtlSO sequence or FtsZ sequence or MinD sequence in, preferably use through manufactured nucleotide sequence in advance, as corresponding cDNA.

Therefore, in this embodiment preferred, compare with wild type, in the preferred genetically modified plants of the present invention, contain at least one extra HMG-CoA reductase gene and/or (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene and/or 1-deoxidation-D-wood sugar-5-phosphate synthase gene and/or 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene and/or isopentene group-bisphosphate Δ-isomerase gene and/or Mang ox base-bisphosphate synthase gene and/or farnesyl diphosphate synthase gene and/or Mang ox base Mang ox base bisphosphate synthase gene and/or phytoene synthase gene and/or phytoene desaturase gene and/or sigma carotene delta 8 desaturase genes and/or crtlSO gene and/or FtsZ gene and/or MinD gene.

In this preferred embodiment; Genetically modified plant has; ,HMG-CoAHMG-CoA/ ( E )-4--3--2-- ( E )-4--3--2--/1--D--5-1--D--5-/1--D--5-1--D--5-/-Δ--Δ-/--/////ζ-ζ-/crtlSOcrtlSO/FtsZFtsZ/MinDMinD。

The example of HMG-CoA reductase gene is:

Accession number be NM_106299 the nucleic acid from the coding HMG-CoA reductase of mouseearcress (Arabidopsis thaliana) (nucleic acid: SEQ ID NO:111, protein: SEQ ID NO:112),

And comprise from other organic other HMG-CoA reductase genes with following accession number:

P54961，P54870，P54868，P54869，O02734，P22791，P54873，P54871，

P23228，P13704，P54872，Q01581，P17425，P54874，P54839，P14891，

P34135，O64966，P29057，P48019，P48020，P12683，P43256，Q9XEL8，

P34136，O64967，P29058，P48022，Q41437，P12684，Q00583，Q9XHL5，

Q41438，Q9YAS4，O76819，O28538，Q9Y7D2，P54960，O51628，P48021，

Q03163，P00347，P14773，Q12577，Q59468，P04035，O24594，P09610，

Q58116，O26662，Q01237，Q01559，Q12649，O74164，O59469，P51639，

Q10283，O08424，P20715，P13703，P13702，Q96UG4，Q8SQZ9，O15888，

Q9TUM4，P93514，Q39628，P93081，P93080，Q944T9，Q40148，Q84MM0，

Q84LS3，Q9Z9N4，Q9KLM0

(E)-example of 4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene is:

From the nucleic acid (lytB/ISPH) of mouseearcress coding (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase, accession number AY168881, (nucleic acid: SEQ ID NO:113, protein: SEQ ID NO:114),

And comprise from other organic other (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase genes with following accession number:

T04781，AF270978_1，NP_485028.1，NP_442089.1，NP_681832.1，

ZP_00110421.1，ZP_00071594.1，ZP_00114706.1，ISPH_SYNY3，

ZP_00114087.1，ZP_00104269.1，AF398145_1，AF398146_1，AAD55762.1，

AF514843_1，NP_622970.1，NP_348471.1，NP_562001.1，NP_223698.1，

NP_781941.1，ZP_00080042.1，NP_859669.1，NP_214191.1，ZP_00086191.1，

ISPH_VIBCH，NP_230334.1，NP_742768.1，NP_302306.1，ISPH_MYCLE，

NP_602581.1，ZP_00026966.1，NP_520563.1，NP_253247.1，NP_282047.1，

ZP_00038210.1，ZP_00064913.1，CAA61555.1，ZP_00125365.1，

ISPH_ACICA，EAA24703.1，ZP_00013067.1，ZP_00029164.1，

NP_790656.1，NP_217899.1，NP_641592.1，NP_636532.1，NP_719076.1，

NP_660497.1，NP_422155.1，NP_715446.1，ZP_00090692.1，NP_759496.1，

ISPH_BURPS，ZP_00129657.1，NP_215626.1，NP_335584.1，

ZP_00135016.1，NP_789585.1，NP_787770.1，NP_769647.1，ZP_00043336.1，

NP_242248.1，ZP_00008555.1，NP_246603.1，ZP_00030951.1，NP_670994.1，

NP_404120.1，NP_540376.1，NP_733653.1，NP_697503.1， NP_840730.1，

NP_274828.1，NP_796916.1，ZP_00123390.1，NP_824386.1，NP_737689.1，

ZP_00021222.1，NP_757521.1，NP_390395.1，ZP_00133322.1，CAD76178.1，

NP_600249.1，NP_454660.1，NP_712601.1，NP_385018.1，NP_751989.1

The example of 1-deoxidation-D-wood sugar-5-phosphate synthase gene is:

From the nucleic acid of the coding 1-deoxidation-D-wood sugar-5-phosphate synthase that eats tomato, accession number #AF143812 (nucleic acid: SEQ ID NO:115, protein: SEQ ID NO:116),

And comprise from other organic other 1-deoxidations-D-wood sugar-5-phosphate synthase genes with following accession number:

AF143812_1，DXS_CAPAN，CAD22530.1，AF182286_1，NP_193291.1，

T52289，AAC49368.1，AAP14353.1，D71420，DXS_ORYSA，AF443590_1，

BAB02345.1，CAA09804.2，NP_850620.1，CAD22155.2，AAM65798.1，

NP_566686.1，CAD22531.1，AAC33513.1，CAC08458.1，AAG10432.1，

T08140，AAP14354.1，AF428463_1，ZP_00010537.1，NP_769291.1，

AAK59424.1，NP_107784.1，NP_697464.1，NP_540415.1，NP_196699.1，

NP_384986.1，ZP_00096461.1，ZP_00013656.1，NP_353769.1，BAA83576.1，

ZP_00005919.1，ZP_00006273.1，NP_420871.1，AAM48660.1，

DXS_RHOCA，ZP_00045608.1，ZP_00031686.1，NP_841218.1，

ZP_00022174.1，ZP_00086851.1，NP_742690.1，NP_520342.1，

ZP_00082120.1，NP_790545.1，ZP_00125266.1，CAC17468.1，NP_252733.1，

ZP_00092466.1，NP_439591.1，NP_414954.1，NP_752465.1，NP_622918.1，

NP_286162.1，NP_836085.1，NP_706308.1，ZP_00081148.1，NP_797065.1，

NP_213598.1，NP_245469.1，ZP_00075029.1，NP_455016.1，NP_230536.1，

NP_459417.1，NP_274863.1，NP_283402.1，NP_759318.1，NP_406652.1，

DXS_SYNLE，DXS_SYNP7，NP_440409.1，ZP_00067331.1，

ZP_00122853.1，NP_717142.1，ZP_00104889.1，NP_243645.1，NP_681412.1，

DXS_SYNEL，NP_637787.1，DXS_CHLTE，ZP_00129863.1，NP_661241.1，

DXS_XANCP，NP_470738.1，NP_484643.1，ZP_00108360.1，NP_833890.1，

NP_846629.1，NP_658213.1，NP_642879.1，ZP_00039479.1，ZP_00060584.1，

ZP_00041364.1，ZP_00117779.1.NP_299528.1

The example of 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene is:

From the nucleic acid of coding 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase of mouseearcress, accession number #AF148852, (nucleic acid: SEQ ID NO:137, protein: SEQ ID NO:138),

And comprise from other organic other 1-deoxidations-D-wood sugar-5-phosphoric acid reduction isomerase genes with following accession number:

AF148852，AY084775，AY054682，AY050802，AY045634，AY081453，

AY091405，AY098952，AJ242588，AB009053，AY202991，NP_201085.1，

T52570，AF331705_1，BAB16915.1，AF367205_1，AF250235_1，

CAC03581.1，CAD22156.1，AF182287_1，DXR_MENPI，ZP_00071219.1，

NP_488391.1，ZP_00111307.1，DXR_SYNLE，AAP56260.1，NP_681831.1，

NP_442113.1，ZP_00115071.1，ZP_00105106.1，ZP_00113484.1，

NP_833540.1，NP_657789.1，NP_661031.1，DXR_BACHD，NP_833080.1，

NP_845693.1，NP_562610.1，NP_623020.1，NP_810915.1，NP_243287.1，

ZP_00118743.1，NP_464842.1，NP_470690.1，ZP_00082201.1，NP_781898.1，

ZP_00123667.1，NP_348420.1，NP_604221.1，ZP_00053349.1，

ZP_00064941.1，NP_246927.1，NP_389537.1，ZP_00102576.1，NP_519531.1，

AF124757_19，DXR_ZYMMO，NP_713472.1，NP_459225.1，NP_454827.1，

ZP_00045738.1，NP_743754.1，DXR_PSEPK，ZP_00130352.1，

NP_702530.1，NP_841744.1，NP_438967.1，AF514841_1，NP_706118.1，

ZP_00125845.1，NP_404661.1，NP_285867.1，NP_240064.1，NP_414715.1，

ZP_00094058.1，NP_791365.1，ZP_00012448.1，ZP_00015132.1，

ZP_00091545.1，NP_629822.1，NP_771495.1，NP_798691.1，NP_231885.1，

NP_252340.1，ZP_00022353.1，NP_355549.1，NP_420724.1，ZP_00085169.1，

EAA17616.1，NP_273242.1，NP_219574.1，NP_387094.1，NP_296721.1，

ZP_00004209.1，NP_823739.1，NP_282934.1，BAA77848.1，NP_660577.1，

NP_760741.1，NP_641750.1，NP_636741.1，NP_829309.1，NP_298338.1，

NP_444964.1，NP_717246.1，NP_224545.1，ZP_00038451.1，DXR_KITGR，

NP_778563.1.

The example of isopentene group-bisphosphate Δ-isomerase gene is:

Carry from John Burroughs and to receive the nucleic acid (ipiAa1) of coding isopentene group-bisphosphate Δ-isomerase of adonis amurensis clone ApIPI28, accession number #AF188060, by Cunningham, F.X.Jr. and Gantt, E.: by the multigene family of the isopentene group-bisphosphate isomerase of encoding in the complementary plant identification of the allos in Escherichia coli, Plant Cell Physiol.41 (1), the open (nucleic acid: SEQ ID NO:117 of 119-123 (2000), protein: SEQ ID NO:118)

And comprise from other organic other isopentene groups-bisphosphate Δ-isomerase genes with following accession number:

Q38929，O48964，Q39472，Q13907，O35586，P58044，O42641，O35760，

Q10132，P15496，Q9YB30，Q8YNH4，Q42553，O27997，P50740，O51627，

O48965，Q8KFR5，Q39471，Q39664，Q9RVE2，Q01335，Q9HHE4，

Q9BXS1，Q9KWF6，Q9CIF5，Q88WB6，Q92BX2，Q8Y7A5，Q8TT35

Q9KK75，Q8NN99，Q8XD58，Q8FE75，Q46822，Q9HP40，P72002，P26173，

Q9Z5D3，Q8Z3X9，Q8ZM82，Q9X7Q6，O13504，Q9HFW8，Q8NJL9，

Q9UUQ1，Q9NH02，Q9M6K9，Q9M6K5，Q9FXR6，O81691，Q9S7C4，

Q8S3L8，Q9M592，Q9M6K3，Q9M6K7，Q9FV48，Q9LLB6，Q9AVJ1，

Q9AVG8，Q9M6K6，Q9AVJ5，Q9M6K2，Q9AYS5，Q9M6K8，Q9AVG7，

Q8S3L7，Q8W250，Q94IE1，Q9AVI8，Q9AYS6，Q9SAY0，Q9M6K4，

Q8GVZ0，Q84RZ8，Q8KZ12，Q8KZ66，Q8FND7，Q88QC9，Q8BFZ6，

BAC26382，CAD94476.

The example of Mang ox base-bisphosphate synthase gene is:

From the nucleic acid of coding Mang ox base-bisphosphate synthase of mouseearcress, accession number #Y17376, Bouvier, F., Suire, C., d ' Harlingue, A., Backhaus, R.A. and Camara, B.: the molecular cloning of Mang ox base-bisphosphate synthase and the compartmentation that monoterpene synthesizes in plant cell, Plant is (2) J.24,241-252 (2000) (nucleic acid: SEQ ID NO:119, protein: SEQ ID NO:120)

And comprise from other organic other Mang ox base-bisphosphate synthase genes with following accession number:

Q9FT89，Q8LKJ2，Q9FSW8，Q8LKJ3，Q9SBR3，Q9SBR4，Q9FET8，

Q8LKJ1，Q84LG1，Q9JK86

The example of farnesyl diphosphate synthase gene is:

Accession number #U80605 from the nucleic acid (FPS1) of the coding farnesyl diphosphate synthase of mouseearcress by Cunillera, N., Arro, M., Delourme, D., Karst, F., Boronat, A. and Ferrer, A.: mouseearcress comprises the farnesyl diphosphate synthase gene that two species diversity are expressed, J.Biol.Chem.271 (13), 7774-7780 (1996) is open, (nucleic acid: SEQ ID NO:121, protein: SEQ ID NO:122)

And comprise from other organic other farnesyl diphosphate synthase genes with following accession number:

P53799，P37268，Q02769，Q09152，P49351，O24241，Q43315，P49352，

O24242，P49350，P08836，P14324，P49349，P08524，O66952，Q08291，

P54383，Q45220，P57537，Q8K9A0，P22939，P45204，O66126，P55539，

Q9SWH9，Q9AVI7，Q9FRX2，Q9AYS7，Q94IE8，Q9FXR9，Q9ZWF6，

Q9FXR8，Q9AR37，O50009，Q94IE9，Q8RVK7，Q8RVQ7，O04882，

Q93RA8，Q93RB0，Q93RB4，Q93RB5，Q93RB3，Q93RB1，Q93RB2，

Q920E5.

The example of Mang ox base Mang ox base bisphosphate synthase gene is:

From the nucleic acid of the basic Mang ox base of the coding Mang ox of sinapsis alba (Sinapis alba) bisphosphate synthase, accession number #X98795 is by Bonk, M., Hoffmann, B., Von Lintig, J., Schledz, M., Al-Babili, S., Hobeika, E., Kleinig, H. and Beyer, P.: the chromoplast input of external four kinds of carotenoid biosynthetic enzymes has disclosed the different fate before film combination and oligomerization assembling, Eur.J.Biochem.247 (3), the open (nucleic acid: SEQ ID NO:123 of 942-950 (1997), protein: SEQ ID NO:124)

And comprise from other organic other Mang ox base Mang ox base bisphosphate synthase genes with following accession number:

P22873，P34802，P56966，P80042，Q42698，Q92236，O95749，Q9WTN0，

Q50727，P24322，P39464，Q9FXR3，Q9AYN2，Q9FXR2，Q9AVG6，

Q9FRW4，Q9SXZ5，Q9AVJ7，Q9AYN1，Q9AVJ4，Q9FXR7，Q8LSC5，

Q9AVJ6，Q8LSC4，Q9AVJ3，Q9SSU0，Q9SXZ6，Q9SST9，Q9AVJ0，

Q9AVI9，Q9FRW3，Q9FXR5，Q94IF0，Q9FRX1，Q9K567，Q93RA9，

Q93QX8，CAD95619，EAA31459

The example of phytoene synthase gene is:

From the nucleic acid of the coding phytoene synthase of Erwinia uredovora, accession number #D90087 is by Misawa, N., Nakagawa, M., Kobayashi, K., Yamano, S., Izawa, Y., Nakamura, K. and Harashima, K.: set forth the carotenoid biosynthesis pathway of Erwinia uredovora by the gene outcome of expression in escherichia coli being carried out functional analysis; J.Bacteriol.172 (12), 6704-6712 (1990) is open, (nucleic acid: SEQ ID NO:125, protein: SEQ ID NO:126),

And comprise from other organic other phytoene synthase genes with following accession number:

CAB39693，BAC69364，AAF10440，CAA45350，BAA20384，AAM72615，

BAC09112，CAA48922，P_001091，CAB84588，AAF41518，CAA48155，

AAD38051，AAF33237，AAG10427，AAA34187，BAB73532，CAC19567，

AAM62787，CAA55391，AAB65697，AAM45379，CAC27383，AAA32836，

AAK07735，BAA84763，P_000205，AAB60314，P_001163，P_000718，

AAB71428，AAA34153，AAK07734，CAA42969，CAD76176，CAA68575，

P_000130，P_001142，CAA47625，CAA85775，BAC14416，CAA79957，

BAC76563，P_000242，P_000551，AAL02001，AAK15621，CAB94795，

AAA91951，P_000448

The example of phytoene desaturase gene is:

From the nucleic acid of the coding phytoene desaturase of Erwinia uredovora, accession number #D90087 is by Misawa, N., Nakagawa, M., Kobayashi, K., Yamano, S., Izawa, Y., Nakamura, K. and Harashima, K.: set forth the carotenoid biosynthesis pathway of Erwinia uredovora by the gene outcome of expression in escherichia coli being carried out functional analysis; J.Bacteriol.172 (12), 6704-6712 (1990) is open, (nucleic acid: SEQ ID NO:127, protein: SEQ IDNO:128),

And comprise from other organic other phytoene desaturase genes with following accession number:

AAL15300，A39597，CAA42573，AAK51545，BAB08179，CAA48195，

BAB82461，AAK92625，CAA55392，AAG10426，AAD02489，AAO24235，

AAC12846，AAA99519，AAL38046，CAA60479，CAA75094，ZP_001041，

ZP_001163，CAA39004，CAA44452，ZP_001142，ZP_000718，BAB82462，

AAM45380，CAB56040，ZP_001091，BAC09113，AAP79175，AAL80005，

AAM72642，AAM72043，ZP_000745，ZP_001141，BAC07889，CAD55814，

ZP_001041，CAD27442，CAE00192，ZP_001163，ZP_000197，BAA18400，

AAG10425，ZP_001119，AAF13698，2121278A，AAB35386，AAD02462，

BAB68552，CAC85667，AAK51557，CAA12062，AAG51402，AAM63349，

AAF85796，BAB74081，AAA91161，CAB56041，AAC48983，AAG14399，

CAB65434，BAB73487，ZP_001117，ZP_000448，CAB39695，CAD76175，

BAC69363，BAA17934，ZP_000171，AAF65586，ZP 000748，BAC07074，

ZP_001133，CAA64853，BAB74484，ZP_001156，AAF23289，AAG28703，

AAP09348，AAM71569，BAB69140，ZP_000130，AAF41516，AAG18866，

CAD95940，NP_656310，AAG10645，ZP_000276，ZP_000192，ZP_000186，

AAM94364，EAA31371，ZP_000612，BAC75676，AAF65582

The example of sigma carotene delta 8 desaturase genes is:

Nucleic acid from the coding sigma carotene desaturase of daffodil, accession number #AJ224683, by Al-Babili, S., Oelschlegel, J. and Beyer, P.: from the cDNA (accession number AJ224683) of the coding beta carotene desaturase of daffodil (PGR98-103), Plant Phvsiol.117, the open (nucleic acid: SEQ ID NO:129 of 719-719 (1998), protein: SEQ ID NO:130)

And comprise from other organic other sigma carotene delta 8 desaturase genes with following accession number:

Q9R6X4，Q38893，Q9SMJ3，Q9SE20，Q9ZTP4，O49901，P74306，Q9FV46，

Q9RCT2，ZDS_NARPS，BAB68552.1，CAC85667.1，AF372617_1，

ZDS_TARER，CAD55814.1，CAD27442.1，2121278A，ZDS_CAPAN，

ZDS_LYCES，NP_187138.1，AAM63349.1，ZDS_ARATH，AAA91161.1，

ZDS_MAIZE，AAG14399.1，NP_441720.1，NP_486422.1，ZP_00111920.1，

CAB56041.1，ZP_00074512.1，ZP_00116357.1，NP_681127.1，

ZP_00114185.1，ZP_00104126.1，CAB65434.1，NP_662300.1

The example of crtlSO gene is:

Nucleic acid from edible tomato coding crtlSO; Accession number #AF416727, by Isaacson, T., Ronen, G., Zamir, D.and Hirschberg, J.: cloning orange element (tangerine) from tomato, to be disclosed in the plant carotenoid isomerase be essential for producing beta carotene and lutein; Plant Cell 14 (2), 333-342 (2002) open (nucleic acid: SEQ ID NO:131, protein: SEQ ID NO:132),

And comprise from other organic other crtlSO gene: AAM53952 with following accession number

The example of FtsZ gene is:

From the nucleic acid of the coding FtsZ of marigold, accession number #AF251346, by Moehs, C.P., Tian, L., Osteryoung, K.W. and Dellapenna, D.: the analysis of between the pot marigold petal puberty, the carotenoid biosynthesis gene being expressed; Plant Mol.Biol.45 (3), 281-293 (2001) open (nucleic acid: SEQ ID NO:133, protein: SEQ ID NO:134),

And comprise from other organic other FtsZ genes with following accession number:

CAB89286.1，AF205858_1，NP_200339.1，CAB89287.1，CAB41987.1，

AAA82068.1，T06774，AF383876_1，BAC57986.1，CAD22047.1，

BAB91150.1，ZP_00072546.1，NP_440816.1，T51092，NP_683172.1，

BAA85116.1，NP_487898.1，JC4289，BAA82871.1，NP_781763.1，

BAC57987.1，ZP_00111461.1，T51088，NP_190843.1，ZP_00060035.1，

NP_846285.1，AAL07180.1，NP_243424.1，NP_833626.1，AAN04561.1，

AAN04557.1，CAD22048.1，T51089，NP_692394.1，NP_623237.1，

NP_565839.1，T51090，CAA07676.1，NP_113397.1，T51087，CAC44257.1，

E84778，ZP_00105267.1，BAA82091.1，ZP_00112790.1，BAA96782.1，

NP_348319.1，NP_471472.1，ZP_00115870.1，NP_465556.1，NP_389412.1，

BAA82090.1，NP_562681.1，AAM22891.1，NP_371710.1，NP_764416.1，

CAB95028.1，FTSZ_STRGR，AF120117_1，NP_827300.1，JE0282，

NP_626341.1，AAC45639.1，NP_785689.1，NP_336679.1，NP_738660.1，

ZP_00057764.1，AAC32265.1，NP_814733.1，FTSZ_MYCKA，

NP_216666.1，CAA75616.1，NP_301700.1，NP_601357.1，ZP_00046269.1，

CAA70158.1，ZP_00037834.1，NP_268026.1，FTSZ_ENTHR，NP_787643.1，

NP_346105.1，AAC32264.1，JC5548，AAC95440.1，NP_710793.1，

NP_687509.1，NP_269594.1，AAC32266.1，NP_720988.1，NP_657875.1，

ZP_00094865.1，ZP_00080499.1，ZP_00043589.1，JC7087，NP_660559.1，

AAC46069.1，AF179611_14，AAC44223.1，NP_404201.1.

The example of MinD gene is:

From the nucleic acid of the coding MinD of marigold, accession number #AF251019, by Moehs, C.P., Tian, L., Osteryoung, K.W. and Dellapenna, D.: the analysis of between the pot marigold petal puberty, the carotenoid biosynthesis gene being expressed; Plant Mol.Biol.45 (3), 281-293 (2001) open (nucleic acid: SEQ ID NO:135, protein: SEQ ID NO:136),

And comprise from other organic other MinD genes with following accession number:

NP_197790.1，BAA90628.1，NP_038435.1，NP_045875.1，AAN33031.1，

NP_050910.1，CAB53105.1，NP_050687.1，NP_682807.1，NP_487496.1，

ZP_00111708.1，ZP_00071109.1，NP_442592.1，NP_603083.1，NP_782631.1，

ZP_00097367.1，ZP_00104319.1，NP_294476.1，NP_622555.1，NP_563054.1，

NP_347881.1，ZP_00113908.1，NP_834154.1，NP_658480.1，ZP_00059858.1，

NP_470915.1，NP_243893.1，NP_465069.1，ZP_00116155.1，NP_390677.1，

NP_692970.1，NP_298610.1，NP_207129.1，ZP_00038874.1，NP_778791.1，

NP_223033.1，NP_641561.1，NP_636499.1，ZP_00088714.1，NP_213595.1，

NP_743889.1，NP_231594.1，ZP_00085067.1，NP_797252.1，ZP_00136593.1，

NP_251934.1，NP_405629.1，NP_759144.1，ZP_00102939.1，NP_793645.1，

NP_699517.1，NP_460771.1，NP_860754.1，NP_456322.1，NP_718163.1，

NP_229666.1，NP_357356.1，NP_541904.1，NP_287414.1，NP_660660.1，

ZP_00128273.1，NP_103411.1，NP_785789.1，NP_715361.1，AF149810_1，

NP_841854.1，NP_437893.1，ZP_00022726.1，EAA24844.1，ZP_00029547.1，

NP_521484.1，NP_240148.1，NP_770852.1，AF345908_2，NP_777923.1，

ZP_00048879.1，NP_579340.1，NP_143455.1，NP_126254.1，NP_142573.1，

NP_613505.1，NP_127112.1，NP_712786.1，NP_578214.1，NP_069530.1，

NP_247526.1，AAA85593.1，NP_212403.1，NP_782258.1，ZP_00058694.1，

NP_247137.1，NP_219149.1，NP_276946.1，NP_614522.1，ZP_00019288.1，

CAD78330.1

In above-mentioned embodiment preferred, as the HMG-CoA reductase gene, the preferred nucleic acid that uses contains amino acid sequence SEQ ID NO:112 as coding or by this sequence being carried out amino acid replacement, insertion or lacking the protein of institute's calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:112 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of HMG-CoA reductase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:112 from database, can be easily from find other example of HMG-CoA reductase and HMG-CoA reductase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:111 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery HMG-CoA reductase of its genome sequence the unknown and other example of HMG-CoA reductase gene.

In particularly preferred embodiment more, in order to increase the activity of HMG-CoA reductase, such nucleic acid is imported organism, the protein of described nucleic acid coding contains the amino acid sequence of the HMG-CoA reductase of sequence SEQ IDNO:112.

For example, suitable nucleotide sequence can obtain by the reverse translation peptide sequence according to genetic code.

Therefore, preferably use those codons of selecting frequent use according to the special codon of plant.Be easy to determine the codon selection based on computer evaluation to relevant other known of organism.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:111.

In above-mentioned embodiment preferred, as (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:114 or by this sequence is carried out amino acid replacement, insert or lack the protein of institute's calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:114 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase.

As mentioned above, by relatively from the oxygen base acid sequence of database or the nucleotide sequence and the homology between the SEQ ID NO:114 of corresponding reverse translation, can be easily from find such as the known multiple organism of its genome sequence (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase with (E)-other example of 4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene.

In addition, as mentioned above, such as by sequence SEQ ID NO:113 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism of its genome sequence the unknown find (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase with (E)-other example of 4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene.

In particularly preferred embodiment more, in order to increase the activity of (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase, such nucleic acid is imported organism, and the protein of described nucleic acid coding contains the amino acid sequence of (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase of sequence SEQ ID NO:114

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:113.

In above-mentioned embodiment preferred, as 1-deoxidation-D-wood sugar-5-phosphate synthase gene, the preferred nucleic acid that uses contains amino acid sequence SEQ ID NO:116 as coding or by this sequence is carried out amino acid replacement, insert or lack the protein of institute's calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:116 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of 1-deoxidation-D-wood sugar-5-phosphate synthase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:116 from database, can be easily from find other example of 1-deoxidation-D-wood sugar-5-phosphate synthase and 1-deoxidation-D-wood sugar-5-phosphate synthase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:115 initial by hybridization and round pcr in a manner known way also can be easily from multiple organism discovery 1-deoxidation-D-wood sugar-5-phosphate synthase of its genome sequence the unknown and other example of 1-deoxidation-D-wood sugar-5-phosphate synthase gene.

In particularly preferred embodiment more, in order to increase the activity of 1-deoxidation-D-wood sugar-5-phosphate synthase, such nucleic acid is imported organism, and the protein of described nucleic acid coding contains the amino acid sequence of 1-deoxidation-D-wood sugar-5-phosphate synthase of sequence SEQID NO:116.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:115.

In above-mentioned embodiment preferred, as 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene, the preferred nucleic acid that uses contains amino acid sequence SEQ ID NO:138 as coding or by this sequence is carried out amino acid replacement, insert or lack the protein of institute's calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:138 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:138 from database, can be easily from find other example of 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase and 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:137 initial by hybridization and round pcr in a manner known way also can be easily from multiple organism discovery 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase of its genome sequence the unknown and other example of 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene.

In particularly preferred embodiment more, in order to increase the activity of 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase, such nucleic acid is imported organism, and the protein of described nucleic acid coding contains the amino acid sequence of sequence SEQ ID NO:138 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:137.

In above-mentioned embodiment preferred, as isopentene group D-isomerase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:118 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQID NO:118 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of isopentene group D-isomerase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:118 from database, can be easily from find other example of isopentene group D-isomerase and isopentene group D-isomerase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:117 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery isopentene group D-isomerase of its genome sequence the unknown and other example of isopentene group D-isomerase gene.

In particularly preferred embodiment more, in order to increase the activity of isopentene group D-isomerase, such nucleic acid is imported organism, the protein of described nucleic acid coding contains the amino acid sequence of sequence SEQ IDNO:118 isopentene group D-isomerase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:117.

In above-mentioned embodiment preferred, as Mang ox base-bisphosphate synthase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:120 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:120 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of Mang ox base-bisphosphate synthase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:120 from database, can be easily from find other example of Mang ox base-bisphosphate synthase and Mang ox base-bisphosphate synthase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:119 initial by hybridization and round pcr in a manner known way also can be easily from multiple organism discovery Mang ox base-bisphosphate synthase of its genome sequence the unknown and other example of Mang ox base-bisphosphate synthase gene.

In particularly preferred embodiment more, in order to increase the activity of Mang ox base-bisphosphate synthase, such nucleic acid is imported organism, and described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:120 Mang ox base-bisphosphate synthase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:119.

In above-mentioned embodiment preferred, as the farnesyl diphosphate synthase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:122 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:122 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of farnesyl diphosphate synthase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:122 from database, can be easily from find other example of farnesyl diphosphate synthase and farnesyl diphosphate synthase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:121 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery farnesyl diphosphate synthase of its genome sequence the unknown and other example of farnesyl diphosphate synthase gene.

In particularly preferred embodiment more, in order to increase the activity of farnesyl diphosphate synthase, such nucleic acid is imported organism, described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:122 farnesyl diphosphate synthase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:121.

In above-mentioned embodiment preferred, as Mang ox base Mang ox base bisphosphate synthase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:124 or by this sequence is carried out amino acid replacement, insert or lack the protein of institute's calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:124 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of Mang ox base Mang ox base bisphosphate synthase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:124 from database, can be easily from find other example of Mang ox base Mang ox base bisphosphate synthase and the basic Mang ox base of Mang ox bisphosphate synthase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as in a manner known way also can be easily finding other example of Mang ox base Mang ox base bisphosphate synthase and the basic bisphosphate synthase gene of Mang ox base Mang ox by hybridization and round pcr from the multiple organism of its genome sequence the unknown by sequence SEQ ID NO:123 is initial.

In particularly preferred embodiment more, in order to increase the activity that Mang ox base Mang ox base bisphosphate closes, such nucleic acid is imported organism, and described nucleic acid coding contains the protein of the amino acid sequence that sequence SEQ IDNO:124 Mang ox base Mang ox base bisphosphate closes.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:123.

In above-mentioned embodiment preferred, as the phytoene synthase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:126 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQID NO:126 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of phytoene synthase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:126 from database, can be easily from find other embodiment of phytoene synthase and phytoene synthase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:125 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery phytoene synthase of its genome sequence the unknown and other example of phytoene synthase gene.

In particularly preferred embodiment more, in order to increase the activity of phytoene synthase, such nucleic acid is imported organism, described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:126 phytoene synthase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:125.

In above-mentioned embodiment preferred, as the phytoene desaturase gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:128 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:128 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of phytoene desaturase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:128 from database, can be easily from find other example of phytoene desaturase and phytoene desaturase gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:127 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery phytoene desaturase of its genome sequence the unknown and other example of phytoene desaturase gene.

In particularly preferred embodiment more, in order to increase the activity of phytoene desaturase, such nucleic acid is imported organism, and described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:128 phytoene desaturase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:127.

In above-mentioned embodiment preferred, as the sigma carotene delta 8 desaturase genes, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:130 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:130 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of sigma carotene desaturase.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of corresponding reverse translation and the homology between the SEQ ID NO:130 from database, can be easily from find other example of sigma carotene desaturase and sigma carotene delta 8 desaturase genes such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:129 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery sigma carotene desaturase of its genome sequence the unknown and other example of sigma carotene delta 8 desaturase genes.

In particularly preferred embodiment more, in order to increase the activity of sigma carotene desaturase, such nucleic acid is imported organism, described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:130 sigma carotene desaturase.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:129.

In above-mentioned embodiment preferred, as the Crtlso gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:132 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ IDNO:132 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of Crtlso.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of respective opposed translation and the homology between the SEQ ID NO:132 from database, can be easily from find other example of Crtlso and Crtlso gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:131 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery Crtlso of its genome sequence the unknown and other example of Crtlso gene.

In particularly preferred embodiment more, in order to increase the activity of Crtlso, such nucleic acid is imported organism, described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:132 Crtlso.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:131.

In above-mentioned embodiment preferred, as the FtsZ gene, the preferred nucleic acid coding that uses contains amino acid sequence SEQ ID NO:134 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:134 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of FtsZ.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of respective opposed translation and the homology between the SEQ ID NO:134 from database, can be easily from find other example of FtsZ and FtsZ gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:133 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery FtsZ of its genome sequence the unknown and other example of FtsZ gene.

In particularly preferred embodiment more, in order to increase the activity of FtsZ, such nucleic acid is imported organism, described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:134 FtsZ.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:133.

In above-mentioned embodiment preferred, as the MinD gene, the preferred nuclear coding that uses contains amino acid sequence SEQ ID NO:136 or by this sequence being carried out the protein of amino acid replacement, insertion or disappearance institute calling sequence, at amino acid levels, the homogeneity of aftermentioned protein and sequence SEQ ID NO:136 is at least 30%, be preferably at least 50%, more preferably be at least 70%, even more preferably be at least 90%, be most preferably at least 95%, and have the enzymatic property of MinD.

As mentioned above, by comparing amino acid sequence or the nucleotide sequence of respective opposed translation and the homology between the SEQ ID NO:136 from database, can be easily from find other example of MinD and MinD gene such as the known multiple organism of its genome sequence.

In addition, as mentioned above, such as by sequence SEQ ID NO:135 initial by hybridization and round pcr in a manner known way also can be easily from the multiple organism discovery MinD of its genome sequence the unknown and other embodiment of MinD gene.

In particularly preferred embodiment more, in order to increase the activity of MinD, such nucleic acid is imported organism, described nucleic acid coding contains the protein of the amino acid sequence of sequence SEQ ID NO:136 MinD.

The nucleic acid importing organism that will contain in particularly preferred embodiments, sequence SEQ ID NO:135.

In addition, pass through in a manner known way from the chemical synthesis of nucleotide structure unit, for example, can prepare all above-mentioned HMG-CoA reductase genes by the fragment condensation of each overlapping complementary nucleic acid construction unit of double helix, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase gene, 1-deoxidation-D-wood sugar-5-phosphate synthase gene, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase gene, isopentene group-bisphosphate Δ-isomerase gene, Mang ox base-bisphosphate synthase gene, method acyl-bisphosphate synthase gene, Mang ox base Mang ox base bisphosphate synthase gene, the phytoene synthase gene, the phytoene desaturase gene, the sigma carotene delta 8 desaturase genes, the crtlSO gene, FtsZ gene or MinD gene.For example, can carry out the chemical synthesis (Voet, Voet, second edition, Wiley Press New York, 896-897 page or leaf) of oligonucleotides in known manner by phosphoramidite method.The annealing of synthetic oligonucleotide, the Klenow fragment fill up the gap that utilizes archaeal dna polymerase, coupled reaction and conventional cloning process are described in (1989) such as Sambrook, Molecularcloning:A laboratory manual, publishing house of cold spring harbor laboratory.

In the embodiment that method is more preferably, plant additionally has compares the endogenous B-hydroxylase activity that has reduced with wild type.

As mentioned above, think the activity that has reduced preferably be meant based on different cell biology mechanism parts suppress fully basically or blocking-up plant cell, plant or its part, tissue, organ, cell or seed in the function of enzyme.

For example, by the amount of protein or the amount of mRNA in the minimizing plant, can realize that the activity of comparing in the plant with wild type reduces.Therefore, compare the activity that has reduced with wild type and can directly measure, or compare the amount of protein in the plant of the present invention or the amount of mRNA with wild type and measure by measuring.

Active reduction comprise protein quantity be reduced to lack fully basically this protein (that is to say shortage can detected corresponding activity or lack immunology can detected respective egg white matter).

Think that the active meaning of endogenous B-hydroxylase is meant the enzymatic activity of the B-hydroxylase that endogenous plant is intrinsic.

Think that the endogenous B-hydroxylase meaning is meant the hydroxylase that endogenous as mentioned above plant is intrinsic.If for example marigold is the target plant that carries out genetic modification, think that the endogenous B-hydroxylase is meant the B-hydroxylase of marigold.

Therefore think that the endogenous B-hydroxylase meaning specifically is meant to have the intrinsic protein of plant that beta carotene is converted into this enzymatic activity of luteole.

Therefore, think that the active meaning of endogenous B-hydroxylase is meant the amount of the beta carotene that is transformed by protein endogenous B-hydroxylase in special time or the amount of the luteole that forms.

When comparing with wild type that the endogenous B-hydroxylase is active to be reduced, compare the amount of the beta carotene that in special time, transforms with wild type or the amount of the luteole that forms reduces by protein endogenous B-hydroxylase.

Preferably, the endogenous B-hydroxylase is active to reduce at least 5%, more preferably for reducing at least 20%, more preferably for reducing at least 50%, more preferably for reducing by 100%.Particularly preferably, endogenous B-hydroxylase activity is closed fully.

Be surprisingly found out that producing for example plant of lutein for example in the plants of tagetes species of carotenoid in a large number that by the alpha-carotene approach it is active and to increase the allos hydroxylase activity as required be favourable to reduce the endogenous B-hydroxylase.Particularly preferably, the hydroxylase that uses or its function equivalent are from the plant that produces a large amount of carotenoid by the beta carotene approach, for example be above-mentioned B-hydroxylase (nucleic acid: SEQ ID No.107, protein: SEQ ID No.108) from tomato.

Measure endogenous B-hydroxylase activity in the mode similar as mentioned above to measuring hydroxylase activity.

Preferably, reduce endogenous B-hydroxylase activity in the plant by at least a following method:

A) import at least a double-stranded endogenous B-hydroxylase RNA sequence, hereinafter be also referred to as endogenous B-hydroxylase-dsRNA, or import an expression cassette or a plurality of expression cassette of guaranteeing its expression.

Comprise wherein endogenous B-hydroxylase-dsRNA at those methods of endogenous Beta-hydroxylase gene (just referring to genomic dna sequence) or endogenous B-hydroxylase transcript (just referring to the mRNA sequence) such as promoter sequence,

B) import at least a endogenous B-hydroxylase antisense RNA sequence, hereinafter be also referred to as endogenous B-hydroxylase-antisense RNA, or import the expression cassette of guaranteeing its expression.Comprise that wherein endogenous B-hydroxylase-antisense RNA is at those methods of endogenous Beta-hydroxylase gene (just referring to genomic dna sequence) or endogenous Beta-hydroxylase gene transcript (just referring to the RNA sequence).Also comprise α-different nucleotide sequence.

C) expression cassette that imports at least a endogenous B-hydroxylase-antisense RNA that combines with ribozyme or guarantee its expression.

D) import at least a endogenous B-hydroxylase and have a mind to RNA sequence, hereinafter be also referred to as endogenous B-hydroxylase-have a mind to RNA inducing common inhibition, or import the expression cassette of guaranteeing its expression

E) import at least a at endogenous Beta-hydroxylase gene, B-hydroxylase RNA or B-hydroxylase protein DNA-or protein-binding factor or guarantee the expression cassette of its expression

F) import at least a nucleic acid sequence or guarantee the expression cassette of its expression, cause the degraded of endogenous B-hydroxylase RNA

G) import at least one construct in the endogenous Beta-hydroxylase gene, to produce afunction, for example produce the displacement in terminator codon or the reading frame, for example insert by in the endogenous Beta-hydroxylase gene, producing, disappearance, oppositely or sudden change implement.Preferably, target inserts described endogenous Beta-hydroxylase gene or implanting needle and can produce the method for the sequence-specific nuclease of endogenous Beta-hydroxylase gene sequence and knock out sudden change by homologous recombination.

The known additive method of those skilled in the art also can be used among the present invention to reduce endogenous B-hydroxylase or its activity or function.For example import the dominant variant of endogenous B-hydroxylase or guarantee that the expression cassette of its expression also can be favourable.Every kind of diverse ways all can cause the amount of endogenous B-hydroxylase protein, amount and/or active reduction of mRNA.Also can consider to be used in combination these methods.Additive method also is known for those skilled in the art and can comprises inhibition or stop the transhipment of the processing of endogenous B-hydroxylase, luteole epoxidase and/or endogenous B-hydroxylase or its mRNA, extension or the termination that the inhibition ribosomes adheres to, suppresses the RNA montage, induces endogenous B-hydroxylase-RNA-digestive enzyme and/or suppress to translate.

Can each preferable methods be described by exemplary embodiment hereinafter:

A) import double-stranded endogenous B-hydroxylase RNA sequence (endogenous B-hydroxylase-dsRNA)

Deeply described above be used to reduce ε-cyclase activity carry out the method for gene regulation in the double-stranded RNA mode.In a similar manner, can implement this method to reduce endogenous B-hydroxylase activity.

Think that double-stranded endogenous B-hydroxylase RNA sequence or endogenous B-hydroxylase-dsRNA preferably are meant to have zone that contains duplex structure and the RNA molecule that contains following nucleotide sequence in this zone:

A) identical with at least a portion of the intrinsic endogenous B-hydroxylase transcript of plant and/or

B) at least a portion with the intrinsic endogenous B-hydroxylase promoter sequence of plant is identical.

In the method for the invention, in order to reduce endogenous B-hydroxylase activity, preferably RNA is imported plant, wherein said RNA contains tool duplex structure zone and contain following nucleotide sequence in this zone

Think that term " endogenous B-hydroxylase transcript " consciousness is meant the part of transcribing of endogenous Beta-hydroxylase gene, wherein except the sequence of coding endogenous B-hydroxylase, also comprises for example non-coding sequence such as UTR.

Think that the RNA of " identical with at least a portion of the intrinsic endogenous B-hydroxylase promoter sequence of plant " is meant that preferably the theoretical transcript of RNA sequence and endogenous B-hydroxylase promoter sequence refers to that just its corresponding RNA sequence is to the identical fact of small part.

Think that " part " meaning of the endogenous B-hydroxylase promoter sequence that endogenous B-hydroxylase transcript that plant is intrinsic or plant are intrinsic is meant the partial sequence from several base-pairs to the as many as full sequence in transcript or the promoter sequence.By those skilled in the art by the routine test optimal length of deciding section sequence easily.

Preferably, find out partial sequence to obtain the mode that the high as far as possible specificity and the activity of other enzymes (not expecting its active reduction) do not reduce.Therefore for the partial sequence of endogenous B-hydroxylase-dsRNA, the partial sequence that is chosen in non-existent part endogenous B-hydroxylase transcript in other activity and/or endogenous B-hydroxylase promoter sequence is favourable.

Therefore, in particularly preferred embodiments, the part of the intrinsic endogenous B-hydroxylase transcript of the sequence that contains of endogenous B-hydroxylase-dsRNA and plant is identical and contain 5 ' terminal or 3 ' end of the nucleic acid of the intrinsic coding endogenous B-hydroxylase of plant.Especially, transcript 5 ' or 3 ' non-translational region are suitable for producing the selectivity duplex structure.

The invention further relates to double stranded rna molecule (dsRNA molecule), when it is imported plant (or its cell, tissue, organ or propagating materials), cause that the endogenous B-hydroxylase reduces.

(the endogenous B-hydroxylase-dsRNA), this double stranded rna molecule preferably comprises to the invention further relates to the double stranded rna molecule that reduces the expression of endogenous B-hydroxylase

A) contain at least a identical with at least a portion of " having a mind to " RNA-endogenous B-hydroxylase transcript basically ribonucleotide acid sequence " having a mind to " RNA chain and

In order to transform plant, preferably used the nucleic acid construct that it is imported plant and be transcribed into endogenous B-hydroxylase-dsRNA in plant with endogenous B-hydroxylase-dsRNA.

The invention still further relates in addition and can be transcribed into following nucleic acid construct:

B) basically preferably fully and " antisense " RNA chain of having a mind to the chain complementation of the RNA a).

These nucleic acid constructs are also referred to as expression cassette or expression vector hereinafter.

About the dsRNA molecule, think that endogenous B-hydroxylase nucleotide sequence or its corresponding transcript preferably are meant the sequence according to SEQ ID NO:139 or its part.

" substantially the same " thus the meaning be meant that comparing the dsRNA sequence with endogenous B-hydroxylase target sequence also can have effective reduction that insertion, disappearance and single point mutation cause expression.Preferably, " having a mind to " chain of inhibition dsRNA and endogenous Beta-hydroxylase gene to small part " is had a mind to " between the rna transcription basis or the homology between " antisense " chain and the endogenous Beta-hydroxylase gene complementary strand is at least 75%, be preferably at least 80%, very particularly preferably be at least 90%, be most preferably 100%.

Reduce for causing that the endogenous B-hydroxylase is expressed effectively, it is not absolute necessary having 100% sequence homogeneity between dsRNA and the endogenous Beta-hydroxylase gene transcript.Therefore, tolerance is because genetic mutation, polymorphism or evolutionary divergence and method that the sequence that may exist departs from is favourable.It is possible for example using dsRNA from a kind of organism endogenous B-hydroxylase sequence to suppress in the another kind of organism that the endogenous B-hydroxylase expresses.For this purpose, dsRNA preferably contains the sequence area corresponding to the endogenous Beta-hydroxylase gene transcript of conserved region.Can obtain described conserved region fast by sequence alignment.

In addition, the dsRNA of " substantially the same " also can be defined as can with the nucleotide sequence of a part of endogenous Beta-hydroxylase gene transcript hybridization (for example in 400mM NaCl, 40mM PIPES pH 6.4,1mM EDTA 50 ℃ or 70 ℃ of hybridization 12-16 hour).

In another embodiment, endogenous B-hydroxylase-dsRNA comprises

A) contain at least a basically with endogenous Beta-hydroxylase gene promoter region " have a mind to " rna transcription this to " having a mind to " RNA chain of the identical ribonucleotide acid sequence of small part and

A) identical with at least a portion of endogenous Beta-hydroxylase gene promoter region basically " having a mind to " DNA chain and

In order to produce the endogenous B-hydroxylase sequence that is used to reduce endogenous B-hydroxylase activity,, particularly preferably use following partial sequence particularly for marigold:

SEQ ID NO:141: the fragment intentionally of endogenous B-hydroxylase 5 ' stub area

SEQ ID NO:142: the antisense fragment of endogenous B-hydroxylase 5 ' stub area

DsRNA can be made up of one or more polybribonucleotide chain.Certainly, in order to realize identical purpose, also can be with multiple different dsRNA molecule transfered cell or organism, each in them all contains one of ribonucleotide acid sequence part defined above.

By the independent RNA chain of two complementations or preferably can form double-stranded dsRNA structure by the RNA start of chain of single self complementation.In this case, " have a mind to " RNA chain and " antisense " RNA chain preferably with the form of oppositely " repetition " covalent bond each other.

For example, dsRNA also can contain hairpin structure described in WO 99/53050, by with catenation sequence (" joint "; Introne for example) connects " having a mind to " and " antisense " chain.The dsRNA structure of self complementation is preferred, and this is because they only need the complementary RNA chain of molar ratios such as expressing a RNA sequence and always contain.Preferably, catenation sequence is that introne is (for example from the introne of potato ST-LS1 gene; (1990) Mol Gen Genet220 (2) such as Vancanneyt GF: 245-250).

Other preferred embodiment that reduces endogenous B-hydroxylase activity is similar to the above-mentioned preferred embodiment that is used to reduce ε-cyclase activity, has just wherein replaced ε-cyclase with the endogenous B-hydroxylase.

In the methods of the invention, particularly preferably use has the genetically modified plant that has made up following genetic modification:

Compare with wild type, it is active and have a genetically modified plant of the hydroxylase activity that has improved to have the ketolase that improved or induce in floral leaf,

Compare with wild type, in floral leaf, have the genetically modified plant that the ketolase that improved or induce is active and have the beta cyclase activity that has improved,

Compare with wild type, it is active and have a genetically modified plant of the ε-cyclase activity that has reduced to have the ketolase that improved or induce in floral leaf,

Compare with wild type, it is active and have a hydroxylase activity that has improved and the genetically modified plant of the beta cyclase activity that improved to have the ketolase that improved or induce in floral leaf,

Compare with wild type, it is active and have a hydroxylase activity that has improved and the genetically modified plant of ε-cyclase activity of having reduced to have the ketolase that improved or induce in floral leaf,

Compare with wild type, it is active and have a genetically modified plant of the active and ε-cyclase activity that reduced of the beta cyclase that improved to have the ketolase that improved or induce in floral leaf, and

Compare with wild type, in floral leaf, have the ketolase that improved or induce active and have the hydroxylase activity that improved, the beta cyclase that improved is active and the genetically modified plant of ε-cyclase activity of having reduced,

Compare with wild type, the genetically modified plant of ε-cyclase activity of in floral leaf, have the ketolase activity that improved or induce, having reduced, the beta cyclase activity that improved,

Compare with wild type, the genetically modified plant of the ε-cyclase activity that in floral leaf, have the ketolase activity that improved or induce, reduced and the endogenous B-hydroxylase activity that reduced,

Compare with wild type, the genetically modified plant of the ε-cyclase activity that in floral leaf, have the ketolase activity that improved or induce, reduced and the hydroxylase activity that improved,

Compare with wild type, the genetically modified plant of the active and hydroxylase activity that improved of the beta cyclase that in floral leaf, have the ketolase activity that improved or induce, improved,

Compare with wild type, the genetically modified plant of the active and endogenous B-hydroxylase activity that reduced of the beta cyclase that in floral leaf, have the ketolase activity that improved or induce, improved,

Compare with wild type, in floral leaf, have the genetically modified plant of the active and beta cyclase activity that improved of the ketolase that improved or induce,

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, ε-the cyclase activity that reduced and at least a activity that other has improved are selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate Δ-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, ε-cyclase activity of have the ketolase activity that improved or induce in floral leaf, having reduced, the beta cyclase that has improved is active and the genetically modified plant of the hydroxylase activity that improved,

Compare with wild type, ε-cyclase activity of have the ketolase activity that improved or induce in floral leaf, having reduced, the beta cyclase that has improved is active and the genetically modified plant of the endogenous B-hydroxylase activity that reduced,

Compare with wild type, the genetically modified plant of the ε-cyclase activity that in floral leaf, have the ketolase activity that improved or induce, reduced and the beta cyclase activity that improved,

Compare with wild type, the genetically modified plant of ε-cyclase activity of in floral leaf, have the ketolase activity that improved or induce, having reduced, the hydroxylase activity that has improved and the endogenous B-hydroxylase activity that reduced,

Compare with wild type, the genetically modified plant of the beta cyclase activity that in floral leaf, have the ketolase activity that improved or induce, improved, the hydroxylase activity that has improved and the endogenous B-hydroxylase activity that reduced,

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, ε-the cyclase activity that has reduced, active and at least a activity that other has improved of the beta cyclase that has improved is selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate D-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, the genetically modified plant of ε-cyclase activity of in floral leaf, have the ketolase activity that improved or induce, having reduced, the beta cyclase activity that has improved, the hydroxylase activity that has improved and the endogenous B-hydroxylase activity that reduced

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, ε-the cyclase activity that has reduced, the hydroxylase activity that improved and at least a activity that other has improved are selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate D-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, ε-the cyclase activity that has reduced, active and at least a activity that other has improved of the endogenous B-hydroxylase that has reduced is selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate D-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, the beta cyclase activity that has improved, the hydroxylase activity that improved and at least a activity that other has improved are selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate Δ-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, the beta cyclase activity that has improved, active and at least a activity that other has improved of the endogenous B-hydroxylase that has reduced is selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate D-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, ε-cyclase activity of have the ketolase activity that improved or induce in floral leaf, having reduced, the beta cyclase that has improved is active and the genetically modified plant of the hydroxylase activity that improved and the B-hydroxylase activity that reduced,

Compare with wild type, in floral leaf, has the ketolase activity that has improved or induce, ε-the cyclase activity that has reduced, the beta cyclase activity that has improved, the hydroxylase activity that improved and at least a activity that other has improved are selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate D-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity

Compare with wild type, in floral leaf, have the ketolase activity that has improved or induce, ε-the cyclase activity that has reduced, the beta cyclase activity that has improved, active and at least a activity that other has improved of the endogenous B-hydroxylase that has reduced is selected from the HMG-CoA reductase activity, (E)-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity, 1-deoxidation-D-wood sugar-5-phosphate synthase activity, 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity, isopentene group-bisphosphate D-isomerase activity, Mang ox base-bisphosphate synthase activity, method acyl-bisphosphate synthase activity, Mang ox base Mang ox base bisphosphate synthase activity, the phytoene synthase activity, the phytoene desaturase activity, sigma carotene desaturase activity, the crtlSO activity, the genetically modified plant of FtsZ activity or MinD activity.

Especially preferably compare with wild type, the genetically modified plant of the active and hydroxylase activity that improved of the beta cyclase that in floral leaf, have the ketolase activity that improved or induce, improved,

Induce the ketolase activity of raising by importing such nucleic acid, the protein of described nucleic acid coding comprises amino acid sequence SEQ ID NO:2 or by this sequence is carried out the sequence that amino acid replacement, insertion or disappearance obtain, and the aftermentioned sequence has at least 20% homogeneity with sequence SEQ ID NO:2 and has the enzymatic property of ketolase on amino acid levels.

Induce the beta cyclase activity of raising by importing such nucleic acid, the beta cyclase of described nucleic acid coding comprises amino acid sequence SEQ ID NO:110 or by this sequence is carried out the sequence that amino acid replacement, insertion or disappearance obtain, the aftermentioned sequence has at least 20% homogeneity with sequence SEQ ID NO:110 on amino acid levels.

Induce the hydroxylase activity of raising by importing such nucleic acid, the hydroxylase of described nucleic acid coding comprises amino acid sequence SEQ ID NO:108 or by this sequence is carried out the sequence that amino acid replacement, insertion or disappearance obtain, the aftermentioned sequence has at least 20% homogeneity with sequence SEQ ID NO:108 on amino acid levels.

Especially preferably compare with wild type, the genetically modified plant of ε-cyclase activity of in floral leaf, have the ketolase activity that improved or induce, having reduced, the beta cyclase activity that has improved, the hydroxylase activity that has improved and the endogenous B-hydroxylase activity that reduced

Induce the hydroxylase activity of raising by importing such nucleic acid, the hydroxylase of described nucleic acid coding comprises amino acid sequence SEQ ID NO:108 or by this sequence is carried out the sequence that amino acid replacement, insertion or disappearance obtain, the aftermentioned sequence has at least 20% homogeneity with sequence SEQ ID NO:108 on amino acid levels.And the endogenous B-hydroxylase activity of inducing the ε-cyclase activity that has reduced and having reduced according to above-mentioned embodiment preferred.

Described in hereinafter, for example, can produce these genetically modified plants of Tagetes by importing independent nucleic acid construct (expression cassette) or containing the multiple construct of two, three or four described activity of as many as by importing.

Hereinafter, mode is described in the generation of the genetically modified plant that has the ketolase activity that has improved or induce in the floral leaf by way of example.β-HMG-CoA/ ( E )-4--3--2--/1--D--5-/1--D--5-/-D-/-/-////ζ-/crtlSO/FtsZ/MinD； Can realize the raising of other activity, for example hydroxylase activity and/or beta cyclase activity and/or HMG-CoA reductase activity and/or ( E )-4-hydroxy-3-methyl but-2-ene base-bisphosphate reductase activity and/or 1-deoxidation-D-wood sugar-5-phosphate synthase activity and/or 1-deoxidation-D-wood sugar-5-phosphoric acid reduction isomerase activity and/or isopentene group-bisphosphate D-isomerase activity and/or Mang ox base-bisphosphate synthase activity and/or method acyl-bisphosphate synthase activity and/or Mang ox base Mang ox base bisphosphate synthase activity and/or phytoene synthase activity and/or phytoene desaturase activity and/or sigma carotene desaturase activity and/or crtlSO activity and/or FtsZ activity and/or MinD are active. Use the reverse repetitive nucleic acid sequence of ε-cyclase anti sense nucleotide sequence or the reverse repetitive nucleic acid sequence of ε-cyclase or use endogenous B-hydroxylase anti sense nucleotide sequence or endogenous B-hydroxylase to replace the nucleotide sequence of coding ketolase in a similar manner; Can realize for example reduction of ε-cyclase activity or endogenous B-hydroxylase activity of other enzymatic activity.Making up under the situation of genetic modification, implementing discriminably to transform or implement to transform by multiple construct.

Preferably, contain above-mentioned coding ketolase and the functional nucleic acid construct that is connected in the nucleic acid on one or more adjustment signals of guaranteeing in plant, to transcribe and translate by use and carry out the conversion of initial plant, produce the Tagetes genetically modified plants.

Wherein functional these nucleic acid constructs that are connected on one or more adjustment signals of guaranteeing to transcribe in plant and translate of nucleic acid sequence encoding are also referred to as expression cassette hereinafter.

Preferably, adjustment signal contains one or more promoters of transcribing and translating guaranteed in plant.

Expression cassette contains adjustment signal, that is to say the modulability nucleotide sequence that coded sequence is expressed in the control host cell.According to embodiment preferred, expression cassette comprises upstream (that is to say at coded sequence 5 ' end), promoter, downstream (that is to say at 3 ' end), polyadenylation signal and also comprises other as required and can be operatively connected in the controlling element of the coded sequence of at least one said gene.Can be operatively connected the meaning be meant promoter, coded sequence, terminator and as required other controlling element mode that can both in coded sequence is expressed, fulfil its function in a suitable manner with each controlling element arrange in proper order.

Hereinafter, describe preferred nucleic acid construct, expression cassette and carrier that is used for plants of tagetes species and the method that is used to produce the Tagetes genetically modified plants by way of example, also had Tagetes genetically modified plants self.

The sequence that is preferred for being operatively connected is that (but being not limited to) guarantees the target sequence of Subcellular Localization in apoplast, vacuole, plastid, mitochondria, endoplasmic reticulum (ER), nucleus, oil body or other compartment and such as the translational enhancer (Gallie etc. from tobacco mosaic virus (TMV) (tobacco mosaic virus) 5 ' targeting sequencing, Nucl.Acids Res.15 (1987), 8693-8711).

In principle, can control any promoter that foreign gene expresses in plant and all be suitable for promoter as expression cassette.

" composing type " promoter be meant those majority preferably the very long in a organized way development of plants phase preferably guarantee expression promoter at the All Time point of development of plants.

Especially preferably use plant promoter or come from the promoter of plant virus.Particularly, the promoter of CaMV cauliflower mosaic virus (CaMV cauliflower mosaic virus) 35S transcript is preferred (Franck etc. (1980) Cell 21:285-294; Odell etc. (1985) Nature313:810-812; Shewmaker etc. (1985) Virology 140:281-288; Gardner etc. (1986) Plant Mol Biol 6:221-228) or 19S CaMV promoter (US 5,352,605; WO 84/02913; Benfey etc. (1989) EMBO J 8:2195-2202).

Other suitable constitutive promoter is that (US 4 for promoter for pds promoter (Pecker etc. (1992) Proc.Natl.Acad.Sci USA 89:4962-4966) or " rubisco small subunit (SSU) ", 962,028), legumin B promoter (GenBank accession number X03677), nopaline synthase promoter from Agrobacterium, the TR double-promoter, OCS (octopine synthase) promoter from Agrobacterium, ubiquitin promoter ((1995) PlantMol Biol 29:637-649 such as Holtorf S), ubiquitin 1 promoter (Christensen etc. (1992) Plant Mol Biol18:675-689; Bruce etc. (1989) Proc Natl Acad Sci USA 86:9692-9696), the Smas promoter, (US 5 for the cinnamyl-alcohol dehydrogenase promoter, 683,439), vacuole ATP enzyme subunit promoter or from promoter (WO 91/13991), the Pnit promoter (Y07648.L of the protein that is rich in proline of wheat, Hillebrand etc. (1998), Plant.Mol.Biol.36,89-99, Hillebrand etc. (1996), Gene, 170,197-200) and other well known by persons skilled in the art in plant the promoter of the gene of constitutive expression.

But expression cassette also can comprise the promoter (survey article: Gatz etc. (1997) Annu Rev Plant Physiol Plant Mol Biol 48:89-108) of chemistry induction type, by chemical inducible promoter can be in special time point control plant the ketolase expression of gene.Can use this type of promoter equally, for example PRP1 promoter (Ward etc. (1993) Plant Mol Biol 22:361-366), salicylic acid-inducible promoter (WO 95/19443), benzsulfamide-inducible promoter (EP 0 388 186), tetracycline-inducible promoter (Gatz etc. (1992) Plant J 2:397-404), abscisic acid-inducible promoter (EP 0 335 528) and ethanol-or cyclohexanone-inducible promoter (WO 93/21334).

And, the promoter of being induced by biology or abiotic stress also is preferred, for example pathogen-the inducible promoter of PRP1 gene (Ward etc. (1993) Plant Mol Biol 22:361-366), (US 5 from heat-derivable hsp70 of tomato or hsp80 promoter, 187,267), from cold-derivable AMS promoter (WO 96/12814), light-derivable PPDK promoter or wound-derivable pinII promoter (EP 375091) of potato.

Pathogen-inducible promoter comprises the result who attacks as pathogen and the promoter of the gene of inducing, described gene is PR albumen, SAR albumen, β-1 for example, ((1983) Neth J Plant Pathol 89:245-254 such as Redolfi for example such as the gene of 3-dextranase, chitinase etc.; Uknes etc. (1992) The Plant Cell 4:645-656; Van Loon (1985) Plant Mol Viral4:111-116; Marineau etc. (1987) Plant Mol Biol 9:335-342; Matton etc. (1987) Molecular Plant-Microbe Interactions 2:325-342; Somssich etc. (1986) ProcNatl Acad Sci USA 83:2427-2430; Somssich etc. (1988) Mol Gen Genetics2:93-98; Chen etc. (1996) Plant J 10:955-966; Zhang and Sing (1994) ProcNatl Acad Sci USA 91:2507-2511; Warner etc. (1993) Plant J 3:191-201; Siebertz etc. (1989) Plant Cell 1:961-968 (1989).

Wound-the inducible promoter that also comprises some genes, described gene such as pinII gene (Ryan (1990) Ann Rev Phytopath 28:425-449; Duan etc. (1996) Nat Biotech14:494-498), (US 5 for wun1 and wun2 gene, 428,148), win1 and win2 gene (Stanford etc. (1989) Mol Gen Genet 215:200-208), systemin (McGurl etc. (1992) Science225:1570-1573), WIP1 gene (Rohmeier etc. (1993) Plant Mol Biol 22:783-792; Ekelkamp etc. (1993) FEBS Letters 323:73-76), MPI gene (Corderok etc. (1994) The Plant J 6 (2): 141-150) or the like.

Other suitable promoter is for example fruit maturation specific promoter, as the fruit maturation specific promoter (WO 94/21794, and EP 409 625) from tomato.Certainly, because different tissues forms to grow the dependence mode, grow the dependence promoter and also comprise the portion of tissue specific promoter.

In addition, especially preferably guarantee in tissue or plant part, to carry out those promoters of for example keto-acid carotenoid biosynthesis or its precursor generation expression.For example preferably have the promoter of flower pesticide, ovary, petal, sepal, flower, leaf, stem and root-specific and their combination.

Stem tuber-, storage root-or root-specific promoter be for example, to start the promoter of subclass I (B33) or cathepsin D's inhibitor from the patatin of potato.

The leaf specific promoter be for example from the promoter (WO 97/05900) of the cytosol FBP enzyme of potato, from the SSU promoter (small subunit) or the ST-LSI promoter (Stockhaus etc. (1989) EMBO J 8:2445-2451) of the rubisco (ribulose-1,5-bisphosphate, 5-diphosphonic acid carboxylase) of potato.

The flower specific promoter is for for example from phytoene synthase promoter (WO 92/16635) or P-rr gene promoter (WO 98/22593) or the AP3 promoter (seeing embodiment 1) of mouseearcress.

The flower pesticide specific promoter is for example 5126 promoters (US 5,689,049, and US 5,689,051), glob-l promoter or g-zeins promoter.

Other are suitable for, and expression promoter is described in (1987) Meth inEnzymol 153:253-277 such as Rogers in plant; (1989) Proc Natl Acad Sci USA 86:8402-8406 such as Schardl etc. (1987) Gene 61:1-11 and Berger).

Promoter described in all the application makes that usually expressing ketolase in the floral leaf of plant of the present invention becomes possibility.

Particularly preferably being composing type in the inventive method spends special and the special promoter of floral leaf especially.

Reorganization and clone technology according to routine, for example be described in T.Maniatis, E.F.Fritsch and J.Sambrook, Molecular Cloning:A Laboratory Manual, Cold SpringHarbor Laboratory, Cold Spring Harbor, NY (1989), T.J.Silhavy, M.L.Berman and L.W.Enquist, Experiments with Gene Fusions, ColdSpring Harbor Laboratory, Cold Spring Harbor, NY (1984) and Ausubel, F.M. etc., Current Protocols in Molecular Biology, reorganization and clone technology among the Greene Publishing Assoc.and Wiley-Interscience (1987) preferably produce expression cassette by nucleic acid that merges suitable promoter and above-mentioned coding ketolase and nucleic acid and the polyadenylation signal that preferably inserts coding plastid unitransport peptide between promoter and this nucleotide sequence.

Preferably insert and the nucleic acid of the plastid transit peptides of encoding guarantees to be positioned plastid, and particularly be positioned chromoplast.

Also can use the expression cassette of its nucleic acid sequence encoding ketolase fused protein, a part of fused protein is as the transit peptides of control polypeptide transposition.For the special transit peptides of chromoplast is preferred, and special transit peptides gets off from ketolase is partially digested after the ketolase transposition enters chromoplast.

Particularly preferred transit peptides is from the transit peptides of tobacco plastid transketolase or other transit peptides (for example transit peptides of rubisco (rbcS) small subunit or ferredoxin NADP oxidoreducing enzyme and isopentenylpyrophosphate isomerase-2 or its function equivalent).

Nucleotide sequence from three boxes of the plastid transit peptides of tobacco plastid transketolase is particularly preferred, and they have three reading frames of ATG codon at the NcoI restriction enzyme site as the KpnI/BamHI fragment:

pTP09

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGC

TATCCTCTCTCGTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTC

TCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAAATCCAA

TCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCG

CCGCCGCCGCCGTCGTAAGGTCACCGGCGATTCGTGCCTCAGCT

GCAACCGAAACCATAGAGAAAACTGAGACTGCGGGATCC_BamH

I

pTP10

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGC

TATCCTCTCTCGTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTC

TCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAAATCCAA

TCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCG

CCGCCGCCGCCGTCGTAAGGTCACCGGCGATTCGTGCCTCAGCT

GCAACCGAAACCATAGAGAAAACTGAGACTGCGCTGGATCC_Ba

mHI

pTP11

KpnI_GGTACCATGGCGTCTTCTTCTTCTCTCACTCTCTCTCAAGC

TATCCTCTCTCGTTCTGTCCCTCGCCATGGCTCTGCCTCTTCTTC

TCAACTTTCCCCTTCTTCTCTCACTTTTTCCGGCCTTAAATCCAA

TCCCAATATCACCACCTCCCGCCGCCGTACTCCTTCCTCCGCCG

CCGCCGCCGCCGTCGTAAGGTCACCGGCGATTCGTGCCTCAGCT

GCAACCGAAACCATAGAGAAAACTGAGACTGCGGGGATCC_Bam

HI

Other example of plastid transit peptides is from the transit peptides of the isopentenylpyrophosphate isomerase-2 (IPP-2) of mouseearcress plastid with from the transit peptides (Guerineau of pea carboxydismutase small subunit (rbcS), F, Woolston, S, Brooks, L, Mullineaux, P (1988) is used for the expression cassette with foreign protein target chromoplast, Nucl.Acids Res.16:11380).

Nucleic acid of the present invention can synthesize preparation or natural generation or can contain synthetic and natural acid mixture of ingredients, and also can partly be made up of multiple organic multiple heterologous gene.

As mentioned above, have by plants of tagetes species the synthesizing ribonucleotide sequence of preferred codon be preferred.Can determine preferred these codons of plant from the codon that most purpose plant species, has high expressed protein frequency.

In the preparation of expression cassette, can operate multiple dna fragmentation and obtain with the correct direction easy-to-read and place the nucleotide sequence of correct reading frame.For being connected to each other of dna fragmentation, joint or connexon can be added on the fragment.

Easily, can the joint of one or more restriction enzyme sites or polylinker be will contain with transcriptional orientation and promoter and terminator zone are provided in to insert described sequence.Usually, joint has from 1 to 10, and usually from 1 to 8, from 2 to 6 restriction enzyme sites preferably.Usually, in the regulation and control zone, the joint size is less than 100bp, is less than 60bp usually, but is at least 5bp.For host plant, promoter can be natural or homology also can be external or allos.Expression cassette 5 '-3 ' transcriptional orientation preferably contains promoter, nucleic acid sequence encoding or nucleic acid construct and tanscription termination zone.Multiple termination zone can be replaced as required each other.

The example of terminator is 35S terminator (Guerineau etc. (1988) Nucl Acids Res.16:11380), no terminator (Depicker A, Stachel S, Dhaese P, Zambryski P, Goodman HM., nopaline synthase: transcripting spectrum and dna sequence dna, J Mol Appl Genet.1982; 1 (6): 561-73) or ocs terminator (Gielen, J, de Beuckeleer, M, Seurinck, J, Debroek, H, de Greve, H, Lemmers, M, van Montagu, M, Schell, J (1984), the TL-DNA total order of Agrobacterium tumefaciems plasmid pTiAch5, EMBO is J.3:835-846).

In addition, can use the operation that the restriction enzyme site that is complementary is provided or removes DNA redundant or restriction enzyme site.Insert, disappearance or alternative can use mutagenesis in vitro, " primer reparation ", restriction enzyme digestion as conversion during with transversion or be connected.

Use suitable operation, for example restriction enzyme digestion, " digestion " or mend flat jag and form blunt ends can obtain the complementary terminal of the fragment that is used to connect.

Preferred polyadenylation signal is the plant polyadenylation signal, preferably correspond essentially to T-DNA polyadenylation signal from Agrobacterium tumefaciems (Agrobacterium tumefaciens), especially Ti-plasmids pTiACH5 (Gielen etc., EMBO is (1984) J.3,835 ff) polyadenylation signal or its function equivalent of T-DNA gene 3 (octopine synthase).

Foreign gene is transferred to Plant Genome is called conversion.

Therefore, can utilization itself known method transforms and from the plant tissue or the plant cell aftergrowth of instantaneous or stable conversion.

The proper method that is used for transforming plant is to take in the biology that carries out protoplast transformation, uses particle gun to launch (biolistic) method of hitting (being also referred to as the particle bombardment method), electroporation, hatch dry embryo method, microinjection and above-mentioned by agriculture bacillus mediated transgenosis containing dna solution by the polyethylene glycol inducing DNA.Described method is described in for example Transgenic Plants, 1 volume, B.Jenes among the Engineeringand Utilization (S.D.Kung and R.Wu Academic Press (1993) publish) etc., gene transfer technique, 128-143, and be described in Potrykus, Annu.Rev.Plant Physiol.Plant Molec.Biol.42 (1991), 205-225).

Preferably, the construct that desire is expressed is cloned into and is suitable for transforming in the carrier of Agrobacterium tumefaciems, pBin19 (Bevan etc., Nucl.Acids Res.12 (1984), 8711) or particularly preferably be pSUN2, pSUN3, pSUN4 or pSUN5 (WO 02/00900) for example.

The Agrobacterium that transforms by expression plasmid can be used to transform plant in known manner, for example by dipping bath wound leaf or vanes block in transforming Agrobacterium solution and cultivate them then in suitable culture medium.

Be also referred to as genetically modified plants hereinafter for preferably producing genetically modified plant, the amalgamation and expression box of expressing ketolase be cloned into carrier for example pBin19 or the particularly pSUN2 that is suitable for being transformed into Agrobacterium tumefaciems.To be used to transform plant with the Agrobacterium that this kind carrier transforms in known manner then, particularly by dipping bath wound leaf or vanes block in transforming Agrobacterium solution and in suitable culture medium, cultivate them then and obtain cultivating plant.

Carry out Plant Transformation by Agrobacterium and especially be disclosed in Transgenic Plants, Vol.1, Engineering and Utilization (S.D.Kung and R.Wu, Academic Press, 1993 publish) F.F.White in the book, be used for the carrier of transgenosis in the higher plant; The 15-38 page or leaf.In known manner, can bear again from the transformant of the leaf of wound or vanes block and contain the genetically modified plants of gene that are integrated into expression cassette and express the nucleic acid of coding ketolase.

For the conversion that transforms the Tagetes host plant with nucleic acid with coding ketolase, its expression cassette is integrated the insertion recombinant vector, described carrier DNA comprises extra functional adjustment signal, for example is used to the sequence of duplicating or integrating.Appropriate carriers especially is described in " Methods in PlantMolecular Biology and Biotechnology " (CRC Press), 6/7 chapter, 71-119 page or leaf (1993).

Use above-cited reorganization and clone technology, expression cassette can be cloned into appropriate carriers, for example amplification in Escherichia coli (E.coli.) to allow their amplification.Suitable cloning vector is pJIT117 (Guerineau etc. (1988) Nucl.Acids Res.16:11380), pBR332, pUC series, M13mp series and pACYC184 especially.Special appropriate carriers is the binary vector that not only can also can duplicate in Agrobacterium in Escherichia coli.

According to selection to promoter, can be in floral leaf composing type ground or be preferably specifically express.

Compare with wild type, the genetically modified plant of Tagetes of the present invention contains a certain amount of astaxanthin, especially in petal.

As mentioned above, the present invention relates to the purposes of the plants of tagetes species of astaxanthin-containing or its part or relate to the plants of tagetes species of astaxanthin-containing or the purposes of the astaxanthin-containing extract of its part, be used to be administered orally in animal.

In preferred embodiments, the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or its part or astaxanthin-containing or its part is used to make animal painted with corresponding animal product.

Think that the astaxanthin-containing extract of astaxanthin-containing plant or plant part preferably is meant the solution that contains the astaxanthin-containing that produces from astaxanthin-containing plant or plant part extracting by at least a appropriate solvent.According to employed solvent and employed chemistry and physical purification method, astaxanthin can be present in the extract with the purity of any expection.Suitably prepare the astaxanthin-containing plant before the extracting or plant part is favourable, for example dried plant or plant part and it is pulverized, it is chosen wantonly in proper order.

By organic solvent for example acetone, hexane, carrene, methyl tertiary butyl ether(MTBE), or by solvent mixture such as ethanol/hexane or acetone/hexane, can be from the plant or the plant part extracting astaxanthin of astaxanthin-containing, the dry in advance and/or pulverizing of the plant of astaxanthin-containing or plant part as required.By the different mixed proportion of solvent, owing to have different polarity, extraction efficiency can be different.By this kind extracting, can be with high concentration enrichment astaxanthin.

Extract the purity that astaxanthin can further improve astaxanthin by vibration and chromatography mixture then.The common conduct list of astaxanthin-and the existence of two ester admixtures, exist with palmitate usually.

Compare according to it is considered herein that " painted " preferably is meant with the non-staining animal, at least a portion color of painted animal or animal product is strengthened or the generation color.The astaxanthin-containing pigment is painted and initial usually or strengthen pink to pink-redness.

Can painted preferred animal be the animal that is selected from fish, crustacean or birds by dosage forms for oral administration of the present invention, especially Galliformes (galliformes) and Anatridae.

Preferred fish are salmonid (salmonid), especially salmon or trout.

Preferred crustacean is shrimp and crab.

Preferred Galliformes is chicken, duck or goose.

Preferred Anatridae is flamingo (flamingo).

Depend on painted animal, preferably, think that painted animal product refers in particular to salmon or trout flesh of fish, the skin of chicken, duck or goose, the feather of chicken, duck, goose or flamingo, and ovum of chicken, duck or goose or yolk.

By directly or by dosage forms for oral administration in advance the plants of tagetes species of astaxanthin-containing or the plants of tagetes species of plant part or astaxanthin-containing or the astaxanthin-containing extract of plant part being mixed in animal feed goods wherein, can realize the plants of tagetes species of astaxanthin-containing or the plants of tagetes species of plant part or astaxanthin-containing or the astaxanthin-containing extract of plant part are administered orally in animal.

In preferred embodiments, the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part is mixed in the animal feed goods and with the animal feed goods be administered orally in animal.

Before being mixed in the animal feed goods, it is favourable that the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part is processed into a kind of form that can be mixed in corresponding animal feed goods and preferably produce high stability and high bioavilability astaxanthin in use field separately.

According to it being carried out the animal of dosage forms for oral administration and also according to the animal feed goods, therefore multiple procedure of processing can be favourable to its purpose.

For the plants of tagetes species or the plant part of astaxanthin-containing, in this embodiment, dry and/or pulverize the plant of astaxanthin-containing or plant part especially capitulum or petal are favourable.Particularly preferably, the plants of tagetes species of astaxanthin-containing or plant part exist with powder type.

Yet no matter astaxanthin-containing plants of tagetes species or plant part that each embodiment is prepared are processed or are not processed, and all can be mixed in the animal feed goods in a manner known way.

For the plants of tagetes species of astaxanthin-containing or the astaxanthin-containing extract of plant part, in this embodiment, multiple procedure of processing all is favourable.

If still the solvent of Cun Zaiing is on the physiology when harmless for corresponding animal, the astaxanthin-containing extract can directly be mixed in the animal feed goods.

Evaporate after the solvent that still exists, extract can use with the form of astaxanthin-containing powder or oil.

For example, resulting astaxanthin-containing powder or oil can mix fish oil, are applied to for example wheat flour or wipe broken marigold petal of dust carrier material, perhaps are included in alginates, gelatin or the lipid.

Therefore preferably liquid or powder type of the extract after astaxanthin-containing extract or the processing.

Yet no matter the astaxanthin-containing extract of the plants of tagetes species of the astaxanthin-containing that each embodiment is prepared or plant part is processed or is not processed, and all can be mixed in the animal feed goods in a manner known way.

Therefore the invention still further relates to the animal feed goods of the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species that comprises astaxanthin-containing or plant part or astaxanthin-containing or plant part.

The invention further relates to by plants of tagetes species or the astaxanthin-containing extract of plant part and the method for traditional animal feed combination results animal feed goods plants of tagetes species or the plant part or the astaxanthin-containing of astaxanthin-containing.

The method embodiment preferred be included in animal feed combination before, with the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part be processed into a kind of can with the form of animal feed combination.

For example, for fish, the fish feed goods can comprise other common fish feed composition, for example fish meal and/or other protein, oil (for example fish oil), cereal, vitamin, mineral matter, anticorrisive agent and the medicine that also contains convention amount as required.

For example, the general fish feed goods that are used for trout are grouped into by following one-tenth:

Composition	% weight	For 500kg body weight kg
Composition	% weight	For 500kg body weight kg	The wheaten starch of fish meal full-fat bean gel in advance	30.00 20.00 18.00	150.00 100.00 90.00

Premix vitamin Lipotril (50%) wheat gluten Sipernat 50S fish oil

0.80 0.20 20.00 3.00 8.00

4.00 1.00 100.00 15.00 40.00

For example, the general fish feed goods that are used for salmon are grouped into by following one-tenth:

Composition	% weight
Composition	% weight	Fish meal phytoprotein cereal vitamin/mineral antioxidant/anticorrisive agent fish oil	75.00 5.00 7.80 1.00 0.20 11.00

In one embodiment, the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing extract preferably are mixed in the animal feed goods with the powder type of drying and pulverizing.

About fish feed, the animal feed goods of the plants of tagetes species of the resulting plants of tagetes species that contains astaxanthin-containing or plant part or astaxanthin-containing or the astaxanthin-containing extract of plant part can be for example in a manner known way by granulating or particularly advantageously be extruded.

In preferred embodiments, the astaxanthin-containing extract mixes in the animal feed goods, preferably mixes with liquid form.This is favourable, particularly when producing the fish feed goods of extruding.Extrusion process for sensitive materials for example astaxanthin cause squeeze pressure, this may cause astaxanthin loss.Squeeze pressure mainly is the effect of mechanical force (kneading, shearing, compressing etc.), but also comprises by adding the hydro-thermal pressure that entry and steam cause, and also can observe oxidative pressure.

For fear of resultant astaxanthin loss, after extruding or dry run, under vacuum condition, can pass through PPA (use the back of granulating) technology using liquid astaxanthin-containing extract as above-mentioned extrusion process.

In the embodiment that is more preferably, the astaxanthin-containing extract per os of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part directly is applied to animal.

Before using, it is favourable that the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part is processed into a kind of form that can directly be administered orally in animal and preferably produce high stability and high bioavilability astaxanthin in use field separately.

Depend on the animal that it is carried out dosage forms for oral administration, and also depend on the animal feed goods that therefore multiple procedure of processing all can be favourable.

For the plants of tagetes species or the plant part of astaxanthin-containing, dry in this embodiment and/or pulverize the plant of astaxanthin-containing or plant part especially capitulum or petal are favourable.Particularly preferably, the plants of tagetes species of astaxanthin-containing or plant part exist with powder type.

Yet no matter the plants of tagetes species of the astaxanthin-containing that each embodiment is prepared or plant part are processed or are not processed, and all can be administered orally in animal in a manner known way.

If still the solvent of Cun Zaiing is harmless on the physiology for corresponding animal, the astaxanthin-containing extract can directly be administered orally in animal.

Evaporate after the solvent that still exists, extract can be applied with the form of astaxanthin-containing powder or oil.

For example, resulting astaxanthin-containing powder or oil can mix fish oil, can be applied to for example wheat flour or wipe broken marigold petal of dust carrier material, perhaps are included in alginates, gelatin or the lipid.

Therefore preferably liquid or powder type of astaxanthin-containing extract or processing back extract.

Yet no matter the astaxanthin-containing extract of the plants of tagetes species of the astaxanthin-containing that each embodiment is prepared or plant part is processed or is not processed, and all can be administered orally in animal in a manner known way.

Therefore the invention still further relates to the colouring agent of the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species that contains astaxanthin-containing or plant part or astaxanthin-containing or plant part, the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part as required can be as above-mentioned processed in this case.

In preferred embodiments, colouring agent contains plants of tagetes species or the plants of tagetes species of plant part or astaxanthin-containing or the astaxanthin-containing extract of plant part of astaxanthin-containing, and the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part as required can be as above-mentioned processed in this case.

In particularly preferred colouring agent, employed plant part is capitulum or petal.

The invention further relates to and be administered orally in animal by astaxanthin-containing extract and carry out animal or animal product method of colouring the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part.

The invention further relates to and be administered orally in animal by astaxanthin-containing extract and produce the painted animal or the method for animal product the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part.

The invention further relates to the purposes of the astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part as animal feed or animal feed additive.

Contain the colouring agent of astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part or the advantage that the animal feed that contains these colouring agents also has pigment astaxanthin high storage stability and high bioavilability.

To describe the present invention by following examples now, but be not limited thereto:

Example I

Produce the genetically modified plant of Tagetes of astaxanthin-containing

The normal experiment condition:

The sequence analysis of recombinant DNA

(Sanger etc., Proc.Natl.Acad.Sci.USA 74 (1977), 5463-5467) use the laser fluorescence DNA-sequenator from Licor (to distribute by MWG Biotech, Ebersbach) recombinant DNA molecules is checked order by the Sanger method.

Example I .1:

Amplification coding is from the cDNA of the total length primary sequence of the ketolase of haematococcus pluvialis Flotow em.Wille

Increase from the cDNA of haematococcus pluvialis coding ketolase from haematococcus pluvialis (192.80 strains at G_ttingen university algal cultures preservation center) suspension culture by PCR method.

For from room temperature (1.2g/l sodium acetate, 2g/l yeast extract, 0.2g/l MgCl the haematococcus culture medium ₂6H ₂O, 0.02 CaCl ₂2H ₂O; PH 6.8; Behind the autoclaving, add 400mg/lL-asparagine, 10mg/l FeSO ₄H ₂O) the indirect daylight total RNA of preparation in haematococcus pluvialis (192.80 strain) suspension culture in 2 weeks that grows, step is a harvesting, freezingly grinds in liquid nitrogen and in mortar.Be transferred to the alga cells of the freezing pulverizing of 100mg in the reaction vessel then and add in the 0.8ml Trizol buffer solution (LifeTechnologies).With 0.2ml chloroform extracting suspension.Behind centrifugal 15 minutes of 12 000g, take out moisture supernatant and it is transferred in the new reaction vessel and carries out extracting with the long-pending ethanol of monoploid.With the long-pending isopropanol precipitating RNA of monoploid, be dissolved in the DEPC water (room temperature will contain the water overnight incubation of 1/1000 volume pyrocarbonic acid diethyl ester, autoclaving then) with the washing of 75% ethanol and with sediment.By spectrophotometry RNA concentration.

Synthetic for cDNA, with 60 ℃ of sex change of the total RNA of 2.5 μ g 10 minutes, cooled on ice 2 minutes is also utilized cDNA kit (Ready-to-go-you-prime-beads, Pharmacia Biotech), use antisense-special primer (PR1 SEQ ID NO:29) that it is transcribed into cDNA according to the explanation of manufacturer.

Use one to have a mind to-special primer (PR2 SEQ ID NO:30) and an antisense-special primer (PR1 SEQ ID NO:29), increase from the nucleic acid of haematococcus pluvialis (192.80 strain) coding ketolase from haematococcus pluvialis by PCR (PCR).

The PCR condition is as follows:

The cDNA of the ketolase protein that pcr amplification coding is made up of the total length primary sequence in containing the 50ml reactant mixture of following composition:

-4ml haematococcus pluvialis cDNA (as above-mentioned preparation)

-0.25mM dNTPs

-0.2mM PR1(SEQ ID NO：29)

-0.2mM PR2(SEQ ID NO：30)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-25.8ml distilled water.

PCR carries out under following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

53 ℃ 2 minutes

72 ℃ 3 minutes

1 * 72 ℃ 10 minutes

Use the 1155bp fragment (SEQ ID NO:22) of the pcr amplification generation coding total length primary sequence protein of SEQ ID NO:29 and SEQ ID NO:30.Use standard method, amplicons cloned is gone into PCR cloning vector pGEM-Teasy (Promega) and obtained cloning pGKETO2.

Sequencing analysis to the clone pGKETO2 that contains T7 and SP6 primer confirms that this sequence only has three codons 73,114 and 119 different with disclosed sequence X 86782, wherein has a base difference in each codon.In different amplification experiment, also produced these nucleotide substitutions and therefore represented nucleotide sequence (Fig. 1 and 2, sequence relatively) in employed haematococcus pluvialis 192.80 strains.

Therefore this clone is used to be cloned into expression vector pJIT117 (Guerineau etc., 1988, Nucl.Acids Res.16:11380).Clone by separating 1027bp SpHI fragment from pGEM-Teasy and connecting into the carrier pJIT117 that cuts through the SpHI enzyme.The clone who contains haematococcus pluvialis ketolase and N end and rbcs transit peptides translation fusion with correct direction is called pJKETO2.

Example I .2:

Amplification coding is from the terminal cDNA that shortens 14 amino acid whose ketolases of the N of haematococcus pluvialis Flotow em.Wille

Utilize the PCR method from the terminal cDNA that shortens 14 amino acid whose ketolases of haematococcus pluvialis suspension culture (192.80 strains at G_ttingen university algal cultures preservation center) amplification coding haematococcus pluvialis (192.80 strain) N.

As described in embodiment 1, prepare total RNA from haematococcus pluvialis (192.80 strain) suspension culture.

Synthetic as carrying out cDNA as described in the embodiment 1.

Utilize PCR (PCR) to use one to have a mind to special primer (PR3 SEQ IDNO:31) and an antisense special primer (PR1 SEQ ID NO:29) from the nucleic acid of haematococcus pluvialis amplification coding from 14 amino acid whose ketolases of the terminal shortening of the N of haematococcus pluvialis (192.80 strain).

The PCR condition is as follows:

The terminal cDNA that shortens 14 amino acid whose ketolase protein of pcr amplification coding N in containing the 50ml reactant mixture of following composition:

-4ml haematococcus pluvialis cDNA (as above-mentioned preparation)

-0.25mM dNTPs

-0.2mM PR1(SEQ ID NO：29)

-0.2mM PR3(SEQ ID NO：31)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-25.8ml distilled water.

PCR carries out under following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

53 ℃ 2 minutes

72 ℃ 3 minutes

1 * 72 ℃ 10 minutes

Use the pcr amplification reaction of SEQ ID NO:29 and SEQ ID NO:31 to produce the 1111bp fragment of coding-terminal amino acid (position 2-16) by the ketolase protein of single amino acid (leucine) replacement.

Use standard method, amplicons cloned is gone into PCR cloning vector pGEM-Teasy (Promega).Use primer T7 to carry out sequencing with SP6 and confirm that this sequence is identical with sequence SEQ IDNO:22, difference is that the 5 ' zone (position 1-53) of SEQ ID NO:22 is replaced by nine different base sequences among the amplicon SEQ ID NO:24.Therefore this clone is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).

Clone by separating 985bp SpHI fragment from pGEM-Teasy and connecting into the carrier pJIT117 that cuts through the SpHI enzyme.Contain the terminal clone who shortens 14 amino acid whose haematococcus pluvialis ketolases and N-end and rbcs transit peptides fusion translation of N with correct direction and be called pJKETO3.

Example I .3:

(algal cultures preservation center 192.80 strains of G_ttingen university) contain the ketolase of whole primary sequences and merge the cDNA that the terminal myc-label of C-is arranged amplification coding from haematococcus pluvialis Flotow em.Wille

(192.80 strain) contains the ketolase of whole primary sequences and merges the cDNA that the terminal myc-label of C-is arranged from haematococcus pluvialis to utilize plasmid pGKETO2 (as described in example 1 above) and primer PR15 (SEQ ID NO:32) preparation coding by the PCR method.Primer PR15 comprises 5 ' zone (nucleotides 1-39) of special 3 ' zone (nucleotides 40-59) of antisense and coding myc-label.

In containing the 11.5ml reactant mixture of following composition, carry out sex change (95 ℃ 5 minutes) and the annealing (slowly cooling to 40 ℃) of pGKETO2 and PR15 in room temperature:

-1mg pGKETO2 DNA

-0.1mg PR15(SEQ ID NO：32)

In containing the 20ml reactant mixture of following composition, mend flat 3 ' terminal (30 ℃ 30 minutes):

-11.5ml pGKETO2/PR15 annealing reaction liquid (producing as mentioned above)

-50mM dNTPs

-2ml 1 * Ke Lienuo buffer solution

-2U Klenow enzyme

Use one to have a mind to special primer (PR2 SEQ IDNO:30) and an antisense special primer (PR15 SEQ ID NO:32) (192.80 strain) contains the ketolase of whole primary sequences and merge the nucleic acid that C end myc-label is arranged from haematococcus pluvialis from the haematococcus pluvialis amplification coding by PCR (PCR).

The PCR condition is as follows:

The pcr amplification coding has the cDNA of the ketolase protein that merges the terminal myc-label of C in containing the 50ml reaction mixture of following composition:

-1ml annealing reaction liquid (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR15(SEQ ID NO：32)

-0.2mM PR2(SEQ ID NO：30)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

Carry out PCR at following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

53 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use SEQ ID NO:32 and SEQ ID NO:30 pcr amplification to produce and encode and contain from whole primary sequences of haematococcus pluvialis ketolase and 1032bp fragment terminal at N and the fusion of rbcS transit peptides and and the dual translation fused protein that the myc-label merges terminal at C.

Use standard method, amplicons cloned is gone into PCR cloning vector pGEM-Teasy (Promega).Use primer T7 to carry out sequencing with SP6 and confirm that this sequence is identical with sequence SEQ IDNO:22, difference is replaced by different 39bp sequences by the 3 ' zone (position 993-1155) of SEQ ID NO:22 in amplicon SEQ ID NO:26.Therefore this clone is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).

Clone by separating 1038bp EcoRI-SpHI fragment from pGEM-Teasy and connecting into the carrier pJIT117 that cuts through the EcoRI-SpHI enzyme.Connect and cause between the C of rbcS transit peptide sequence end and ketolase sequence of N end, producing the translation fusion.Contain with correct direction and be called pJKETO4 the terminal clone of merging myc-label and and the haematococcus pluvialis ketolase that the translation of rbcS transit peptides is merged terminal of C at N.

Example I .4:

Amplification coding is from the DNA of the whole primary sequences of ketolase of beads algae (Nostoc sp.) PCC 7120

By the bacterial strain of PCR from beads algae PCC 7120 (" Pasteur cyanobacteria culture collection center (Pasteur Culture Collection of Cyanobacterium ")) amplification coding is from the DNA of beads algae PCC 7120 ketolases.

For from 25 ℃ in BG 11 culture mediums (1.5g/l NaNO ₃, 0.04g/lK ₂PO ₄3H ₂O, 0.075g/l MgSO ₄H ₂O, 0.036g/l CaCl ₂2H ₂O, 0.006g/l citric acid, 0.006g/l ferric citrate, 0.001g/l EDTA disodium magnesium, 0.04g/l Na ₂CO ₃, 1ml trace meter mixture A5+Co (2.86g/l H ₃BO ₃, 1.81g/l MnCl ₂4H ₂O, 0.222g/lZnSO ₄7H ₂O, 0.39g/l NaMoO ₄2H ₂O, 0.079g/l CuSO ₄5H ₂O, 0.0494g/lCo (NO ₃) ₂6H ₂O) prepare genomic DNA in beads algae PCC 7120 suspension cultures in continuous light and persistent oscillation (150 rev/mins) one week of growth in,, freezingly pulverize in liquid nitrogen and in mortar by centrifugal cell harvesting.

Step from beads algae PCC 7120 DNA isolations:

By 8000 rev/mins centrifugal 10 minutes, from the 10ml liquid culture, be settled out bacterial cell.Use mortar in liquid nitrogen, to push and grind bacterial cell then.Cellular material is resuspended in 1ml 10mM Tris HCl (pH 7.5) and is transferred in the Eppendorf reaction vessel (2ml volume).Add 100 μ l Proteinase Ks (concentration: 20mg/ml), cell suspension was hatched 3 hours at 37 ℃.Use 500 μ l phenol extracting suspension then.13000 rev/mins after centrifugal 5 minutes, the water on upper strata is transferred in the new 2ml Eppendorf reaction tube.Repeat phenol extracting 3 times.Add the 3M sodium acetate (pH 5.2) of 1/10 volume and the isopropanol precipitating DNA of 0.6 volume, wash with 70% ethanol then.Drying at room temperature DNA precipitation adds 25 μ l water then 65 ℃ of heating for dissolving.

By PCR (PCR), use one to have a mind to special primer (NOSTF, SEQID No.87) and an antisense special primer (NOSTG, SEQ ID NO.88) from the nucleic acid of beads algae PCC7120 amplification coding from the ketolase of beads algae PCC 7120.

The PCR condition is as follows:

The pcr amplification coding contains the ketolase protein DNA of whole primary sequences in containing 50 μ l reaction mixtures of following composition:

-1 μ l beads algae PCC 7120 DNA (preparation as mentioned above)

-0.25mM dNTPs

-0.2mM NOSTF(SEQ ID No.87)

-0.2mM NOSTG(SEQ ID No.88)

-5 μ l 10 * PCR buffer solutions (TAKARA)

-0.25 μ l R Taq polymerase (TAKARA)

-25.8 μ l distilled water.

Under following cycling condition, carry out PCR:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

55 ℃ 1 minute

72 ℃ 3 minutes

1 * 72 ℃ 10 minutes

Use SEQ ID NO:87 and SEQ ID NO:88 pcr amplification to produce and encode and contain the 805bp fragment (SEQ ID NO:89) of the whole primary sequences of protein.Use standard method, amplicons cloned is gone into PCR cloning vector pGEM-T (Promega) and obtained cloning pNOSTF-G.

Use M13F to check order at clone pNOSTF-G and confirm that this sequence is identical with the dna sequence dna of database typing AP003592 with the M13R primer.In different amplification experiments, also produced this nucleotide sequence, so it has represented the nucleotide sequence among the employed beads algae PCC 7120.

Therefore cloning pNOSTF-G is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).Clone by separating 1027bp SpHI fragment from pGEM-T and connecting into the carrier pJIT117 that cuts through the SpHI enzyme.Contain the Nostoc ketolase and be called pJNOST with correct direction the terminal clone of merging of its N with the translation of rbcS transit peptides.

Example I .5:

Generation is used for the expression vector at marigold constitutive expression haematococcus pluvialis ketolase.

Ketolase from haematococcus pluvialis is expressed (Franck etc. 1980, Cell 21:285-294) in marigold under the constitutive promoter d35S of CaMV control.Use is expressed (Anderson etc. 1986, and Biochem J.240:709-715) from the transit peptides rbcS of pea.

Produce the expression cassette be used for carrying out agriculture bacillus mediated conversion from the haematococcus pluvialis ketolase marigold by binary vector pSUN5 (WO 02/00900).

In order to produce marigold expression vector pS5KETO2, will be connected (Fig. 3, construct figure) with the carrier pSUN5 that cuts through the SacI-XhoI enzyme from the 2.8KbSacI-XhoI fragment of pJKETO2.In Fig. 3,35S promoter (747bp), fragment rbcS that fragment d35S contains repetition are that the rbcS transit peptides (204bp) from pea, whole primary sequences (1027bp), the fragment term of fragment KETO2 coding haematococcus pluvialis ketolase are CaMV polyadenylation signal (761bp).

Example I .5A:

Generation is used for the expression vector at marigold specifically expressing haematococcus pluvialis ketolase

Use is expressed ketolase (Anderson etc. 1986, and Biochem J.240:709-715) from haematococcus pluvialis from the transit peptides rbcS of pea in marigold.At arabidopsis cauliflower specific promoter (AL132971: nucleotides zone 9298-10 200; Hill etc. (1998) Development 125:1711-1721) expresses under the control of modified forms AP3P.

Utilize genomic DNA (separating from mouseearcress) and primer PR7 (SEQ ID NO:33) and PR10 (SEQ ID NO:36) to produce the dna fragmentation that contains mouseearcress AP3 promoter region-902-+15 by PCR by standard method.

The PCR condition is as follows:

In containing the 50ml reaction mixture of following composition pcr amplification contain the AP3 promoter fragment (DNA 902-+15):

-100ng mouseearcress genomic DNA

-0.25mM dNTPs

-0.2mM PR7(SEQ ID NO：33)

-0.2mM PR10(SEQ ID NO：36)

-5ml 10 * PCR buffer solution (Stratagene)

-0.25ml Pfu polymerase (Stratagene)

-28.8ml distilled water.

PCR is undertaken by following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use standard method that the 922bp amplicons cloned is gone into PCR cloning vector pCR 2.1 (Invitrogen), and obtain plasmid pTAP3.

Sequencing to clone pTAP3 confirms that its sequence and disclosed AP3 sequence (AL132971, nucleotides zone 9298-10 200) only exist an insertion (9765 of sequence A L132971 are inserted G) to replace the different of (9726 the A of sequence A L132971 replaces with G) with a base.The difference that these nucleotides in different amplification experiments, also occurred, so this sequence has been represented nucleotide sequence actual in the used mouseearcress plant.

Utilize plasmid pTAP3 to produce the AP3P of modified forms by the recombinant PCR method.Use primer PR7 (SEQ ID NO:33) and PR9 (SEQ ID NO:35) amplification region 10 200-9771 (amplicon A7/9), use PR8 (SEQ ID NO:34) and PR10 (SEQ ID NO:36) amplification region 9526-9285 (amplicon A8/10).

The PCR condition is as follows:

Pcr amplification contains the dna fragmentation of AP3 promoter region 10 200-9771 and regional 9526-9285 in the 50ml reactant mixture, and wherein composition is as follows:

-100ng AP3 amplicon (as mentioned above)

-0.25mM dNTP

-0.2mM has a mind to primer (PR7 SEQ ID NO:33 or PR8 SEQ ID NO:34)

-0.2mM antisense primer (PR9 SEQ ID NO:35 or PR10 SEQ ID NO:36)

-5ml 10 * PCR buffer solution (Stratagene)

-0.25ml Pfu Taq polymerase (Stratagene)

-28.8ml distilled water.

PCR is undertaken by following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

The recombinant PCR reaction comprises anneals to 25 overlapping amplicon A7/9 and A8/10 of nucleotide sequence, forms double-stranded and amplification subsequently.This produces the modified forms AP3P of AP3 promoter, wherein 9670-9526 position disappearance.In containing the 17.6ml reactant mixture of following composition, carry out sex change (95 ℃ 5 minutes) and the annealing (room temperature slowly cools to 40 ℃) of two amplicon A7/9 and A8/10:

-0.5mg A7/9 amplicon

-0.25mg A8/10 amplicon

In containing the 20ml reactant mixture of following composition, mend flat (30 ℃ 30 minutes) 3 ' end:

-17.6ml gA7/9 and A8/10 annealing reaction liquid (producing as mentioned above)

-50mM dNTP

-2ml 1 * Ke Lienuo buffer solution

-2U Klenow enzyme

Use a nucleic acid of having a mind to special primer (PR7 SEQ ID NO:33) and an antisense special primer (PR10 SEQ ID NO:36) the modified form AP3P of amplification coding promoter by PCR method.

The PCR condition is as follows:

Pcr amplification AP3P fragment in containing the 50ml reactant mixture of following composition:

-1ml annealing reaction liquid (producing as mentioned above)

-0.25mM dNTP

-0.2mM PR7(SEQ ID NO：33)

-0.2mM PR10(SEQ ID NO：36)

-5ml 10 * PCR buffer solution (Stratagene)

-0.25ml Pfu Taq polymerase (Stratagene)

-28.8ml distilled water.

PCR is undertaken by following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

The pcr amplification that uses SEQ ID NO:33 and SEQ ID NO:36 to carry out produces the 778bp fragment of the modified form AP3P of coding promoter.Amplicons cloned is gone into cloning vector pCR2.1 (Invitrogen).Use the sequencing of primer T7 and M13 to confirm that its sequence is identical with zone 10 200-9298 that sequence A L132971 interior zone 9285-9526 has lacked.Therefore this clone is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).

Clone by separating 771bp SacI-HindIII fragment from pTAP3P and connecting into the carrier pJIT117 that cuts through the SacI-HindIII-enzyme.The clone who contains promoter AP3P rather than original promoter d35S is called pJAP3P.

In order to produce expression cassette pJAP3PKETO2, KETO2 is cloned in the carrier pJAP3P that the SpHI-enzyme is cut with 1027bp SpHI fragment.The fragment KETO2 and the terminal clone of merging with the rbcS transit peptides of its N-that contain correct direction are called pJAP3PKETO2.

In order to produce expression cassette pJAP3PKETO4,1032bp SpHI-EcoRI fragment KETO4 (being described in embodiment 3) is cloned in the carrier pJAP3P that the SpHI-EcoRI-enzyme is cut.The fragment KETO4 and the terminal clone of merging with the rbcS transit peptides of its N-that contain correct direction are called pJAP3PKETO4.

Use binary vector pSUN5 (WO 02/00900) preparation to be used for carrying out the expression vector that agriculture bacillus mediated haematococcus pluvialis is subjected to the conversion of AP3P-control ketolase marigold.

In order to produce expression vector pS5AP3PKETO2, will connect into the carrier pSUN5 (Fig. 4, construct figure) that cuts through the SacI-XhoI-enzyme from the 2.8KB bp SacI-XhoI fragment of pJAP3PKETO2.In Fig. 4, Segment A P3P contains modified AP3P promoter (771bp), fragment rbcS contains the rbcS transit peptides (204bp) of pea, fragment KETO2 (1027bp) contains whole primary sequences of coding haematococcus pluvialis ketolase, and fragment term (761bp) contains the CaMV polyadenylation signal.

Example I .5.B:

Generation is used for reading at the marigold constitutive expression expression vector of ball algae PCC 7120 ketolases

The Nostoc ketolase is expressed under mouseearcress constitutive promoter FNR (ferredoxin-NADPH oxidoreducing enzyme) control in the marigold.Use pea transit peptides rbcS to express (Anderson etc. 1986, and Biochem J.240:709-715).

Utilize genomic DNA (using standard method to separate) and primers F NR-1 (SEQ ID No.90) and FNR-2 (SEQ ID No.91) to produce the dna fragmentation that contains mouseearcress FNR promoter region-635--1 by PCR method from mouseearcress.

The PCR condition is as follows:

In containing 50 μ l reactant mixtures of following composition pcr amplification contain FNR promoter fragment FNR1-2 (DNA 635--1):

-100ng mouseearcress genomic DNA

-0.25mM dNTP

-0.2mM FNR-1(SEQ ID No.90)

-0.2mM FNR-2(SEQ ID No.91)

-5 μ l 10 * PCR buffer solutions (Stratagene)

-0.25 μ l Pfu polymerase (Stratagene)

-28.8 μ l distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

By standard method the 653bp amplicons cloned is gone into PCR cloning vector pCR 2.1 (Invitrogen) and obtained plasmid pFNR.

Clone pFNR is carried out sequencing confirm that No. 5 chromosome of its sequence and mouseearcress is from 70127-69 493 bit sequences parts consistent (data base access AB011474).This gene originates in base-pair 69 492 and is called " ferredoxin-NADP ⁺Reductase ".

This clone is called pFNR and is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).

Clone by separating 635bp SacI-HindIII fragment from pFNR and connecting into the carrier pJIT117 that cuts through the SacI-HindIII-enzyme.The clone who contains promoter FNR rather than original promoter d35S is called pJITFNR.

In order to produce expression cassette pJFNRNOST, 805bp SpHI fragment NOSTF-G (being described in embodiment 1) is cloned into the carrier pJITFNR that cuts through the SpHI-enzyme.The fragment NOSTF-G and the terminal clone of merging with the rbcS transit peptides of its N-that contain correct direction are called pJFNRNOST.

Use binary vector pSUN5 (WO 02/00900) to produce and be used for carrying out the expression cassette that the agriculture bacillus mediated expression vector with Nostoc ketolase transforms marigold.

In order to produce marigold expression vector pS5FNRNOST, the 2.4KbSacI-XhoI fragment (part SacI hydrolysis) of pJFNRNOST is connected into the carrier pSUN5 (Fig. 5, construct figure) that cuts through the SacI-XhoI-enzyme.In Fig. 5, fragment FNR promoter contains the FNR promoter (655bp) of repetition, fragment rbcS transit peptides contains pea rbcS transit peptides (204bp), fragment Nost ketolase (799bp) contains whole primary sequences of coding Nostoc ketolase, and fragment 35S Term (761bp) contains the CaMV polyadenylation signal.

Example I .5C:

Generation is used for the expression vector at marigold specifically expressing beads algae PCC 7120 ketolases

Use pea transit peptides rbcS in marigold, to express Nostoc ketolase (Anderson etc. 1986, and Biochen J.240:709-715).Be expressed in arabidopsis cauliflower specific promoter AP3 (AL132971: nucleotides zone 9298-10 200; Hill etc. (1998) Development 125:1711-1721) carries out under the modified form AP3P control.

Utilize genomic DNA (using standard method to separate) and primer AP3-1 (SEQ ID No.93) and AP3-2 (SEQ ID No.94) to produce the dna fragmentation that contains mouseearcress AP3 promoter region-902-+15 by PCR from mouseearcress.

The PCR condition is as follows:

In containing 50 μ l reactant mixtures of following composition pcr amplification contain the AP3 promoter fragment (DNA 902-+15):

-100ng mouseearcress genomic DNA

-0.25mM dNTP

-0.2mM AP3-1(SEQ ID No.93)

-0.2mM AP3-2(SEQ ID No.94)

-5 μ l 10 * PCR buffer solutions (Stratagene)

-0.25 μ l Pfu polymerase (Stratagene)

-28.8 μ l distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use standard method that the 929bp amplicons cloned is gone into PCR cloning vector pCR 2.1 (Invitrogen) and obtained plasmid pAP3.

Clone pAP3 is carried out sequencing confirm that this sequence and disclosed AP3 sequence (AL132971, nucleotides zone 9298-10 200) only exist an insertion (9765 of sequence A L132971 are inserted a G) to replace the different of (9726 the A of sequence A L132971 replaces with G) with a base.In different amplification experiments, also produced these nucleotides differences, so this sequence has been represented nucleotide sequence actual in the employed mouseearcress plant.

Utilize plasmid pAP3 to produce modified forms AP3P by the recombinant PCR method.Use primer AP3-1 (SEQ ID No.93) and AP3-4 (SEQ ID No.96) amplification region 10 200-9771 (amplicon A1/4), use AP3-3 (SEQ ID No.95) and AP3-2 (SEQ ID No.94) amplification region 9526-9285 (amplicon A2/3).

The PCR condition is as follows:

Pcr amplification contains the dna fragmentation of AP3 promoter region 10 200-9771 and regional 9526-9285 in containing 50 μ l reactant mixtures of following composition:

-100ng AP3 amplicon (as mentioned above)

-0.25mM dNTPs

-0.2mM has a mind to primer (AP3-1 SEQ ID No.93 or AP3-3 SEQ ID No.95)

-0.2mM antisense primer (AP3-4 SEQ ID No.96 or AP3-2 SEQ ID No.94)

-5 μ l 10 * PCR buffer solutions (Stratagene)

-0.25 μ l Pfu Taq polymerase (Stratagene)

-28.8 μ l distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Recombinant PCR comprises that there are 25 amplicon A1/4 and A2/3 that nucleotide sequence is overlapping in annealing, forms double-stranded and amplification subsequently.This produces the modified form AP3P of AP3 promoter, wherein 9670-9526 position disappearance.In containing 17.6 μ l reactant mixtures of following composition, carry out sex change (95 ℃ 5 minutes) and the annealing (room temperature slowly cools to 40 ℃) of two amplicon A1/4 and A2/3:

-0.5 μ g A1/4 amplicon

-0.25 μ g A2/3 amplicon

In containing 20 μ l reactant mixtures of following composition, mend flat (30 ℃ 30 minutes) 3 ' end:

-17.6 μ l A1/4 and A2/3 annealing reaction liquid (producing as mentioned above)

-50μM dNTPs

-2 μ l 1 * Ke Lienuo buffer solution

-2U Klenow enzyme

Use a nucleic acid of having a mind to special primer (AP3-1 SEQ ID No.93) and an antisense special primer (AP3-2 SEQ ID No.94) the modified form AP3P of amplification coding promoter by PCR method.

The PCR condition is as follows:

Pcr amplification AP3P fragment in containing 50 μ l reactant mixtures of following composition:

-1 μ l annealing reaction liquid (producing as mentioned above)

-0.25mM dNTPs

-0.2mM AP3-1(SEQ ID No.93)

-0.2mM AP3-2(SEQ ID No.94)

-5 μ l 10 * PCR buffer solutions (Stratagene)

-0.25 μ l Pfu Taq polymerase (Stratagene)

-28.8 μ l distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use SEQ ID No.93 (AP3-1) and SEQ ID No.94 (AP3-2) to carry out the 783bp fragment that pcr amplification produces the modified form AP3P of coding promoter.Amplicons cloned is gone into cloning vector pCR2.1 (Invitrogen) and obtained plasmid pAP3P.Use primer T7 to carry out sequencing and confirm that this sequence is identical with the regional 10200-9298 that sequence A L132971 interior zone 9285-9526 has lacked with M13.Therefore this clone is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).

Clone by separating 783bp SacI-HindIII fragment from pAP3P and connecting into the carrier pJIT117 that cuts through the SacI-HindIII-enzyme.The clone who contains promoter AP3P rather than original promoter d35S is called pJITAP3P.In order to produce expression cassette pJAP3NOST, 805bp SpHI fragment NOSTF-G (being described in embodiment 1) is cloned into the carrier pJITAP3P that cuts through the SpHI-enzyme.The fragment NOSTF-G and the terminal clone of merging with the rbcS transit peptides of its N-that contain correct direction are called pJAP3PNOST.

Use binary vector pSUN5 (WO 02/00900) generation to be used for carrying out the expression cassette of the Nostoc ketolase conversion of agriculture bacillus mediated AP3P control marigold.

In order to produce expression vector pS5AP3PNOST, the 2.6KbSacI-XhoI fragment (part SacI hydrolysis) of pS5AP3PNOST is connected into the carrier pSUN5 (Fig. 6, construct figure) that cuts through the SacI-XhoI-enzyme.In Fig. 6, Segment A P3P contains modified AP3P promoter (783bp), fragment rbcS contains pea rbcS transit peptides (207bp), and fragment NOSTF-G (792bp) contains whole primary sequences of coding Nostoc ketolase, and fragment term (795bp) contains the CaMV polyadenylation signal.

Example I .6:

The generation of transgenosis marigold plant

With marigold seed sterilization and be positioned over germination culture medium (MS culture medium; Murashige and Skoog, Physiol.Plant.15 (1962), 473-497) pH 5.8,2% sucrose).Germination is to carry out in 18-28 ℃/20-200mE/3-16 week in temperature/illumination/time interval, is preferably 21 ℃, and 20-70mE cultivates 4-8 week.

Gather in the crops all ectogenetic plant leafs and transverse cuts till that time to middle arteries and veins.In preparation process, be 10-60mm with the size that is produced ²The leaf explant room temperature preservation the longest 2 hours in liquid MS medium.

Optional Agrobacterium tumefaciems bacterial strain but be preferably highly virulent strain and for example have the EHA105 grow overnight of the corresponding double base plasmid (for example pS5KETO2 and pS5AP3PKETO2) that carries selectable marker gene (preferably bar or pat) and one or more characteristic or reporter gene and be used for cultivating altogether with the leaf material.The growth of bacterial isolates is following to be carried out: the monospecific polyclonal of corresponding bacterial strain is inoculated in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, the 0.5% magnesium sulfate 7H that contains the 25mg/l kanamycins ₂O) cultivated 16-20 hour in and at 28 ℃.Pass through then 6000g centrifugal 10 minutes results bacterial suspension and with every OD ₆₀₀Approximately the concentration of 0.1-0.8 is resuspended in the liquid MS medium.This suspension is used for cultivating altogether with the leaf material.

Before cultivating altogether, replace preserving the MS culture medium of leaf immediately with bacterial suspension.The room temperature of vibrating was gently hatched leaf in the Agrobacterium suspension 30 minutes.Then the explant that infects being positioned over agar solidifies and (contains growth regulator for example on the MS culture medium of 3mg/l benayl aminopurine (BAP) and 1mg/l heteroauxin (IAA) as 0.8% plant agar (Duchefa, NL)).The location of leaf on culture medium is not important.Explant is cultivated 1-8 days, but be preferably 6 days, can use following condition: luminous intensity: 30-80mmol/m ²X second, temperature: 22-24 ℃, light/secretly be replaced by 16/8 hour.Then, the explant of cultivating altogether is transferred to fresh MS culture medium, is preferably the fresh MS culture medium that contains the isometric growth conditioning agent, this second culture medium additionally contains the antibiotic of bacteria growing inhibiting.Concentration is that the Ticarcillin/Clavulanate Acid (Timentin) of 200-500mg/l is particularly suitable for this purpose.As second selection component, use be to be used to screen successfully the composition that transforms.Be that the phosphinothricin of 1-5mg/l selects with concentration be very effective, but also can consider to use other selection component according to this method.

After each situation cultivated for one to three week, explant is transferred in the fresh culture up to plumule and budlet forms, then they are transferred to and contain the composition that Ticarcillin/Clavulanate Acid and PPT or other contain conditioning agent and just refer to such as 0.5mg/l indolebutyric acid (IBA) and 0.5mg/l gibberellic acid GA ₃The same basic culture medium in to take root.The branch of taking root can be transferred to the greenhouse.

Except said method, following promising change also is possible:

Before the bacterial infection explant, can with they in above-mentioned culture medium preincubate 1-12 days, be preferably 3-4 days, to be used for common cultivation.Then, infect as mentioned above, cultivate altogether and selectivity regeneration.

The pH that is used to regenerate (being generally 5.8) can be reduced to pH 5.2.This has improved the control to the Agrobacterium growth.

In regeneration culture medium, add AgNO ₃(3-10mg/l) improve cultivation conditions, comprised regeneration itself.

Reduction phenol forms and is for example citric acid, ascorbic acid, PVP and many other compositions of composition well known to those skilled in the art, and cultivation is had beneficial effect.

For all method, also can use fluid nutrient medium.Hatch on the conventional holder that culture also can the commerce in being placed on fluid nutrient medium can get.

According to above-mentioned method for transformation, use following expression construct to obtain following strain:

For example, use pS5KETO2 to obtain following strain: cs18-1 and cs18-2, for example use pS5AP3PKETO2 to obtain following strain: cs19-1, cs19-2 and cs19-3.For example, use pS5FNRNOST to obtain following strain: ms 103-1, ms103-2, ms103-3 for example, uses pS5AP3NOST to obtain following strain: ms 104-1, ms104-2, ms104-3.

Example I .8

The feature of genetically modified plants

Example I .8.1

The separation of carotenoid ester class in the genetically modified plants floral leaf

The overall work explanation:

In liquid nitrogen, grind the floral leaf of genetically modified plants also with 100% acetone extracting (3 times, each 500ml) petal powder (approximately 40mg) with mortar.Evaporating solvent and with carotenoid be resuspended in 100-200ml benzinum/acetone (5: 1, v/v).

According to their hydrophobicity, pass through at organic mobile phase (benzinum/acetone with the form that concentrates; 5: 1) in go up by TLC (TLC) in silica 60 F254 plates (Merck) and to separate carotenoid.On TLC, scrape yellow (lutein ester), red (keto-acid carotenoid ester) and orange (mixture of lutein ester and keto-acid carotenoid ester) band.

With the carotenoid of three wash-out silica bound of 500ml acetone, evaporating solvent also separates carotenoid by the HPLC method and also identifies.

By the C30 reversed-phase column, can region class carrotene monoesters and diester.The HPLC condition of work is in fact identical with disclosed method, and (Frazer etc. (2000), Plant Journal 24 (4): 551-558).Can identify carotenoid based on UV-VIS spectrum.

Example I .9

The enzyme hydrolysis of carotenoid ester and the evaluation of carotenoid

The overall work explanation

The petal material (50-100mg fresh weight) that in mortar, grinds with 100% acetone extracting (, vibrating about 15 minutes) at every turn with 500ml extracting 3 times.Evaporating solvent is dissolved in carotenoid 400ml acetone (475nm is absorbed between the 0.75-1.25) then and handled in ultra sonic bath 5 minutes.Carotenoid extract and 300ml 50mM Tris-HCl buffer solution (pH 7.0) mixed be incorporated in 37 ℃ and hatched 5-10 minute.Afterwards, add 100-200ml cholesterol esterase (storage liquid: 6.8 units/ml cholesterol esterase of pseudomonas (Pseudomonas spec.)).After 8-12 hour, add the 100-200ml enzyme again; In 24 hours, hatch the ester hydrolysis class at 37 ℃.Adding 0.35gNa ₂SO ₄10H ₂Behind O and the 500ml benzinum, mixture is fully mixed and centrifugal (3 minutes; 4500g).Take out benzinum mutually and again with 0.35g Na ₂SO ₄10H ₂O (anhydrous) mixes.Centrifugal 1 minute of 10 000g.Evaporate benzinum and dissociation carrotene is dissolved in 100-120ml acetone.Use HPLC and C30 reversed-phase column method, can identify dissociation carrotene based on retention time and UV-VIS spectrum.

Example I .10:

Generation is used for the cloning vector at the reverse repetition expression cassette of marigold specifically expressing ε-cyclase ds RNA

In marigold in arabidopsis cauliflower specific promoter AP3 (AL132971: nucleotides zone 9298-10 200; Hill etc. (1998) Development 125:1711-1721) the reverse repetition transcript of being made up of ε-cyclase fragment is expressed in modified form AP3P control down.

Under each situation, oppositely repeating transcript, to contain by functional introne be a potato ST-LH1 gene PIV2 introne forward fragment connected to one another (have a mind to fragment) and a reverse identical sequence fragment (antisense fragment) (1990) Mol Gen Genet220:245-50 such as () Vancanneyt G..

By PCR method, utilize genomic DNA (separating from mouseearcress) and primer PR7 (SEQ ID NO:49) and PR10 (SEQ ID NO:52) to produce coding mouseearcress AP3 promoter (cDNA 902-+15) by standard method.

The PCR condition is as follows:

Pcr amplification coding AP3 promoter fragment in containing the 50ml reactant mixture of following composition (DNA 902-+15):

-1ml mouseearcress genomic DNA (1: 100 dilution of Chan Shenging as mentioned above)

-0.25mM dNTP

-0.2mM PR7(SEQ ID NO：49)

-0.2mM PR10(SEQ ID NO：52)

-5ml 10 * PCR buffer solution (Stratagene)

-0.25ml Pfu polymerase (Stratagene)

-28.8ml distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use standard method that the 922bp amplicons cloned is gone into PCR cloning vector pCR 2.1 (Invitrogen) and obtained plasmid pTAP3.Clone pTAP3 is carried out sequencing confirm this sequence and disclosed AP3 sequence (AL132971, nucleotides zone 9298-10 200) only there is insertions (9765 of sequence A L132971 are inserted a G) alternative with a base (9726 the A of sequence A L132971 replaces with G) different (33: G replaces with T, and 55: G replaces with T).In different amplification experiments, also produce the difference of these nucleotides, therefore represented the nucleotide sequence in the employed mouseearcress.

Utilize plasmid pTAP3 to produce modified forms AP3P by the recombinant PCR method.Use primer PR7 (SEQ ID NO:49) and primer PR9 (SEQ ID NO:51) amplification 10 200-9771 zones (amplicon A7/9), use PR8 (SEQ ID NO:50) and PR10 (SEQ ID NO:52) amplification 9526-9285 zone (amplicon A8/10).

The PCR condition is as follows:

The dna fragmentation in pcr amplification coding AP3 promoter 10 200-9771 zone and 9526-9285 zone in containing the 50ml reactant mixture of following composition:

-100ng AP3 amplicon (as mentioned above)

-0.25mM dNTPs

-0.2mM PR7 (SEQ ID NO:49) or PR8 (SEQ ID NO:50)

-0.2mM PR9 (SEQ ID NO:51) or PR10 (SEQ ID NO:52)

-5ml 10 * PCR buffer solution (Stratagene)

-0.25ml Pfu Taq polymerase (Stratagene)

-28.8ml distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 2 minutes

72 ℃ 3 minutes

1 * 72 ℃ 10 minutes

The recombinant PCR method comprises having overlapping amplicon A7/9 of 25 nucleotide sequences and the annealing of A8/10, forms amplification double-stranded and subsequently.This has produced the modified forms AP3P of AP3 promoter, and wherein the 9670-9526 position is lacked.In containing the 17.6ml reactant mixture of following composition, carry out sex change (95 ℃ 5 minutes) and the annealing (room temperature slowly cools to 40 ℃) of two amplicon A7/9 and A8/10:

-0.5mg A7/9

-0.25mg A8/10

-17.6ml A7/9 and A8/10 annealing reaction liquid (producing as mentioned above)

-50mM dNTPs

-2ml 1 * Ke Lienuo buffer solution

-2U Klenow enzyme

Use a nucleic acid of having a mind to special primer (PR7 SEQ ID NO:49) and an antisense special primer (PR10 SEQ ID NO:52) the modified form AP3P of amplification coding promoter by PCR method.

The PCR condition is as follows:

-1ml annealing reaction liquid (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR7(SEQ ID NO：49)

-0.2mM PR10(SEQ ID NO：52)

-5ml 10 * PCR buffer solution (Stratagene)

-0.25ml Pfu Taq polymerase (Stratagene)

-28.8ml distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

50 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use PR7, the pcr amplification that SEQ ID NO:49 and PR10 SEQ ID NO:52 carry out produces the 778bp fragment of the modified form AP3P of coding promoter.Amplicons cloned is gone into cloning vector pCR2.1 (Invitrogen).Use the sequencing of primer T7 and M13 to confirm that this sequence is identical with the 10 200-9298 zones that sequence A L132971 interior zone 9285-9526 has lacked.Therefore this clone is used to be cloned into expression vector pJIT117 (Guerineau etc. 1988, Nucl.Acids Res.16:11380).

Clone by separating 771bp SacI-HindIII fragment from pTAP3P and connecting into the carrier pJIT117 that cuts through the SacI-HindIII-enzyme.Contain promoter AP3P but not the clone of original promoter d35S is called pJAP3P.

Utilize DNA p35SGUS INT (1990) Mol Gen Genet 220:245-50 such as () Vancanneyt G and primer PR40 (Seq ID NO:54) and PR41 (SeqID NO:55) amplification to contain the dna fragmentation of gene ST-LS1 introne PIV2 by PCR method.

The PCR condition is as follows:

Pcr amplification gene ST-LS1 introne PIV2 sequence in containing the 50ml reactant mixture of following composition:

-1ml p35SGUS INT

-0.25mM dNTPs

-0.2mM PR40(SEQ ID NO：54)

-0.2mM PR41(SEQ ID NO：55)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

53 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

The pcr amplification reaction that uses PR40 and PR41 to carry out produces the 206bp fragment.Use standard method, amplicons cloned is gone into PCR cloning vector pBluntII (Invitrogen) and obtained cloning pBluntII-40-41.Use primer SP6 that this clone is carried out sequencing and confirm that this sequence is with identical from the corresponding sequence of carrier p35SGUS INT.

Therefore this clone is used to be cloned into carrier pJAP3P (as mentioned above).

Clone by separating 206bp SalI-BamHI fragment from pBluntII-40-41 and connecting into the carrier pJAP3P that cuts through the SalI-BamHI-enzyme.Contain correct direction ST-LS1 gene PIV2 introne and be connected in the terminal clone of rbcs transit peptides 3 ' and be called pJAI1 and this clone and be suitable for producing and be used for the expression cassette that the flower specifically expressing oppositely repeats transcript.

In Fig. 7, Segment A P3P contains that modified AP3P promoter (771bp), fragment rbcs contain pea rbcS transit peptides (204 bp), fragment intron contains potato ST-LS1 gene PIV2 introne and fragment term (761bp) contains the CaMV polyadenylation signal.

Example I .11

Generation is used for the reverse repetition expression cassette (at the 5 ' zone of ε-cyclase cDNA) at marigold specifically expressing ε-cyclase dsRNA

Utilize one to have a mind to special primer (PR42 SEQ IDNO:56) and an antisense special primer (PR43 SEQ ID NO:57) and increase from marigold cDNA and contain ε-cyclase cDNA (Genbank accession number: the AF251016) nucleic acid in 5 '-terminal 435bp zone by PCR (PCR) method.Marigold ε-cyclase cDNA 5 '-terminal 435bp zone comprises 138bp 5 '-non-translated sequence (5 ' UTR) and 297bp corresponding N end code area.

In order to prepare total RNA of marigold flower, the flower of the freezing pulverizing of 100mg is transferred to reaction vessel and is dissolved in 0.8ml Trizol buffer solution (LifeTechnologies).With 0.2ml chloroform extracting suspension.Behind centrifugal 15 minutes of 12 000g, take out water and it is transferred to new reaction tube and with the long-pending alcohol extract of monoploid.With the long-pending isopropanol precipitating RNA of monoploid, wash and precipitation is dissolved in DEPC water (room temperature with the pyrocarbonic acid diethyl ester night incubation of 1/1000 volume, autoclaving then) with 75% ethanol.By spectrophotometry RNA concentration.Synthetic for cDNA, with the total RNA of 2.5 μ g 60 ℃ of sex change 10 minutes, cooled on ice 2 minutes is also utilized cDNA kit (Ready-to-go-you-prime-beads, Pharmacia Biotech), use antisense special primer (PR17 SEQ ID NO:53) that it is transcribed into cDNA according to the operation instruction of manufacturer.

PCR reaction condition subsequently is as follows:

Pcr amplification contains the PR42-PR43 dna fragmentation in ε-cyclase 5 '-terminal 435bp zone in containing the 50ml reactant mixture of following composition:

-1ml cDNA (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR42(SEQ ID NO：56)

-0.2mM PR43(SEQ ID NO：57)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water..

Pcr amplification contains the PR44-PR45 dna fragmentation in ε-cyclase 5 '-terminal 435bp zone in containing the 50ml reactant mixture of following composition:

-1ml cDNA (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR44(SEQ ID NO：58)

-0.2mM PR45(SEQ ID NO：59)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

PCR carries out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

58 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

The pcr amplification reaction that uses primer PR42 and PR43 to carry out produces the 443bp fragment, and uses the pcr amplification reaction of primer PR44 and PR45 to produce the 444bp fragment.

Use standard method that two amplicon PR42-PR43 (HindIII-SalI has a mind to) fragment and PR44-PR45 (EcoRI-BamHI antisense) fragment cloning are gone into PCR cloning vector pCR-BluntII (Invitrogen).Use primer SP6 to carry out sequencing and confirm that its sequence is identical with disclosed sequence A F251016 (SEQ ID NO:38) under each situation, except the restriction enzyme site difference that is imported.Therefore this clone is used for producing oppositely repetition construct (seeing example I .10) at cloning vector pJAI1.

Carry out cloning the first time step by separating 444bp PR44-PR45BamHI-EcoRI fragment from cloning vector pCR-BluntII (Invitrogen) and connecting into the carrier pJAI1 that cuts through the BamHI-EcoRI-enzyme.The clone who contains antisense orientation ε-cyclase 5 '-stub area is called pJAI2.Connect the fusion of transcribing that produces between ε-cyclase 5 '-stub area antisense fragment and the CaMV polyadenylation signal.

Carry out cloning the second time step by separating 443bp PR42-PR43HindIII-SalI fragment from cloning vector pCR-BluntII (Invitrogen) and connecting into the carrier pJAI2 that cuts through the HindIII-SalI-enzyme.Contain direction 435bp ε intentionally; The clone of-cyclase cDNA 5 '-stub area is called pJAI3.Connect to produce AP3P and ε-cyclase 5 '-stub area and have a mind to the fusion of transcribing between the fragment.

In order to be created in the reverse repetition expression cassette under the control of CHRC promoter, utilize petunia (petunia) genomic DNA (producing) and primer PRCHRC5 (SEQID NO:76) and PRCHRC3 (SEQ ID NO:77) amplification CHRC promoter fragment according to standard method.Amplicons cloned is gone into cloning vector pCR2.1 (Invitrogen).Use primer M13 the DCRP pCR2.1-CHRC of institute to be carried out sequencing and confirm that this sequence is identical with sequence A F099501 with T7.Therefore this clone is used to be cloned into expression vector pJAI3.

Clone by separating 1537bp SacI-HindIII fragment from pCR2.1-CHRC and connecting into the carrier pJAI3 that cuts through the SacI-HindIII-enzyme.Contain promoter CHRC but not the clone of original promoter AP3P is called pJCI3.

Utilize binary vector pSUN5 (WO02/00900) generation to be used for carrying out the expression vector of the conversion of the agriculture bacillus mediated reverse repetition transcript under AP3P-or CHRC-control marigold.

In order to produce expression vector pS5AI3, will connect into the carrier pSUN5 (Fig. 8, construct figure) that cuts through the SacI-XhoI-enzyme from the 2622bp SacI-XhoI fragment of pJAI3.

In Fig. 8, Segment A P3P contains modified AP3P promoter (771bp), fragment 5sense contains marigold ε-cyclase 5 ' zone (435bp) of direction intentionally, fragment intron contains potato ST-LS1 gene PIV2 introne, fragment 5anti contains marigold ε-cyclase 5 ' zone (435bp) of antisense orientation, and fragment term (761bp) contains the CaMV polyadenylation signal.

In order to produce expression vector pS5CI3, will connect into the carrier pSUN5 (Fig. 9, construct figure) that cuts through the SacI-XhoI-enzyme from the 3394bp SacI-XhoI fragment of pJCI3.

In Fig. 9, fragment CHRC contains promoter (1537bp), fragment 5sense contains marigold ε-cyclase 5 ' zone (435bp) of direction intentionally, fragment intron contains potato ST-LS1 gene PIV2 introne, fragment 5anti contains marigold ε-cyclase 5 ' zone (435bp) of antisense orientation, and fragment term (761bp) contains the CaMV polyadenylation signal.

Example I .12

Generation is used for the reverse repetition expression cassette (at the 3 ' zone of ε-cyclase cDNA) at marigold specifically expressing ε-cyclase dsRNA

By PCR (PCR) method, use one to have a mind to special primer (PR46SEQ ID NO:60) and an antisense special primer (PR47 SEQ ID NO:61) and increase from marigold and contain ε-cyclase cDNA (Genbank accession number: AF251016) 3 '-stub area (384bp) nucleic acid.Marigold ε-cyclase cDNA3 '-stub area (384bp) is made up of corresponding to the coding region of C end 140bp 3 '-non-translated sequence (3 ' UTR) and 244bp.

I.11 prepare total RNA from marigold flower as embodiment as described in.

As embodiment I.11 as described in, use the synthetic cDNA of antisense special primer PR17 (SEQ ID NO:53).

PCR reaction condition subsequently is as follows:

Pcr amplification contains the PR46-PR47 dna fragmentation in ε-cyclase 3 '-terminal 384bp zone in containing the 50ml reactant mixture of following composition:

-1ml cDNA (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR46(SEQ ID NO：60)

-0.2mM PR47(SEQ ID NO：61)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

Pcr amplification contains the PR48-PR49 dna fragmentation in ε-cyclase 3 '-terminal 384bp zone in containing the 50ml reactant mixture of following composition:

-1ml cDNA (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR48(SEQ ID NO：62)

-0.2mM PR49(SEQ ID NO：63)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

The PCR reaction is carried out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

58 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use the fragment of the pcr amplification reaction generation 392bp of SEQ ID NO:60 and SEQ ID NO:61, use the fragment of the pcr amplification reaction generation 396bp of SEQ ID NO:62 and SEQ ID NO:63.

Use standard method with two amplicons, PR46-PR47 fragment and PR48-PR49 fragment are cloned into PCR cloning vector pCR-BluntII (Invitrogen).Use primer SP6 to carry out sequencing and confirm that its sequence is identical with disclosed sequence A F251016 (SEQ ID NO:38) under each situation, except the restriction enzyme site difference that is imported.Therefore described clone is used for producing the reverse repetition construct (seeing example I .10) of cloning vector pJAI1.

Carry out first clone's step by separating 396bp PR48-PR49BamHI-EcoRI fragment from cloning vector pCR-BluntII (Invitrogen) and connecting into the carrier pJAI1 that cuts through the BamHI-EcoRI-enzyme.The clone who contains ε-cyclase 3 '-stub area of antisense orientation is called pJAI4.Connect the fusion of transcribing between the antisense fragment produced ε-cyclase 3 '-stub area and the CaMV polyadenylation signal.

Carry out second clone's step by separating 392bp PR46-PR47HindIII-SalI fragment from cloning vector pCR-BluntII (Invitrogen) and connecting into the carrier pJAI4 that cuts through the HindIII-SalI-enzyme.Containing intentionally, the clone of ε-cyclase the 392bp 3 '-stub area of direction is called pJAI5.Connect and to have produced AP3P and ε-cyclase 3 '-stub area and have a mind to the fusion of transcribing between the fragment.

Use binary vector pSUN5 (WO02/00900) to produce and be used for carrying out the expression vector that the agriculture bacillus mediated reverse repetition transcript under AP3P-control transforms marigold.In order to produce expression vector pS5AI5, will connect into the carrier pSUN5 (Figure 10, construct figure) that cuts through the SacI-XhoI enzyme from the 2523bp SacI-XhoI fragment of pJAI5.

In Figure 10, Segment A P3P contains the AP3P promoter (771bp) of modification, fragment 3sense contains marigold ε-cyclase 3 ' zone (435bp) of direction intentionally, fragment intron contains potato ST-LS1 gene IV2 introne, fragment 3anti contains marigold ε-cyclase 3 ' zone (435bp) of antisense orientation, and fragment term (761bp) contains the CaMV polyadenylation signal.

Example I .13

The clone of ε-cyclase promoter

Use genomic DNA (separating from marigold Orangenprinz strain) by two 199bp fragment and 312bp fragments of independently cloning tactful inverse PCR (adopting Proc.Natl.Acad.SciUSA 90:10370 such as Long) and TAIL-PCR (1995) Plant such as (J.8:457-463) Liu Y-G. separate epsilon-cyclase promoter by standard method.

In containing the 25 μ l reaction mixtures of EcoRV and RsaI, digest 2 μ g genomic DNAs for the inverse PCR method, be diluted to 300 μ l then and use the 3U ligase to reconnect for 16 ℃ and spend the night.Use primer PR50 (SEQ ID NO:64) and PR51 (SEQ ID NO:65), pass through pcr amplification reaction, produced under each situation to have a mind to direction and contained the fragment of 354bp ε-cyclase cDNA (Genbank accession number AF251016), this fragment has been connected (seeing Figure 11) with 5 '-stub area of ε-cyclase cDNA of 300bp ε-cyclase promoter and 70bp.

The PCR reaction condition is as follows:

Pcr amplification contains the PR50-PR51 dna fragmentation of ε-cyclase 312bp promoter fragment in containing the 50ml reaction mixture of following composition:

-1ml connects mixture (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR50(SEQ ID NO：64)

-0.2mM PR51(SEQ ID NO：65)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

The PCR reaction is carried out according to following cycling condition:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

53 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use the pcr amplification reaction of primer PR50 and PR51 to produce the 734bp fragment, wherein especially contain ε-cyclase 312bp promoter fragment (Figure 11).

Use standard method that amplicons cloned is gone into PCR cloning vector pCR2.1 (Invitrogen), use primer M13 and T7 to carry out sequencing and obtain sequence SEQ ID NO:45.In different amplification experiments, also produced this sequence, so this sequence has been represented the nucleotide sequence among the employed marigold strain Orangenprinz.

For the TAIL-PCR method, under each situation, use different gene specific primers (nested primer) to carry out three continuous PCR reactions.

In containing the 20ml reaction mixture of following composition, carry out the TAIL1-PCR reaction:

-1ng genomic DNA (producing as mentioned above)

Every kind of dNTP of-0.2mM

-0.2mM PR60(SEQ ID NO：66)

-0.2mM AD1(SEQ ID NO：69)

-2ml 10 * PCR buffer solution (TAKARA)

-0.5UR Taq polymerase (TAKARA)

-mend to 20ml with distilled water.

-AD1 is first mixture of sequence (a/c/g/t) tcga (g/c) t (a/t) t (g/c) g (a/t) gtt primer.

PCR reaction TAIL1 carries out under following cycling condition:

1 * 93 ℃: 1 minute, 95 ℃: 1 minute

5 * 94 ℃: 30 seconds, 62 ℃: 1 minute, 72 ℃: 2.5 minutes

1 * 94 ℃: 30 seconds, 25 ℃: 3 minutes, in 3 minutes, rise to 72 ℃,

72 ℃: 2.5 minutes

15 * 94 ℃: 10 seconds, 68 ℃: 1 minute, 72 ℃: 2.5 minutes;

94 ℃: 10 seconds, 68 ℃: 1 minute, 72 ℃: 2.5 minutes;

94 ℃: 10 seconds, 29 ℃: 1 minute, 72 ℃: 2.5 minutes

1 * 72 ℃: 5 minutes

In containing the 21ml reactant mixture of following composition, carry out TAIL2-PCR:

1: 50 dilution of-1ml TAIL1 reactant mixture (producing as mentioned above)

-0.8mM dNTP

-0.2mM PR61(SEQ ID NO：67)

-0.2mM AD1(SEQ ID NO：69)

-2ml 10 * PCR buffer solution (TAKARA)

-0.5UR Taq polymerase (TAKARA)

-mend to 21ml with distilled water.

PCR reaction TAIL2 carries out under following cycling condition:

12 * 94 ℃: 10 seconds, 64 ℃: 1 minute, 72 ℃: 2.5 minutes;

94 ℃: 10 seconds, 64 ℃: 1 minute, 72 ℃: 2.5 minutes;

94 ℃: 10 seconds, 29 ℃: 1 minute, 72 ℃: 2.5 minutes

1 * 72 ℃: 5 minutes

In containing the 100ml reactant mixture of following composition, carry out the TAIL3-PCR reaction:

1: 10 dilution of-1ml TAIL2 reactant mixture (producing as mentioned above)

-0.8mM dNTP

-0.2mM PR63(SEQ ID NO：68)

-0.2mM AD1(SEQ ID NO：69)

-10ml 10 * PCR buffer solution (TAKARA)

-0.5UR Taq polymerase (TAKARA)

-mend to 100ml with distilled water.

PCR reaction TAIL3 carries out under following cycling condition:

20 * 94 ℃: 15 seconds, 29 ℃: 30 seconds, 72 ℃: 2 minutes

1 * 72 ℃: 5 minutes

Use the pcr amplification reaction of primer PR63 and AD1 to produce the 280bp fragment, wherein especially contain ε-cyclase 199bp promoter fragment (Figure 12).

Use standard method that amplicons cloned is gone into PCR cloning vector pCR2.1 (Invitrogen).Use primer M13 and T7 to carry out sequencing and obtain sequence SEQ ID NO:46.This sequence is identical with the sequence SEQ ID NO:45 that separates by the IPCR strategy, has therefore represented the nucleotide sequence among the employed marigold strain Orangenprinz.

The pCR2.1 clone who contains the ε-cyclase promoter 312bp fragment (SEQ IDNO:45) of separating by the IPCR strategy is called pTA-ecycP and is used to produce the IR construct.

Example I .14

Generation is used for the reverse repetition expression cassette (at ε-cyclase cDNA promoter region) at marigold specifically expressing ε-cyclase dsRNA

Under the control of the modified forms AP3P that is expressed in arabidopsis cauliflower specific promoter AP3 of reverse repetition transcript in marigold that forms by ε-cyclase promoter fragment (seeing example I .10) or under the control of flower specific promoter CHRC (Genbank accession number AF099501), carry out.Under each situation, oppositely repeat a ε-cyclase promoter fragment (fragment intentionally) and a reverse ε-cyclase promoter fragment (antisense fragment) (seeing example I .10) that sequence is identical that transcript contains a correct direction that links together by the function introne.

Use DNA (clone pTA-ecycP sees example I .13) and primer PR124 (SEQ ID NO:70) to produce promoter fragment with PR127 (SEQ ID NO:73) by PCR method with PR126 (SEQ ID NO:72) and primer PR125 (SEQ ID NO:71).

The PCR reaction condition is as follows:

Pcr amplification contains the PR124-PR126 dna fragmentation of ε-cyclase promoter fragment in containing the 50ml reactant mixture of following composition:

-1ml cDNA (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR124(SEQ ID NO：70)

-0.2mM PR126(SEQ ID NO：72)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

Pcr amplification contains the PR125-PR127 dna fragmentation of ε-cyclase 312bp promoter fragment in containing the 50ml reactant mixture of following composition:

-1ml cDNA (producing as mentioned above)

-0.25mM dNTPs

-0.2mM PR125(SEQ ID NO：71)

-0.2mM PR127(SEQ ID NO：73)

-5ml 10 * PCR buffer solution (TAKARA)

-0.25ml R Taq polymerase (TAKARA)

-28.8ml distilled water.

Under following cycling condition, carry out the PCR reaction:

1 * 94 ℃ 2 minutes

35 * 94 ℃ 1 minute

53 ℃ 1 minute

72 ℃ 1 minute

1 * 72 ℃ 10 minutes

Use the pcr amplification reaction of primer PR124 and PR126 to produce the 358bp fragment, use the pcr amplification reaction of primer PR125 and PR127 to produce the 361bp fragment.

Use standard method with two amplicons, PR124-PR126 (HindIII-SalI has a mind to) fragment and PR125-PR127 (EcoRI-BamHI antisense) fragment are cloned into PCR cloning vector pCR-BluntII (Invitrogen).Use primer SP6 to carry out sequencing and confirm that its sequence is identical with SEQ ID NO:45 except the restriction enzyme site that is imported under each situation.Therefore this clone is used for producing the reverse repetition construct (seeing example I .10) of cloning vector pJAI1.

Carry out cloning the first time step by separating 358bp PR124-PR126HindIII-SalI fragment from cloning vector pCR-BluntII (Invitrogen) and connecting into the carrier pJAI1 that cuts through the BamHI-EcoRI enzyme.Containing intentionally, the clone of direction ε-cyclase promoter fragment is called cs43.Coupled reaction imports ε-cyclase promoter and has a mind to fragment between AP3P promoter and introne.

Carry out cloning the second time step by separating 361bp PR125-PR127BamHI-EcoRI fragment from cloning vector pCR-BluntII (Invitrogen) and connecting into the carrier cs43 that cuts through the BamHI-EcoRI-enzyme.The clone who contains antisense orientation ε-cyclase promoter fragment is called cs44.Coupled reaction forms between introne and ε-cyclase promoter antisense fragment and transcribes fusion.

In order to be created in the reverse repetition expression cassette under the control of CHRC promoter, use petunia genomic DNA (producing) and primer PRCHRC3 ' (SEQ ID NO:77) and PRCHRC5 ' (SEQ ID NO:76) amplification CHRC promoter fragment according to standard method.Amplicons cloned is gone into cloning vector pCR2.1 (Invitrogen).Use primer M13 the DCRP pCR2.1-CHRC of institute to be carried out sequencing and confirm that this sequence is identical with sequence A F099501 with T7.Therefore this clone is used to be cloned into expression vector cs44.

Clone by separating 1537bp SacI-HindIII fragment from pCR2.1-CHRC and connecting into the carrier cs44 that cuts through the SacI-HindIII enzyme.Contain promoter CHRC but not the clone of original promoter AP3P is called cs45.

In order to be created in the reverse repetition expression cassette under the control of two promoter CHRC promoters and AP3P promoter, the AP3P promoter is cloned into 3 ' end of ε-cyclase antisense fragment of cs45 with antisense orientation.Use the AP3P promoter fragment of primer PR128 and PR129 amplification from pJAI1.Amplicons cloned is gone into cloning vector pCR2.1 (Invitrogen).Use primer M13 to carry out sequencing and confirm that this sequence is identical with sequence SEQ ID NO:28 (AL132971) with T7.This clone pCR2.1-AP3PSX is used to be created in two reverse repetition expression cassettes under the promoter control.

Clone by separating 771bp SalI-XhoI fragment from pCR2.1-AP3PSX and connecting into the carrier cs45 that cuts through the XhoI-enzyme.The clone who contains antisense orientation promoter AP3P in inverted repeats 3 ' side is called cs46.

Use binary vector pSUN5 (WO 02/00900) to produce and be used for carrying out the expression vector that the agriculture bacillus mediated reverse repetition transcript under AP3P-control transforms marigold.

In order to produce expression vector pS5AI7, will connect into the carrier pSUN5 (Figure 13, construct figure) that cuts through the SacI-XhoI-enzyme from the 1685bp SacI-XhoI fragment of cs44.In Figure 13, Segment A P3P contains the AP3P promoter (771bp) of modification, fragment P-sense contains the ε-cyclase 312bp promoter fragment of direction intentionally, fragment intron contains potato ST-LS1 gene IV2 introne, and fragment P-anti contains the ε-cyclase 312bp promoter fragment of antisense orientation.

In order to produce expression vector pS5CI7, will connect into the carrier pSUN5 (Figure 14, construct figure) that cuts through the SacI-XhoI-enzyme from the 2445bp SacI-XhoI fragment of cs45.

In Figure 14, fragment CHRC contains CHRC promoter (1537bp), fragment P-sense contains the ε-cyclase 312bp promoter fragment of direction intentionally, fragment intron contains potato ST-LS1 gene IV2 introne, and fragment P-anti contains the ε-cyclase 312bp promoter fragment of antisense orientation.

In order to produce expression vector pS5CAI7, will connect into the carrier pSUN5 (Figure 15, construct figure) that cuts through the SacI-XhoI-enzyme from the 3219bp SacI-XhoI fragment of cs46.

In Figure 15, fragment CHRC contains CHRC promoter (1537bp), fragment P-sense contains the ε-cyclase 312bp promoter fragment of direction intentionally, fragment intron contains potato ST-LS1 gene IV2 introne, fragment P-anti contains the ε-cyclase 312bp promoter fragment of antisense orientation, and Segment A P3P contains antisense orientation 771bp AP3P promoter fragment.

Example I .15

Generation with transgenosis marigold plant of the ε-cyclase activity that has reduced

Be positioned over (MS culture medium on the germination culture medium with the sterilization of marigold seed and with it; Murashige and Skoog, Physiol.Plant.15 (1962), 473-497) pH 5.8,2% sucrose).It is under the 18-28 ℃/20-200mE/3-16 week condition that germination betides temperature/illumination/time interval, is preferably 21 ℃, 20-70mE, 4-8 week.

Till that time results in all leaves of ectogenetic plant and transverse cuts to middle arteries and veins.In preparation process, be 10-60mm with resulting size ²Leaf explant to be stored in the liquid MS medium room temperature the longest 2 hours.

Use binary vector pS5AI3 to transform Agrobacterium tumefaciems bacterial strain EHA105.The Agrobacterium tumefaciems bacterial strain EHA105 that transforms is grow overnight under the following conditions: monospecific polyclonal is inoculated in YEB (0.1% yeast extract, 0.5% beef extract, 0.5% peptone, 0.5% sucrose, the 0.5% magnesium sulfate 7H that contains the 25mg/l kanamycins ₂O) cultivated 16-20 hour in and at 28 ℃.Pass through then 6000g centrifugal 10 minutes results bacterial suspension and with OD ₆₀₀Approximately the concentration of 0.1-0.8 is resuspended in the liquid MS medium.This suspension is used for cultivating altogether with the leaf material.

Before cultivating altogether, replace preserving the MS culture medium of leaf immediately with bacterial suspension.Gently vibration down room temperature leaf was hatched in transforming the Agrobacterium suspension 30 minutes.Then the explant that infects being positioned over agar solidifies and (contains growth regulator for example on the MS culture medium of 3mg/l benayl aminopurine (BAP) and 1mg/l heteroauxin (IAA) as 0.8% plant agar (Duchefa, NL)).The location of leaf on culture medium is not important.Explant is cultivated 1-8 days, but be preferably 6 days, can use following condition: luminous intensity: 30-80mmol/m ²X second, temperature: 22-24 ℃, light/secretly be replaced by 16/8 hour.Then, the explant of cultivating altogether is transferred to fresh MS culture medium, is preferably the fresh MS culture medium that contains the isometric growth conditioning agent, this second culture medium additionally contains the antibiotic of bacteria growing inhibiting.Concentration is that the Ticarcillin/Clavulanate Acid of 200-500mg/l is particularly suitable for this purpose.As second selection component, spendable is to be used to screen the composition that successfully transforms.Concentration is that the phosphinothricin selection of 1-5mg/l is very effective, but also can consider to use other selection component according to this method.

After cultivating for one to three week under each situation, explant is transferred in the fresh culture up to plumule and budlet forms, then they are transferred to and contain the composition that Ticarcillin/Clavulanate Acid and PPT or other contain conditioning agent and just refer to such as 0.5mg/l indolebutyric acid (IBA) and 0.5mg/l gibberellic acid GA ₃The same basic culture medium in to take root.The bud of taking root can be transferred to the greenhouse.

Except said method, following promising change also is possible:

Before the bacterial infection explant, for cultivation altogether can be preferably 3-4 days with explant in above-mentioned culture medium preincubate 1-12 days.Then, infect as mentioned above, cultivate altogether and selectivity regeneration.

According to above-mentioned method for transformation, use expression construct pS5AI3, obtain following strain:

CS30-1, CS30-3 and CS30-4

Example I .16:

Characteristic with transgenosis marigold plant of the ε-cyclase activity that has reduced

In liquid nitrogen, grind transgenosis marigold plant floral material with mortar from example I .15, and with 100% acetone extracting (three times, each 500ml) powder (approximately 250-500mg).Evaporating solvent also is resuspended in 100ml acetone with carotenoid.

Use C30 reversed-phase column method, quantitatively different carotenoid.In fact (Frazer etc. (2000), Plant Journal 24 (4): 551-558) identical with disclosed method for the HPLC condition of work.Can identify carotenoid based on UV-VIS spectrum.

Table 2 has shown carotenoid spectrum in transgenosis marigold plant that produces according to the foregoing description and the marigold petal that contrasts marigold plant.The amount of all carotenoid provides with [μ g/g] fresh weight, changes at the parenthetic percentage of comparing with check plant that provides.

Compare with the check plant of non-genetic modification, has the carotenoid content that the genetically modified plant of the ε-cyclase activity that has reduced has " the beta carotene approach " of remarkable increase, the beta carotene and the luteole content that have for example significantly increased, and the carotenoid content of " the alpha-carotene approach " that significantly reduced, the lutein content that has for example significantly reduced.

Table 2

Plant	Lutein	Beta carotene	Luteole	Violaxanthin	Total carotinoid
Plant	Lutein	Beta carotene	Luteole	Violaxanthin	Total carotinoid	Contrast	260	4.8	2.7	36	304
CS 30-1	35(-86％)	13(+170％)	4.4(+62％)	59(+63％)	111(-63％)	Contrast	260	4.8	2.7	36	304
CS 30-1	35(-86％)	13(+170％)	4.4(+62％)	59(+63％)	111(-63％)	Contrast	456	6.4	6.9	58	527
CS 30-3	62(-86％)	13(+103％)	8.9(+29％)	75(+29％)	159(-70％)	Contrast	456	6.4	6.9	58	527
CS 30-3	62(-86％)	13(+103％)	8.9(+29％)	75(+29％)	159(-70％)	CS 30-4	68(-85％)	9.1(+42％)	5.7(-17％)	61(+5％)	144(-73％)

Example II

The generation of the plants of tagetes species part of astaxanthin-containing

Isolate the capitulum or the petal and dry of the astaxanthin-containing plants of tagetes species that produces according to example I .6.Capitulum or petal with drying changes into powder type by pulverizing then.

EXAMPLE III

The generation of astaxanthin-containing extract and being further purified

In homogenizer with excessive (the about 10 parts of solvents of a vegetable material) solvent (for example acetone, hexane, carrene, methyl tertiary butyl ether(MTBE), oxolane, ethanol, heptane, cycloheptane or benzinum, but be not limited in these) or with solvent mixture (for example acetone/hexane, ethanol/hexane are (50: 50, v/v) or acetone/methanol (7: 3, v/v)) dry floral leaf or the dry capitulum of the marigold that produces according to example I .6 of homogenate, and vibration is down in dark and the extracting of cold place.Residue can be repeated extracting nearly three times with employed solvent/solvents mixture.Use collected organic solvent of evaporator evaporation or solvent mixture up to the concentrate that has obtained reducing.In addition, can be with the further extracting material of hexane.The employed hexane of evaporation (also at dark and cold place).

To be dissolved in hexane with the concentrate that this kind mode produces and utilize column chromatography to use earth silicon material to carry out chromatography.A copy of it earth silicon material is mixed with 1-2 part carotenoid solutions and be loaded in the post.At dark and cold place with the abundant column scrubber of hexane.Abandon this eluate.With hexane and alcohol mixture (2-5% ethanol is arranged in the hexane) wash-out keto-acid carotenoid astaxanthin particularly, go out orange red fraction up to wash-out.Collect orange red eluate up to color change.Orange red eluate contains monoesters and diester astaxanthin mixture.

EXAMPLE IV

The generation of extrusion pressing type trout feed, described feed comprise plants of tagetes species or plant part that contains astaxanthin or the astaxanthin-containing extract that contains astaxanthin plants of tagetes species or plant part

The following composition of extruding in double-screw extrusion device.

Composition	(％)	Weight kg in 500kg
Composition	(％)	Weight kg in 500kg	Wheaten starch premix vitamin Lipotril (50%) the wheat gluten Sipernat 50S fish oil of fish meal full-fat bean gel in advance	30.00 20.00 18.00 0.80 0.20 20.00 3.00 8.00	150.00 100.00 90.00 4.00 1.00 100.00 15.00 40.00

Before the extruding, as plants of tagetes species or the plants of tagetes species of plant part or astaxanthin-containing or the astaxanthin-containing extract of plant part of component adding according to the astaxanthin-containing that produces such as example II through pulverizing processing.

After the extruding, with the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part or through the processing extract with liquid form, for example produce according to EXAMPLE III, sparge on the extrudate and (use) by the PPA method.

The dosage of astaxanthin active component is to contain 10,20 and the 40mg astaxanthin in every kg feed.

Finish after the extrusion process dry and cooling with extrudate.

EXAMPLE V

The astaxanthin-containing extract of the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part is administered orally in trout-bioavilability with the standard trout form of feeding to be detected

The trout feed that contains astaxanthin pigment of the present invention that produces according to EXAMPLE IV also is administered orally in trout (average live body quality 180g).Test 3 concentration: every kg feed 10,20 and 40mg are from the astaxanthin of astaxanthin pigment of the present invention.

As culturing trout described in hereinafter:

Give 14 day laundering period of trout standard.

During raising is tested, in the permanent current plastics cylinder of each volume 80 premium on currency, culture 10 tail trouts.Water temperature is 15 ℃.Biology purification of water process and every day, the water of cumulative volume 10% replaced with fresh water at least.

The illumination phase is that 12 hours every days are to avoid the too early sexal maturity of animal.

Each is handled, and the quantity in pond is 3.This equals each dosage level 30 tail trout.

Feed storage in-20 ℃ to avoid astaxanthin loss.Thawing feed a part (weekly) is also used.

Experiment periods was 8 weeks.

Feed and raise as carrying out trout described in hereinafter:

The experiment feed of being used is the extrusion pressing type trout feed of having carried out oily dressing in addition that produces according to EXAMPLE IV.

During the laundering period, the extrusion pressing type oil dressing of using the no astaxanthin that produces according to EXAMPLE IV does not have astaxanthin standard trout feed.

As negative control, the extrusion pressing type oil dressing that whole experimental session is used the no astaxanthin that produces according to EXAMPLE IV does not have astaxanthin standard trout feed.

Every day 2 * carry out feeding with hand to have enough up to animal.

The painted behavior parameter that not only influences fish of astaxanthin of the present invention, for example feed picked-up, feed conversion and body weight increase, but also the painted biologicak efficiency that influence is studied.

Statistical evaluation is carried out in average food consumption, food conversion and body weight increase to every tail fish.

Compare under each situation the content astaxanthin in the fillet (mg/kg) with negative control and measure the painted of fish by reflective spectrophotometer determination method (red value of Minolta a value=fillet incision) and by measuring.

Represent the Minolta a value of the red part in the tone to increase with of the reduction of dosage dependence mode with the function ladder.The Minolta b value of reflection yl moiety is near negative scope or zero.This shows that the red color tone in the trout fillet depends on the amount of the astaxanthin that is consumed.

Experimental session, for observed behavior parameter, (extract of the powder of astaxanthin-containing, liquid form astaxanthin-containing, synthesizing astaxanthin, negative control) do not observed statistics and gone up significant difference between processed group or in the processed group.

The astaxanthin-containing extract of finding the plants of tagetes species of the plants of tagetes species of astaxanthin-containing or plant part or astaxanthin-containing or plant part is that the trout of representative is biological available and the trout biological behaviour do not caused negative effect in painted making with the salmonid.

Sequence table

＜110〉Sungene GmbH ﹠ Co. KG

＜120〉plants of tagetes species of astaxanthin-containing or plant part are as the purposes of feed

<130>PF 54148

<160>142

＜170〉PatentIn version 3 .1

<210>1

<211>1771

<212>DNA

＜213〉haematococcus pluvialis (Haematococcus pluvialis)

<220>

<221>CDS

<222>(166)..(1155)

<223>

<400>1

ggcacgagct tgcacgcaag tcagcgcgcg caagtcaaca cctgccggtc cacagcctca 60

aataataaag agctcaagcg tttgtgcgcc tcgacgtggc cagtctgcac tgccttgaac 120

ccgcgagtct cccgccgcac tgactgccat agcacagcta gacga atg cag cta gca 177

Met Gln Leu Ala

1

gcg aca gta atg ttg gag cag ctt acc gga agc gct gag gca ctc aag 225

Ala Thr Val Met Leu Glu Gln Leu Thr Gly Ser Ala Glu Ala Leu Lys

5 10 15 20

gag aag gag aag gag gtt gca ggc agc tct gac gtg ttg cgt aca tgg 273

Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp Val Leu Arg Thr Trp

25 30 35

gcg acc cag tac tcg ctt ccg tca gaa gag tca gac gcg gcc cgc ccg 321

Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser Asp Ala Ala Arg Pro

40 45 50

gga ctg aag aat gcc tac aag cca cca cct tcc gac aca aag ggc atc 369

Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser Asp Thr Lys Gly Ile

55 60 65

aca atg gcg cta cgt gtc atc ggc tcc tgg gcc gca gtg ttc ctc cac 417

Thr Met Ala Leu Arg Val Ile Gly Ser Trp Ala Ala Val Phe Leu His

70 75 80

gcc att ttt caa atc aag ctt ccg acc tcc ttg gac cag ctg cac tgg 465

Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu Asp Gln Leu His Trp

85 90 95 100

ctg ccc gtg tca gat gcc aca gct cag ctg gtt agc ggc acg agc agc 513

Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val Ser Gly Thr Ser Ser

105 110 115

ctg ctc gac atc gtc gta gta ttc ttt gtc ctg gag ttc ctg tac aca 561

Leu Leu Asp Ile Val Val Val Phe Phe Val Leu Glu Phe Leu Tyr Thr

120 125 130

ggc ctt ttt atc acc acg cat gat gct atg cat ggc acc atc gcc atg 609

Gly Leu Phe Ile Thr Thr His Asp Ala Met His Gly Thr Ile Ala Met

135 140 145

aga aac agg cag ctt aat gac ttc ttg ggc aga gta tgc atc tcc ttg 657

Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg Val Cys Ile Ser Leu

150 155 160

tac gcc tgg ttt gat tac aac atg ctg cac cgc aag cat tgg gag cac 705

Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg Lys His Trp Glu His

165 170 175 180

cac aac cac act ggc gag gtg ggc aag gac cct gac ttc cac agg gga 753

His Asn His Thr Gly Glu Val Gly Lys Asp Pro Asp Phe His Arg Gly

185 190 195

aac cct ggc att gtg ccc tgg ttt gcc agc ttc atg tcc agc tac atg 801

Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe Met Ser Ser Tyr Met

200 205 210

tcg atg tgg cag ttt gcg cgc ctc gca tgg tgg acg gtg gtc atg cag 849

Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp Thr Val Val Met Gln

215 220 225

ctg ctg ggt gcg cca atg gcg aac ctg ctg gtg ttc atg gcg gcc gcg 897

Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val Phe Met Ala Ala Ala

230 235 240

ccc atc ctg tcc gcc ttc cgc ttg ttc tac ttt ggc acg tac atg ccc 945

Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe Gly Thr Tyr Met Pro

245 250 255 260

cac aag cct gag cct ggc gcc gcg tca ggc tct tca cca gcc gtc atg 993

His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser Ser Pro Ala Val Met

265 270 275

aac tgg tgg aag tcg cgc act agc cag gcg tcc gac ctg gtc agc ttt 1041

Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser Asp Leu Val Ser Phe

280 285 290

ctg acc tgc tac cac ttc gac ctg cac tgg gag cac cac cgc tgg ccc 1089

Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu His His Arg Trp Pro

295 300 305

ttc gcc ccc tgg tgg gag ctg ccc aac tgc cgc cgc ctg tct ggc cga 1137

Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg Arg Leu Ser Gly Arg

310 315 320

ggt ctg gtt cct gcc tag ctggacacac tgcagtgggc cctgctgcca 1185

Gly Leu Val Pro Ala

325

gctgggcatg caggttgtgg caggactggg tgaggtgaaa agctgcaggc gctgctgccg 1245

gacacgctgc atgggctacc ctgtgtagct gccgccacta ggggaggggg tttgtagctg 1305

tcgagcttgc cccatggatg aagctgtgta gtggtgcagg gagtacaccc acaggccaac 1365

acccttgcag gagatgtctt gcgtcgggag gagtgttggg cagtgtagat gctatgattg 1425

tatcttaatg ctgaagcctt taggggagcg acacttagtg ctgggcaggc aacgccctgc 1485

aaggtgcagg cacaagctag gctggacgag gactcggtgg caggcaggtg aagaggtgcg 1545

ggagggtggt gccacaccca ctgggcaaga ccatgctgca atgctggcgg tgtggcagtg 1605

agagctgcgt gattaactgg gctatggatt gtttgagcag tctcacttat tctttgatat 1665

agatactggt caggcaggtc aggagagtga gtatgaacaa gttgagaggt ggtgcgctgc 1725

ccctgcgctt atgaagctgt aacaataaag tggttcaaaa aaaaaa 1771

<210>2

<211>329

<212>PRT

＜213〉haematococcus pluvialis

<400>2

Met Gln Leu Ala Ala Thr Val Met Leu Glu Gln Leu Thr Gly Ser Ala

1 5 10 15

Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp Val

20 25 30

Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser Asp

35 40 45

Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser Asp

50 55 60

Thr Lys Gly Ile Thr Met Ala Leu Arg Val Ile Gly Ser Trp Ala Ala

65 70 75 80

Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu Asp

85 90 95

Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val Ser

100 105 110

Gly Thr Ser Ser Leu Leu Asp Ile Val Val Val Phe Phe Val Leu Glu

115 120 125

Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met His Gly

130 135 140

Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg Val

145 150 155 160

Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg Lys

165 170 175

His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp Pro Asp

180 185 190

Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe Met

195 200 205

Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp Thr

210 215 220

Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val Phe

225 230 235 240

Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe Gly

245 250 255

Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser Ser

260 265 270

Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser Asp

275 280 285

Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu His

290 295 300

His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg Arg

305 310 315 320

Leu Ser Gly Arg Gly Leu Val Pro Ala

325

<210>3

<211>1662

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(168)..(1130)

<223>

<400>3

cggggcaact caagaaattc aacagctgca agcgcgcccc agcctcacag cgccaagtga 60

gctatcgacg tggttgtgag cgctcgacgt ggtccactga cgggcctgtg agcctctgcg 120

ctccgtcctc tgccaaatct cgcgtcgggg cctgcctaag tcgaaga atg cac gtc 176

Met His Val

1

gca tcg gca cta atg gtc gag cag aaa ggc agt gag gca gct gct tcc 224

Ala Ser Ala Leu Met Val Glu Gln Lys Gly Ser Glu Ala Ala Ala Ser

5 10 15

agc cca gac gtc ttg aga gcg tgg gcg aca cag tat cac atg cca tcc 272

Ser Pro Asp Val Leu Arg Ala Trp Ala Thr Gln Tyr His Met Pro Ser

20 25 30 35

gag tcg tca gac gca gct cgt cct gcg cta aag cac gcc tac aaa cct 320

Glu Ser Ser Asp Ala Ala Arg Pro Ala Leu Lys His Ala Tyr Lys Pro

40 45 50

cca gca tct gac gcc aag ggc atc acg atg gcg ctg acc atc att ggc 368

Pro Ala Ser Asp Ala Lys Gly Ile Thr Met Ala Leu Thr Ile Ile Gly

55 60 65

acc tgg acc gca gtg ttt tta cac gca ata ttt caa atc agg cta ccg 416

Thr Trp Thr Ala Val Phe Leu His Ala Ile Phe Gln Ile Arg Leu Pro

70 75 80

aca tcc atg gac cag ctt cac tgg ttg cct gtg tcc gaa gcc aca gcc 464

Thr Ser Met Asp Gln Leu His Trp Leu Pro Val Ser Glu Ala Thr Ala

85 90 95

cag ctt ttg ggc gga agc agc agc cta ctg cac atc gct gca gtc ttc 512

Gln Leu Leu Gly Gly Ser Ser Ser Leu Leu His Ile Ala Ala Val Phe

100 105 110 115

att gta ctt gag ttc ctg tac act ggt cta ttc atc acc aca cat gac 560

Ile Val Leu Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp

120 125 130

gca atg cat ggc acc ata gct ttg agg cac agg cag ctc aat gat ctc 608

Ala Met His Gly Thr Ile Ala Leu Arg His Arg Gln Leu Asn Asp Leu

135 140 145

ctt ggc aac atc tgc ata tca ctg tac gcc tgg ttt gac tac agc atg 656

Leu Gly Asn Ile Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Ser Met

150 155 160

ctg cat cgc aag cac tgg gag cac cac aac cat act ggc gaa gtg ggg 704

Leu His Arg Lys His Trp Glu His His Asn His Thr Gly Glu Val Gly

165 170 175

aaa gac cct gac ttc cac aag gga aat ccc ggc ctt gtc ccc tgg ttc 752

Lys Asp Pro Asp Phe His Lys Gly Asn Pro Gly Leu Val Pro Trp Phe

180 185 190 195

gcc agc ttc atg tcc agc tac atg tcc ctg tgg cag ttt gcc cgg ctg 800

Ala Ser Phe Met Set Ser Tyr Met Ser Leu Trp Gln Phe Ala Arg Leu

200 205 210

gca tgg tgg gca gtg gtg atg caa atg ctg ggg gcg ccc atg gca aat 848

Ala Trp Trp Ala Val Val Met Gln Met Leu Gly Ala Pro Met Ala Asn

215 220 225

ctc cta gtc ttc atg gct gca gcc cca atc ttg tca gca ttc cgc ctc 896

Leu Leu Val Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu

230 235 240

ttc tac ttc ggc act tac ctg cca cac aag cct gag cca ggc cct gca 944

Phe Tyr Phe Gly Thr Tyr Leu Pro His Lys Pro Glu Pro Gly Pro Ala

245 250 255

gca ggc tct cag gtg atg gcc tgg ttc agg gcc aag aca agt gag gca 992

Ala Gly Ser Gln Val Met Ala Trp Phe Arg Ala Lys Thr Ser Glu Ala

260 265 270 275

tct gat gtg atg agt ttc ctg aca tgc tac cac ttt gac ctg cac tgg 1040

Ser Asp Val Met Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp

280 285 290

gag cac cac agg tgg ccc ttt gcc ccc tgg tgg cag ctg ccc cac tgc 1088

Glu His His Arg Trp Pro Phe Ala Pro Trp Trp Gln Leu Pro His Cys

295 300 305

cgc cgc ctg tcc ggg cgt ggc ctg gtg cct gcc ttg gca tga 1130

Arg Arg Leu Ser Gly Arg Gly Leu Val Pro Ala Leu Ala

310 315 320

cctggtccct ccgctggtga cccagcgtct gcacaagagt gtcatgctac agggtgctgc 1190

ggccagtggc agcgcagtgc actctcagcc tgtatggggc taccgctgtg ccactgagca 1250

ctgggcatgc cactgagcac tgggcgtgct actgagcaat gggcgtgcta ctgagcaatg 1310

ggcgtgctac tgacaatggg cgtgctactg gggtctggca gtggctagga tggagtttga 1370

tgcattcagt agcggtggcc aacgtcatgt ggatggtgga agtgctgagg ggtttaggca 1430

gccggcattt gagagggcta agttataaat cgcatgctgc tcatgcgcac atatctgcac 1490

acagccaggg aaatcccttc gagagtgatt atgggacact tgtattggtt tcgtgctatt 1550

gttttattca gcagcagtac ttagtgaggg tgagagcagg gtggtgagag tggagtgagt 1610

gagtatgaac ctggtcagcg aggtgaacag cctgtaatga atgactctgt ct 1662

<210>4

<211>320

<212>PRT

＜213〉haematococcus pluvialis

<400>4

Met His Val Ala Ser Ala Leu Met Val Glu Gln Lys Gly Ser Glu Ala

1 5 10 15

Ala Ala Ser Ser Pro Asp Val Leu Arg Ala Trp Ala Thr Gln Tyr His

20 25 30

Met Pro Ser Glu Ser Ser Asp Ala Ala Arg Pro Ala Leu Lys His Ala

35 40 45

Tyr Lys Pro Pro Ala Ser Asp Ala Lys Gly Ile Thr Met Ala Leu Thr

50 55 60

Ile Ile Gly Thr Trp Thr Ala Val Phe Leu His Ala Ile Phe Gln Ile

65 70 75 80

Arg Leu Pro Thr Ser Met Asp Gln Leu His Trp Leu Pro Val Ser Glu

85 90 95

Ala Thr Ala Gln Leu Leu Gly Gly Ser Ser Ser Leu Leu His Ile Ala

100 105 110

Ala Val Phe Ile Val Leu Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr

115 120 125

Thr His Asp Ala Met His Gly Thr Ile Ala Leu Arg His Arg Gln Leu

130 135 140

Asn Asp Leu Leu Gly Asn Ile Cys Ile Ser Leu Tyr Ala Trp Phe Asp

145 150 155 160

Tyr Ser Met Leu His Arg Lys His Trp Glu His His Asn His Thr Gly

165 170 175

Glu Val Gly Lys Asp Pro Asp Phe His Lys Gly Asn Pro Gly Leu Val

180 185 190

Pro Trp Phe Ala Ser Phe Met Ser Ser Tyr Met Ser Leu Trp Gln Phe

195 200 205

Ala Arg Leu Ala Trp Trp Ala Val Val Met Gln Met Leu Gly Ala Pro

210 215 220

Met Ala Asn Leu Leu Val Phe Met Ala Ala Ala Pro Ile Leu Ser Ala

225 230 235 240

Phe Arg Leu Phe Tyr Phe Gly Thr Tyr Leu Pro His Lys Pro Glu Pro

245 250 255

Gly Pro Ala Ala Gly Ser Gln Val Met Ala Trp Phe Arg Ala Lys Thr

260 265 270

Ser Glu Ala Ser Asp Val Met Ser Phe Leu Thr Cys Tyr His Phe Asp

275 280 285

Leu His Trp Glu His His Arg Trp Pro Phe Ala Pro Trp Trp Gln Leu

290 295 300

Pro His Cys Arg Arg Leu Ser Gly Arg Gly Leu Val Pro Ala Leu Ala

305 310 315 320

<210>5

<211>729

<212>DNA

＜213〉orange Agrobacterium (Agrobacterium aurantiacum)

<220>

<221>CDS

<222>(1)..(729)

<223>

<400>5

atg agc gca cat gcc ctg ccc aag gca gat ctg acc gcc acc agc ctg 48

Met Ser Ala His Ala Leu Pro Lys Ala Asp Leu Thr Ala Thr Ser Leu

1 5 10 15

atc gtc tcg ggc ggc atc atc gcc gct tgg ctg gcc ctg cat gtg cat 96

Ile Val Ser Gly Gly Ile Ile Ala Ala Trp Leu Ala Leu His Val His

20 25 30

gcg ctg tgg ttt ctg gac gca gcg gcg cat ccc atc ctg gcg atc gca 144

Ala Leu Trp Phe Leu Asp Ala Ala Ala His Pro Ile Leu Ala Ile Ala

35 40 45

aat ttc ctg ggg ctg acc tgg ctg tcg gtc gga ttg ttc atc atc gcg 192

Asn Phe Leu Gly Leu Thr Trp Leu ser Val Gly Leu Phe Ile Ile Ala

50 55 60

cat gac gcg atg cac ggg tcg gtg gtg ccg ggg cgt ccg cgc gcc aat 240

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

gcg gcg atg ggc cag ctt gtc ctg tgg ctg tat gcc gga ttt tcg tgg 288

Ala Ala Met Gly Gln Leu Val Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

cgc aag atg atc gtc aag cac atg gcc cat cac cgc cat gcc gga acc 336

Arg Lys Met Ile Val Lys His Met Ala His His Arg His Ala Gly Thr

100 105 110

gac gac gac ccc gat ttc gac cat ggc ggc ccg gtc cgc tgg tac gcc 384

Asp Asp Asp Pro Asp Phe Asp His Gly Gly Pro Val Arg Trp Tyr Ala

115 120 125

cgc ttc atc ggc acc tat ttc ggc tgg cgc gag ggg ctg ctg ctg ccc 432

Arg Phe Ile Gly Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

gtc atc gtg acg gtc tat gcg ctg atc ctt ggg gat cgc tgg atg tac 480

Val Ile Val Thr Val Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 160

gtg gtc ttc tgg ccg ctg ccg tcg atc ctg gcg tcg atc cag ctg ttc 528

Val Val Phe Trp Pro Leu Pro Ser Ile Leu Ala Ser Ile Gln Leu Phe

165 170 175

gtg ttc ggc acc tgg ctg ccg cac cgc ccc ggc cac gac gcg ttc ccg 576

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Ala Phe Pro

180 185 190

gac cgc cac aat gcg cgg tcg tcg cgg atc agc gac ccc gtg tcg ctg 624

Asp Arg His Asn Ala Arg Ser Ser Arg Ile Ser Asp Pro Val Ser Leu

195 200 205

ctg acc tgc ttt cac ttt ggc ggt tat cat cac gaa cac cac ctg cac 672

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

ccg acg gtg ccg tgg tgg cgc ctg ccc agc acc cgc acc aag ggg gac 720

Pro Thr Val Pro Trp Trp Arg Leu Pro Ser Thr Arg Thr Lys Gly Asp

225 230 235 240

acc gca tga 729

Thr Ala

<210>6

<211>242

<212>PRT

＜213〉orange Agrobacterium

<400>6

Met Ser Ala His Ala Leu Pro Lys Ala Asp Leu Thr Ala Thr Ser Leu

1 5 10 15

Ile Val Ser Gly Gly Ile Ile Ala Ala Trp Leu Ala Leu His Val His

20 25 30

Ala Leu Trp Phe Leu Asp Ala Ala Ala His Pro Ile Leu Ala Ile Ala

35 40 45

Asn Phe Leu Gly Leu Thr Trp Leu Ser Val Gly Leu Phe Ile Ile Ala

50 55 60

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

Ala Ala Met Gly Gln Leu Val Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

Arg Lys Met Ile Val Lys His Met Ala His His Arg His Ala Gly Thr

100 105 110

Asp Asp Asp Pro Asp Phe Asp His Gly Gly Pro Val Arg Trp Tyr Ala

115 120 125

Arg Phe Ile Gly Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

Val Ile Val Thr Val Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 l60

Val Val Phe Trp Pro Leu Pro Ser Ile Leu Ala Ser Ile Gln Leu Phe

165 170 175

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Ala Phe Pro

180 185 190

Asp Arg His Asn Ala Arg Ser Ser Arg Ile Ser Asp Pro Val Ser Leu

195 200 205

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

Pro Thr Val Pro Trp Trp Arg Leu Pro Ser Thr Arg Thr Lys Gly Asp

225 230 235 240

Thr Ala

<210>7

<211>1631

<212>DNA

＜213〉Alcaligenes (Alcaligenes sp.)

<220>

<221>CDS

<222>(99)..(827)

<223>

<400>7

ctgcaggccg ggcccggtgg ccaatggtcg caaccggcag gactggaaca ggacggcggg 60

ccggtctagg ctgtcgccct acgcagcagg agtttcgg atg tcc gga cgg aag cct 116

Met Ser Gly Arg Lys Pro

1 5

ggc aca act ggc gac acg atc gtc aat ctc ggt ctg acc gcc gcg atc 164

Gly Thr Thr Gly Asp Thr Ile Val Asn Leu Gly Leu Thr Ala Ala Ile

10 15 20

ctg ctg tgc tgg ctg gtc ctg cac gcc ttt acg cta tgg ttg cta gat 212

Leu Leu Cys Trp Leu Val Leu His Ala Phe Thr Leu Trp Leu Leu Asp

25 30 35

gcg gcc gcg cat ccg ctg ctt gcc gtg ctg tgc ctg gct ggg ctg acc 260

Ala Ala Ala His Pro Leu Leu Ala Val Leu Cys Leu Ala Gly Leu Thr

40 45 50

tgg ctg tcg gtc ggg ctg ttc atc atc gcg cat gac gca atg cac ggg 308

Trp Leu Ser Val Gly Leu Phe Ile Ile Ala His Asp Ala Met His Gly

55 60 65 70

tcc gtg gtg ccg ggg cgg ccg cgc gcc aat gcg gcg atc ggg caa ctg 356

Ser Val Val Pro Gly Arg Pro Arg Ala Asn Ala Ala Ile Gly Gln Leu

75 80 85

gcg ctg tgg ctc tat gcg ggg ttc tcg tgg ccc aag ctg atc gcc aag 404

Ala Leu Trp Leu Tyr Ala Gly Phe Ser Trp Pro Lys Leu Ile Ala Lys

90 95 100

cac atg acg cat cac cgg cac gcc ggc acc gac aac gat ccc gat ttc 452

His Met Thr His His Arg His Ala Gly Thr Asp Asn Asp Pro Asp Phe

105 110 115

ggt cac gga ggg ccc gtg cgc tgg tac ggc agc ttc gtc tcc acc tat 500

Gly His Gly Gly Pro Val Arg Trp Tyr Gly Ser Phe Val Ser Thr Tyr

120 125 130

ttc ggc tgg cga gag gga ctg ctg cta ccg gtg atc gtc acc acc tat 548

Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro Val Ile Val Thr Thr Tyr

135 140 145 150

gcg ctg atc ctg ggc gat cgc tgg atg tat gtc atc ttc tgg ccg gtc 596

Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr Val Ile Phe Trp Pro Val

155 160 165

ccg gcc gtt ctg gcg tcg atc cag att ttc gtc ttc gga act tgg ctg 644

Pro Ala Val Leu Ala Ser Ile Gln Ile Phe Val Phe Gly Thr Trp Leu

170 175 180

ccc cac cgc ccg gga cat gac gat ttt ccc gac cgg cac aac gcg agg 692

Pro His Arg Pro Gly His Asp Asp Phe Pro Asp Arg His Asn Ala Arg

185 190 195

tcg acc ggc atc ggc gac ccg ttg tca cta ctg acc tgc ttc cat ttc 740

Ser Thr Gly Ile Gly Asp Pro Leu Ser Leu Leu Thr Cys Phe His Phe

200 205 210

ggc ggc tat cac cac gaa cat cac ctg cat ccg cat gtg cog tgg tgg 788

Gly Gly Tyr His His Glu His His Leu His Pro His Val Pro Trp Trp

215 220 225 230

cgc ctg cct cgt aca cgc aag acc gga ggc cgc gca tga cgcaattcct 837

Arg Leu Pro Arg Thr Arg Lys Thr Gly Gly Arg Ala

235 240

cattgtcgtg gcgacagtcc tcgtgatgga gctgaccgcc tattccgtcc accgctggat 897

tatgcacggc cccctaggct ggggctggca caagtcccat cacgaagagc acgaccacgc 957

gttggagaag aacgacotct acggcgtcgt cttcgcggtg ctggcgacga tcctcttcac 1017

cgtgggcgcc tattggtggc cggtgctgtg gtggatcgcc ctgggcatga cggtctatgg 1077

gttgatctat ttcatcctgc acgacgggct tgtgcatcaa cgctggccgt ttcggtatat 1137

tccgcggcgg ggctatttcc gcaggctcta ccaagctcat cgcctgcacc acgcggtcga 1197

ggggcgggac cactgcgtca gcttcggctt catctatgcc ccacccgtgg acaagctgaa 1257

gcaggatctg aagcggtcgg gtgtcctgcg cccccaggac gagcgtccgt cgtgatctct 1317

gatcccggcg tggccgcatg aaatccgacg tgctgctggc aggggccggc cttgccaacg 1377

gactgatcgc gctggcgatc cgcaaggcgc ggcccgacct tcgcgtgctg ctgctggacc 1437

gtgcggcggg cgcctcggac gggcatactt ggtcctgcca cgacaccgat ttggcgccgc 1497

actggctgga ccgcctgaag ccgatcaggc gtggcgactg gcccgatcag gaggtgcggt 1557

tcccagacca ttcgcgaagg ctccgggccg gatatggctc gatcgacggg cgggggctga 1617

tgcgtgcggt gacc 1631

<210>8

<211>242

<212>PRT

＜213〉Alcaligenes

<400>8

Met Ser Gly Arg Lys Pro Gly Thr Thr Gly Asp Thr Ile Val Asn Leu

1 5 10 15

Gly Leu Thr Ala Ala Ile Leu Leu Cys Trp Leu Val Leu His Ala Phe

20 25 30

Thr Leu Trp Leu Leu Asp Ala Ala Ala His Pro Leu Leu Ala Val Leu

35 40 45

Cys Leu Ala Gly Leu Thr Trp Leu Ser Val Gly Leu Phe Ile Ile Ala

50 55 60

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

Ala Ala Ile Gly Gln Leu Ala Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

Pro Lys Leu Ile Ala Lys His Met Thr His His Arg His Ala Gly Thr

100 105 110

Asp Asn Asp Pro Asp Phe Gly His Gly Gly Pro Val Arg Trp Tyr Gly

115 120 125

Ser Phe Val Ser Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

Val Ile Val Thr Thr Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 160

Val Ile Phe Trp Pro Val Pro Ala Val Leu Ala Ser Ile Gln Ile Phe

165 170 175

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Asp Phe Pro

180 185 190

Asp Arg His Asn Ala Arg Ser Thr Gly Ile Gly Asp Pro Leu Ser Leu

195 200 205

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

Pro His Val Pro Trp Trp Arg Leu Pro Arg Thr Arg Lys Thr Gly Gly

225 230 235 240

Arg Ala

<210>9

<211>729

<212>DNA

<213>Paracoccus marcusii

<220>

<221>CDS

<222>(1)..(729)

<223>

<400>9

atg agc gca cat gcc ctg ccc aag gca gat ctg acc gcc aca agc ctg 48

Met Ser Ala His Ala Leu Pro Lys Ala Asp Leu Thr Ala Thr Ser Leu

1 5 10 15

atc gtc tcg ggc ggc atc atc gcc gca tgg ctg gcc ctg cat gtg cat 96

Ile Val Ser Gly Gly Ile Ile Ala Ala Trp Leu Ala Leu His Val His

20 25 30

gcg ctg tgg ttt ctg gac gcg gcg gcc cat ccc atc ctg gcg gtc gcg 144

Ala Leu Trp Phe Leu Asp Ala Ala Ala His Pro Ile Leu Ala Val Ala

35 40 45

aat ttc ctg ggg ctg acc tgg ctg tcg gtc gga ttg ttc atc atc gcg 192

Asn Phe Leu Gly Leu Thr Trp Leu Ser Val Gly Leu Phe Ile Ile Ala

50 55 60

cat gac gcg atg cac ggg tcg gtc gtg ccg ggg cgt ccg cgc gcc aat 240

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

gcg gcg atg ggc cag ctt gtc ctg tgg ctg tat gcc gga ttt tcg tgg 288

Ala Ala Met Gly Gln Leu Val Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

cgc aag atg atc gtc aag cac atg gcc cat cac cgc cat gcc gga acc 336

Arg Lys Met Ile Val Lys His Met Ala His His Arg His Ala Gly Thr

100 105 110

gac gac gac cca gat ttc gac cat ggc ggc ccg gtc cgc tgg tac gcc 384

Asp Asp Asp Pro Asp Phe Asp His Gly Gly Pro Val Arg Trp Tyr Ala

115 120 125

cgc ttc atc ggc acc tat ttc ggc tgg cgc gag ggg ctg ctg ctg ccc 432

Arg Phe Ile Gly Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

gtc atc gtg acg gtc tat gcg ctg atc ctg ggg gat cgc tgg atg tac 480

Val Ile Val Thr Val Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 160

gtg gtc ttc tgg ccg ttg ccg tcg atc ctg gcg tcg atc cag ctg ttc 528

Val Val Phe Trp Pro Leu Pro Ser Ile Leu Ala Ser Ile Gln Leu Phe

165 170 175

gtg ttc ggc act tgg ctg ccg cac cgc ccc ggc cac gac gcg ttc ccg 576

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Ala Phe Pro

180 185 190

gac cgc cat aat gcg cgg tcg tcg cgg atc agc gac cct gtg tcg ctg 624

Asp Arg His Asn Ala Arg Ser Ser Arg Ile Ser Asp Pro Val Ser Leu

195 200 205

ctg acc tgc ttt cat ttt ggc ggt tat cat cac gaa cac cac ctg cac 672

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

ccg acg gtg ccg tgg tgg cgc ctg ccc agc acc cgc acc aag ggg gac 720

Pro Thr Val Pro Trp Trp Arg Leu Pro Ser Thr Arg Thr Lys Gly Asp

225 230 235 240

acc gca tga 729

Thr Ala

<210>10

<211>242

<212>PRT

<213>Paracoccus marcusii

<400>10

Met Ser Ala His Ala Leu Pro Lys Ala Asp Leu Thr Ala Thr Ser Leu

1 5 10 15

Ile Val Ser Gly Gly Ile Ile Ala Ala Trp Leu Ala Leu His Val His

20 25 30

Ala Leu Trp Phe Leu Asp Ala Ala Ala His Pro Ile Leu Ala Val Ala

35 40 45

Asn Phe Leu Gly Leu Thr Trp Leu Ser Val Gly Leu Phe Ile Ile Ala

50 55 60

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

Ala Ala Met Gly Gln Leu Val Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

Arg Lys Met Ile Val Lys His Met Ala His His Arg His Ala Gly Thr

100 105 110

Asp Asp Asp Pro Asp Phe Asp His Gly Gly Pro Val Arg Trp Tyr Ala

115 120 125

Arg Phe Ile Gly Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

Val Ile Val Thr Val Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 160

Val Val Phe Trp Pro Leu Pro Ser Ile Leu Ala Ser Ile Gln Leu Phe

165 170 175

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Ala Phe Pro

180 185 190

Asp Arg His Asn Ala Arg Ser Ser Arg Ile Ser Asp Pro Val Ser Leu

195 200 205

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

Pro Thr Val Pro Trp Trp Arg Leu Pro Ser Thr Arg Thr Lys Gly Asp

225 230 235 240

Thr Ala

<210>11

<211>1629

<212>DNA

＜213〉Synechococcus (synechococcus sp.)

<220>

<221>CDS

<222>(1)..(1629)

<223>

<400>11

atg atc acc acc gat gtt gtc att att ggg gcg ggg cac aat ggc tta 48

Met Ile Thr Thr Asp Val Val Ile Ile Gly Ala Gly His Asn Gly Leu

1 5 10 15

gtc tgt gca gcc tat ttg ctc caa cgg ggc ttg ggg gtg acg tta cta 96

Val Cys Ala Ala Tyr Leu Leu Gln Arg Gly Leu Gly Val Thr Leu Leu

20 25 30

gaa aag cgg gaa gta cca ggg ggg gcg gcc acc aca gaa gct ctc atg 144

Glu Lys Arg Glu Val Pro Gly Gly Ala Ala Thr Thr Glu Ala Leu Met

35 40 45

ccg gag cta tcc ccc cag ttt cgc ttt aac cgc tgt gcc att gac cac 192

Pro Glu Leu Ser Pro Gln Phe Arg Phe Asn Arg Cys Ala Ile Asp His

50 55 60

gaa ttt atc ttt ctg ggg ccg gtg ttg cag gag cta aat tta gcc cag 240

Glu Phe Ile Phe Leu Gly Pro Val Leu Gln Glu Leu Asn Leu Ala Gln

65 70 75 80

tat ggt ttg gaa tat tta ttt tgt gac ccc agt gtt ttt tgt ccg ggg 288

Tyr Gly Leu Glu Tyr Leu Phe Cys Asp Pro Ser Val Phe Cys Pro Gly

85 90 95

ctg gat ggc caa gct ttt atg agc tac cgt tcc cta gaa aaa acc tgt 336

Leu Asp Gly Gln Ala Phe Met Ser Tyr Arg Ser Leu Glu Lys Thr Cys

100 105 110

gcc cac att gcc acc tat agc ccc cga gat gcg gaa aaa tat cgg caa 384

Ala His Ile Ala Thr Tyr Ser Pro Arg Asp Ala Glu Lys Tyr Arg Gln

115 120 125

ttt gtc aat tat tgg acg gat ttg ctc aac gct gtc cag cct gct ttt 432

Phe Val Asn Tyr Trp Thr Asp Leu Leu Asn Ala Val Gln Pro Ala Phe

130 135 140

aat gct ccg ccc cag gct tta cta gat tta gcc ctg aac tat ggt tgg 480

Asn Ala Pro Pro Gln Ala Leu Leu Asp Leu Ala Leu Asn Tyr Gly Trp

145 150 155 160

gaa aac tta aaa tcc gtg ctg gcg atc gcc ggg tcg aaa acc aag gcg 528

Glu Asn Leu Lys Ser Val Leu Ala Ile Ala Gly Ser Lys Thr Lys Ala

165 170 175

ttg gat ttt atc cgc act atg atc ggc tcc ccg gaa gat gtg ctc aat 576

Leu Asp Phe Ile Arg Thr Met Ile Gly Ser Pro Glu Asp Val Leu Asn

180 185 190

gaa tgg ttc gac agc gaa cgg gtt aaa gct cct tta gct aga cta tgt 624

Glu Trp Phe Asp Ser Glu Arg Val Lys Ala Pro Leu Ala Arg Leu Cys

195 200 205

tcg gaa att ggc gct ccc cca tcc caa aag ggt agt agc tcc ggc atg 672

Ser Glu Ile Gly Ala Pro Pro Ser Gln Lys Gly Ser Ser Ser Gly Met

210 215 220

atg atg gtg gcc atg cgg cat ttg gag gga att gcc aga cca aaa gga 720

Met Met Val Ala Met Arg His Leu Glu Gly Ile Ala Arg Pro Lys Gly

225 230 235 240

ggc act gga gcc ctc aca gaa gcc ttg gtg aag tta gtg caa gcc caa 768

Gly Thr Gly Ala Leu Thr Glu Ala Leu Val Lys Leu Val Gln Ala Gln

245 250 255

ggg gga aaa atc ctc act gac caa acc gtc aaa cgg gta ttg gtg gaa 816

Gly Gly Lys Ile Leu Thr Asp Gln Thr Val Lys Arg Val Leu Val Glu

260 265 270

aac aac cag gcg atc ggg gtg gag gta gct aac gga gaa cag tac cgg 864

Asn Asn Gln Ala Ile Gly Val Glu Val Ala Asn Gly Glu Gln Tyr Arg

275 280 285

gcc aaa aaa ggc gtg att tct aac atc gat gcc cgc cgt tta ttt ttg 912

Ala Lys Lys Gly Val Ile Ser Asn Ile Asp Ala Arg Arg Leu Phe Leu

290 295 300

caa ttg gtg gaa ccg ggg gcc cta gcc aag gtg aat caa aac cta ggg 960

Gln Leu Val Glu Pro Gly Ala Leu Ala Lys Val Asn Gln Asn Leu Gly

305 310 315 320

gaa cga ctg gaa cgg cgc act gtg aac aat aac gaa gcc att tta aaa 1008

Glu Arg Leu Glu Arg Arg Thr Val Asn Asn Asn Glu Ala Ile Leu Lys

325 330 335

atc gat tgt gcc ctc tcc ggt tta ccc cac ttc act gcc atg gcc ggg 1056

Ile Asp Cys Ala Leu Ser Gly Leu Pro His Phe Thr Ala Met Ala Gly

340 345 350

ccg gag gat cta acg gga act att ttg att gcc gac tcg gta cgc cat 1104

Pro Glu Asp Leu Thr Gly Thr Ile Leu Ile Ala Asp Ser Val Arg His

355 360 365

gtc gag gaa gcc cac gcc ctc att gcc ttg ggg caa att ccc gat gct 1152

Val Glu Glu Ala His Ala Leu Ile Ala Leu Gly Gln Ile Pro Asp Ala

370 375 380

aat ccg tct tta tat ttg gat att ccc act gta ttg gac ccc acc atg 1200

Asn Pro Ser Leu Tyr Leu Asp Ile Pro Thr Val Leu Asp Pro Thr Met

385 390 395 400

gcc ccc cct ggg cag cac acc ctc tgg atc gaa ttt ttt gcc ccc tac 1248

Ala Pro Pro Gly Gln His Thr Leu Trp Ile Glu Phe Phe Ala Pro Tyr

405 410 415

cgc atc gcc ggg ttg gaa ggg aca ggg tta atg ggc aca ggt tgg acc 1296

Arg Ile Ala Gly Leu Glu Gly Thr Gly Leu Met Gly Thr Gly Trp Thr

420 425 430

gat gag tta aag gaa aaa gtg gcg gat cgg gtg att gat aaa tta acg 1344

Asp Glu Leu Lys Glu Lys Val Ala Asp Arg Val Ile Asp Lys Leu Thr

435 440 445

gac tat gcc cct aac cta aaa tct ctg atc att ggt cgc cga gtg gaa 1392

Asp Tyr Ala Pro Asn Leu Lys Ser Leu Ile Ile Gly Arg Arg Val Glu

450 455 460

agt ccc gcc gaa ctg gcc caa cgg ctg gga agt tac aac ggc aat gtc 1440

Ser Pro Ala Glu Leu Ala Gln Arg Leu Gly Ser Tyr Asn Gly Asn Val

465 470 475 480

tat cat ctg gat atg agt ttg gac caa atg atg ttc ctc cgg cct cta 1488

Tyr His Leu Asp Met Ser Leu Asp Gln Met Met Phe Leu Arg Pro Leu

485 490 495

ccg gaa att gcc aac tac caa acc ccc atc aaa aat ctt tac tta aca 1536

Pro Glu Ile Ala Asn Tyr Gln Thr Pro Ile Lys Asn Leu Tyr Leu Thr

500 505 510

ggg gcg ggt acc cat ccc ggt ggc tcc ata tca ggt atg ccc ggt aga 1584

Gly Ala Gly Thr His Pro Gly Gly Ser Ile Ser Gly Met Pro Gly Arg

515 520 525

aat tgc gct cgg gtc ttt tta aaa caa caa cgt cgt ttt tgg taa 1629

Asn Cys Ala Arg Val Phe Leu Lys Gln Gln Arg Arg Phe Trp

530 535 540

<210>12

<211>542

<212>PRT

＜213〉Synechococcus

<400>12

Met Ile Thr Thr Asp Val Val Ile Ile Gly Ala Gly His Asn Gly Leu

1 5 10 15

Val Cys Ala Ala Tyr Leu Leu Gln Arg Gly Leu Gly Val Thr Leu Leu

20 25 30

Glu Lys Arg Glu Val Pro Gly Gly Ala Ala Thr Thr Glu Ala Leu Met

35 40 45

Pro Glu Leu Ser Pro Gln Phe Arg Phe Asn Arg Cys Ala Ile Asp His

50 55 60

Glu Phe Ile Phe Leu Gly Pro Val Leu Gln Glu Leu Asn Leu Ala Gln

65 70 75 80

Tyr Gly Leu Glu Tyr Leu Phe Cys Asp Pro Ser Val Phe Cys Pro Gly

85 90 95

Leu Asp Gly Gln Ala Phe Met Ser Tyr Arg Ser Leu Glu Lys Thr Cys

100 105 110

Ala His Ile Ala Thr Tyr Ser Pro Arg Asp Ala Glu Lys Tyr Arg Gln

115 120 125

Phe Val Asn Tyr Trp Thr Asp Leu Leu Asn Ala Val Gln Pro Ala Phe

130 135 140

Asn Ala Pro Pro Gln Ala Leu Leu Asp Leu Ala Leu Asn Tyr Gly Trp

145 150 155 160

Glu Asn Leu Lys Ser Val Leu Ala Ile Ala Gly Ser Lys Thr Lys Ala

165 170 175

Leu Asp Phe Ile Arg Thr Met Ile Gly Ser Pro Glu Asp Val Leu Asn

180 185 190

Glu Trp Phe Asp Ser Glu Arg Val Lys Ala Pro Leu Ala Arg Leu Cys

195 200 205

Ser Glu Ile Gly Ala Pro Pro Ser Gln Lys Gly Ser Ser Ser Gly Met

210 215 220

Met Met Val Ala Met Arg His Leu Glu Gly Ile Ala Arg Pro Lys Gly

225 230 235 240

Gly Thr Gly Ala Leu Thr Glu Ala Leu Val Lys Leu Val Gln Ala Gln

245 250 255

Gly Gly Lys Ile Leu Thr Asp Gln Thr Val Lys Arg Val Leu Val Glu

260 265 270

Asn Asn Gln Ala Ile Gly Val Glu Val Ala Asn Gly Glu Gln Tyr Arg

275 280 285

Ala Lys Lys Gly Val Ile Ser Asn Ile Asp Ala Arg Arg Leu Phe Leu

290 295 300

Gln Leu Val Glu Pro Gly Ala Leu Ala Lys Val Asn Gln Asn Leu Gly

305 310 315 320

Glu Arg Leu Glu Arg Arg Thr Val Asn Asn Asn Glu Ala Ile Leu Lys

325 330 335

Ile Asp Cys Ala Leu Ser Gly Leu Pro His Phe Thr Ala Met Ala Gly

340 345 350

Pro Glu Asp Leu Thr Gly Thr Ile Leu Ile Ala Asp Ser Val Arg His

355 360 365

Val Glu Glu Ala His Ala Leu Ile Ala Leu Gly Gln Ile Pro Asp Ala

370 375 380

Asn Pro Ser Leu Tyr Leu Asp Ile Pro Thr Val Leu Asp Pro Thr Met

385 390 395 400

Ala Pro Pro Gly Gln His Thr Leu Trp Ile Glu Phe Phe Ala Pro Tyr

405 410 415

Arg Ile Ala Gly Leu Glu Gly Thr Gly Leu Met Gly Thr Gly Trp Thr

420 425 430

Asp Glu Leu Lys Glu Lys Val Ala Asp Arg Val Ile Asp Lys Leu Thr

435 440 445

Asp Tyr Ala Pro Asn Leu Lys Ser Leu Ile Ile Gly Arg Arg Val Glu

450 455 460

Ser Pro Ala Glu Leu Ala Gln Arg Leu Gly Ser Tyr Asn Gly Asn Val

465 470 475 480

Tyr His Leu Asp Met Ser Leu Asp Gln Met Met Phe Leu Arg Pro Leu

485 490 495

Pro Glu Ile Ala Asn Tyr Gln Thr Pro Ile Lys Asn Leu Tyr Leu Thr

500 505 510

Gly Ala Gly Thr His Pro Gly Gly Ser Ile Ser Gly Met Pro Gly Arg

515 520 525

Asn Cys Ala Arg Val Phe Leu Lys Gln Gln Arg Arg Phe Trp

530 535 540

<210>13

<211>776

<212>DNA

＜213〉living slowly rhizobium (Bradyrhizobium sp.)

<220>

<221>CDS

<222>(1)..(774)

<223>

<400>13

atg cat gca gca acc gcc aag gct act gag ttc ggg gcc tct cgg cgc 48

Met His Ala Ala Thr Ala Lys Ala Thr Glu Phe Gly Ala Ser Arg Arg

1 5 10 15

gac gat gcg agg cag cgc cgc gtc ggt ctc acg ctg gcc gcg gtc atc 96

Asp Asp Ala Arg Gln Arg Arg Val Gly Leu Thr Leu Ala Ala Val Ile

20 25 30

atc gcc gcc tgg ctg gtg ctg cat gtc ggt ctg atg ttc ttc tgg ccg 144

Ile Ala Ala Trp Leu Val Leu His Val Gly Leu Met Phe Phe Trp Pro

35 40 45

ctg acc ctt cac agc ctg ctg ccg gct ttg cct ctg gtg gtg ctg cag 192

Leu Thr Leu His Ser Leu Leu Pro Ala Leu Pro Leu Val Val Leu Gln

50 55 60

acc tgg ctc tat gta ggc ctg ttc atc atc gcg cat gac tgc atg cac 240

Thr Trp Leu Tyr Val Gly Leu Phe Ile Ile Ala His Asp Cys Met His

65 70 75 80

ggc tcg ctg gtg ccg ttc aag ccg cag gtc aac cgc cgt atc gga cag 288

Gly Ser Leu Val Pro Phe Lys Pro Gln Val Asn Arg Arg Ile Gly Gln

85 90 95

ctc tgc ctg ttc ctc tat gcc ggg ttc tcc ttc gac gct ctc aat gtc 336

Leu Cys Leu Phe Leu Tyr Ala Gly Phe Ser Phe Asp Ala Leu Asn Val

100 105 110

gag cac cac aag cat cac cgc cat ccc ggc acg gcc gag gat ccc gat 384

Glu His His Lys His His Arg His Pro Gly Thr Ala Glu Asp Pro Asp

115 120 125

ttc gac gag gtg ccg ccg cac ggc ttc tgg cac tgg ttc gcc agc ttt 432

Phe Asp Glu Val Pro Pro His Gly Phe Trp His Trp Phe Ala Ser Phe

130 135 140

ttc ctg cac tat ttc ggc tgg aag cag gtc gcg atc atc gca gcc gtc 480

Phe Leu His Tyr Phe Gly Trp Lys Gln Val Ala Ile I1e Ala Ala Val

145 150 155 160

tcg ctg gtt tat cag ctc gtc ttc gcc gtt ccc ttg cag aac atc ctg 528

Ser Leu Val Tyr Gln Leu Val Phe Ala Val Pro Leu Gln Asn Ile Leu

165 170 175

ctg ttc tgg gcg ctg ccc ggg ctg ctg tcg gcg ctg cag ctg ttc acc 576

Leu Phe Trp Ala Leu Pro Gly Leu Leu Ser Ala Leu Gln Leu Phe Thr

180 185 190

ttc ggc acc tat ctg ccg cac aag ccg gcc acg cag ccc ttc gcc gat 624

Phe Gly Thr Tyr Leu Pro His Lys Pro Ala Thr Gln Pro Phe Ala Asp

195 200 205

cgc cac aac gcg cgg acg agc gaa ttt ccc gcg tgg ctg tcg ctg ctg 672

Arg His Asn Ala Arg Thr Ser Glu Phe Pro Ala Trp Leu Ser Leu Leu

210 215 220

acc tgc ttc cac ttc ggc ttt cat cac gag cat cat ctg cat ccc gat 720

Thr Cys Phe His Phe Gly Phe His His Glu His His Leu His Pro Asp

225 230 235 240

gcg ccg tgg tgg cgg ctg ccg gag atc aag cgg cgg gcc ctg gaa agg 768

Ala Pro Trp Trp Arg Leu Pro Glu Ile Lys Arg Arg Ala Leu Glu Arg

245 250 255

cgt gac ta 776

Arg Asp

<210>14

<211>258

<212>PRT

＜213〉living slowly rhizobium

<400>14

Met His Ala Ala Thr Ala Lys Ala Thr Glu Phe Gly Ala Ser Arg Arg

1 5 10 15

Asp Asp Ala Arg Gln Arg Arg Val Gly Leu Thr Leu Ala Ala Val Ile

20 25 30

Ile Ala Ala Trp Leu Val Leu His Val Gly Leu Met Phe Phe Trp Pro

35 40 45

Leu Thr Leu His Ser Leu Leu Pro Ala Leu Pro Leu Val Val Leu Gln

50 55 60

Thr Trp Leu Tyr Val Gly Leu Phe Ile Ile Ala His Asp Cys Met His

65 70 75 80

Gly Ser Leu Val Pro Phe Lys Pro Gln Val Asn Arg Arg Ile Gly Gln

85 90 95

Leu Cys Leu Phe Leu Tyr Ala Gly Phe Ser Phe Asp Ala Leu Asn Val

100 105 110

Glu His His Lys His His Arg His Pro Gly Thr Ala Glu Asp Pro Asp

115 120 125

Phe Asp Glu Val Pro Pro His Gly Phe Trp His Trp Phe Ala Ser Phe

130 135 140

Phe Leu His Tyr Phe Gly Trp Lys Gln Val Ala Ile Ile Ala Ala Val

145 150 155 160

Ser Leu Val Tyr Gln Leu Val Phe Ala Val Pro Leu Gln Asn Ile Leu

165 170 175

Leu Phe Trp Ala Leu Pro Gly Leu Leu Ser Ala Leu Gln Leu Phe Thr

180 185 190

Phe Gly Thr Tyr Leu Pro His Lys Pro Ala Thr Gln Pro Phe Ala Asp

195 200 205

Arg His Asn Ala Arg Thr Ser Glu Phe Pro Ala Trp Leu Ser Leu Leu

210 215 220

Thr Cys Phe His Phe Gly Phe His His Glu His His Leu His Pro Asp

225 230 235 240

Ala Pro Trp Trp Arg Leu Pro Glu Ile Lys Arg Arg Ala Leu Glu Arg

245 250 255

Arg Asp

<210>15

<211>77

<212>DNA

＜213〉beads algae (Nostoc sp.)

<220>

<221>CDS

<222>(1)..(777)

<223>

<400>15

atg gtt cag tgt caa cca tca tct ctg cat tca gaa aaa ctg gtg tta 48

Met Val Gln Cys Gln Pro Ser Ser Leu His Ser Glu Lys Leu Val Leu

1 5 10 15

ttg tca tcg aca atc aga gat gat aaa aat att aat aag ggt ata ttt 96

Leu Ser Ser Thr Ile Arg Asp Asp Lys Asn Ile Asn Lys Gly Ile Phe

20 25 30

att gcc tgc ttt atc tta ttt tta tgg gca att agt tta atc tta tta 144

Ile Ala Cys Phe Ile Leu Phe Leu Trp Ala Ile Ser Leu Ile Leu Leu

35 40 45

ctc tca ata gat aca tcc ata att cat aag agc tta tta ggt ata gcc 192

Leu Ser Ile Asp Thr Ser Ile Ile His Lys Ser Leu Leu Gly Ile Ala

50 55 60

atg ctt tgg cag acc ttc tta tat aca ggt tta ttt att act gct cat 240

Met Leu Trp Gln Thr Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ala His

65 70 75 80

gat gcc atg cac ggc gta gtt tat ccc aaa aat ccc aga ata aat aat 288

Asp Ala Met His Gly Val Val Tyr Pro Lys Asn Pro Arg Ile Asn Asn

85 90 95

ttt ata ggt aag ctc act cta atc ttg tat gga cta ctc cct tat aaa 336

Phe Ile Gly Lys Leu Thr Leu Ile Leu Tyr Gly Leu Leu Pro Tyr Lys

100 105 110

gat tta ttg aaa aaa cat tgg tta cac cac gga cat cct ggt act gat 384

Asp Leu Leu Lys Lys His Trp Leu His His Gly His Pro Gly Thr Asp

115 120 125

tta gac cct gat tat tac aat ggt cat ccc caa aac ttc ttt ctt tgg 432

Leu Asp Pro Asp Tyr Tyr Asn Gly His Pro Gln Asn Phe Phe Leu Trp

130 135 140

tat cta cat ttt atg aag tct tat tgg cga tgg acg caa att ttc gga 480

Tyr Leu His Phe Met Lys Ser Tyr Trp Arg Trp Thr Gln Ile Phe Gly

145 150 155 160

tta gtg atg att ttt cat gga ctt aaa aat ctg gtg cat ata cca gaa 528

Leu Val Met Ile Phe His Gly Leu Lys Asn Leu Val His Ile Pro Glu

165 170 175

aat aat tta att ata ttt tgg atg ata cct tct att tta agt tca gta 576

Asn Asn Leu Ile Ile Phe Trp Met Ile Pro Ser Ile Leu Ser Ser Val

180 185 190

caa cta ttt tat ttt ggt aca ttt ttg cct cat aaa aag cta gaa ggt 624

Gln Leu Phe Tyr Phe Gly Thr Phe Leu Pro His Lys Lys Leu Glu Gly

195 200 205

ggt tat act aac ccc cat tgt gcg cgc agt atc cca tta cct ctt ttt 672

Gly Tyr Thr Asn Pro His Cys Ala Arg Ser Ile Pro Leu Pro Leu Phe

210 215 220

tgg tct ttt gtt act tgt tat cac ttc ggc tac cac aag gaa cat cac 720

Trp Ser Phe Val Thr Cys Tyr His Phe Gly Tyr His Lys Glu His His

225 230 235 240

gaa tac cct caa ctt cct tgg tgg aaa tta cct gaa gct cac aaa ata 768

Glu Tyr Pro Gln Leu Pro Trp Trp Lys Leu Pro Glu Ala His Lys Ile

245 250 255

tct tta taa 777

Ser Leu

<210>16

<211>258

<212>PRT

＜213〉beads algae

<400>16

Met Val Gln Cys Gln Pro Ser Ser Leu His Ser Glu Lys Leu Val Leu

1 5 10 15

Leu Ser Ser Thr Ile Arg Asp Asp Lys Asn Ile Asn Lys Gly Ile Phe

20 25 30

Ile Ala Cys Phe Ile Leu Phe Leu Trp Ala Ile Ser Leu Ile Leu Leu

35 40 45

Leu Ser Ile Asp Thr Ser Ile Ile His Lys Ser Leu Leu Gly Ile Ala

50 55 60

Met Leu Trp Gln Thr Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ala His

65 70 75 80

Asp Ala Met His Gly Val Val Tyr Pro Lys Asn Pro Arg Ile Asn Asn

85 90 95

Phe Ile Gly Lys Leu Thr Leu Ile Leu Tyr Gly Leu Leu Pro Tyr Lys

100 105 110

Asp Leu Leu Lys Lys His Trp Leu His His Gly His Pro Gly Thr Asp

115 120 125

Leu Asp Pro Asp Tyr Tyr Asn Gly His Pro Gln Asn Phe Phe Leu Trp

130 135 140

Tyr Leu His Phe Met Lys Ser Tyr Trp Arg Trp Thr Gln Ile Phe Gly

145 150 155 160

Leu Val Met Ile Phe His Gly Leu Lys Asn Leu Val His Ile Pro Glu

165 170 175

Asn Asn Leu Ile Ile Phe Trp Met Ile Pro Ser Ile Leu Ser Ser Val

180 185 190

Gln Leu Phe Tyr Phe Gly Thr Phe Leu Pro His Lys Lys Leu Glu Gly

195 200 205

Gly Tyr Thr Asn Pro His Cys Ala Arg Ser Ile Pro Leu Pro Leu Phe

210 215 220

Trp Ser Phe Val Thr Cys Tyr His Phe Gly Tyr His Lys Glu His His

225 230 235 240

Glu Tyr Pro Gln Leu Pro Trp Trp Lys Leu Pro Glu Ala His Lys Ile

245 250 255

Ser Leu

<210>17

<211>1608

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(3)..(971)

<223>

<400>17

ct aca ttt cac aag ccc gtg agc ggt gca agc gct ctg ccc cac atc 47

Thr Phe His Lys Pro Val Ser Gly Ala Ser Ala Leu Pro His Ile

1 5 10 15

ggc cca cct cct cat ctc cat cgg tca ttt gct gct acc acg atg ctg 95

Gly Pro Pro Pro His Leu His Arg Ser Phe Ala Ala Thr Thr Met Leu

20 25 30

tcg aag ctg cag tca atc agc gtc aag gcc cgc cgc gtt gaa cta gcc 143

Ser Lys Leu Gln Ser Ile Ser Val Lys Ala Arg Arg Val Glu Leu Ala

35 40 45

cgc gac atc acg cgg ccc aaa gtc tgc ctg cat gct cag cgg tgc tcg 191

Arg Asp Ile Thr Arg Pro Lys Val Cys Leu Hls Ala Gln Arg Cys Ser

50 55 60

tta gtt cgg ctg cga gtg gca gca cca cag aca gag gag gcg ctg gga 239

Leu Val Arg Leu Arg Val Ala Ala Pro Gln Thr Glu Glu Ala Leu Gly

65 70 75

acc gtg cag gct gcc ggc gcg ggc gat gag cac agc gcc gat gta gca 287

Thr Val Gln Ala Ala Gly Ala Gly Asp Glu His Ser Ala Asp Val Ala

80 85 90 95

ctc cag cag ctt gac cgg gct atc gca gag cgt cgt gcc cgg cgc aaa 335

Leu Gln Gln Leu Asp Arg Ala Ile Ala Glu Arg Arg Ala Arg Arg Lys

100 105 110

cgg gag cag ctg tca tac cag gct gcc gcc att gca gca tca att ggc 383

Arg Glu Gln Leu Ser Tyr Gln Ala Ala Ala Ile Ala Ala Ser Ile Gly

115 120 125

gtg tca ggc att gcc atc ttc gcc acc tac ctg aga ttt gcc atg cac 431

Val Ser Gly Ile Ala Ile Phe Ala Thr Tyr Leu Arg Phe Ala Met His

130 135 140

atg acc gtg ggc ggc gca gtg cca tgg ggt gaa gtg gct ggc act ctc 479

Met Thr Val Gly Gly Ala Val Pro Trp Gly Glu Val Ala Gly Thr Leu

145 150 155

ctc ttg gtg gtt ggt ggc gcg ctc ggc atg gag atg tat gcc cgc tat 527

Leu Leu Val Val Gly Gly Ala Leu Gly Met Glu Met Tyr Ala Arg Tyr

160 165 170 175

gca cac aaa gcc atc tgg cat gag tcg cct ctg ggc tgg ctg ctg cac 575

Ala His Lys Ala Ile Trp His Glu Ser Pro Leu Gly Trp Leu Leu His

180 185 190

aag agc cac cac aca cct cgc act gga ccc ttt gaa gcc aac gac ttg 623

Lys Ser His His Thr Pro Arg Thr Gly Pro Phe Glu Ala Asn Asp Leu

195 200 205

ttt gca atc atc aat gga ctg ccc gcc atg ctc ctg tgt acc ttt ggc 671

Phe Ala Ile Ile Asn Gly Leu Pro Ala Met Leu Leu Cys Thr Phe Gly

210 215 220

ttc tgg ctg ccc aac gtc ctg ggg gcg gcc tgc ttt gga gcg ggg ctg 719

Phe Trp Leu Pro Asn Val Leu Gly Ala Ala Cys Phe Gly Ala Gly Leu

225 230 235

ggc atc acg cta tac ggc atg gca tat atg ttt gta cac gat ggc ctg 767

Gly Ile Thr Leu Tyr Gly Met Ala Tyr Met Phe Val His Asp Gly Leu

240 245 250 255

gtg cac agg cgc ttt ccc acc ggg ccc atc gct ggc ctg ccc tac atg 815

Val His Arg Arg Phe Pro Thr Gly Pro Ile Ala Gly Leu Pro Tyr Met

260 265 270

aag cgc ctg aca gtg gcc cac cag cta cac cac agc ggc aag tac ggt 863

Lys Arg Leu Thr Val Ala His Gln Leu His His Ser Gly Lys Tyr Gly

275 280 285

ggc gcg ccc tgg ggt atg ttc ttg ggt cca cag gag ctg cag cac att 911

Gly Ala Pro Trp Gly Met Phe Leu Gly Pro Gln Glu Leu Gln His Ile

290 295 300

cca ggt gcg gcg gag gag gtg gag cga ctg gtc ctg gaa ctg gac tgg 959

Pro Gly Ala Ala Glu Glu Val Glu Arg Leu Val Leu Glu Leu Asp Trp

305 310 315

tcc aag cgg tag ggtgcggaac caggcacgct ggtttcacac ctcatgcctg 1011

Ser Lys Arg

320

tgataaggtg tggctagagc gatgcgtgtg agacgggtat gtcacggtcg actggtctga 1071

tggccaatgg catcggccat gtctggtcat cacgggctgg ttgcctgggt gaaggtgatg 1131

cacatcatca tgtgcggttg gaggggctgg cacagtgtgg gctgaactgg agcagttgtc 1191

caggctggcg ttgaatcagt gagggtttgt gattggcggt tgtgaagcaa tgactccgcc 1251

catattctat ttgtgggagc tgagatgatg gcatgcttgg gatgtgcatg gatcatggta 1311

gtgcagcaaa ctatattcac ctagggctgt tggtaggatc aggtgaggcc ttgcacattg 1371

catgatgtac tcgtcatggt gtgttggtga gaggatggat gtggatggat gtgtattctc 1431

agacgtagac cttgactgga ggcttgatcg agagagtggg ccgtattctt tgagagggga 1491

ggctcgtgcc agaaatggtg agtggatgac tgtgacgctg tacattgcag gcaggtgaga 1551

tgcactgtct cgattgtaaa atacattcag atgcaaaaaa aaaaaaaaaa aaaaaaa 1608

<210>18

<211>322

<212>PRT

＜213〉haematococcus pluvialis

<400>18

Thr Phe His Lys Pro Val Ser Gly Ala Ser Ala Leu Pro His Ile Gly

1 5 10 15

Pro Pro Pro His Leu His Arg Ser Phe Ala Ala Thr Thr Met Leu Ser

20 25 30

Lys Leu Gln Ser Ile Ser Val Lys Ala Arg Arg Val Glu Leu Ala Arg

35 40 45

Asp Ile Thr Arg Pro Lys Val Cys Leu His Ala Gln Arg Cys Ser Leu

50 55 60

Val Arg Leu Arg Val Ala Ala Pro Gln Thr Glu Glu Ala Leu Gly Thr

65 70 75 80

Val Gln Ala Ala Gly Ala Gly Asp Glu His Ser Ala Asp Val Ala Leu

85 90 95

Gln Gln Leu Asp Arg Ala Ile Ala Glu Arg Arg Ala Arg Arg Lys Arg

100 105 110

Glu Gln Leu Ser Tyr Gln Ala Ala Ala Ile Ala Ala Ser Ile Gly Val

115 120 125

Ser Gly Ile Ala Ile Phe Ala Thr Tyr Leu Arg Phe Ala Met His Met

130 135 140

Thr Val Gly Gly Ala Val Pro Trp Gly Glu Val Ala Gly Thr Leu Leu

145 150 155 160

Leu Val Val Gly Gly Ala Leu Gly Met Glu Met Tyr Ala Arg Tyr Ala

165 170 175

His Lys Ala Ile Trp His Glu Ser Pro Leu Gly Trp Leu Leu His Lys

180 185 190

Ser His His Thr Pro Arg Thr Gly Pro Phe Glu Ala Asn Asp Leu Phe

195 200 205

Ala Ile Ile Asn Gly Leu Pro Ala Met Leu Leu Cys Thr Phe Gly Phe

210 215 220

Trp Leu Pro Asn Val Leu Gly Ala Ala Cys Phe Gly Ala Gly Leu Gly

225 230 235 240

Ile Thr Leu Tyr Gly Met Ala Tyr Met Phe Val His Asp Gly Leu Val

245 250 255

His Arg Arg Phe Pro Thr Gly Pro Ile Ala Gly Leu Pro Tyr Met Lys

260 265 270

Arg Leu Thr Val Ala His Gln Leu His His Ser Gly Lys Tyr Gly Gly

275 280 285

Ala Pro Trp Gly Met Phe Leu Gly Pro Gln Glu Leu Gln His Ile Pro

290 295 300

Gly Ala Ala Glu Glu Val Glu Arg Leu Val Leu Glu Leu Asp Trp Ser

305 310 315 320

Lys Arg

<210>19

<211>1503

<212>DNA

＜213〉tomato

<220>

<221>CDS

<222>(1)..(1503)

<223>

<400>19

atg gat act ttg ttg aaa acc cca aat aac ctt gaa ttt ctg aac cca 48

Met Asp Thr Leu Leu Lys Thr Pro Asn Asn Leu Glu Phe Leu Asn Pro

1 5 10 15

cat cat ggt ttt gct gtt aaa gct agt acc ttt aga tct gag aag cat 96

His His Gly Phe Ala Val Lys Ala Ser Thr Phe Arg Ser Glu Lys His

20 25 30

cat aat ttt ggt tct agg aag ttt tgt gaa act ttg ggt aga agt gtt 144

His Asn Phe Gly Ser Arg Lys Phe Cys Glu Thr Leu Gly Arg Ser Val

35 40 45

tgt gtt aag ggt agt agt agt gct ctt tta gag ctt gta cct gag acc 192

Cys Val Lys Gly Ser Ser Ser Ala Leu Leu Glu Leu Val Pro Glu Thr

50 55 60

aaa aag gag aat ctt gat ttt gag ctt cct atg tat gac cct tca aaa 240

Lys Lys Glu Asn Leu Asp Phe Glu Leu Pro Met Tyr Asp Pro Ser Lys

65 70 75 80

ggg gtt gtt gtg gat ctt gct gtg gtt ggt ggt ggc cct gca gga ctt 288

Gly Val Val Val Asp Leu Ala Val Val Gly Gly Gly Pro Ala Gly Leu

85 90 95

gct gtt gca cag caa gtt tct gaa gca gga ctc tct gtt tgt tca att 336

Ala Val Ala Gln Gln Val Ser Glu Ala Gly Leu Ser Val Cys Ser Ile

100 105 110

gat ccg aat cct aaa ttg ata tgg cct aat aac tat ggt gtt tgg gtg 384

Asp Pro Asn Pro Lys Leu Ile Trp Pro Asn Asn Tyr Gly Val Trp Val

115 120 125

gat gaa ttt gag gct atg gac ttg tta gat tgt cta gat gct acc tgg 432

Asp Glu Phe Glu Ala Met Asp Leu Leu Asp Cys Leu Asp Ala Thr Trp

130 135 140

tct ggt gca gca gtg tac att gat gat aat acg gct aaa gat ctt cat 480

Ser Gly Ala Ala Val Tyr Ile Asp Asp Asn Thr Ala Lys Asp Leu His

145 150 155 160

aga cct tat gga agg gtt aac cgg aaa cag ctg aaa tcg aaa atg atg 528

Arg Pro Tyr Gly Arg Val Asn Arg Lys Gln Leu Lys Ser Lys Met Met

165 170 175

cag aaa tgt ata atg aat ggt gtt aaa ttc cac caa gcc aaa gtt ata 576

Gln Lys Cys Ile Met Asn Gly Val Lys Phe His Gln Ala Lys Val Ile

180 185 190

aag gtg att cat gag gaa tcg aaa tcc atg ttg ata tgc aat gat ggt 624

Lys Val Ile His Glu Glu Ser Lys Ser Met Leu Ile Cys Asn Asp Gly

195 200 205

att act att cag gca acg gtg gtg ctc gat gca act ggc ttc tct aga 672

Ile Thr Ile Gln Ala Thr Val Val Leu Asp Ala Thr Gly Phe Ser Arg

210 215 220

tct ctt gtt cag tat gat aag cct tat aac ccc ggg tat caa gtt gct 720

Ser Leu Val Gln Tyr Asp Lys Pro Tyr Asn Pro Gly Tyr Gln Val Ala

225 230 235 240

tat ggc att ttg gct gaa gtg gaa gag cac ccc ttt gat gta aac aag 768

Tyr Gly Ile Leu Ala Glu Val Glu Glu His Pro Phe Asp Val Asn Lys

245 250 255

atg gtt ttc atg gat tgg cga gat tct cat ttg aag aac aat act gat 816

Met Val Phe Met Asp Trp Arg Asp Ser His Leu Lys Asn Asn Thr Asp

260 265 270

ctc aag gag aga aat agt aga ata cca act ttt ctt tat gca atg cca 864

Leu Lys Glu Arg Asn Ser Arg Ile Pro Thr Phe Leu Tyr Ala Met Pro

275 280 285

ttt tca tcc aac agg ata ttt ctt gaa gaa aca tca ctc gta gct cgt 912

Phe Ser Ser Asn Arg Ile Phe Leu Glu Glu Thr Ser Leu Val Ala Arg

290 295 300

cct ggc ttg cgt ata gat gat att caa gaa cga atg gtg gct cgt tta 960

Pro Gly Leu Arg Ile Asp Asp Ile Gln Glu Arg Met Val Ala Arg Leu

305 310 315 320

aac cat ttg ggg ata aaa gtg aag agc att gaa gaa gat gaa cat tgt 1008

Asn His Leu Gly Ile Lys Val Lys Ser Ile Glu Glu Asp Glu His Cys

325 330 335

cta ata cca atg ggt ggt cca ctt cca gta tta cct cag aga gtc gtt 1056

Leu Ile Pro Met Gly Gly Pro Leu Pro Val Leu Pro Gln Arg Val Val

340 345 350

gga atc ggt ggt aca gct ggc atg gtt cat cca tcc acc ggt tat atg 1104

Gly Ile Gly Gly Thr Ala Gly Met Val His Pro Ser Thr Gly Tyr Met

355 360 365

gtg gca agg aca cta gct gcg gct cct gtt gtt gcc aat gcc ata att 1152

Val Ala Arg Thr Leu Ala Ala Ala Pro Val Val Ala Asn Ala Ile Ile

370 375 380

caa tac ctc ggt tct gaa aga agt cat tcg ggt aat gaa tta tcc aca 1200

Gln Tyr Leu Gly Ser Glu Arg Ser His Ser Gly Asn Glu Leu Ser Thr

385 390 395 400

gct gtt tgg aaa gat ttg tgg cct ata gag agg aga cgt caa aga gag 1248

Ala Val Trp Lys Asp Leu Trp Pro Ile Glu Arg Arg Arg Gln Arg Glu

405 410 415

ttc ttc tgc ttc ggt atg gat att ctt ctg aag ctt gat tta cct gct 1296

Phe Phe Cys Phe Gly Met Asp Ile Leu Leu Lys Leu Asp Leu Pro Ala

420 425 430

aca aga agg ttc ttt gat gca ttc ttt gac tta gaa cct cgt tat tgg 1344

Thr Arg Arg Phe Phe Asp Ala Phe Phe Asp Leu Glu Pro Arg Tyr Trp

435 440 445

cat ggc ttc tta tcg tct cga ttg ttt cta cct gaa ctc ata gtt ttt 1392

His Gly Phe Leu Ser Ser Arg Leu Phe Leu Pro Glu Leu Ile Val Phe

450 455 460

ggg ctg tct cta ttc tct cat gct tca aat act tct aga ttt gag ata 1440

Gly Leu Ser Leu Phe Ser His Ala Ser Asn Thr Ser Arg Phe Glu Ile

465 470 475 480

atg aca aag gga act gtt cca tta gta aat atg atc aac aat ttg tta 1488

Met Thr Lys Gly Thr Val Pro Leu Val Asn Met Ile Asn Asr Leu Leu

485 490 495

cag gat aaa gaa tga 1503

Gln Asp Lys Glu

500

<210>20

<211>500

<212>PRT

＜213〉tomato

<400>20

Met Asp Thr Leu Leu Lys Thr Pro Asn Asn Leu Glu Phe Leu Asn Pro

1 5 10 15

His His Gly Phe Ala Val Lys Ala Ser Thr Phe Arg Ser Glu Lys His

20 25 30

His Asn Phe Gly Ser Arg Lys Phe Cys Glu Thr Leu Gly Arg Ser Val

35 40 45

Cys Val Lys Gly Ser Ser Ser Ala Leu Leu Glu Leu Val Pro Glu Thr

50 55 60

Lys Lys Glu Asn Leu Asp Phe Glu Leu Pro Met Tyr Asp Pro Ser Lys

65 70 75 80

Gly Val Val Val Asp Leu Ala Val Val Gly Gly Gly Pro Ala Gly Leu

85 90 95

Ala Val Ala Gln Gln Val Ser Glu Ala Gly Leu Ser Val Cys Ser Ile

100 105 110

Asp Pro Asn Pro Lys Leu Ile Trp Pro Asn Asn Tyr Gly Val Trp Val

115 120 125

Asp Glu Phe Glu Ala Met Asp Leu Leu Asp Cys Leu Asp Ala Thr Trp

130 135 140

Ser Gly Ala Ala Val Tyr Ile Asp Asp Asn Thr Ala Lys Asp Leu His

145 150 155 160

Arg Pro Tyr Gly Arg Val Asn Arg Lys Gln Leu Lys Ser Lys Met Met

165 170 175

Gln Lys Cys Ile Met Asn Gly Val Lys Phe His Gln Ala Lys Val Ile

180 185 190

Lys Val Ile His Glu Glu Ser Lys Ser Met Leu Ile Cys Asn Asp Gly

195 200 205

Ile Thr Ile Gln Ala Thr Val Val Leu Asp Ala Thr Gly Phe Ser Arg

210 215 220

Ser Leu Val Gln Tyr Asp Lys Pro Tyr Asn Pro Gly Tyr Gln Val Ala

225 230 235 240

Tyr Gly Ile Leu Ala Glu Val Glu Glu His Pro Phe Asp Val Asn Lys

245 250 255

Met Val Phe Met Asp Trp Arg Asp Ser His Leu Lys Asn Asn Thr Asp

260 265 270

Leu Lys Glu Arg Asn Ser Arg Ile Pro Thr Phe Leu Tyr Ala Met Pro

275 280 285

Phe Ser Ser Asn Arg Ile Phe Leu Glu Glu Thr Ser Leu Val Ala Arg

290 295 300

Pro Gly Leu Arg Ile Asp Asp Ile Gln Glu Arg Met Val Ala Arg Leu

305 310 315 320

Asn His Leu Gly Ile Lys Val Lys Ser Ile Glu Glu Asp Glu His Cys

325 330 335

Leu Ile Pro Met Gly Gly Pro Leu Pro Val Leu Pro Gln Arg Val Val

340 345 350

Gly Ile Gly Gly Thr Ala Gly Met Val His Pro Ser Thr Gly Tyr Met

355 360 365

Val Ala Arg Thr Leu Ala Ala Ala Pro Val Val Ala Asn Ala Ile Ile

370 375 380

Gln Tyr Leu Gly Ser Glu Arg Ser His Ser Gly Asn Glu Leu Ser Thr

385 390 395 400

Ala Val Trp Lys Asp Leu Trp Pro Ile Glu Arg Arg Arg Gln Arg Glu

405 410 415

Phe Phe Cys Phe Gly Met Asp Ile Leu Leu Lys Leu Asp Leu Pro Ala

420 425 430

Thr Arg Arg Phe Phe Asp Ala Phe Phe Asp Leu Glu Pro Arg Tyr Trp

435 440 445

His Gly Phe Leu Ser Ser Arg Leu Phe Leu Pro Glu Leu Ile Val Phe

450 455 460

Gly Leu Ser Leu Phe Ser His Ala Ser Asn Thr Ser Arg Phe Glu Ile

465 470 475 480

Met Thr Lys Gly Thr Val Pro Leu Val Asn Met Ile Asn Asn Leu Leu

485 490 495

Gln Asp Lys Glu

500

<210>21

<211>195

<212>DNA

＜213〉potato

<220>

＜221〉introne

<222>(1)..(195)

<223>

<400>21

tacgtaagtt tctgcttcta cctttgatat atatataata attatcatta attagtagta 60

atataatatt tcaaatattt ttttcaaaat aaaagaatgt agtatatagc aattgctttt 120

ctgtagttta taagtgtgta tattttaatt tataactttt ctaatatatg accaaaattt 180

gttgatgtgc agctg 195

<210>22

<211>1155

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(6)..(995)

<223>

<400>22

gaagc atg cag cta gca gcg aca gta atg ttg gag cag ctt acc gga agc 50

Met Gln Leu Ala Ala Thr Val Met Leu Glu Gln Leu Thr Gly Ser

1 5 10 15

gct gag gca ctc aag gag aag gag aag gag gtt gca ggc agc tct gac 98

Ala Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp

20 25 30

gtg ttg cgt aca tgg gcg acc cag tac tcg ctt ccg tca gag gag tca 146

Val Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser

35 40 45

gac gcg gcc cgc ccg gga ctg aag aat gcc tac aag cca cca cct tcc 194

Asp Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser

50 55 60

gac aca aag ggc atc aca atg gcg cta gct gtc atc ggc tcc tgg gcc 242

Asp Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser Trp Ala

65 70 75

gca gtg ttc ctc cac gcc att ttt caa atc aag ctt ccg acc tcc ttg 290

Ala Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu

80 85 90 95

gac cag ctg cac tgg ctg ccc gtg tca gat gcc aca gct cag ctg gtt 338

Asp Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val

100 105 110

agc ggc agc agc agc ctg ctg cac atc gtc gta gta ttc ttt gtc ctg 386

Ser Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe Val Leu

115 120 125

gag ttc ctg tac aca ggc ctt ttt atc acc acg cat gat gct atg cat 434

Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met His

130 135 140

ggc acc atc gcc atg aga aac agg cag ctt aat gac ttc ttg ggc aga 482

Gly Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg

145 150 155

gta tgc atc tcc ttg tac gcc tgg ttt gat tac aac atg ctg cac cgc 530

Val Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg

160 165 170 175

aag cat tgg gag cac cac aac cac act ggc gag gtg ggc aag gac cct 578

Lys His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp Pro

180 185 190

gac ttc cac agg gga aac cct ggc att gtg ccc tgg ttt gcc agc ttc 626

Asp Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe

195 200 205

atg tcc agc tac atg tcg atg tgg cag ttt gcg cgc ctc gca tgg tgg 674

Met Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp

210 215 220

acg gtg gtc atg cag ctg ctg ggt gcg cca atg gcg aac ctg ctg gtg 722

Thr Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val

225 230 235

ttc atg gcg gcc gcg ccc atc ctg tcc gcc ttc cgc ttg ttc tac ttt 770

Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe

240 245 250 255

ggc acg tac atg ccc cac aag cct gag cct ggc gcc gcg tca ggc tct 818

Gly Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser

260 265 270

tca cca gcc gtc atg aac tgg tgg aag tcg cgc act agc cag gcg tcc 866

Ser Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser

275 280 285

gac ctg gtc agc ttt ctg acc tgc tac cac ttc gac ctg cac tgg gag 914

Asp Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu

290 295 300

cac cac cgc tgg ccc ttt gcc ccc tgg tgg gag ctg ccc aac tgc cgc 962

His His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg

305 310 315

cgc ctg tct ggc cga ggt ctg gtt cct gcc tag ctggacacac tgcagtgggc 1015

Arg Leu Ser Gly Arg Gly Leu Val Pro Ala

320 325

cctgctgcca gctgggcatg caggttgtgg caggactggg tgaggtgaaa agctgcaggc 1075

gctgctgccg gacacgctgc atgggctacc ctgtgtagct gccgccacta ggggaggggg 1135

tttgtagctg tcgagcttgc 1155

<210>23

<211>329

<212>PRT

＜213〉haematococcus pluvialis

<400>23

Met Gln Leu Ala Ala Thr Val Met Leu Glu Gln Leu Thr Gly Ser Ala

1 5 10 15

Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp Val

20 25 30

Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser Asp

35 40 45

Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser Asp

50 55 60

Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser Trp Ala Ala

65 70 75 80

Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu Asp

85 90 95

Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val Ser

100 105 110

Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe Val Leu Glu

115 120 125

Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met His Gly

130 135 140

Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg Val

145 150 155 160

Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg Lys

165 170 175

His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp Pro Asp

180 185 190

Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe Met

195 200 205

Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp Thr

210 215 220

Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val Phe

225 230 235 240

Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe Gly

245 250 255

Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser Ser

260 265 270

Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser Asp

275 280 285

Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu His

290 295 300

His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg Arg

305 310 315 320

Leu Ser Gly Arg Gly Leu Val Pro Ala

325

<210>24

<211>1111

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(4)..(951)

<223>

<400>24

tgc atg cta gag gca ctc aag gag aag gag aag gag gtt gca ggc agc 48

Met Leu Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser

1 5 10 15

tct gac gtg ttg cgt aca tgg gcg acc cag tac tcg ctt ccg tca gaa 96

Ser Asp Val Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu

20 25 30

gag tca gac gcg gcc cgc ccg gga ctg aag aat gcc tac aag cca cca 144

Glu Ser Asp Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro

35 40 45

cct tcc gac aca aag ggc atc aca atg gcg cta gct gtc atc ggc tcc 192

Pro Ser Asp Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser

50 55 60

tgg gcc gca gtg ttc ctc cac gcc att ttt caa atc aag ctt ccg acc 240

Trp Ala Ala Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr

65 70 75

tcc ttg gac cag ctg cac tgg ctg ccc gtg tca gat gcc aca gct cag 288

Ser Leu Asp Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln

80 85 90 95

ctg gtt agc ggc agc agc agc ctg ctg cac atc gtc gta gta ttc ttt 336

Leu Val Ser Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe

100 105 110

gtc ctg gag ttc ctg tac aca ggc ctt ttt atc acc acg cat gat gct 384

Val Leu Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala

115 120 125

atg cat ggc acc atc gcc atg aga aac agg cag ctt aat gac ttc ttg 432

Met His Gly Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu

130 135 140

ggc aga gta tgc atc tcc ttg tac gcc tgg ttt gat tac aac atg ctg 480

Gly Arg Val Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu

145 150 155

cac cgc aag cat tgg gag cac cac aac cac act ggc gag gtg ggc aag 528

His Arg Lys His Trp Glu His His Ash His Thr Gly Glu Val Gly Lys

160 165 170 175

gac cct gac ttc cac agg gga aac cct ggc att gtg ccc tgg ttt gcc 576

Asp Pro Asp Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala

180 185 190

agc ttc atg tcc agc tac atg tcg atg tgg cag ttt gcg cgc ctc gca 624

Ser Phe Met Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala

195 200 205

tgg tgg acg gtg gtc atg cag ctg ctg ggt gcg cca atg gcg aac ctg 672

Trp Trp Thr Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu

210 215 220

ctg gtg ttc atg gcg gcc gcg ccc atc ctg tcc gcc ttc cgc ttg ttc 720

Leu Val Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe

225 230 235

tac ttt ggc acg tac atg ccc cac aag cct gag cct ggc gcc gcg tca 768

Tyr Phe Gly Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser

240 245 250 255

ggc tct tca cca gcc gtc atg aac tgg tgg aag tcg cgc act agc cag 816

Gly Ser Ser Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln

260 265 270

gcg tcc gac ctg gtc agc ttt ctg acc tgc tac cac ttc gac ctg cac 864

Ala Ser Asp Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His

275 280 285

tgg gag cac cac cgc tgg ccc ttc gcc ccc tgg tgg gag ctg ccc aac 912

Trp Glu His His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn

290 295 300

tgc cgc cgc ctg tct ggc cga ggt ctg gtt cct gcc tag ctggacacac 961

Cys Arg Arg Leu Ser Gly Arg Gly Leu Val Pro Ala

305 310 315

tgcagtgggc cctgctgcca gctgggcatg caggttgtgg caggactggg tgaggtgaaa 1021

agctgcaggc gctgctgccg gacacgttgc atgggctacc ctgtgtagct gccgccacta 1081

ggggaggggg tttgtagctg tcgagcttgc 1111

<210>25

<211>315

<212>PRT

＜213〉haematococcus pluvialis

<400>25

Met Leu Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser

1 5 10 15

Asp Val Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu

20 25 30

Ser Asp Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro

35 40 45

Ser Asp Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser Trp

50 55 60

Ala Ala Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser

65 70 75 80

Leu Asp Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu

85 90 95

Val Ser Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe Val

100 105 110

Leu Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met

115 120 125

His Gly Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly

130 135 140

Arg Val Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His

145 150 155 160

Arg Lys His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp

165 170 175

Pro Asp Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser

180 185 190

Phe Met Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp

195 200 205

Trp Thr Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu

210 215 220

Val Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr

225 230 235 240

Phe Gly Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly

245 250 255

Ser Ser Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala

260 265 270

Ser Asp Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp

275 280 285

Glu His His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys

290 295 300

Arg Arg Leu Ser Gly Arg Gly Leu Val Pro Ala

305 310 315

<210>26

<211>1031

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(6)..(1031)

<223>

<400>26

gaagc atg cag cta gca gcg aca gta atg ttg gag cag ctt acc gga agc 50

Met Gln Leu Ala Ala Thr Val Met Leu Glu Gln Leu Thr Gly Ser

1 5 10 15

gct gag gca ctc aag gag aag gag aag gag gtt gca ggc agc tct gac 98

Ala Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp

20 25 30

gtg ttg cgt aca tgg gcg acc cag tac tcg ctt ccg tca gag gag tca 146

Val Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser

35 40 45

gac gcg gcc cgc ccg gga ctg aag aat gcc tac aag cca cca cct tcc 194

Asp Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser

50 55 60

gac aca aag ggc atc aca atg gcg cta gct gtc atc ggc tcc tgg gct 242

Asp Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser Trp Ala

65 70 75

gca gtg ttc ctc cac gcc att ttt caa atc aag ctt ccg acc tcc ttg 290

Ala Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu

80 85 90 95

gac cag ctg cac tgg ctg ccc gtg tca gat gcc aca gct cag ctg gtt 338

Asp Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val

100 105 110

agc ggc agc agc agc ctg ctg cac atc gtc gta gta ttc ttt gtc ctg 386

Ser Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe Val Leu

115 120 125

gag ttc ctg tac aca ggc ctt ttt atc acc acg cat gat gct atg cat 434

Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met His

130 135 140

ggc acc atc gcc atg aga aac agg cag ctt aat gac ttc ttg ggc aga 482

Gly Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg

145 150 155

gta tgc atc tcc ttg tac gcc tgg ttt gat tac aac atg ctg cac cgc 530

Val Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg

160 165 170 175

aag cat tgg gag cac cac aac cac act ggc gag gtg ggc aag gac cct 578

Lys His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp Pro

180 185 190

gac ttc cac agg gga aac cct ggc att gtg ccc tgg ttt gcc agc ttc 626

Asp Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe

195 200 205

atg tcc agc tac atg tcg atg tgg cag ttt gcg cgc ctc gca tgg tgg 674

Met Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp

210 215 220

acg gtg gtc atg cag ctg ctg ggt gcg cca atg gcg aac ctg ctg gtg 722

Thr Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val

225 230 235

ttc atg gcg gcc gcg ccc atc ctg tcc gcc ttc cgc ttg ttc tac ttt 770

Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe

240 245 250 255

ggc acg tac atg ccc cac aag cct gag cct ggc gcc gcg tca ggc tct 818

Gly Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser

260 265 270

tca cca gcc gtc atg aac tgg tgg aag tcg cgc act agc cag gcg tcc 866

Ser Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser

275 280 285

gac ctg gtc agc ttt ctg acc tgc tac cac ttc gac ctg cac tgg gag 914

Asp Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu

290 295 300

cac cac cgc tgg ccc ttt gcc ccc tgg tgg gag ctg ccc aac tgc cgc 962

His His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg

305 310 315

cgc ctg tct ggc cga ggt ctg gtt cct gcc gag caa aaa ctc atc tca 1010

Arg Leu Ser Gly Arg Gly Leu Val Pro Ala Glu Gln Lys Leu Ile Ser

320 325 330 335

gaa gag gat ctg aat agc tag 1031

Glu Glu Asp Leu Asn Ser

340

<210>27

<211>341

<212>PRT

＜213〉haematococcus pluvialis

<400>27

Met Gln Leu Ala Ala Thr Val Met Leu Glu Gln Leu Thr Gly Ser Ala

1 5 10 15

Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp Val

20 25 30

Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser Asp

35 40 45

Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser Asp

50 55 60

Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser Trp Ala Ala

65 70 75 80

Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu Asp

85 90 95

Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val Ser

100 105 110

Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe Val Leu Glu

115 120 125

Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met His Gly

130 135 140

Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg Val

145 150 155 160

Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg Lys

165 170 175

His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp Pro Asp

180 185 190

Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe Met

195 200 205

Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp Thr

210 215 220

Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val Phe

225 230 235 240

Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe Gly

245 250 255

Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser Ser

260 265 270

Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser Asp

275 280 285

Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu His

290 295 300

His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg Arg

305 310 315 320

Leu Ser Gly Arg Gly Leu Val Pro Ala Glu Gln Lys Leu Ile Ser Glu

325 330 335

Glu Asp Leu Asn Ser

340

<210>28

<211>777

<212>DNA

＜213〉mouseearcress (Arabidopsis thaliana)

<220>

＜221〉promoter

<222>(1)..(777)

<223>

<400>28

gagctcactc actgatttcc attgcttgaa aattgatgat gaactaagat caatccatgt 60

tagtttcaaa acaacagtaa ctgtggccaa cttagttttg aaacaacact aactggtcga 120

agcaaaaaga aaaaagagtt tcatcatata tctgatttga tggactgttt ggagttagga 180

ccaaacatta tctacaaaca aagacttttc tcctaacttg tgattccttc ttaaacccta 240

ggggtaatat tctattttcc aaggatcttt agttaaaggc aaatccggga aattattgta 300

atcatttggg gaaacatata aaagatttga gttagatgga agtgacgatt aatccaaaca 360

tatatatctc tttcttctta tttcccaaat taacagacaa aagtagaata ttggctttta 420

acaccaatat aaaaacttgc ttcacaccta aacacttttg tttactttag ggtaagtgca 480

aaaagccaac caaatccacc tgcactgatt tgacgtttac aaacgccgtt aagtcgatgt 540

ccgttgattt aaacagtgtc ttgtaattaa aaaaatcagt ttacataaat ggaaaattta 600

tcacttagtt ttcatcaact tctgaactta cctttcatgg attaggcaat actttccatt 660

tttagtaact caagtggacc ctttacttct tcaactccat ctctctcttt ctatttcact 720

tctttcttct cattatatct cttgtcctct ccaccaaatc tcttcaacaa aaagctt 777

<210>29

<211>22

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(22)

<223>

<400>29

gcaagctcga cagctacaaa cc 22

<210>30

<211>24

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(24)

<223>

<400>30

gaagcatgca gctagcagcg acag 24

<210>31

<211>30

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(30)

<223>

<400>31

tgcatgctag aggcactcaa ggagaaggag 30

<210>32

<211>59

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(59)

<223>

<400>32

ctagctattc agatcctctt ctgagatgag tttttgctcg gcaggaacca gacctcggc 59

<210>33

<211>28

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(28)

<223>

<400>33

gagctcactc actgatttcc attgcttg 28

<210>34

<211>37

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(37)

<223>

<400>34

cgccgttaag tcgatgtccg ttgatttaaa cagtgtc 37

<210>35

<211>34

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(34)

<223>

<400>35

atcaacggac atcgacttaa cggcgtttgt aaac 34

<210>36

<211>25

<212>DNA

＜213〉synthesize

<220>

＜221〉primer _ combination

<222>(1)..(25)

<223>

<400>36

taagcttttt gttgaagaga tttgg 25

<210>37

<211>212

<212>DNA

＜213〉composition sequence

<220>

＜221〉introne

<222>(1)..(212)

<223>

<400>37

gtcgactacg taagtttctg cttctacctt tgatatatat ataataatta tcattaatta 60

gtagtaatat aatatttcaa atattttttt caaaataaaa gaatgtagta tatagcaatt 120

gcttttctgt agtttataag tgtgtatatt ttaatttata acttttctaa tatatgacca 180

aaatttgttg atgtgcaggt atcaccggat cc 212

<210>38

<211>1830

<212>DNA

＜213〉marigold (Tagetes erecta)

<220>

<221>CDS

<222>(141)..(1691)

<223>

<400>38

ggcacgaggc aaagcaaagg ttgtttgttg ttgttgttga gagacactcc aatccaaaca 60

gatacaaggc gtgactggat atttctctct cgttcctaac aacagcaacg aagaagaaaa 120

agaatcatta ctaacaatca atg agt atg aga gct gga cac atg acg gca aca 173

Met Ser Met Arg Ala Gly His Met Thr Ala Thr

1 5 10

atg gcg gct ttt aca tgc cct agg ttt atg act agc atc aga tac acg 221

Met Ala Ala Phe Thr Cys Pro Arg Phe Met Thr Ser Ile Arg Tyr Thr

15 20 25

aag caa att aag tgc aac gct gct aaa agc cag cta gtc gtt aaa caa 269

Lys Gln Ile Lys Cys Asn Ala Ala Lys Ser Gln Leu Val Val Lys Gln

30 35 40

gag att gag gag gaa gaa gat tat gtg aaa gcc ggt gga tcg gag ctg 317

Glu Ile Glu Glu Glu Glu Asp Tyr Val Lys Ala Gly Gly Ser Glu Leu

45 50 55

ctt ttt gtt caa atg caa cag aat aag tcc atg gat gca cag tct agc 365

Leu Phe Val Gln Met Gln Gln Asn Lys Ser Met Asp Ala Gln Ser Ser

60 65 70 75

cta tcc caa aag ctc cca agg gta cca ata gga gga gga gga gac agt 413

Leu Ser Gln Lys Leu Pro Arg Val Pro Ile Gly Gly Gly Gly Asp Ser

80 85 90

aac tgt ata ctg gat ttg gtt gta att ggt tgt ggt cct gct ggc ctt 461

Asn Cys Ile Leu Asp Leu Val Val Ile Gly Cys Gly Pro Ala Gly Leu

95 100 105

gct ctt gct gga gaa tca gcc aag cta ggc ttg aat gtc gca ctt atc 509

Ala Leu Ala Gly Glu Ser Ala Lys Leu Gly Leu Asn Val Ala Leu Ile

110 115 120

ggc cct gat ctt cct ttt aca aat aac tat ggt gtt tgg gag gat gaa 557

Gly Pro Asp Leu Pro Phe Thr Asn Asn Tyr Gly Val Trp Glu Asp Glu

125 130 135

ttt ata ggt ctt gga ctt gag ggc tgt att gaa cat gtt tgg cga gat 605

Phe Ile Gly Leu Gly Leu Glu Gly Cys Ile Glu His Val Trp Arg Asp

140 145 150 155

act gta gta tat ctt gat gac aac gat ccc att ctc ata ggt cgt gcc 653

Thr Val Val Tyr Leu Asp Asp Asn Asp Pro Ile Leu Ile Gly Arg Ala

160 165 170

tat gga cga gtt agt cgt gat tta ctt cac gag gag ttg ttg act agg 701

Tyr Gly Arg Val Ser Arg Asp Leu Leu His Glu Glu Leu Leu Thr Arg

175 180 185

tgc atg gag tca ggc gtt tca tat ctg agc tcc aaa gtg gaa cgg att 749

Cys Met Glu Ser Gly Val Ser Tyr Leu Ser Ser Lys Val Glu Arg Ile

190 195 200

act gaa gct cca aat ggc cta agt ctc ata gag tgt gaa ggc aat atc 797

Thr Glu Ala Pro Asn Gly Leu Ser Leu Ile Glu Cys Glu Gly Asn Ile

205 210 215

aca att cca tgc agg ctt gct act gtc gct tct gga gca gct tct gga 845

Thr Ile Pro Cys Arg Leu Ala Thr Val Ala Ser Gly Ala Ala Ser Gly

220 225 230 235

aaa ctt ttg cag tat gaa ctt ggc ggt ccc cgt gtt tgc gtt caa aca 893

Lys Leu Leu Gln Tyr Glu Leu Gly Gly Pro Arg Val Cys Val Gln Thr

240 245 250

gct tat ggt ata gag gtt gag gtt gaa agc ata ccc tat gat cca agc 941

Ala Tyr Gly Ile Glu Val Glu Val Glu Ser Ile Pro Tyr Asp Pro Ser

255 260 265

cta atg gtt ttc atg gat tat aga gac tac acc aaa cat aaa tct caa 989

Leu Met Val Phe Met Asp Tyr Arg Asp Tyr Thr Lys His Lys Ser Gln

270 275 280

tca cta gaa gca caa tat cca aca ttt ttg tat gtc atg cca atg tct 1037

Ser Leu Glu Ala Gln Tyr Pro Thr Phe Leu Tyr Val Met Pro Met Ser

285 290 295

cca act aaa gta ttc ttt gag gaa act tgt ttg gct tca aaa gag gcc 1085

Pro Thr Lys Val Phe Phe Glu Glu Thr Cys Leu Ala Ser Lys Glu Ala

300 305 310 315

atg cct ttt gag tta ttg aag aca aaa ctc atg tca aga tta aag act 1133

Met Pro Phe Glu Leu Leu Lys Thr Lys Leu Met Ser Arg Leu Lys Thr

320 325 330

atg ggg atc cga ata acc aaa act tat gaa gag gaa tgg tca tat att 1181

Met Gly Ile Arg Ile Thr Lys Thr Tyr Glu Glu Glu Trp Ser Tyr Ile

335 340 345

cca gta ggt gga tcc tta cca aat acc gag caa aag aac ctt gca ttt 1229

Pro Val Gly Gly Ser Leu Pro Asn Thr Glu Gln Lys Asn Leu Ala Phe

350 355 360

ggt gct gct gct agc atg gtg cat cca gcc aca gga tat tcg gtt gta 1277

Gly Ala Ala Ala Ser Met Val His Pro Ala Thr Gly Tyr Ser Val Val

365 370 375

aga tca ctg tca gaa gct cct aat tat gca gca gta att gca aag att 1325

Arg Ser Leu Ser Glu Ala Pro Asn Tyr Ala Ala Val Ile Ala Lys Ile

380 385 390 395

tta ggg aaa gga aat tca aaa cag atg ctt gat cat gga aga tac aca 1373

Leu Gly Lys Gly Asn Ser Lys Gln Met Leu Asp His Gly Arg Tyr Thr

400 405 410

acc aac atc tca aag caa gct tgg gaa aca ctt tgg ccc ctt gaa agg 1421

Thr Asn Ile Ser Lys Gln Ala Trp Glu Thr Leu Trp Pro Leu Glu Arg

415 420 425

aaa aga cag aga gca ttc ttt ctc ttt gga tta gca ctg att gtc cag 1469

Lys Arg Gln Arg Ala Phe Phe Leu Phe Gly Leu Ala Leu Ile Val Gln

430 435 440

atg gat att gag ggg acc cgc aca ttc ttc cgg act ttc ttc cgc ttg 1517

Met Asp Ile Glu Gly Thr Arg Thr Phe Phe Arg Thr Phe Phe Arg Leu

445 450 455

ccc aca tgg atg tgg tgg ggg ttt ctt gga tct tcg tta tca tca act 1565

Pro Thr Trp Met Trp Trp Gly Phe Leu Gly Set Ser Leu Ser Ser Thr

460 465 470 475

gac ttg ata ata ttt gcg ttt tac atg ttt atc ata gca ccg cat agc 1613

Asp Leu Ile Ile Phe Ala Phe Tyr Met Phe Ile Ile Ala Pro His Ser

480 485 490

ctg aga atg ggt ctg gtt aga cat ttg ctt tct gac ccg aca gga gga 1661

Leu Arg Met Gly Leu Val Arg His Leu Leu Ser Asp Pro Thr Gly Gly

495 500 505

aca atg tta aaa gcg tat ctc acg ata taa ataactctag tcgcgatcag 1711

Thr Met Leu Lys Ala Tyr Leu Thr Ile

510 515

tttagattat aggcacatct tgcatatata tatgtataaa ccttatgtgt gctgtatcct 1771

tacatcaaca cagtcattaa ttgtatttct tggggtaatg ctgatgaagt attttctgg 1830

<210>39

<211>516

<212>PRT

＜213〉marigold

<400>39

Met Ser Met Arg Ala Gly His Met Thr Ala Thr Met Ala Ala Phe Thr

1 5 10 15

Cys Pro Arg Phe Met Thr Ser Ile Arg Tyr Thr Lys Gln Ile Lys Cys

20 25 30

Asn Ala Ala Lys Ser Gln Leu Val Val Lys Gln Glu Ile Glu Glu Glu

35 40 45

Glu Asp Tyr Val Lys Ala Gly Gly Ser Glu Leu Leu Phe Val Gln Met

50 55 60

Gln Gln Asn Lys Ser Met Asp Ala Gln Ser Ser Leu Ser Gln Lys Leu

65 70 75 80

Pro Arg Val Pro Ile Gly Gly Gly Gly Asp Ser Asn Cys Ile Leu Asp

85 90 95

Leu Val Val Ile Gly Cys Gly Pro Ala Gly Leu Ala Leu Ala Gly Glu

100 105 110

Ser Ala Lys Leu Gly Leu Asn Val Ala Leu Ile Gly Pro Asp Leu Pro

115 120 125

Phe Thr Asn Asn Tyr Gly Val Trp Glu Asp Glu Phe Ile Gly Leu Gly

130 135 140

Leu Glu Gly Cys Ile Glu His Val Trp Arg Asp Thr Val Val Tyr Leu

145 150 155 160

Asp Asp Asn Asp Pro Ile Leu Ile Gly Arg Ala Tyr Gly Arg Val Ser

165 170 175

Arg Asp Leu Leu His Glu Glu Leu Leu Thr Arg Cys Met Glu Ser Gly

180 185 190

Val Ser Tyr Leu Ser Ser Lys Val Glu Arg Ile Thr Glu Ala Pro Asn

195 200 205

Gly Leu Ser Leu Ile Glu Cys Glu Gly Asn Ile Thr Ile Pro Cys Arg

210 215 220

Leu Ala Thr Val Ala Ser Gly Ala Ala Ser Gly Lys Leu Leu Gln Tyr

225 230 235 240

Glu Leu Gly Gly Pro Arg Val Cys Val Gln Thr Ala Tyr Gly Ile Glu

245 250 255

Val Glu Val Glu Ser Ile Pro Tyr Asp Pro Ser Leu Met Val Phe Met

260 265 270

Asp Tyr Arg Asp Tyr Thr Lys His Lys Ser Gln Ser Leu Glu Ala Gln

275 280 285

Tyr Pro Thr Phe Leu Tyr Val Met Pro Met Ser Pro Thr Lys Val Phe

290 295 300

Phe Glu Glu Thr Cys Leu Ala Ser Lys Glu Ala Met Pro Phe Glu Leu

305 310 315 320

Leu Lys Thr Lys Leu Met Ser Arg Leu Lys Thr Met Gly Ile Arg Ile

325 330 335

Thr Lys Thr Tyr Glu Glu Glu Trp Ser Tyr Ile Pro Val Gly Gly Ser

340 345 350

Leu Pro Asn Thr Glu Gln Lys Asn Leu Ala Phe Gly Ala Ala Ala Ser

355 360 365

Met Val His Pro Ala Thr Gly Tyr Ser Val Val Arg Ser Leu Ser Glu

370 375 380

Ala Pro Asn Tyr Ala Ala Val Ile Ala Lys Ile Leu Gly Lys Gly Asn

385 390 395 400

Ser Lys Gln Met Leu Asp His Gly Arg Tyr Thr Thr Asn Ile Ser Lys

405 410 415

Gln Ala Trp Glu Thr Leu Trp Pro Leu Glu Arg Lys Arg Gln Arg Ala

420 425 430

Phe Phe Leu Phe Gly Leu Ala Leu Ile Val Gln Met Asp Ile Glu Gly

435 440 445

Thr Arg Thr Phe Phe Arg Thr Phe Phe Arg Leu Pro Thr Trp Met Trp

450 455 460

Trp Gly Phe Leu Gly Ser Ser Leu Ser Ser Thr Asp Leu Ile Ile Phe

465 470 475 480

Ala Phe Tyr Met Phe Ile Ile Ala Pro His Ser Leu Arg Met Gly Leu

485 490 495

Val Arg His Leu Leu Ser Asp Pro Thr Gly Gly Thr Met Leu Lys Ala

500 505 510

Tyr Leu Thr Ile

515

<210>40

<211>445

<212>DNA

＜213〉marigold

<220>

＜221〉have a mind to fragment

<222>(1)..(4 45)

<223>

<400>40

aagcttgcac gaggcaaagc aaaggttgtt tgttgttgtt gttgagagac actccaatcc 60

aaacagatac aaggcgtgac tggatatttc tctctcgttc ctaacaacag caacgaagaa 120

gaaaaagaat cattactaac aatcaatgag tatgagagct ggacacatga cggcaacaat 180

ggcggctttt acatgcccta ggtttatgac tagcatcaga tacacgaagc aaattaagtg 240

caacgctgct aaaagccagc tagtcgttaa acaagagatt gaggaggaag aagattatgt 300

gaaagccggt ggatcggagc tgctttttgt tcaaatgcaa cagaataagt ccatggatgc 360

acagtctagc ctatcccaaa agctcccaag ggtaccaata ggaggaggag gagacagtaa 420

ctgtatactg gatttggttg tcgac 445

<210>41

<211>446

<212>DNA

＜213〉marigold

<220>

＜221〉antisense fragment

<222>(1).(446)

<223>

<400>41

gaattcgcac gaggcaaagc aaaggttgtt tgttgttgtt gttgagagac actccaatcc 60

aaacagatac aaggcgtgac tggatatttc tctctcgttc ctaacaacag caacgaagaa 120

gaaaaagaat cattactaac aatcaatgag tatgagagct ggacacatga cggcaacaat 180

ggcggctttt acatgcccta ggtttatgac tagcatcaga tacacgaagc aaattaagtg 240

caacgctgct aaaagccagc tagtcgttaa acaagagatt gaggaggaag aagattatgt 300

gaaagccggt ggatcggagc tgctttttgt tcaaatgcaa cagaataagt ccatggatgc 360

acagtctagc ctatcccaaa agctcccaag ggtaccaata ggaggaggag gagacagtaa 420

ctgtatactg gatttggttg gatcct 446

<210>42

<211>393

<212>DNA

＜213〉marigold

<220>

＜221〉have a mind to fragment

<222>(1)..(393)

<223>

<400>42

aagctttgga ttagcactga ttgtccagat ggatattgag gggacccgca cattcttccg 60

gactttcttc cgcttgccca catggatgtg gtgggggttt cttggatctt cgttatcatc 120

aactgacttg ataatatttg cgttttacat gtttatcata gcaccgcata gcctgagaat 180

gggtctggtt agacatttgc tttctgaccc gacaggagga acaatgttaa aagcgtatct 240

cacgatataa ataactctag tcgcgatcag tttagattat aggcacatct tgcatatata 300

tatgtataaa ccttatgtgt gctgtatcct tacatcaaca cagtcattaa ttgtatttct 360

tggggtaatg ctgatgaagt attttctgtc gac 393

<210>43

<211>397

<212>DNA

＜213〉marigold

<220>

＜221〉antisense fragment

<222>(1)..(397)

<223>

<400>43

gaattctctt tggattagca ctgattgtcc agatggatat tgaggggacc cgcacattct 60

tccggacttt cttccgcttg cccacatgga tgtggtgggg gtttcttgga tcttcgttat 120

catcaactga cttgataata tttgcgtttt acatgtttat catagcaccg catagcctga 180

gaatgggtct ggttagacat ttgctttctg acccgacagg aggaacaatg ttaaaagcgt 240

atctcacgat ataaataact ctagtcgcga tcagtttaga ttataggcac atcttgcata 300

tatatatgta taaaccttat gtgtgctgta tccttacatc aacacagtca ttaattgtat 360

ttcttggggt aatgctgatg aagtattttc tggatcc 397

<210>44

<211>1537

<212>DNA

<213>-

<220>

＜221〉promoter

<222>(1)..(1537)

<223>

<400>44

gagctctaca aattagggtt actttattca ttttcatcca ttctctttat tgttaaattt 60

tgtacattta ttcaataata ttatatgttt attacaaatt ctcactttct tattcatacc 120

tattcactca agcctttacc atcttccttt tctatttcaa tactatttct acttcatttt 180

tcacgttttt aacatctttc tttatttctt gtccacttcg tttagggatg cctaatgtcc 240

caaatttcat ctctcgtagt aacacaaaac caatgtaatg ctacttctct ctacattttt 300

aatacaaata aagtgaaaca aaatatctat aaataaacaa atatatatat tttgttagac 360

gctgtctcaa cccatcaatt aaaaaatttt gttatatttc tactttacct actaaatttg 420

tttctcatat ttacctttta acccccacaa aaaaaaatta taaaaaagaa agaaaaaagc 480

taaaccctat ttaaatagct aactataaga tcttaaaatt atcctcatca gtgtatagtt 540

taattggtta ttaacttata acattatata tctatgacat atactctcte ctagctattt 600

ctcacatttt ttaacttaag aaaatagtca taacatagtc taaaattcaa acatccacat 660

gctctaattt gattaacaaa aagttagaaa tatttattta aataaaaaag actaataaat 720

atataaaatg aatgttcata cgcagaccca tttagagatg agtatgcttt cacatgctga 780

gattattttc aaaactaagg ttgtagcaat attaaatcaa taaaattatt ataaataaca 840

aaattaacct gctcgtgttt gctgtatatg ggaggctaca aaataaatta aactaaagat 900

gattatgttt tagacatttt ttctatctgt attagtttat acatattaat tcaggagctg 960

cacaacccaa ttctattttc gttccttggt ggctgggttt ctcacaaggt tcaatagtca 1020

atattaggtt ttattggact tttaetagta tcaaacaaat ctatgtgtga acttaaaaat 1080

tgtattaaat atttagggta acctgttgcc gtttttagaa taatgtttct tcttaataca 1140

cgaaagcgta ttgtgtattc attcatttgg cgcctcacat gcttcggttg gctcgcttta 1200

gtctctgcct tctttgtata ttgtactccc cctcttccta tgccacgtgt tctgagctta 1260

acaagccacg ttgcgtgcca ttgccaaaca agtcatttta acttcacaag gtccgatttg 1320

acctccaaaa caacgacaag tttccgaaca gtcgcgaaga tcaagggtat aatcgtcttt 1380

ttgaattcta tttctcttta tttaatagtc cctctcgtgt gatagttttt aaaagatttt 1440

taaaacgtag ctgctgttta agtaaatccc agtccttcag tttgtgcttt tgtgtgtttt 1500

gtttctctga tttacggaat ttggaaataa taagctt 1537

<210>45

<211>734

<212>DNA

＜213〉composition sequence

<220>

＜221〉variation

<222>(1)..(734)

<223>

<400>45

ctaacaatca atgagtagag agctggacac atgacggcaa caatggcggc ttttacatgc 60

cctaggttta tgactagcat cagatacacg aagcaaatta agtgcaacgc tgctaaaagc 120

cagctagtcg ttaaacaaga gattgaggag gaagaagatt atgtgaaagc cggtggatcg 180

gagctgcttt ttgttcaaat gcaacagaat aagtccatgg atgcacagtc tagcctatcc 240

caaaaggtca ctccagactt aattgcttat aaataaataa atatgttttt taggaataat 300

gatatttaga tagattagct atcacctgtg ctgtggtgtg cagctcccaa gggtcttacc 360

gatagtaaaa tcgttagtta tgattaatac ttgggaggtg ggggattata ggctttgttg 420

tgagaatgtt gagaaagagg tttgacaaat cggtgtttga atgaggttaa atggagttta 480

attaaaataa agagaagaga aagattaaga gggtgatggg gatattaaag acggscaata 540

tagtgatgcc acgtagaaaa aggtaagtga aaacatacaa cgtggcttta aaagatggct 600

tggctgctaa tcaactcaac tcaactcata tcctatccat tcaaattcaa ttcaattcta 660

ttgaatgcaa agcaaagcaa aggttgtttg ttgttgttgt tgagagacac tccaatccaa 720

acagatacaa ggcg 734

<210>46

<211>280

<212>DNA

＜213〉composition sequence

<220>

＜221〉variation

<222>(1)..(280)

<223>

<400>46

gtcgagtatg gagttcaatt aaaataaaga gaagaraaag attaagaggg tgatggggat 60

attaaagacg gccaatrtag tgatgccacg taagaaaaag gtaagtgaaa acatacaacg 120

tggctttaaa agatggcttg gctgctaatc aactcaactc aactcatatc ctatccattc 180

aaattcaatt caattctatt gaatgcaaag caaagcaaag caaaggttgt ttgttgttgt 240

tgttgagaga cactccaatc caaacagata caaggcgtga 280

<210>47

<211>358

<212>DNA

＜213〉marigold

<220>

＜221〉have a mind to promoter

<222>(1)..(358)

<223>

<400>47

aagcttaccg atagtaaaat cgttagttat gattaatact tgggaggtgg gggattatag 60

gctttgttgt gagaatgttg agaaagaggt ttgacaaatc ggtgtttgaa tgaggttaaa 120

tggagtttaa ttaaaataaa gagaagagaa agattaagag ggtgatgggg atattaaaga 180

cggccaatat agtgatgcca cgtagaaaaa ggtaagtgaa aacatacaac gtggctttaa 240

aagatggctt ggctgctaat caactcaact caactcatat cctatccatt caaattcaat 300

tcaattctat tgaatgcaaa gcaaagcaaa gcaaaggttg tttgttgttg ttgtcgac 358

<210>48

<211>361

<212>DNA

＜213〉marigold

<220>

＜221〉antisense promoter

<222>(1)..(361)

<223>

<400>48

ctcgagctta ccgatagtaa aatcgttagt tatgattaat acttgggagg tgggggatta 60

taggctttgt tgtgagaatg ttgagaaaga ggtttgacaa ateggtgttt gaatgaggtt 120

aaatggagtt taattaaaat aaagagaaga gaaagattaa gagggtgatg gggatattaa 180

agacggccaa tatagtgatg ccacgtagaa aaaggtaagt gaaaacatac aacgtggctt 240

taaaagatgg cttggctgct aatcaactca actcaactca tatcctatcc attcaaattc 300

aattcaattc tattgaatgc aaagcaaagc aaagcaaagg ttgtttgttg ttgttggatc 360

c 361

<210>49

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>49

gagctcactc actgatttcc attgcttg 28

<210>50

<211>37

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(37)

<223>

<400>50

cgccgttaag tcgatgtccg ttgatttaaa cagtgtc 37

<210>51

<211>34

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(34)

<223>

<400>51

atcaacggac atcgacttaa cggcgtttgt aaac 34

<210>52

<211>25

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(25)

<223>

<400>52

taagcttttt gttgaagaga tttgg 25

<210>53

<211>23

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(23)

<223>

<400>53

gaaaatactt catcagcatt acc 23

<210>54

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>54

gtcgactacg taagtttctg cttctacc 28

<210>55

<211>26

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(26)

<223>

<400>55

ggatccggtg atacctgcac atcaac 26

<210>56

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>56

aagcttgcac gaggcaaagc aaaggttg 28

<210>57

<211>29

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(29)

<223>

<400>57

gtcgacaacc aaatccagta tacagttac 29

<210>58

<211>30

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(30)

<223>

<400>58

aggatccaac caaatccagt atacagttac 30

<210>59

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>59

gaattcgcac gaggcaaagc aaaggttg 28

<210>60

<211>25

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(25)

<223>

<400>60

aagctttgga ttagcactga ttgtc 25

<210>61

<211>29

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(29)

<223>

<400>61

gtcgacagaa aatacttcat cagcattac 29

<210>62

<211>29

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(29)

<223>

<400>62

ggatccagaa aatacttcat cagcattac 29

<210>63

<211>27

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(27)

<223>

<400>63

gaattctctt tggattagea ctgattg 27

<210>64

<211>23

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(23)

<223>

<400>64

cgccttgtat ctgtttggat tgg 23

<210>65

<211>24

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(24)

<223>

<400>65

ctaacaatca atgagtatga gagc 24

<210>66

<211>26

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(26)

<223>

<400>66

agagcaaggc cagcaggacc acaacc 26

<210>67

<211>26

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(26)

<223>

<400>67

ccttgggagc ttttgggata ggctag 26

<210>68

<211>26

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(26)

<223>

<400>68

tcacgccttg tatctgtttg gattgg 26

<210>69

<211>15

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(15)

<223>

<400>69

gtcgagtatg gagtt 15

<210>70

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>70

aagcttaccg atagtaaaat cgttagtt 28

<210>71

<211>31

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(31)

<223>

<400>71

ctcgagctta ccgatagtaa aatcgttagt t 31

<210>72

<211>28

<212>DNA

＜213〉composition sequence

<400>72

gtcgacaaca acaacaaaca acctttgc 28

<210>73

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>73

ggatccaaca acaacaaaca acctttgc 28

<210>74

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>74

gtcgactttt tgttgaagag atttggtg 28

<210>75

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(28)

<223>

<400>75

ctcgagactc actgatttcc attgcttg 28

<210>76

<211>22

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(22)

<223>

<400>76

gagctctaca aattagggtt ac 22

<210>77

<211>23

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(23)

<223>

<400>77

aagcttatta tttccaaatt ccg 23

<210>78

<211>50

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer

<222>(1)..(50)

<223>

<400>78

aagctttgca attcatacag aagtgagaaa aatgcagcta gcagcgacag 50

<210>79

<211>1062

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(32)..(1021)

<223>

<400>79

aagctttgca attcatacag aagtgagaaa a atg cag cta gca gcg aca gta 52

Met Gln Leu Ala Ala Thr Val

1 5

atg ttg gag cag ctt acc gga agc gct gag gca ctc aag gag aag gag 100

Met Leu Glu Gln Leu Thr Gly Ser Ala Glu Ala Leu Lys Glu Lys Glu

10 15 20

aag gag gtt gca ggc agc tct gac gtg ttg cgt aca tgg gcg acc cag 148

Lys Glu Val Ala Gly Ser Ser Asp Val Leu Arg Thr Trp Ala Thr Gln

25 30 35

tac tcg ctt ccg tca gag gag tca gac gcg gcc cgc ccg gga ctg aag 196

Tyr Ser Leu Pro Ser Glu Glu Ser Asp Ala Ala Arg Pro Gly Leu Lys

40 45 50 55

aat gcc tac aag cca cca cct tcc gac aca aag ggc atc aca atg gcg 244

Asn Ala Tyr Lys Pro Pro Pro Ser Asp Thr Lys Gly Ile Thr Met Ala

60 65 70

cta gct gtc atc ggc tcc tgg gcc gca gtg ttc ctc cac gcc att ttt 292

Leu Ala Val Ile Gly Ser Trp Ala Ala Val Phe Leu His Ala Ile Phe

75 80 85

caa atc aag ctt ccg acc tcc ttg gac cag ctg cac tgg ctg ccc gtg 340

Gln Ile Lys Leu Pro Thr Ser Leu Asp Gln Leu His Trp Leu Pro Val

90 95 100

tca gat gcc aca gct cag ctg gtt agc ggc agc agc agc ctg ctg cac 388

Ser Asp Ala Thr Ala Gln Leu Val Ser Gly Ser Ser Ser Leu Leu His

105 110 115

atc gtc gta gta ttc ttt gtc ctg gag ttc ctg tac aca ggc ctt ttt 436

Ile Val Val Val Phe Phe Val Leu Glu Phe Leu Tyr Thr Gly Leu Phe

120 125 130 135

atc acc acg cat gat gct atg cat ggc acc atc gcc atg aga aac agg 484

Ile Thr Thr His Asp Ala Met His Gly Thr Ile Ala Met Arg Asn Arg

140 145 150

cag ctt aat gac ttc ttg ggc aga gta tgc atc tcc ttg tac gcc tgg 532

Gln Leu Asn Asp Phe Leu Gly Arg Val Cys Ile Ser Leu Tyr Ala Trp

155 160 165

ttt gat tac aac atg ctg cac cgc aag cat tgg gag cac cac aac cac 580

Phe Asp Tyr Asn Met Leu His Arg Lys His Trp Glu His His Asn His

170 175 180

act ggc gag gtg ggc aag gac cct gac ttc cac agg gga aac cct ggc 628

Thr Gly Glu Val Gly Lys Asp Pro Asp Phe His Arg Gly Asn Pro Gly

185 190 195

att gtg ccc tgg ttt gcc agc ttc atg tcc agc tac atg tcg atg tgg 676

Ile Val Pro Trp Phe Ala Ser Phe Met Ser Ser Tyr Met Ser Met Trp

200 205 210 215

cag ttt gcg cgc ctc gca tgg tgg acg gtg gtc atg cag ctg ctg ggt 724

Gln Phe Ala Arg Leu Ala Trp Trp Thr Val Val Met Gln Leu Leu Gly

220 225 230

gcg cca atg gcg aac ctg ctg gtg ttc atg gcg gcc gcg ccc atc ctg 772

Ala Pro Met Ala Asn Leu Leu Val Phe Met Ala Ala Ala Pro Ile Leu

235 240 245

tcc gcc ttc cgc ttg ttc tac ttt ggc acg tac atg ccc cac aag cct 820

Ser Ala Phe Arg Leu Phe Tyr Phe Gly Thr Tyr Met Pro His Lys Pro

250 255 260

gag cct ggc gcc gcg tca ggc tct tca cca gcc gtc atg aac tgg tgg 868

Glu Pro Gly Ala Ala Ser Gly Ser Ser Pro Ala Val Met Asn Trp Trp

265 270 275

aag tcg cgc act agc cag gcg tcc gac ctg gtc agc ttt ctg acc tgc 916

Lys Ser Arg Thr Ser Gln Ala Ser Asp Leu Val Ser Phe Leu Thr Cys

280 285 290 295

tac cac ttc gac ctg cac tgg gag cac cac cgc tgg ccc ttt gcc ccc 964

Tyr His Phe Asp Leu His Trp Glu His His Arg Trp Pro Phe Ala Pro

300 305 310

tgg tgg gag ctg ccc aac tgc cgc cgc ctg tct ggc cga ggt ctg gtt 1012

Trp Trp Glu Leu Pro Asn Cys Arg Arg Leu Ser Gly Arg Gly Leu Val

315 320 325

cct gcc tag ctggacacac tgcagtgggc cctgctgcca gctgggcatg c 1062

Pro Ala

<210>80

<211>329

<212>PRT

＜213〉haematococcus pluvialis

<400>80

Met Gln Leu Ala Ala Thr ValMet Leu Glu Gln Leu Thr Gly Ser Ala

1 5 10 15

Glu Ala Leu Lys Glu Lys Glu Lys Glu Val Ala Gly Ser Ser Asp Val

20 25 30

Leu Arg Thr Trp Ala Thr Gln Tyr Ser Leu Pro Ser Glu Glu Ser Asp

35 40 45

Ala Ala Arg Pro Gly Leu Lys Asn Ala Tyr Lys Pro Pro Pro Ser Asp

50 55 60

Thr Lys Gly Ile Thr Met Ala Leu Ala Val Ile Gly Ser Trp Ala Ala

65 70 75 80

Val Phe Leu His Ala Ile Phe Gln Ile Lys Leu Pro Thr Ser Leu Asp

85 90 95

Gln Leu His Trp Leu Pro Val Ser Asp Ala Thr Ala Gln Leu Val Ser

100 105 110

Gly Ser Ser Ser Leu Leu His Ile Val Val Val Phe Phe Val Leu Glu

115 120 125

Phe Leu Tyr Thr Gly Leu Phe Ile Thr Thr His Asp Ala Met His Gly

130 135 140

Thr Ile Ala Met Arg Asn Arg Gln Leu Asn Asp Phe Leu Gly Arg Val

145 150 155 160

Cys Ile Ser Leu Tyr Ala Trp Phe Asp Tyr Asn Met Leu His Arg Lys

165 170 175

His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys Asp Pro Asp

180 185 190

Phe His Arg Gly Asn Pro Gly Ile Val Pro Trp Phe Ala Ser Phe Met

195 200 205

Ser Ser Tyr Met Ser Met Trp Gln Phe Ala Arg Leu Ala Trp Trp Thr

210 215 220

Val Val Met Gln Leu Leu Gly Ala Pro Met Ala Asn Leu Leu Val Phe

225 230 235 240

Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe Tyr Phe Gly

245 250 255

Thr Tyr Met Pro His Lys Pro Glu Pro Gly Ala Ala Ser Gly Ser Ser

260 265 270

Pro Ala Val Met Asn Trp Trp Lys Ser Arg Thr Ser Gln Ala Ser Asp

275 280 285

Leu Val Ser Phe Leu Thr Cys Tyr His Phe Asp Leu His Trp Glu His

290 295 300

His Arg Trp Pro Phe Ala Pro Trp Trp Glu Leu Pro Asn Cys Arg Arg

305 310 315 320

Leu Ser Gly Arg Gly Leu Val Pro Ala

325

<210>81

<211>789

<212>DNA

＜213〉some shape beads algae (Nostoc punctiforme)

<220>

<221>CDS

<222>(1)..(789)

<223>

<400>81

ttg aat ttt tgt gat aaa cca gtt agc tat tat gtt gca ata gag caa 48

Leu Asn Phe Cys Asp Lys Pro Val Ser Tyr Tyr Val Ala Ile Glu Gln

1 5 10 15

tta agt gct aaa gaa gat act gtt tgg ggg ctg gtg att gtc ata gta 96

Leu Ser Ala Lys Glu Asp Thr Val Trp Gly Leu Val Ile Val Ile Val

20 25 30

att att agt ctt tgg gta gct agt ttg gct ttt tta cta gct att aat 144

Ile Ile Ser Leu Trp Val Ala Ser Leu Ala Phe Leu Leu Ala Ile Asn

35 40 45

tat gcc aaa gtc cca att tgg ttg ata cct att gca ata gtt tgg caa 192

Tyr Ala Lys Val Pro Ile Trp Leu Ile Pro Ile Ala Ile Val Trp Gln

50 55 60

atg ttc ctt tat aca ggg cta ttt att act gca cat gat gct atg cat 240

Met Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ala His Asp Ala Met His

65 70 75 80

ggg tca gtt tat cgt aaa aat ccc aaa att aat aat ttt atc ggt tca 288

Gly Ser Val Tyr Arg Lys Asn Pro Lys Ile Asn Asn Phe Ile Gly Ser

85 90 95

cta gct gta gcg ctt tac gct gtg ttt cca tat caa cag atg tta aag 336

Leu Ala Val Ala Leu Tyr Ala Val Phe Pro Tyr Gln Gln Met Leu Lys

100 105 110

aat cat tgc tta cat cat cgt cat cct gct agc gaa gtt gac cca gat 384

Asn His Cys Leu His His Arg His Pro Ala Ser Glu Val Asp Pro Asp

115 120 125

ttt cat gat ggt aag aga aca aac gct att ttc tgg tat ctc cat ttc 432

Phe His Asp Gly Lys Arg Thr Asn Ala Ile Phe Trp Tyr Leu His Phe

130 135 140

atg ata gaa tac tcc agt tgg caa cag tta ata gta cta act atc cta 480

Met Ile Glu Tyr Ser Ser Trp Gln Gln Leu Ile Val Leu Thr Ile Leu

145 150 155 160

ttt aat tta gct aaa tac gtt ttg cac atc cat caa ata aat ctc atc 528

Phe Asn Leu Ala Lys Tyr Val Leu His Ile His Gln Ile Asn Leu Ile

165 170 175

tta ttt tgg agt att cct cca att tta agt tcc att caa ctg ttt tat 576

Leu Phe Trp Ser Ile Pro Pro Ile Leu Ser Ser Ile Gln Leu Phe Tyr

180 185 190

ttc gga aca ttt ttg cct cat cga gaa ccc aag aaa gga tat gtt tat 624

Phe Gly Thr Phe Leu Pro His Arg Glu Pro Lys Lys Gly Tyr Val Tyr

195 200 205

ccc cat tgc agc caa aca ata aaa ttg cca act ttt ttg tca ttt atc 672

Pro His Cys Ser Gln Thr Ile Lys Leu Pro Thr Phe Leu Ser Phe Ile

210 215 220

gct tgc tac cac ttt ggt tat cat gaa gaa cat cat gag tat ccc cat 720

Ala Cys Tyr His Phe Gly Tyr His Glu Glu His His Glu Tyr Pro His

225 230 235 240

gta cct tgg tgg caa ctt cca tct gta tat aag cag aga gta ttc aac 768

Val Pro Trp Trp Gln Leu Pro Ser Val Tyr Lys Gln Arg Val Phe Asn

245 250 255

aat tca gta acc aat tcg taa 789

Asn Ser Val Thr Asn Ser

260

<210>82

<211>262

<212>PRT

＜213〉some shape beads algae

<400>82

Leu Asn Phe Cys Asp Lys Pro Val Ser Tyr Tyr Val Ala Ile Glu Gln

1 5 10 15

Leu Ser Ala Lys Glu Asp Thr Val Trp Gly Leu Val Ile Val Ile Val

20 25 30

Ile Ile Ser Leu Trp Val Ala Ser Leu Ala Phe Leu Leu Ala Ile Asn

35 40 45

Tyr Ala Lys Val Pro Ile Trp Leu Ile Pro Ile Ala Ile Val Trp Gln

50 55 60

Met Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ala His Asp Ala Met His

65 70 75 80

Gly Ser Val Tyr Arg Lys Asn Pro Lys Ile Asn Asn Phe Ile Gly Ser

85 90 95

Leu Ala Val Ala Leu Tyr Ala Val Phe Pro Tyr Gln Gln Met Leu Lys

100 105 110

Asn His Cys Leu His His Arg His Pro Ala Ser Glu Val Asp Pro Asp

115 120 125

Phe His Asp Gly Lys Arg Thr Asn Ala Ile Phe Trp Tyr Leu His Phe

130 135 140

Met Ile Glu Tyr Ser Ser Trp Gln Gln Leu Ile Val Leu Thr Ile Leu

145 150 155 160

Phe Asn Leu Ala Lys Tyr Val Leu His Ile His Gln Ile Asn Leu Ile

165 170 175

Leu Phe Trp Ser Ile Pro Pro Ile Leu Ser Ser Ile Gln Leu Phe Tyr

180 185 190

Phe Gly Thr Phe Leu Pro His Arg Glu Pro Lys Lys Gly Tyr Val Tyr

195 200 205

Pro His Cys Ser Gln Thr Ile Lys Leu Pro Thr Phe Leu Ser Phe Ile

210 215 220

Ala Cys Tyr His Phe Gly Tyr His Glu Glu His His Glu Tyr Pro His

225 230 235 240

Val Pro Trp Trp Gln Leu Pro Ser Val Tyr Lys Gln Arg Val Phe Asn

245 250 255

Asn Ser Val Thr Asn Ser

260

<210>83

<211>762

<212>DNA

＜213〉some shape beads algae

<220>

<221>CDS

<222>(1)..(762)

<223>

<400>83

gtg atc cag tta gaa caa cca ctc agt cat caa gca aaa ctg act cca 48

Val Ile Gln Leu Glu Gln Pro Leu Ser His Gln Ala Lys Leu Thr Pro

1 5 10 15

gta ctg aga agt aaa tct cag ttt aag ggg ctt ttc att gct att gtc 96

Val Leu Arg Ser Lys Ser Gln Phe Lys Gly Leu Phe Ile Ala Ile Val

20 25 30

att gtt agc gca tgg gtc att agc ctg agt tta tta ctt tcc ctt gac 144

Ile Val Ser Ala Trp Val Ile Ser Leu Ser Leu Leu Leu Ser Leu Asp

35 40 45

atc tca aag cta aaa ttt tgg atg tta ttg cct gtt ata cta tgg caa 192

Ile Ser Lys Leu Lys Phe Trp Met Leu Leu Pro Val Ile Leu Trp Gln

50 55 60

aca ttt tta tat acg gga tta ttt att aca tct cat gat gcc atg cat 240

Thr Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ser His Asp Ala Met His

65 70 75 80

ggc gta gta ttt ccc caa aac acc aag att aat cat ttg att gga aca 288

Gly Val Val Phe Pro Gln Asn Thr Lys Ile Asn His Leu Ile Gly Thr

85 90 95

ttg acc cta tcc ctt tat ggt ctt tta cca tat caa aaa cta ttg aaa 336

Leu Thr Leu Ser Leu Tyr Gly Leu Leu Pro Tyr Gln Lys Leu Leu Lys

100 105 110

aaa cat tgg tta cac cac cac aat cca gca agc tca ata gac ccg gat 384

Lys His Trp Leu His His His Asn Pro Ala Ser Ser Ile Asp Pro Asp

115 120 125

ttt cac aat ggt aaa cac caa agt ttc ttt gct tgg tat ttt cat ttt 432

Phe His Asn Gly Lys His Gln Set Phe Phe Ala Trp Tyr Phe His Phe

130 135 140

atg aaa ggt tac tgg agt tgg ggg caa ata att gcg ttg act att att 480

Met Lys Gly Tyr Trp Ser Trp Gly Gln Ile Ile Ala Leu Thr Ile Ile

145 150 155 160

tat aac ttt gct aaa tac ata ctc cat atc cca agt gat aat cta act 528

Tyr Asn Phe Ala Lys Tyr Ile Leu His Ile Pro Ser Asp Asn Leu Thr

165 170 175

tac ttt tgg gtg cta ccc tcg ctt tta agt tca tta caa tta ttc tat 576

Tyr Phe Trp Val Leu Pro Ser Leu Leu Ser Ser Leu Gln Leu Phe Tyr

180 185 190

ttt ggt act ttt tta ccc cat agt gaa cca ata ggg ggt tat gtt cag 624

Phe Gly Thr Phe Leu Pro His Ser Glu Pro Ile Gly Gly Tyr Val Gln

195 200 205

cct cat tgt gcc caa aca att agc cgt cct att tgg tgg tca ttt atc 672

Pro His Cys Ala Gln Thr Ile Ser Arg Pro Ile Trp Trp Ser Phe Ile

210 215 220

acg tgc tat cat ttt ggc tac cac gag gaa cat cac gaa tat cct cat 720

Thr Cys Tyr His Phe Gly Tyr His Glu Glu His His Glu Tyr Pro His

225 230 235 240

att tct tgg tgg cag tta cca gaa att tac aaa gca aaa tag 762

Ile Ser Trp Trp Gln Leu Pro Glu Ile Tyr Lys Ala Lys

245 250

<210>84

<211>253

<212>PRT

＜213〉some shape beads algae

<400>84

Val Ile Gln Leu Glu Gln Pro Leu Ser His Gln Ala Lys Leu Thr Pro

1 5 10 15

Val Leu Arg Ser Lys Ser Gln Phe Lys Gly Leu Phe Ile Ala Ile Val

20 25 30

Ile Val Ser Ala Trp Val Ile Ser Leu Ser Leu Leu Leu Ser Leu Asp

35 40 45

Ile Ser Lys Leu Lys Phe Trp Met Leu Leu Pro Val Ile Leu Trp Gln

50 55 60

Thr Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ser His Asp Ala Met His

65 70 75 80

Gly Val Val Phe Pro Gln Asn Thr Lys Ile Asn His Leu Ile Gly Thr

85 90 95

Leu Thr Leu Ser Leu Tyr Gly Leu Leu Pro Tyr Gln Lys Leu Leu Lys

100 105 110

Lys His Trp Leu His His His Asn Pro Ala Ser Ser Ile Asp Pro Asp

115 120 125

Phe His Asn Gly Lys His Gln Ser Phe Phe Ala Trp Tyr Phe His Phe

130 135 140

Met Lys Gly Tyr Trp Ser Trp Gly Gln Ile Ile Ala Leu Thr Ile Ile

145 150 155 160

Tyr Asn Phe Ala Lys Tyr Ile Leu His Ile Pro Ser Asp Asn Leu Thr

165 170 175

Tyr Phe Trp Val Leu Pro Ser Leu Leu Ser Ser Leu Gln Leu Phe Tyr

180 185 190

Phe Gly Thr Phe Leu Pro His Ser Glu Pro Ile Gly Gly Tyr Val Gln

195 200 205

Pro His Cys Ala Gln Thr Ile Ser Arg Pro Ile Trp Trp Ser Phe Ile

210 215 220

Thr Cys Tyr His Phe Gly Tyr His Glu Glu His His Glu Tyr Pro His

225 230 235 240

Ile Ser Trp Trp Gln Leu Pro Glu Ile Tyr Lys Ala Lys

245 250

<210>85

<211>804

<212>DNA

＜213〉Synechococcus (Synechococcus) WH8102

<220>

<221>CDS

<222>(1)..(804)

<223>

<400>85

atg aaa acg aca aga tct att tcg tgg cca tcg act tgc tgg cat cac 48

Met Lys Thr Thr Arg Ser Ile Ser Trp Pro Ser Thr Cys Trp His His

1 5 10 15

cag ccg agt tgc tca agc tgg gtg gca aat gag ttc agc cct cag gcc 96

Gln Pro Ser Cys Ser Ser Trp Val Ala Asn Glu Phe Ser Pro Gln Ala

20 25 30

ctc aaa ggg ttg gct ctg gct ggt ctg att gga tca gcc tgg ctg ctc 144

Leu Lys Gly Leu Ala Leu Ala Gly Leu Ile Gly Ser Ala Trp Leu Leu

35 40 45

tcc ctg ggc ctg agc tac acc ctg cca ctt gat cag acg cct ggg ctg 192

Ser Leu Gly Leu Ser Tyr Thr Leu Pro Leu Asp Gln Thr Pro Gly Leu

50 55 60

ttg att ggc agc ttg att ctg ctc aga gca ttt ctg cac acc ggg ctg 240

Leu Ile Gly Ser Leu Ile Leu Leu Arg Ala Phe Leu His Thr Gly Leu

65 70 75 80

ttc atc gtt gcc cac gat tcc atg cac gcc agt ctg gtt ccg ggt cat 288

Phe Ile Val Ala His Asp Ser Met His Ala Ser Leu Val Pro Gly His

85 90 95

ccc gga ttg aac cgc tgg atc ggc aaa gtg tat ttg ttg gtg tat gca 336

Pro Gly Leu Asn Arg Trp Ile Gly Lys Val Tyr Leu Leu Val Tyr Ala

100 105 110

ggc ttg tct tat gag cgt tgt tcc cgc aac cac aga cgt cat cac ctg 384

Gly Leu Ser Tyr Glu Arg Cys Ser Arg Asn His Arg Arg His His Leu

115 120 125

gca ccg gag acg ttc cag gat cct gac tac caa cgt tgc acc aat aac 432

Ala Pro Glu Thr Phe Gln Asp Pro Asp Tyr Gln Arg Cys Thr Asn Asn

130 135 140

aac atc cta gat tgg tat gtt cac ttc atg ggc aac tat ctg ggc atg 480

Asn Ile Leu Asp Trp Tyr Val His Phe Met Gly Asn Tyr Leu Gly Met

145 150 155 160

cgg caa ctg tta aat cta agc tgt ctt tgg ctg gcg cta atc att ctc 528

Arg Gln Leu Leu Asn Leu Ser Cys Leu Trp Leu Ala Leu Ile Ile Leu

165 170 175

aac ggt tct gat ctc cct gct cag atc atg cat ctg ctg ttg ttc agc 576

Asn Gly Ser Asp Leu Pro Ala Gln Ile Met His Leu Leu Leu Phe Ser

180 185 190

gtt ctg ccg ttg atc atc agt tcc tgt caa ttg ttt cta gtg gga acc 624

Val Leu Pro Leu Ile Ile Ser Ser Cys Gln Leu Phe Leu Val Gly Thr

195 200 205

tgg tta ccc cac cga cgt ggg gcc acg aca cga ccg ggc gtg aca acg 672

Trp Leu Pro His Arg Arg Gly Ala Thr Thr Arg Pro Gly Val Thr Thr

210 215 220

cgc agc ctg gct ttg cat cca gcc ctc tct ttc gca gct tgt tac aac 720

Arg Ser Leu Ala Leu His Pro Ala Leu Ser Phe Ala Ala Cys Tyr Asn

225 230 235 240

ttt ggc tat cat cgt gaa cat cat gaa tcg cct tcc aca ccc tgg ttt 768

Phe Gly Tyr His Arg Glu His His Glu Ser Pro Ser Thr Pro Trp Phe

245 250 255

cag ctg cca caa ctt cga aat gaa tca ttc act tga 804

Gln Leu Pro Gln Leu Arg Asn Glu Ser Phe Thr

260 265

<210>86

<211>267

<212>PRT

＜213〉Synechococcus WH8102

<400>86

Met Lys Thr Thr Arg Ser Ile Ser Trp Pro Ser Thr Cys Trp His His

1 5 10 15

Gln Pro Ser Cys Ser Ser Trp Val Ala Asn Glu Phe Ser Pro Gln Ala

20 25 30

Leu Lys Gly Leu Ala Leu Ala Gly Leu Ile Gly Ser Ala Trp Leu Leu

35 40 45

Ser Leu Gly Leu Ser Tyr Thr Leu Pro Leu Asp Gln Thr Pro Gly Leu

50 55 60

Leu Ile Gly Ser Leu Ile Leu Leu Arg Ala Phe Leu His Thr Gly Leu

65 70 75 80

Phe Ile Val Ala His Asp Ser Met His Ala Ser Leu Val Pro Gly His

85 90 95

Pro Gly Leu Asn Arg Trp Ile Gly Lys Val Tyr Leu Leu Val Tyr Ala

100 105 110

Gly Leu Ser Tyr Glu Arg Cys Ser Arg Asn His Arg Arg His His Leu

115 120 125

Ala Pro Glu Thr Phe Gln Asp Pro Asp Tyr Gln Arg Cys Thr Asn Asn

130 135 140

Asn Ile Leu Asp Trp Tyr Val His Phe Met Gly Asn Tyr Leu Gly Met

145 150 155 160

Arg Gln Leu Leu Asn Leu Ser Cys Leu Trp Leu Ala Leu Ile Ile Leu

165 170 175

Asn Gly Ser Asp Leu Pro Ala Gln Ile Met His Leu Leu Leu Phe Ser

180 185 190

Val Leu Pro Leu Ile Ile Ser Ser Cys Gln Leu Phe Leu Val Gly Thr

195 200 205

Trp Leu Pro His Arg Arg Gly Ala Thr Thr Arg Pro Gly Val Thr Thr

210 215 220

Arg Ser Leu Ala Leu His Pro Ala Leu Ser Phe Ala Ala Cys Tyr Asn

225 230 235 240

Phe Gly Tyr His Arg Glu His His Glu Ser Pro Ser Thr Pro Trp Phe

245 250 255

Gln Leu Pro Gln Leu Arg Asn Glu Ser Phe Thr

260 265

<210>87

<211>33

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(33)

<223>

<400>87

gcatgctcta gaccttataa agatattttg tga 33

<210>88

<211>33

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(33)

<223>

<400>88

gcatgcatct agaaatggtt cagtgtcaac cat 33

<210>89

<211>805

<212>DNA

＜213〉beads algae PCC7120 strain

<220>

＜221〉variation

<222>(1)..(805)

<223>

<400>89

gcatgcatct agaaatggtt cagtgtcaac catcatctct gcattcagaa aaactggtgt 60

tattgtcatc gacaatcaga gatgataaaa atattaataa gggtatattt attgcctgct 120

ttatcttatt tttatgggca attagtttaa tcttattact ctcaatagat acatccataa 180

ttcataagag cttattaggt atagccatgc tttggcagac cttcttatat acaggtttat 240

ttattactgc tcatgatgcc atgcacggcg tagtttatcc caaaaatccc agaataaata 300

attttatagg taagctcact ctaatcttgt atggactact cccttataaa gatttattga 360

aaaaacattg gttacaccac ggacatcctg gtactgattt agaccctgat tattacaatg 420

gtcatcccca aaacttcttt ctttggtatc tacattttat gaagtcttat tggcgatgga 480

cgcaaatttt cggattagtg atgatttttc atggacttaa aaatctggtg catataccag 540

aaaataattt aattatattt tggatgatac cttctatttt aagttcagta caactatttt 600

attttggtac atttttgcct cataaaaagc tagaaggtgg ttatactaac ccccattgtg 660

cgcgcagtat cccattacct cttttttggt cttttgttac ttgttatcac ttcggctacc 720

acaaggaaca tcacgaatac cctcaacttc cttggtggaa attacctgaa gctcacaaaa 780

tatctttata aggtctagag catgc 805

<210>90

<211>35

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(35)

<223>

<400>90

gagctcttca ttatttcgat tttgatttcg tgacc 35

<210>91

<211>44

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(44)

<223>

<400>91

aagcttgagc tcggttgatc agaagaagaa gaagaagatg aact 44

<210>92

<211>653

<212>DNA

＜213〉mouseearcress

<220>

＜221〉promoter

<222>(1)..(653)

<223>

<400>92

gagctcttca ttatttcgat tttgatttcg tgaccagcga acgcagaata ccttgttgtg 60

taatacttta cccgtgtaaa tcaaaaacaa aaaggctttt gagctttttg tagttgaatt 120

tctctggctg atcttttctg tacagattca tatatctgca gagacgatat cattgattat 180

ttgagcttct tttgaactat ttcgtgtaat ttgggatgag agctctatgt atgtgtgtaa 240

actttgaaga caacaagaaa ggtaacaagt gagggaggga tgactccatg tcaaaataga 300

tgtcataaga ggcccatcaa taagtgcttg agcccattag ctagcccagt aactaccaga 360

ttgtgagatg gatgtgtgaa cagttttttt tttgatgtag gactgaaatg tgaacaacag 420

gcgcatgaaa ggctaaatta ggacaatgat aagcagaaat aacttatcct ctctaacact 480

tggcctcaca ttgcccttca cacaatccac acacatccaa tcacaacctc atcatatatc 540

tcccgctaat ctttttttct ttgatctttt tttttttgct tattattttt ttgactttga 600

tctcccatca gttcatottc ttcttcttct tctgatcaac cgagctcaag ctt 653

<210>93

<211>28

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(28)

<223>

<400>93

gagctcactc actgatttcc attgcttg 28

<210>94

<211>30

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(30)

<223>

<400>94

aagcttgagc tctttgttga agagatttgg 30

<210>95

<211>37

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(37)

<223>

<400>95

cgccgttaag tcgatgtccg ttgatttaaa cagtgtc 37

<210>96

<211>34

<212>DNA

＜213〉composition sequence

<220>

＜221〉primer _ combination

<222>(1)..(34)

<223>

<400>96

atcaacggac atcgacttaa cggcgtttgt aaac 34

<210>97

<211>831

<212>DNA

＜213〉haematococcus pluvialis

<220>

<221>CDS

<222>(1)..(831)

<223>

<400>97

atg cca tcc gag tcg tca gac gca gct cgt cct gtg ttg aag cac gcc 48

Met Pro Ser Glu Ser Ser Asp Ala Ala Arg Pro Val Leu Lys His Ala

1 5 10 15

tat aaa cct cca gca tct gac gcc aag ggc atc act atg gcg ctg acc 96

Tyr Lys Pro Pro Ala Ser Asp Ala Lys Gly Ile Thr Met Ala Leu Thr

20 25 30

atc att ggc acc tgg acc gca gtg ttt tta cac gca ata ttc caa atc 144

Ile Ile Gly Thr Trp Thr Ala Val Phe Leu His Ala Ile Phe Gln Ile

35 40 45

agg cta ccg aca tcc atg gac cag ctt cac tgg ttg cct gtg tcc gaa 192

Arg Leu Pro Thr Ser Met Asp Gln Leu His Trp Leu Pro Val Ser Glu

50 55 60

gcc aca gcc cag ctg ttg ggc gga agc agc agc cta ttg cac atc gcc 240

Ala Thr Ala Gln Leu Leu Gly Gly Ser Ser Ser Leu Leu His Ile Ala

65 70 75 80

gca gtc ttc att gta ctt gag ttt ctg tac act ggt cta ttc atc acc 288

Ala Val Phe Ile Val Leu Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr

85 90 95

acg cat gat gca atg cat ggc acc ata gct ttg agg aac agg cag ctc 336

Thr His Asp Ala Met His Gly Thr Ile Ala Leu Arg Asn Arg Gln Leu

100 105 110

aat gat ctc ctt ggc aac atc tgc ata tca ctg tac gcc tgg ttt gac 384

Asn Asp Leu Leu Gly Asn Ile Cys Ile Ser Leu Tyr Ala Trp Phe Asp

115 120 125

tac agc atg cac tgg gag cac cac aac cat act ggc gaa gtg ggg aaa 432

Tyr ser Met His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys

130 135 140

gac cct gac ttc cac aaa gga aat cct ggc ctt gtc ccc tgg ttc gcc 480

Asp Pro Asp Phe His Lys Gly Asn Pro Gly Leu Val Pro Trp Phe Ala

145 150 155 160

agc ttc atg tcc agc tac atg tcc ctg tgg cag ttt gcc cgg ctg gca 528

Ser Phe Met Ser Ser Tyr Met Ser Leu Trp Gln Phe Ala Arg Leu Ala

165 170 175

tgg tgg gca gtg gtg atg caa acg ttg ggg gcc ccc atg gcg aat ctc 576

Trp Trp Ala Val Val Met Gln Thr Leu Gly Ala Pro Met Ala Asn Leu

180 185 190

cta gtc ttc atg gct gca gcc cca atc ttg tca gca ttc cgc ctc ttc 624

Leu Val Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe

195 200 205

tac ttc ggc act tac ctg cca cac aag cct gag cca ggc cct gca gca 672

Tyr Phe Gly Thr Tyr Leu Pro His Lys Pro Glu Pro Gly Pro Ala Ala

210 215 220

ggc tct cag gtc atg tct tgg ttc agg gcc aag aca agt gag gca tct 720

Gly Ser Gln Val Met Ser Trp Phe Arg Ala Lys Thr Ser Glu Ala Ser

225 230 235 240

gat gtg atg agc ttc ctg aca tgc tac cac ttt gac ctg ttt gcc ccc 768

Asp Val Met Ser Phe Leu Thr Cys Tyr His Phe Asp Leu Phe Ala Pro

245 250 255

tgg tgg cag ctg ccc cac tgc cgc cgc ctg tct ggg cgt ggc ctg gtg 816

Trp Trp Gln Leu Pro His Cys Arg Arg Leu Ser Gly Arg Gly Leu Val

260 265 270

cct gcc ttg gca tga 831

Pro Ala Leu Ala

275

<210>98

<211>276

<212>PRT

＜213〉haematococcus pluvialis

<400>98

Met Pro Ser Glu Ser Ser Asp Ala Ala Arg Pro Val Leu Lys His Ala

1 5 10 15

Tyr Lys Pro Pro Ala Ser Asp Ala Lys Gly Ile Thr Met Ala Leu Thr

20 25 30

Ile Ile Gly Thr Trp Thr Ala Val Phe Leu His Ala Ile Phe Gln Ile

35 40 45

Arg Leu Pro Thr Ser Met Asp Gln Leu His Trp Leu Pro Val Ser Glu

50 55 60

Ala Thr Ala Gln Leu Leu Gly Gly Ser Ser Ser Leu Leu His Ile Ala

65 70 75 80

Ala Val Phe Ile Val Leu Glu Phe Leu Tyr Thr Gly Leu Phe Ile Thr

85 90 95

Thr His Asp Ala Met His Gly Thr Ile Ala Leu Arg Asn Arg Gln Leu

100 105 110

Asn Asp Leu Leu Gly Asn Ile Cys Ile Ser Leu Tyr Ala Trp Phe Asp

115 120 125

Tyr Ser Met His Trp Glu His His Asn His Thr Gly Glu Val Gly Lys

130 135 140

Asp Pro Asp Phe His Lys Gly Asn Pro Gly Leu Val Pro Trp Phe Ala

145 150 155 160

Ser Phe Met Ser Ser Tyr Met Ser Leu Trp Gln Phe Ala Arg Leu Ala

165 170 175

Trp Trp Ala Val Val Met Gln Thr Leu Gly Ala Pro Met Ala Asn Leu

180 185 190

Leu Val Phe Met Ala Ala Ala Pro Ile Leu Ser Ala Phe Arg Leu Phe

195 200 205

Tyr Phe Gly Thr Tyr Leu Pro His Lys Pro Glu Pro Gly Pro Ala Ala

210 215 220

Gly Ser Gln Val Met Ser Trp Phe Arg Ala Lys Thr Ser Glu Ala Ser

225 230 235 240

Asp Val Met Ser Phe Leu Thr Cys Tyr His Phe Asp Leu Phe Ala Pro

245 250 255

Trp Trp Gln Leu Pro His Cys Arg Arg Leu Ser Gly Arg Gly Leu Val

260 265 270

Pro Ala Leu Ala

275

<210>99

<211>729

<212>DNA

＜213〉secondary coccus (Paracoccus sp.) MBIC1143

<220>

<221>CDS

<222>(1)..(729)

<223>

<400>99

atg agc gca cat gcc ctg ccc aag gca gat ctg acc gcc acc agc ctg 48

Met Ser Ala His Ala Leu Pro Lys Ala Asp Leu Thr Ala Thr Ser Leu

1 5 10 15

atc gtc tcg ggc ggc atc atc gcc gct tgg ctg gcc ctg cat gtg cat 96

Ile Val Ser Gly Gly Ile Ile Ala Ala Trp Leu Ala Leu His Val His

20 25 30

gcg ctg tgg ttt ctg gac gca gcg gcg cat ccc atc ctg gcg atc gca 144

Ala Leu Trp Phe Leu Asp Ala Ala Ala His Pro Ile Leu Ala Ile Ala

35 40 45

aat ttc ctg ggg ctg acc tgg ctg tcg gtc gga ttg ttc atc atc gcg 192

Asn Phe Leu Gly Leu Thr Trp Leu Ser Val Gly Leu Phe Ile Ile Ala

50 55 60

cat gac gcg atg cac ggg tcg gtg gtg ccg ggg cgt ccg cgc gcc aat 240

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

gcg gcg atg ggc cag ctt gtc ctg tgg ctg tat gcc gga ttt tcg tgg 288

Ala Ala Met Gly Gln Leu Val Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

cgc aag atg atc gtc aag cac atg gcc cat cac cgc cat gcc gga acc 336

Arg Lys Met Ile Val Lys His Met Ala His His Arg His Ala Gly Thr

100 105 110

gac gac gac ccc gat ttc gac cat ggc ggc ccg gtc cgc tgg tac gcc 384

Asp Asp Asp Pro Asp Phe Asp His Gly Gly Pro Val Arg Trp Tyr Ala

115 120 125

cgc ttc atc ggc acc tat ttc ggc tgg cgc gag ggg ctg ctg ctg ccc 432

Arg Phe Ile Gly Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

gtc atc gtg acg gtc tat gcg ctg atc ctt ggg gat cgc tgg atg tac 480

Val Ile Val Thr Val Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 160

gtg gtc ttc tgg ccg ctg ccg tcg atc ctg gcg tcg atc cag ctg ttc 528

Val Val Phe Trp Pro Leu Pro Ser Ile Leu Ala Ser Ile Gln Leu Phe

165 170 175

gtg ttc ggc acc tgg ctg ccg cac cgc ccc ggc cac gac gcg ttc ccg 576

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Ala Phe Pro

180 185 190

gac cgc cac aat gcg cgg tcg tcg cgg atc agc gac ccc gtg tcg ctg 624

Asp Arg His Asn Ala Arg Ser Ser Arg Ile Ser Asp Pro Val Ser Leu

195 200 205

ctg acc tgc ttt cac ttt ggc ggt tat cat cac gaa cac cac ctg cac 672

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

ccg acg gtg ccg tgg tgg cgc ctg ccc agc acc cgc acc aag ggg gac 720

Pro Thr Val Pro Trp Trp Arg Leu Pro Ser Thr Arg Thr Lys Gly Asp

225 230 235 240

acc gca tga 729

Thr Ala

<210>100

<211>242

<212>PRI

＜213〉secondary coccus MBIC1143

<400>100

Met Ser Ala His Ala Leu Pro Lys Ala Asp Leu Thr Ala Thr Ser Leu

1 5 10 15

Ile Val Ser Gly Gly Ile Ile Ala Ala Trp Leu Ala Leu His Val His

20 25 30

Ala Leu Trp Phe Leu Asp Ala Ala Ala His Pro Ile Leu Ala Ile Ala

35 40 45

Asn Phe Leu Gly Leu Thr Trp Leu Ser Val Gly Leu Phe Ile Ile Ala

50 55 60

His Asp Ala Met His Gly Ser Val Val Pro Gly Arg Pro Arg Ala Asn

65 70 75 80

Ala Ala Met Gly Gln Leu Val Leu Trp Leu Tyr Ala Gly Phe Ser Trp

85 90 95

Arg Lys Met Ile Val Lys His Met Ala His His Arg His Ala Gly Thr

100 105 110

Asp Asp Asp Pro Asp Phe Asp His Gly Gly Pro Val Arg Trp Tyr Ala

115 120 125

Arg Phe Ile Gly Thr Tyr Phe Gly Trp Arg Glu Gly Leu Leu Leu Pro

130 135 140

Val Ile Val Thr Val Tyr Ala Leu Ile Leu Gly Asp Arg Trp Met Tyr

145 150 155 160

Val Val Phe Trp Pro Leu Pro Ser Ile Leu Ala Ser Ile Gln Leu Phe

165 170 175

Val Phe Gly Thr Trp Leu Pro His Arg Pro Gly His Asp Ala Phe Pro

180 185 190

Asp Arg His Asn Ala Arg Ser Ser Arg Ile Ser Asp Pro Val Ser Leu

195 200 205

Leu Thr Cys Phe His Phe Gly Gly Tyr His His Glu His His Leu His

210 215 220

Pro Thr Val Pro Trp Trp Arg Leu Pro Ser Thr Arg Thr Lys Gly Asp

225 230 235 240

Thr Ala

<210>101

<211>735

<212>DNA

＜213〉orange shortwave monad (Brevundimonas aurantiaca)

<220>

<221>CDS

<222>(1)..(735)

<223>

<400>101

atg acc gcc gcc gtc gcc gag cca cgc acc gtc ccg cgc cag acc tgg 48

Met Thr Ala Ala Val Ala Glu Pro Arg Thr Val Pro Arg Gln Thr Trp

1 5 10 15

atc ggt ctg acc ctg gcg gga atg atc gtg gcg gga tgg gcg gtt ctg 96

Ile Gly Leu Thr Leu Ala Gly Met Ile Val Ala Gly Trp Ala Val Leu

20 25 30

cat gtc tac ggc gtc tat ttt cac cga tgg ggg ccg ttg acc ctg gtg 144

His Val Tyr Gly Val Tyr Phe His Arg Trp Gly Pro Leu Thr Leu Val

35 40 45

atc gcc ccg gcg atc gtg gcg gtc cag acc tgg ttg tcg gtc ggc ctt 192

Ile Ala Pro Ala Ile Val Ala Val Gln Thr Trp Leu Ser Val Gly Leu

50 55 60

ttc atc gtc gcc cat gac gcc atg tac ggc tcc ctg gcg ccg gga cgg 240

Phe Ile Val Ala His Asp Ala Met Tyr Gly Ser Leu Ala Pro Gly Arg

65 70 75 80

ccg cgg ctg aac gcc gca gtc ggc cgg ctg acc ctg ggg ctc tat gcg 288

Pro Arg Leu Asn Ala Ala Val Gly Arg Leu Thr Leu Gly Leu Tyr Ala

85 90 95

ggc ttc cgc ttc gat cgg ctg aag acg gcg cac cac gcc cac cac gcc 336

Gly Phe Arg Phe Asp Arg Leu Lys Thr Ala His His Ala His His Ala

100 105 110

gcg ccc ggc acg gcc gac gac ccg gat ttt cac gcc ccg gcg ccc cgc 384

Ala Pro Gly Thr Ala Asp Asp Pro Asp Phe His Ala Pro Ala Pro Arg

115 120 125

gcc ttc ctt ccc tgg ttc ctg aac ttc ttt cgc acc tat ttc ggc tgg 432

Ala Phe Leu Pro Trp Phe Leu Asn Phe Phe Arg Thr Tyr Phe Gly Trp

130 135 140

cgc gag atg gcg gtc ctg acc gcc ctg gtc ctg atc gcc ctc ttc ggc 480

Arg Glu Met Ala Val Leu Thr Ala Leu Val Leu Ile Ala Leu Phe Gly

145 150 155 160

ctg ggg gcg cgg ccg gcc aat ctc ctg acc ttc tgg gcc gcg ccg gcc 528

Leu Gly Ala Arg Pro Ala Asn Leu Leu Thr Phe Trp Ala Ala Pro Ala

165 170 175

ctg ctt tca gcg ctt cag ctc ttc acc ttc ggc acc tgg ctg ccg cac 576

Leu Leu Ser Ala Leu Gln Leu Phe Thr Phe Gly Thr Trp Leu Pro His

180 185 190

cgc cac acc gac cag ccg ttc gcc gac gcg cac cac gcc cgc agc agc 624

Arg His Thr Asp Gln Pro Phe Ala Asp Ala His His Ala Arg Ser Ser

195 200 205

ggc tac ggc ccc gtg ctt tcc ctg ctc acc tgt ttc cac ttc ggc cgc 672

Gly Tyr Gly Pro Val Leu Ser Leu Leu Thr Cys Phe His Phe Gly Arg

210 215 220

cac cac gaa cac cat ctg agc ccc tgg cgg ccc tgg tgg cgt ctg tgg 720

His His Glu His His Leu Ser Pro Trp Arg Pro Trp Trp Arg Leu Trp

225 230 235 240

cgc ggc gag tct tga 735

Arg Gly Glu Ser

<210>102

<211>244

<212>PRT

＜213〉orange shortwave monad

<400>102

Met Thr Ala Ala Val Ala Glu Pro Arg Thr Val Pro Arg Gln Thr Trp

1 5 10 15

Ile Gly Leu Thr Leu Ala Gly Met Ile Val Ala Gly Trp Ala Val Leu

20 25 30

His Val Tyr Gly Val Tyr Phe His Arg Trp Gly Pro Leu Thr Leu Val

35 40 45

Ile Ala Pro Ala Ile Val Ala Val Gln Thr Trp Leu Ser Val Gly Leu

50 55 60

Phe Ile Val Ala His Asp Ala Met Tyr Gly Ser Leu Ala Pro Gly Arg

65 70 75 80

Pro Arg Leu Asn Ala Ala Val Gly Arg Leu Thr Leu Gly Leu Tyr Ala

85 90 95

Gly Phe Arg Phe Asp Arg Leu Lys Thr Ala His His Ala His His Ala

100 105 110

Ala Pro Gly Thr Ala Asp Asp Pro Asp Phe His Ala Pro Ala Pro Arg

115 120 125

Ala Phe Leu Pro Trp Phe Leu Asn Phe Phe Arg Thr Tyr Phe Gly Trp

130 135 140

Arg Glu Met Ala Val Leu Thr Ala Leu Val Leu Ile Ala Leu Phe Gly

145 150 155 160

Leu Gly Ala Arg Pro Ala Asn Leu Leu Thr Phe Trp Ala Ala Pro Ala

165 170 175

Leu Leu Ser Ala Leu Gln Leu Phe Thr Phe Gly Thr Trp Leu Pro His

180 185 190

Arg His Thr Asp Gln Pro Phe Ala Asp Ala His His Ala Arg Ser Ser

195 200 205

Gly Tyr Gly Pro Val Leu Ser Leu Leu Thr Cys Phe His Phe Gly Arg

210 215 220

His His Glu His His Leu Ser Pro Trp Arg Pro Trp Trp Arg Leu Trp

225 230 235 240

Arg Gly Glu Ser

<210>103

<211>690

<212>DNA

＜213〉foam joint ball algae (Nodularia spumigena) NSOR10

<220>

<221>CDS

<222>(1)..(690)

<223>

<400>103

atg gcg atc gcc att att agt ata tgg gct atc agc cta ggt ttg tta 48

Met Ala Ile Ala Ile Ile Ser Ile Trp Ala Ile Ser Leu Gly Leu Leu

1 5 10 15

ctt tat att gat ata tcc caa ttc aag ttt tgg atg ttg tta ccg ctc 96

Leu Tyr Ile Asp Ile Ser Gln Phe Lys Phe Trp Met Leu Leu Pro Leu

20 25 30

ata ttt tgg caa aca ttt tta tat acg gga tta ttt att aca gct cat 144

Ile Phe Trp Gln Thr Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ala His

35 40 45

gat gcc atg cat ggg gta gtt ttt ccc aaa aat ccc aaa atc aac cat 192

Asp Ala Met His Gly Val Val Phe Pro Lys Asn Pro Lys Ile Asn His

50 55 60

ttc att ggc tca ttg tgc ctg ttt ctt tat ggt ctt tta cct tat caa 240

Phe Ile Gly Ser Leu Cys Leu Phe Leu Tyr Gly Leu Leu Pro Tyr Gln

65 70 75 80

aaa ctt tta aaa aag cat tgg cta cat cac cat aat cca gcc agt gaa 288

Lys Leu Leu Lys Lys His Trp Leu His His His Asn Pro Ala Ser Glu

85 90 95

aca gat cca gat ttt cac aac ggg aag cag aaa aac ttt ttt gct tgg 336

Thr Asp Pro Asp Phe His Asn Gly Lys Gln Lys Asn Phe Phe Ala Trp

100 105 110

tat tta tat ttt atg aag cgt tac tgg agt tgg tta caa att atc aca 384

Tyr Leu Tyr Phe Met Lys Arg Tyr Trp Ser Trp Leu Gln Ile Ile Thr

115 120 125

tta atg att att tat aac tta cta aaa tat ata tgg cat ttt cca gag 432

Leu Met Ile Ile Tyr Asn Leu Leu Lys Tyr Ile Trp His Phe Pro Glu

130 135 140

gat aat atg act tat ttt tgg gta gtt ccc tca att tta agt tct tta 480

Asp Asn Met Thr Tyr Phe Trp Val Val Pro Ser Ile Leu Ser Ser Leu

145 150 155 160

caa tta ttt tat ttt gga act ttt cta ccc cac agt gag cct gta gaa 528

Gln Leu Phe Tyr Phe Gly Thr Phe Leu Pro His Ser Glu Pro Val Glu

165 170 175

ggt tat aaa gag cct cat cgt tcc caa act att agc cgt ccc att tgg 576

Gly Tyr Lys Glu Pro His Arg Ser Gln Thr Ile Ser Arg Pro Ile Trp

180 185 190

tgg tca ttt ata act tgt tac cat ttt ggt tat cat tac gaa cat cat 624

Trp Ser Phe Ile Thr Cys Tyr His Phe Gly Tyr His Tyr Glu His His

195 200 205

gaa tac ccc cat gtt cct tgg tgg caa tta cca gaa att tat aaa atg 672

Glu Tyr Pro His Val Pro Trp Trp Gln Leu Pro Glu Ile Tyr Lys Met

210 215 220

tct aaa tca aat ttg tga 690

Ser Lys Ser Asn Leu

225

<210>104

<211>229

<212>PRT

＜213〉foam joint ball algae NSOR10

<400>104

Met Ala Ile Ala Ile Ile Ser Ile Trp Ala Ile Ser Leu Gly Leu Leu

1 5 10 15

Leu Tyr Ile Asp Ile Ser Gln Phe Lys Phe Trp Met Leu Leu Pro Leu

20 25 30

Ile Phe Trp Gln Thr Phe Leu Tyr Thr Gly Leu Phe Ile Thr Ala His

35 40 45

Asp Ala Met His Gly Val Val Phe Pro Lys Asn Pro Lys Ile Asn His

50 55 60

Phe Ile Gly Ser Leu Cys Leu Phe Leu Tyr Gly Leu Leu Pro Tyr Gln

65 70 75 80

Lys Leu Leu Lys Lys His Trp Leu His His His Asn Pro Ala Ser Glu

85 90 95

Thr Asp Pro Asp Phe His Asn Gly Lys Gln Lys Asn Phe Phe Ala Trp

100 105 110

Tyr Leu Tyr Phe Met Lys Arg Tyr Trp Ser Trp Leu Gln Ile Ile Thr

115 120 125

Leu Met Ile Ile Tyr Asn Leu Leu Lys Tyr Ile Trp His Phe Pro Glu

130 135 140

Asp Asn Met Thr Tyr Phe Trp Val Val Pro Ser Ile Leu Ser Ser Leu

145 150 155 160

Gln Leu Phe Tyr Phe Gly Thr Phe Leu Pro His Ser Glu Pro Val Glu

165 170 175

Gly Tyr Lys Glu Pro His Arg Ser Gln Thr Ile Ser Arg Pro Ile Trp

180 185 190

Trp Ser Phe Ile Thr Cys Tyr His Phe Gly Tyr His Tyr Glu His His

195 200 205

Glu Tyr Pro His Val Pro Trp Trp Gln Leu Pro Glu Ile Tyr Lys Met

210 215 220

Ser Lys Ser Asn Leu

225

<210>105

<211>1536

<212>DNA

＜213〉the unusual coccus of radiation hardness (Deinococcus radiodurans) R1

<220>

<221>CDS

<222>(1)..(1536)

<223>

<400>105

atg ccg gat tac gac ctg atc gtc atg ggc gcg ggc cac aac gcg ctg 48

Met Pro Asp Tyr Asp Leu Ile Val Met Gly Ala Gly His Asn Ala Leu

1 5 10 15

gtg act gct gcc tac gcc gcc cgg gcg ggc ctg aaa gtc ggc gtg ttc 96

Val Thr Ala Ala Tyr Ala Ala Arg Ala Gly Leu Lys Val Gly Val Phe

20 25 30

gag cgg cgg cac ctc gtc ggc ggg gcg gtc agc acc gag gag gtc gtg 144

Glu Arg Arg His Leu Val Gly Gly Ala Val Ser Thr Glu Glu Val Val

35 40 45

ccc ggt tac cgc ttc gac tac ggc ggc agc gcc cac atc ctg att cgg 192

Pro Gly Tyr Arg Phe Asp Tyr Gly Gly Ser Ala His Ile Leu Ile Arg

50 55 60

atg acg ccc atc gtg cgc gaa ctc gaa ctc acg cgg cac ggg ctg cat 240

Met Thr Pro Ile Val Arg Glu Leu Glu Leu Thr Arg His Gly Leu His

65 70 75 80

tac ctc gaa gtg gac cct atg ttt cac gct tcc gac ggt gaa acg ccc 288

Tyr Leu Glu Val Asp Pro Met Phe His Ala Ser Asp Gly Glu Thr Pro

85 90 95

tgg ttc att cac cgc gac gcc ggg cgg acc atc cgc gaa ctg gac gaa 336

Trp Phe Ile His Arg Asp Ala Gly Arg Thr Ile Arg Glu Leu Asp Glu

100 105 110

aag ttt ccc ggg cag ggc gac gcc tac ggg cgc ttt ctc gac gat tgg 384

Lys Phe Pro Gly Gln Gly Asp Ala Tyr Gly Arg Phe Leu Asp Asp Trp

115 120 125

aca ccc ttc gcg cgc gcc gtg gcc gac ctg ttc aac tcg gcg ccg ggg 432

Thr Pro Phe Ala Arg Ala Val Ala Asp Leu Phe Asn Ser Ala Pro Gly

130 135 140

ccg ctc gac ctg ggc aaa atg gtg atg cgc agc ggc cag ggc aag gac 480

Pro Leu Asp Leu Gly Lys Met Val Met Arg Ser Gly Gln Gly Lys Asp

145 150 155 160

tgg aac gag cag ctc ccg cgc atc ctg cgg ccc tac ggc gac gtg gcg 528

Trp Asn Glu Gln Leu Pro Arg Ile Leu Arg Pro Tyr Gly Asp Val Ala

165 170 175

cgc gag tac ttc agc gag gag cgc gtg cgg gct ccc ctg acc tgg atg 576

Arg Glu Tyr Phe Ser Glu Glu Arg Val Arg Ala Pro Leu Thr Trp Met

180 185 190

gcg gcc cag agc ggc ccc cca ccc tcg gac ccg ctg agc gcg ccc ttt 624

Ala Ala Gln Ser Gly Pro Pro Pro Ser Asp Pro Leu Ser Ala Pro Phe

195 200 205

ttg ctg tgg cac ccg ctc tac cac gaa ggc ggc gtg gcg cgg ccc aaa 672

Leu Leu Trp His Pro Leu Tyr His Glu Gly Gly Val Ala Arg Pro Lys

210 215 220

ggc ggc agc ggc ggc ctg acc aaa gcc ctg cgc cgg gcc acc gag gcc 720

Gly Gly Ser Gly Gly Leu Thr Lys Ala Leu Arg Arg Ala Thr Glu Ala

225 230 235 240

gaa ggc ggc gag gtc ttc acc gac gcg ccg gtc aag gaa att ctg gtc 768

Glu Gly Gly Glu Val Phe Thr Asp Ala Pro Val Lys Glu Ile Leu Val

245 250 255

aag gac ggc aag gcg cag ggc atc cgg ctg gaa agc ggc gag acg tac 816

Lys Asp Gly Lys Ala Gln Gly Ile Arg Leu Glu Ser Gly Glu Thr Tyr

260 265 270

acc gcc cgc gcc gtc gtg tcg ggc gtc cac atc ctg acc act gcg aat 864

Thr Ala Arg Ala Val Val Ser Gly Val His Ile Leu Thr Thr Ala Asn

275 280 285

gcc ctg ccc gcc gaa tat gtc cct agc gcc gcc agg aat gtg cgc gtg 912

Ala Leu Pro Ala Glu Tyr Val Pro Ser Ala Ala Arg Asn Val Arg Val

290 295 300

ggc aac ggc ttc ggc atg att ttg cgc ctc gcc ctc agt gaa aaa gtc 960

Gly Asn Gly Phe Gly Met Ile Leu Arg Leu Ala Leu Ser Glu Lys Val

305 310 315 320

aaa tac cgt cac cac acc gag ccc gac tca cgc atc ggc ctg gga ttg 1008

Lys Tyr Arg His His Thr Glu Pro Asp Ser Arg Ile Gly Leu Gly Leu

325 330 335

ctg atc aaa aac gag cgg caa atc atg cag ggc tac ggc gaa tac ctc 1056

Leu Ile Lys Asn Glu Arg Gln Ile Met Gln Gly Tyr Gly Glu Tyr Leu

340 345 350

gcc ggg cag ccc acc acc gac ccg ccc ctc gtc gcc atg agc ttc agc 1104

Ala Gly Gln Pro Thr Thr Asp Pro Pro Leu Val Ala Met Ser Phe Ser

355 360 365

gcg gtg gac gac tcg ctc gcc cca ccg aac ggc gac gtg ttg tgg ctg 1152

Ala Val Asp Asp Ser Leu Ala Pro Pro Asn Gly Asp Val Leu Trp Leu

370 375 380

tgg gcg cag tac tac ccc ttc gag ctc gcc acc ggg agc tgg gaa acg 1200

Trp Ala Gln Tyr Tyr Pro Phe Glu Leu Ala Thr Gly Ser Trp Glu Thr

385 390 395 400

cgc acc gcc gaa gcg cgg gag aac atc ctg cgg gcc ttt gag cac tac 1248

Arg Thr Ala Glu Ala Arg Glu Asn Ile Leu Arg Ala Phe Glu His Tyr

405 410 415

gcg ccg ggc acc cgc gac acg att gtg ggc gaa ctc gtg cag acg ccg 1296

Ala Pro Gly Thr Arg Asp Thr Ile Val Gly Glu Leu Val Gln Thr Pro

420 425 430

cag tgg ctg gaa acc aac ctc ggc ctg cac cgg ggc aac gtg atg cac 1344

Gln Trp Leu Glu Thr Asn Leu Gly Leu His Arg Gly Asn Val Met His

435 440 445

ctg gaa atg tcc ttc gac cag atg ttc tcc ttc cgc ccc tgg ctg aaa 1392

Leu Glu Met Ser Phe Asp Gln Met Phe Ser Phe Arg Pro Trp Leu Lys

450 455 460

gcg agc cag tac cgc tgg ccg ggc gtg cag ggg ctg tac ctc acc ggc 1440

Ala Ser Gln Tyr Arg Trp Pro Gly Val Gln Gly Leu Tyr Leu Thr Gly

465 470 475 480

gcc agc acc cac ccc ggc gga ggc atc atg ggc gcc tcg gga cgc aac 1488

Ala Ser Thr His Pro Gly Gly Gly Ile Met Gly Ala Ser Gly Arg Asn

485 490 495

gcg gcg cgg gtc atc gtg aag gac ctg acg cgg agg cgc tgg aaa tga 1536

Ala Ala Arg Val Ile Val Lys Asp Leu Thr Arg Arg Arg Trp Lys

500 505 510

<210>106

<211>511

<212>PRT

＜213〉the unusual coccus R1 of radiation hardness

<400>106

Met Pro Asp Tyr Asp Leu Ile Val Met Gly Ala Gly His Asn Ala Leu

1 5 10 15

Val Thr Ala Ala Tyr Ala Ala Arg Ala Gly Leu Lys Val Gly Val Phe

20 25 30

Glu Arg Arg His Leu Val Gly Gly Ala Val Ser Thr Glu Glu Val Val

35 40 45

Pro Gly Tyr Arg Phe Asp Tyr Gly Gly Ser Ala His Ile Leu Ile Arg

50 55 60

Met Thr Pro Ile Val Arg Glu Leu Glu Leu Thr Arg His Gly Leu His

65 70 75 80

Tyr Leu Glu Val Asp Pro Met Phe His Ala Ser Asp Gly Glu Thr Pro

85 90 95

Trp Phe Ile His Arg Asp Ala Gly Arg Thr Ile Arg Glu Leu Asp Glu

100 105 110

Lys Phe Pro Gly Gln Gly Asp Ala Tyr Gly Arg Phe Leu Asp Asp Trp

115 120 125

Thr Pro Phe Ala Arg Ala Val Ala Asp Leu Phe Asn Ser Ala Pro Gly

130 135 140

Pro Leu Asp Leu Gly Lys Met Val Met Arg Ser Gly Gln Gly Lys Asp

145 150 155 160

Trp Asn Glu Gln Leu Pro Arg Ile Leu Arg Pro Tyr Gly Asp Val Ala

165 170 175

Arg Glu Tyr Phe Ser Glu Glu Arg Val Arg Ala Pro Leu Thr Trp Met

180 185 190

Ala Ala Gln Ser Gly Pro Pro Pro Ser Asp Pro Leu Ser Ala Pro Phe

195 200 205

Leu Leu Trp His Pro Leu Tyr His Glu Gly Gly Val Ala Arg Pro Lys

210 215 220

Gly Gly Ser Gly Gly Leu Thr Lys Ala Leu Arg Arg Ala Thr Glu Ala

225 230 235 240

Glu Gly Gly Glu Val Phe Thr Asp Ala Pro Val Lys Glu Ile Leu Val

245 250 255

Lys Asp Gly Lys Ala Gln Gly Ile Arg Leu Glu Ser Gly Glu Thr Tyr

260 265 270

Thr Ala Arg Ala Val Val Ser Gly Val His Ile Leu Thr Thr Ala Asn

275 280 285

Ala Leu Pro Ala Glu Tyr Val Pro Ser Ala Ala Arg Asn Val Arg Val

290 295 300

Gly Asn Gly Phe Gly Met Ile Leu Arg Leu Ala Leu Ser Glu Lys Val

305 310 315 320

Lys Tyr Arg His His Thr Glu Pro Asp Ser Arg Ile Gly Leu Gly Leu

325 330 335

Leu Ile Lys Asn Glu Arg Gln Ile Met Gln Gly Tyr Gly Glu Tyr Leu

340 345 350

Ala Gly Gln Pro Thr Thr Asp Pro Pro Leu Val Ala Met Ser Phe Ser

355 360 365

Ala Val Asp Asp Ser Leu Ala Pro Pro Asn Gly Asp Val Leu Trp Leu

370 375 380

Trp Ala Gln Tyr Tyr Pro Phe Glu Leu Ala Thr Gly Ser Trp Glu Thr

385 390 395 400

Arg Thr Ala Glu Ala Arg Glu Asn Ile Leu Arg Ala Phe Glu His Tyr

405 410 415

Ala Pro Gly Thr Arg Asp Thr Ile Val Gly Glu Leu Val Gln Thr Pro

420 425 430

Gln Trp Leu Glu Thr Asn Leu Gly Leu His Arg Gly Asn Val Met His

435 440 445

Leu Glu Met Ser Phe Asp Gln Met Phe Ser Phe Arg Pro Trp Leu Lys

450 455 460

Ala Ser Gln Tyr Arg Trp Pro Gly Val Gln Gly Leu Tyr Leu Thr Gly

465 470 475 480

Ala Ser Thr His Pro Gly Gly Gly Ile Met Gly Ala Ser Gly Arg Asn

485 490 495

Ala Ala Arg Val Ile Val Lys Asp Leu Thr Arg Arg Arg Trp Lys

500 505 510

<210>107

<211>1666

<212>DNA

＜213〉edible tomato (Lycopersicon esculentum)

<220>

<221>CDS

<222>(1)..(1494)

<223>

<400>107

atg gaa gct ctt ctc aag cct ttt cca tct ctt tta ctt tcc tct cct 48

Met Glu Ala Leu Leu Lys Pro Phe Pro Ser Leu Leu Leu Ser Ser Pro

1 5 10 15

aca ccc cat agg tct att ttc caa caa aat ccc tct ttt cta agt ccc 96

Thr Pro His Arg Ser Ile Phe Gln Gln Asn Pro Ser Phe Leu Ser Pro

20 25 30

acc acc aaa aaa aaa tca aga aaa tgt ctt ctt aga aac aaa agt agt 144

Thr Thr Lys Lys Lys Ser Arg Lys Cys Leu Leu Arg Asn Lys Ser Ser

35 40 45

aaa ctt ttt tgt agc ttt ctt gat tta gca ccc aca tca aag cca gag 192

Lys Leu Phe Cys Ser Phe Leu Asp Leu Ala Pro Thr Ser Lys Pro Glu

50 55 60

tct tta gat gtt aac atc tca tgg gtt gat cct aat tcg aat cgg gct 240

Ser Leu Asp Val Asn Ile Ser Trp Val Asp Pro Asn Ser Asn Arg Ala

65 70 75 80

cea ttc gac gtg atc att atc gga gct ggc cct gct ggg ctc agg cta 288

Gln Phe Asp Val Ile Ile Ile Gly Ala Gly Pro Ala Gly Leu Arg Leu

85 90 95

gct gaa caa gtt tct aaa tat ggt att aag gta tgt tgt gtt gac cct 336

Ala Glu Gln Val Ser Lys Tyr Gly Ile Lys Val Cys Cys Val Asp Pro

100 105 110

tca cca ctc tcc atg tgg cca aat aat tat ggt gtt tgg gtt gat gag 384

Ser Pro Leu Ser Met Trp Pro Asn Asn Tyr Gly Val Trp Val Asp Glu

115 120 125

ttt gag aat tta gga ctg gaa aat tgt tta gat cat aaa tgg cct atg 432

Phe Glu Asn Leu Gly Leu Glu Asn Cys Leu Asp His Lys Trp Pro Met

130 135 140

act tgt gtg cat ata aat gat aac aaa act aag tat ttg gga aga cca 480

Thr Cys Val His Ile Asn Asp Asn Lys Thr Lys Tyr Leu Gly Arg Pro

145 150 155 160

tat ggt aga gtt agt aga aag aag ctg aag ttg aaa ttg ttg aat agt 528

Tyr Gly Arg Val Ser Arg Lys Lys Leu Lys Leu Lys Leu Leu Asn Ser

165 170 175

tgt gtt gag aac aga gtg aag ttt tat aaa gct aag gtt tgg aaa gtg 576

Cys Val Glu Asn Arg Val Lys Phe Tyr Lys Ala Lys Val Trp Lys Val

180 185 190

gaa cat gaa gaa ttt gag tct tca att gtt tgt gat gat ggt aag aag 624

Glu His Glu Glu Phe Glu Ser Ser Ile Val Cys Asp Asp Gly Lys Lys

195 200 205

ata aga ggt agt ttg gtt gtg gat gca agt ggt ttt gct agt gat ttt 672

Ile Arg Gly Ser Leu Val Val Asp Ala Ser Gly Phe Ala Ser Asp Phe

210 215 220

ata gag tat gac agg cca aga aac cat ggt tat caa att gct cat ggg 720

Ile Glu Tyr Asp Arg Pro Arg Asn His Gly Tyr Gln Ile Ala His Gly

225 230 235 240

gtt tta gta gaa gtt gat aat cat cca ttt gat ttg gat aaa atg gtg 768

Val Leu Val Glu Val Asp Asn His Pro Phe Asp Leu Asp Lys Met Val

245 250 255

ctt atg gat tgg agg gat tct cat ttg ggt aat gag cca tat tta agg 816

Leu Met Asp Trp Arg Asp Ser His Leu Gly Asn Glu Pro Tyr Leu Arg

260 265 270

gtg aat aat gct aaa gaa cca aca ttc ttg tat gca atg cca ttt gat 864

Val Asn Asn Ala Lys Glu Pro Thr Phe Leu Tyr Ala Met Pro Phe Asp

275 280 285

aga gat ttg gtt ttc ttg gaa gag act tct ttg gtg agt cgt cct gtt 912

Arg Asp Leu Val Phe Leu Glu Glu Thr Ser Leu Val Ser Arg Pro Val

290 295 300

tta tcg tat atg gaa gta aaa aga agg atg gtg gca aga tta agg cat 960

Leu Ser Tyr Met Glu Val Lys Arg Arg Met Val Ala Arg Leu Arg His

305 310 315 320

ttg ggg atc aaa gtg aaa agt gtt att gag gaa gag aaa tgt gtg atc 1008

Leu Gly Ile Lys Val Lys Ser Val Ile Glu Glu Glu Lys Cys Val Ile

325 330 335

cct atg gga gga cca ctt ccg cgg att cct caa aat gtt atg gct att 1056

Pro Met Gly Gly Pro Leu Pro Arg Ile Pro Gln Asn Val Met Ala Ile

340 345 350

ggt ggg aat tca ggg ata gtt cat cca tca aca ggg tac atg gtg gct 1104

Gly Gly Asn Ser Gly Ile Val His Pro Ser Thr Gly Tyr Met Val Ala

355 360 365

agg agc atg gct tta gca cca gta cta gct gaa gcc atc gtc gag ggg 1152

Arg Ser Met Ala Leu Ala Pro Val Leu Ala Glu Ala Ile Val Glu Gly

370 375 380

ctt ggc tca aca aga atg ata aga ggg tct caa ctt tac cat aga gtt 1200

Leu Gly Ser Thr Arg Met Ile Arg Gly Ser Gln Leu Tyr His Arg Val

385 390 395 400

tgg aat ggt ttg tgg cct ttg gat aga aga tgt gtt aga gaa tgt tat 1248

Trp Asn Gly Leu Trp Pro Leu Asp Arg Arg Cys Val Arg Glu Cys Tyr

405 410 415

tca ttt ggg atg gag aca ttg ttg aag ctt gat ttg aaa ggg act agg 1296

Ser Phe Gly Met Glu Thr Leu Leu Lys Leu Asp Leu Lys Gly Thr Arg

420 425 430

aga ttg ttt gac gct ttc ttt gat ctt gat cct aaa tac tgg caa ggg 1344

Arg Leu Phe Asp Ala Phe Phe Asp Leu Asp Pro Lys Tyr Trp Gln Gly

435 440 445

ttc ctt tct tca aga ttg tct gtc aaa gaa ctt ggt tta ctc agc ttg 1392

Phe Leu Ser Ser Arg Leu Ser Val Lys Glu Leu Gly Leu Leu Ser Leu

450 455 460

tgt ctt ttc gga cat ggc tca aac atg act agg ttg gat att gtt aca 1440

Cys Leu Phe Gly His Gly Ser Asn Met Thr Arg Leu Asp Ile Val Thr

465 470 475 480

aaa tgt cct ctt cct ttg gtt aga ctg att ggc aat cta gca ata gag 1488

Lys Cys Pro Leu Pro Leu Val Arg Leu Ile Gly Asn Leu Ala Ile Glu

485 490 495

agc ctt tgaatgtgaa aagtttgaat cattttcttc attttaattt ctttgattat 1544

Ser Leu

tttcatattt tctcaattgc aaaagtgaga taagagctac atactgtcaa caaataaact 1604

actattggaa agttaaaata tgtgtttgtt gtatgttatt ctaatggaat ggattttgta 1664

aa 1666

<210>108

<211>498

<212>PRT

＜213〉edible tomato

<400>108

Met Glu Ala Leu Leu Lys Pro Phe Pro Ser Leu Leu Leu Ser Ser Pro

1 5 10 15

Thr Pro His Arg Ser Ile Phe Gln Gln Asn Pro Ser Phe Leu Ser Pro

20 25 30

Thr Thr Lys Lys Lys Ser Arg Lys Cys Leu Leu Arg Asn Lys Ser Ser

35 40 45

Lys Leu Phe Cys Ser Phe Leu Asp Leu Ala Pro Thr Ser Lys Pro Glu

50 55 60

Ser Leu Asp Val Asn Ile Ser Trp Val Asp Pro Asn Ser Asn Arg Ala

65 70 75 80

Gln Phe Asp Val Ile Ile Ile Gly Ala Gly Pro Ala Gly Leu Arg Leu

85 90 95

Ala Glu Gln Val Ser Lys Tyr Gly Ile Lys Val Cys Cys Val Asp Pro

100 105 110

Ser Pro Leu Ser Met Trp Pro Asn Asn Tyr Gly Val Trp Val Asp Glu

115 120 125

Phe Glu Asn Leu Gly Leu Glu Asn Cys Leu Asp His Lys Trp Pro Met

130 135 140

Thr Cys Val His Ile Asn Asp Asn Lys Thr Lys Tyr Leu Gly Arg Pro

145 150 155 160

Tyr Gly Arg Val Ser Arg Lys Lys Leu Lys Leu Lys Leu Leu Asn Ser

165 170 175

Cys Val Glu Asn Arg Val Lys Phe Tyr Lys Ala Lys Val Trp Lys Val

180 185 190

Glu His Glu Glu Phe Glu Ser Ser Ile Val Cys Asp Asp Gly Lys Lys

195 200 205

Ile Arg Gly Ser Leu Val Val Asp Ala Ser Gly Phe Ala Ser Asp Phe

210 215 220

Ile Glu Tyr Asp Arg Pro Arg Asn His Gly Tyr Gln Ile Ala His Gly

225 230 235 240

Val Leu Val Glu Val Asp Asn His Pro Phe Asp Leu Asp Lys Met Val

245 250 255

Leu Met Asp Trp Arg Asp Ser His Leu Gly Asn Glu Pro Tyr Leu Arg

260 265 270

Val Asn Asn Ala Lys Glu Pro Thr Phe Leu Tyr Ala Met Pro Phe Asp

275 280 285

Arg Asp Leu Val Phe Leu Glu Glu Thr Ser Leu Val Ser Arg Pro Val

290 295 300

Leu Ser Tyr Met Glu Val Lys Arg Arg Met Val Ala Arg Leu Arg His

305 310 315 320

Leu Gly Ile Lys Val Lys Ser Val Ile Glu Glu Glu Lys Cys Val Ile

325 330 335

Pro Met Gly Gly Pro Leu Pro Arg Ile Pro Gln Asn Val Met Ala Ile

340 345 350

Gly Gly Asn Ser Gly Ile Val His Pro Ser Thr Gly Tyr Met Val Ala

355 360 365

Arg Ser Met Ala Leu Ala Pro Val Leu Ala Glu Ala Ile Val Glu Gly

370 375 380

Leu Gly Ser Thr Arg Met Ile Arg Gly Ser Gln Leu Tyr His Arg Val

385 390 395 400

Trp Asn Gly Leu Trp Pro Leu Asp Arg Arg Cys Val Arg Glu Cys Tyr

405 410 415

Ser Phe Gly Met Glu Thr Leu Leu Lys Leu Asp Leu Lys Gly Thr Arg

420 425 430

Arg Leu Phe Asp Ala Phe Phe Asp Leu Asp Pro Lys Tyr Trp Gln Gly

435 440 445

Phe Leu Ser Ser Arg Leu Ser Val Lys Glu Leu Gly Leu Leu Ser Leu

450 455 460

Cys Leu Phe Gly His Gly Ser Asn Met Thr Arg Leu Asp Ile Val Thr

465 470 475 480

Lys Cys Pro Leu Pro Leu Val Arg Leu Ile Gly Asn Leu Ala Ile Glu

485 490 495

Ser Leu

<210>109

<211>1125

<212>DNA

＜213〉edible tomato

<220>

<221>CDS

<222>(20)..(946)

<223>

<400>109

ttggtcatct ccacaatca atg gct gcc gcc gcc aga atc tcc gcc tcc tct 52

Met Ala Ala Ala Ala Arg Ile Ser Ala Ser Ser

1 5 10

acc tca cga act ttt tat ttc cgt cat tca ccg ttt ctt ggc cca aaa 100

Thr Ser Arg Thr Phe Tyr Phe Arg His Ser Pro Phe Leu Gly Pro Lys

15 20 25

cct act tcg aca acc tca cat gtt tct cca atc tct cct ttt tct ctt 148

Pro Thr Ser Thr Thr Ser His Val Ser Pro Ile Ser Pro Phe Ser Leu

30 35 40

aat cta ggc cca att ttg agg tct aga aga aaa ccc agt ttc act gtt 196

Asn Leu Gly Pro Ile Leu Arg Ser Arg Arg Lys Pro Ser Phe Thr Val

45 50 55

tgc ttt gtt ctc gag gat gag aag ctg aaa cct caa ttt gac gat gag 244

Cys Phe Val Leu Glu Asp Glu Lys Leu Lys Pro Gln Phe Asp Asp Glu

60 65 70 75

gct gag gat ttt gaa aag aag att gag gaa cag atc tta gct act cgc 292

Ala Glu Asp Phe Glu Lys Lys Ile Glu Glu Gln Ile Leu Ala Thr Arg

80 85 90

ttg gcg gag aaa ctg gct agg aag aaa tcg gag agg ttt act tat ctt 340

Leu Ala Glu Lys Leu Ala Arg Lys Lys Ser Glu Arg Phe Thr Tyr Leu

95 100 105

gtg gct gct ata atg tct agt ttt ggg att act tct atg gct gtt atg 388

Val Ala Ala Ile Met Ser Ser Phe Gly Ile Thr Ser Met Ala Val Met

110 115 120

gct gtt tat tac aga ttt tcg tgg caa atg gag gga gga gaa gtt cct 436

Ala Val Tyr Tyr Arg Phe Ser Trp Gln Met Glu Gly Gly Glu Val Pro

125 130 135

gta acc gaa atg ttg ggt aca ttt gct ctc tct gtt ggt gct gct gta 484

Val Thr Glu Met Leu Gly Thr Phe Ala Leu Ser Val Gly Ala Ala Val

140 145 150 155

gga atg gag ttt tgg gcg aga tgg gca cac aaa gca ctg tgg cat gct 532

Gly Met Glu Phe Trp Ala Arg Trp Ala His Lys Ala Leu Trp His Ala

160 165 170

tca cta tgg cac atg cat gag tca cac cac aaa cca aga gaa gga cct 580

Ser Leu Trp His Met His Glu Ser His His Lys Pro Arg Glu Gly Pro

175 180 185

ttt gag ctg aac gac gtt ttc gcc ata aca aac gct gtt cca gca ata 628

Phe Glu Leu Agn Asp Val Phe Ala Ile Thr Asn Ala Val Pro Ala Ile

190 195 200

gcc ctc ctc aac tat ggt ttc ttc cat aaa ggc ctc att gcc gga cta 676

Ala Leu Leu Asn Tyr Gly Phe Phe His Lys Gly Leu Ile Ala Gly Leu

205 210 215

tgc ttc ggt gct ggg cta ggg atc aca gta ttt gga atg gca tac atg 724

Cys Phe Gly Ala Gly Leu Gly Ile Thr Val Phe Gly Met Ala Tyr Met

220 225 230 235

ttt gtt cac gat ggt ttg gtt cac aag aga ttc cca gtt gga cct gta 772

Phe Val His Asp Gly Leu Val His Lys Arg Phe Pro Val Gly Pro Val

240 245 250

gcc aat gta cct tat ctt agg aag gtg gct gct gct cat tcg ctt cat 820

Ala Asn Val Pro Tyr Leu Arg Lys Val Ala Ala Ala His Ser Leu His

255 260 265

cac tca gag aag ttc aat ggt gtc cca tat ggc ttg ttc ttc gga cct 868

His Ser Glu Lys Phe Asn Gly Val Pro Tyr Gly Leu Phe Phe Gly Pro

270 275 280

aag gaa ctg gaa gaa gta gga ggg acg gaa gag ttg gaa aag gaa gtg 916

Lys Glu Leu Glu Glu Val Gly Gly Thr Glu Glu Leu Glu Lys Glu Val

285 290 295

ata cga agg acg aga ctt tcg aaa gga tca tgaacgattg ttcataaaca 966

Ile Arg Arg Thr Arg Leu Ser Lys Gly Ser

300 305

tagaatgtca ttttacactt cttatcaatg aggaagggtg atttttgatg tatttgatag 1026

tagagaaaaa tgtagctctc ttgatgaaat gaatttgtat ttatgtaggc tcttcttatt 1086

cagtaagatt ttttcttttt tttgatctcg tgccgaatt 1125

<210>110

<211>309

<212>PRT

＜213〉edible tomato

<400>110

Met Ala Ala Ala Ala Arg Ile Ser Ala Ser Ser Thr Ser Arg Thr Phe

1 5 10 15

Tyr Phe Arg His Ser Pro Phe Leu Gly Pro Lys Pro Thr Ser Thr Thr

20 25 30

Ser His Val Ser Pro Ile Ser Pro Phe Ser Leu Asn Leu Gly Pro Ile

35 40 45

Leu Arg Ser Arg Arg Lys Pro Ser Phe Thr Val Cys Phe Val Leu Glu

50 55 60

Asp Glu Lys Leu Lys Pro Gln Phe Asp Asp Glu Ala Glu Asp Phe Glu

65 70 75 80

Lys Lys Ile Glu Glu Gln Ile Leu Ala Thr Arg Leu Ala Glu Lys Leu

85 90 95

Ala Arg Lys Lys Ser Glu Arg Phe Thr Tyr Leu Val Ala Ala Ile Met

100 105 110

Ser Ser Phe Gly Ile Thr Ser Met Ala Val Met Ala Val Tyr Tyr Arg

115 120 125

Phe Ser Trp Gln Met Glu Gly Gly Glu Val Pro Val Thr Glu Met Leu

130 135 140

Gly Thr Phe Ala Leu Ser Val Gly Ala Ala Val Gly Met Glu Phe Trp

145 150 155 160

Ala Arg Trp Ala His Lys Ala Leu Trp His Ala Ser Leu Trp His Met

165 170 175

His Glu Ser His His Lys Pro Arg Glu Gly Pro Phe Glu Leu Asn Asp

180 185 190

Val Phe Ala Ile Thr Asn Ala Val Pro Ala Ile Ala Leu Leu Asn Tyr

195 200 205

Gly Phe Phe His Lys Gly Leu Ile Ala Gly Leu Cys Phe Gly Ala Gly

210 215 220

Leu Gly Ile Thr Val Phe Gly Met Ala Tyr Met Phe Val His Asp Gly

225 230 235 240

Leu Val His Lys Arg Phe Pro Val Gly Pro Val Ala Asn Val Pro Tyr

245 250 255

Leu Arg Lys Val Ala Ala Ala His Ser Leu His His Ser Glu Lys Phe

260 265 270

Asn Gly Val Pro Tyr Gly Leu Phe Phe Gly Pro Lys Glu Leu Glu Glu

275 280 285

Val Gly Gly Thr Glu Glu Leu Glu Lys Glu Val Ile Arg Arg Thr Arg

290 295 300

Leu Ser Lys Gly Ser

305

<210>111

<211>1779

<212>DNA

＜213〉mouseearcress

<220>

<221>CDS

<222>(1)..(1779)

<223>

<400>111

atg gat ctc cgt cgg agg cct cct aaa cca ccg gtt acc aac aac aac 48

Met Asp Leu Arg Arg Arg Pro Pro Lys Pro Pro Val Thr Asn Asn Asn

1 5 10 15

aac tcc aac gga tct ttc cgt tct tat cag cct cgc act tcc gat gac 96

Asn Ser Asn Gly Ser Phe Arg Ser Tyr Gln Pro Arg Thr Ser Asp Asp

20 25 30

gat cat cgt cgc cgg gct aca aca att gct cct cca ccg aaa gca tcc 144

Asp His Arg Arg Arg Ala Thr Thr Ile Ala Pro Pro Pro Lys Ala Ser

35 40 45

gac gcg ctt cct ctt ccg tta tat ctc aca aac gcc gtt ttc ttc acg 192

Asp Ala Leu Pro Leu Pro Leu Tyr Leu Thr Asn Ala Val Phe Phe Thr

50 55 60

ctc ttc ttc tcc gtc gcg tat tac ctc ctc cac cgg tgg cgt gac aag 240

Leu Phe Phe Ser Val Ala Tyr Tyr Leu Leu His Arg Trp Arg Asp Lys

65 70 75 80

atc cgt tac aat acg cct ctt cac gtc gtc act atc aca gaa ctc ggc 288

Ile Arg Tyr Asn Thr Pro Leu His Val Val Thr Ile Thr Glu Leu Gly

85 90 95

gcc att att gct ctc atc gct tcg ttt atc tat ctc cta ggg ttt ttt 336

Ala Ile Ile Ala Leu Ile Ala Ser Phe Ile Tyr Leu Leu Gly Phe Phe

100 105 110

ggt att gac ttt gtt cag tca ttt atc tca cgt gcc tct ggt gat gct 384

Gly Ile Asp Phe Val Gln Ser Phe Ile Ser Arg Ala Ser Gly Asp Ala

115 120 125

tgg gat ctc gcc gat acg atc gat gat gat gac cac cgc ctt gtc acg 432

Trp Asp Leu Ala Asp Thr Ile Asp Asp Asp Asp His Arg Leu Val Thr

130 135 140

tgc tct cca ccg act ccg atc gtt tcc gtt gct aaa tta cct aat ccg 480

Cys Ser Pro Pro Thr Pro Ile Val Ser Val Ala Lys Leu Pro Asn Pro

145 150 155 160

gaa cct att gtt acc gaa tcg ctt cct gag gaa gac gag gag att gtg 528

Glu Pro Ile Val Thr Glu Ser Leu Pro Glu Glu Asp Glu Glu Ile Val

165 170 175

aaa tcg gtt atc gac gga gtt att cca tcg tac tcg ctt gaa tct cgt 576

Lys Ser Val Ile Asp Gly Val Ile Pro Ser Tyr Ser Leu Glu Ser Arg

180 185 190

ctc ggt gat tgc aaa aga gcg gcg tcg att cgt cgt gag gcg ttg cag 624

Leu Gly Asp Cys Lys Arg Ala Ala Ser Ile Arg Arg Glu Ala Leu Gln

195 200 205

aga gtc acc ggg aga tcg att gaa ggg tta ccg ttg gat gga ttt gat 672

Arg Val Thr Gly Arg Ser Ile Glu Gly Leu Pro Leu Asp Gly Phe Asp

210 215 220

tat gaa tcg att ttg ggg caa tgc tgt gag atg cct gtt gga tac att 720

Tyr Glu Ser Ile Leu Gly Gln Cys Cys Glu Met Pro Val Gly Tyr Ile

225 230 235 240

cag att cct gtt ggg att gct ggt cca ttg ttg ctt gat ggt tat gag 768

Gln Ile Pro Val Gly Ile Ala Gly Pro Leu Leu Leu Asp Gly Tyr Glu

245 250 255

tac tct gtt cct atg gct aca acc gaa ggt tgt ttg gtt gct agc act 816

Tyr Ser Val Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Thr

260 265 270

aac aga ggc tgc aag gct atg ttt atc tct ggt ggc gcc acc agt acc 864

Asn Arg Gly Cys Lys Ala Met Phe Ile Ser Gly Gly Ala Thr Ser Thr

275 280 285

gtt ctt aag gac ggt atg acc cga gca cct gtt gtt cgg ttc gct tcg 912

Val Leu Lys Asp Gly Met Thr Arg Ala Pro Val Val Arg Phe Ala Ser

290 295 300

gcg aga cga gct tcg gag ctt aag ttt ttc ttg gag aat cca gag aac 960

Ala Arg Arg Ala Ser Glu Leu Lys Phe Phe Leu Glu Asn Pro Glu Asn

305 310 315 320

ttt gat act ttg gca gta gtc ttc aac agg tcg agt aga ttt gca aga 1008

Phe Asp Thr Leu Ala Val Val Phe Asn Arg Ser Ser Arg Phe Ala Arg

325 330 335

ctg caa agt gtt aaa tgc aca atc gcg ggg aag aat gct tat gta agg 1056

Leu Gln Ser Val Lys Cys Thr Ile Ala Gly Lys Asn Ala Tyr Val Arg

340 345 350

ttc tgt tgt agt act ggt gat gct atg ggg atg aat atg gtt tct aaa 1104

Phe Cys Cys Ser Thr Gly Asp Ala Met Gly Met Asn Met Val Ser Lys

355 360 365

ggt gtg cag aat gtt ctt gag tat ctt acc gat gat ttc cct gac atg 1152

Gly Val Gln Asn Val Leu Glu Tyr Leu Thr Asp Asp Phe Pro Asp Met

370 375 380

gat gtg att gga atc tct ggt aac ttc tgt tcg gac aag aaa cct gct 1200

Asp Val Ile Gly Ile Ser Gly Asn Phe Cys Ser Asp Lys Lys Pro Ala

385 390 395 400

gct gtg aac tgg att gag gga cgt ggt aaa tca gtt gtt tgc gag gct 1248

Ala Val Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Cys Glu Ala

405 410 415

gta atc aga gga gag atc gtg aac aag gtc ttg aaa acg agc gtg gct 1296

Val Ile Arg Gly Glu Ile Val Asn Lys Val Leu Lys Thr Ser Val Ala

420 425 430

gct tta gtc gag ctc aac atg ctc aag aac cta gct ggc tct gct gtt 1344

Ala Leu Val Glu Leu Asn Met Leu Lys Asn Leu Ala Gly Ser Ala Val

435 440 445

gca ggc tct cta ggt gga ttc aac gct cat gcc agt aac ata gtg tct 1392

Ala Gly Ser Leu Gly Gly Phe Asn Ala His Ala Ssr Asn Ile Val Ser

450 455 460

gct gta ttc ata gct act ggc caa gat cca gct caa aac gtg gag agt 1440

Ala Val Phe Ile Ala Thr Gly Gln Asp Pro Ala Gln Asn Val Glu Ser

465 470 475 480

tct caa tgc atc acc atg atg gaa gct att aat gac ggc aaa gat atc 1488

Ser Gln Cys Ile Thr Met Met Glu Ala Ile Asn Asp Gly Lys Asp Ile

485 490 495

cat atc tca gtc act atg cca tct atc gag gtg ggg aca gtg gga gga 1536

His Ile Ser Val Thr Met Pro Ser Ile Glu Val Gly Thr Val Gly Gly

500 505 510

gga aca cag ctt gca tct caa tca gcg tgt tta aac ctg ctc gga gtt 1584

Gly Thr Gln Leu Ala Ser Gln Ser Ala Cys Leu Asn Leu Leu Gly Val

515 520 525

aaa gga gca agc aca gag tcg ccg gga atg aac gca agg agg cta gcg 1632

Lys Gly Ala Ser Thr Glu Ser Pro Gly Met Asn Ala Arg Arg Leu Ala

530 535 540

acg atc gta gcc gga gca gtt tta gct gga gag tta tct tta atg tca 1680

Thr Ile Val Ala Gly Ala Val Leu Ala Gly Glu Lau Ser Leu Met Ser

545 550 555 560

gca att gca gct gga cag ctt gtg aga agt cac atg aaa tac aat aga 1728

Ala Ile Ala Ala Gly Gln Leu Val Arg Ser His Met Lys Tyr Asn Arg

565 570 575

tcc agc cga gac atc tct gga gca acg aca acg aca aca acs aca aca 1776

Ser Ser Arg Asp Ile Ser Gly Ala Thr Thr Thr Thr Thr Thr Thr Thr

580 585 590

tga 1779

<210>112

<211>592

<212>PRT

＜213〉mouseearcress

<400>112

Met Asp Leu Arg Arg Arg Pro Pro Lys Pro Pro Val Thr Asn Asn Asn

1 5 10 15

Asn Ser Asn Gly Ser Phe Arg Ser Tyr Gln Pro Arg Thr Ser Asp Asp

20 25 30

Asp His Arg Arg Arg Ala Thr Thr Ile Ala Pro Pro Pro Lys Ala Ser

35 40 45

Asp Ala Leu Pro Leu Pro Leu Tyr Leu Thr Asn Ala Val Phe Phe Thr

50 55 60

Leu Phe Phe Ser Val Ala Tyr Tyr Leu Leu His Arg Trp Arg Asp Lys

65 70 75 80

Ile Arg Tyr Asn Thr Pro Leu His Val Val Thr Ile Thr Glu Leu Gly

85 90 95

Ala Ile Ile Ala Leu Ile Ala Ser Phe Ile Tyr Leu Leu Gly Phe Phe

100 105 110

Gly Ile Asp Phe Val Gln Ser Phe Ile Ser Arg Ala Ser Gly Asp Ala

115 120 125

Trp Asp Leu Ala Asp Thr Ile Asp Asp Asp Asp His Arg Leu Val Thr

130 135 140

Cys Ser Pro Pro Thr Pro Ile Val Ser Val Ala Lys Leu Pro Asn Pro

145 150 155 160

Glu Pro Ile Val Thr Glu Ser Leu Pro Glu Glu Asp Glu Glu Ile Val

165 170 175

Lys Ser Val Ile Asp Gly Val Ile Pro Ser Tyr Ser Leu Glu Ser Arg

180 185 190

Leu Gly Asp Cys Lys Arg Ala Ala Ser Ile Arg Arg Glu Ala Leu Gln

195 200 205

Arg Val Thr Gly Arg Ser Ile Glu Gly Leu Pro Leu Asp Gly Phe Asp

210 215 220

Tyr Glu Ser Ile Leu Gly Gln Cys Cys Glu Met Pro Val Gly Tyr Ile

225 230 235 240

Gln Ile Pro Val Gly Ile Ala Gly Pro Leu Leu Leu Asp Gly Tyr Glu

245 250 255

Tyr Ser Val Pro Met Ala Thr Thr Glu Gly Cys Leu Val Ala Ser Thr

260 265 270

Asn Arg Gly Cys Lys Ala Met Phe Ile Ser Gly Gly Ala Thr Ser Thr

275 280 285

Val Leu Lys Asp Gly Met Thr Arg Ala Pro Val Val Arg Phe Ala Ser

290 295 300

Ala Arg Arg Ala Ser Glu Leu Lys Phe Phe Leu Glu Asn Pro Glu Asn

305 310 315 320

Phe Asp Thr Leu Ala Val Val Phe Asn Arg Ser Ser Arg Phe Ala Arg

325 330 335

Leu Gln Ser Val Lys Cys Thr Ile Ala Gly Lys Asn Ala Tyr Val Arg

340 345 350

Phe Cys Cys Ser Thr Gly Asp Ala Met Gly Met Asn Met Val Ser Lys

355 360 365

Gly Val Gln Asn Val Leu Glu Tyr Leu Thr Asp Asp Phe Pro Asp Met

370 375 380

Asp Val Ile Gly Ile Ser Gly Asn Phe Cys Ser Asp Lys Lys Pro Ala

385 390 395 400

Ala Val Asn Trp Ile Glu Gly Arg Gly Lys Ser Val Val Cys Glu Ala

405 410 415

Val Ile Arg Gly Glu Ile Val Asn Lys Val Leu Lys Thr Ser Val Ala

420 425 430

Ala Leu Val Glu Leu Asn Met Leu Lys Asn Leu Ala Gly Ser Ala Val

435 440 445

Ala Gly Ser Leu Gly Gly Phe Asn Ala His Ala Ser Asn Ile Val Ser

450 455 460

Ala Val Phe Ile Ala Thr Gly Gln Asp Pro Ala Gln Asn Val Glu Ser

465 470 475 480

Ser Gln Cys Ile Thr Met Met Glu Ala Ile Asn Asp Gly Lys Asp Ile

485 490 495

His Ile Ser Val Thr Met Pro Ser Ile Glu Val Gly Thr Val Gly Gly

500 505 510

Gly Thr Gln Leu Ala Ser Gln Ser Ala Cys Leu Asn Leu Leu Gly Val

515 520 525

Lys Gly Ala Ser Thr Glu Ser Pro Gly Met Asn Ala Arg Arg Leu Ala

530 535 540

Thr Ile Val Ala Gly Ala Val Leu Ala Gly Glu Leu Ser Leu Met Ser

545 550 555 560

Ala Ile Ala Ala Gly Gln Leu Val Arg ser His Met Lys Tyr Asn Arg

565 570 575

Ser Ser Arg Asp Ile Ser Gly Ala Thr Thr Thr Thr Thr Thr Thr Thr

580 585 590

<210>113

<211>1401

<212>DNA

＜213〉mouseearcress ISPH

<220>

<221>CDS

<222>(1)..(1401)

<223>

<400>113

atg gct gtt gcg ctc caa ttc agc cga tta tgc gtt cga ccg gat act 48

Met Ala Val Ala Leu Gln Phe Ser Arg Leu Cys Val Arg Pro Asp Thr

1 5 10 15

ttc gtg cgg gag aat cat ctc tct gga tcc gga tct ctc cgc cgc cgg 96

Phe Val Arg Glu Asn His Leu Ser Gly Ser Gly Ser Leu Arg Arg Arg

20 25 30

aaa gct tta tca gtc cgg tgc tcg tct ggc gat gag aac gct cct tcg 144

Lys Ala Leu Ser Val Arg Cys Ser Ser Gly Asp Glu Asn Ala Pro Ser

35 40 45

cca tcg gtg gtg atg gac tcc gat ttc gac gcc aag gtg ttc cgt aag 192

Pro Ser Val Val Met Asp Ser Asp Phe Asp Ala Lys Val Phe Arg Lys

50 55 60

aac ttg acg aga agc gat aat tac aat cgt aaa ggg ttc ggt cat aag 240

Asn Leu Thr Arg Ser Asp Asn Tyr Asn Arg Lys Gly Phe Gly His Lys

65 70 75 80

gag gag aca ctc aag ctc atg aat cga gag tac acc agt gat ata ttg 288

Glu Glu Thr Leu Lys Leu Met Asn Arg Glu Tyr Thr Ser Asp Ile Leu

85 90 95

gag aca ctg aaa aca aat ggg tat act tat tct tgg gga gat gtt act 336

Glu Thr Leu Lys Thr Asn Gly Tyr Thr Tyr Ser Trp Gly Asp Val Thr

100 105 110

gtg aaa ctc gct aaa gca tat ggt ttt tgc tgg ggt gtt gag cgt gct 384

Val Lys Leu Ala Lys Ala Tyr Gly Phe Cys Trp Gly Val Glu Arg Ala

115 120 125

gtt cag att gca tat gaa gca cga aag cag ttt cca gag gag agg ctt 432

Val Gln Ile Ala Tyr Glu Ala Arg Lys Gln Phe Pro Glu Glu Arg Leu

130 135 140

tgg att act aac gaa atc att cat aac ccg acc gtc aat aag agg ttg 480

Trp Ile Thr Asn Glu Ile Ile His Asn Pro Thr Val Asn Lys Arg Leu

145 150 155 160

gaa gat atg gat gtt aaa att att ccg gtt gag gat tca aag aaa cag 528

Glu Asp Met Asp Val Lys Ile Ile Pro Val Glu Asp Ser Lys Lys Gln

165 170 175

ttt gat gta gta gag aaa gat gat gtg gtt atc ctt cct gcg ttt gga 576

Phe Asp Val Val Glu Lys Asp Asp Val Val Ile Leu Pro Ala Phe Gly

180 185 190

gct ggt gtt gac gag atg tat gtt ctt aat gat aaa aag gtg caa att 624

Ala Gly Val Asp Glu Met Tyr Val Leu Asn Asp Lys Lys Val Gln Ile

195 200 205

gtt gac acg act tgt cct tgg gtg aca aag gtc tgg aac acg gtt gag 672

Val Asp Thr Thr Cys Pro Trp Val Thr Lys Val Trp Asn Thr Val Glu

210 215 220

aag cac aag aag ggg gaa tac aca tca gta atc cat ggt aaa tat aat 720

Lys His Lys Lys Gly Glu Tyr Thr Ser Val Ile His Gly Lys Tyr Asn

225 230 235 240

cat gaa gag acg att gca act gcg tct ttt gca gga aag tac atc att 768

His Glu Glu Thr Ile Ala Thr Ala Ser Phe Ala Gly Lys Tyr Ile Ile

245 250 255

gta aag aac atg aaa gag gca aat tac gtt tgt gat tac att ctc ggt 816

Val Lys Asn Met Lys Glu Ala Asn Tyr Val Cys Asp Tyr Ile Leu Gly

260 265 270

ggc cae tac gat gga tct agc tcc aca aaa gag gag ttc atg gag aaa 864

Gly Gln Tyr Asp Gly Ser Ser Ser Thr Lys Glu Glu Phe Met Glu Lys

275 280 285

ttc aaa tac gca att tcg aag ggt ttc gat ccc gac aat gac ctt gtc 912

Phe Lys Tyr Ala Ile Ser Lys Gly Phe Asp Pro Asp Asn Asp Leu Val

290 295 300

aaa gtt ggt att gca aac caa aca acg atg cta aag gga gaa aca gag 960

Lys Val Gly Ile Ala Asn Gln Thr Thr Met Leu Lys Gly Glu Thr Glu

305 310 315 320

gag ata gga aga tta ctc gag aca aca atg atg cgc aag tat gga gtg 1008

Glu Ile Gly Arg Leu Leu Glu Thr Thr Met Met Arg Lys Tyr Gly Val

325 330 335

gaa aat gta agc gga cat ttc atc agc ttc aac aca ata tgc gac gct 1056

Glu Asn Val Ser Gly His Phe Ile Ser Phe Asn Thr Ile Cys Asp Ala

340 345 350

act caa gag cga caa gac gca atc tat gag cta gtg gaa gag aag att 1104

Thr Gln Glu Arg Gln Asp Ala Ile Tyr Glu Leu Val Glu Glu Lys Ile

355 360 365

gac ctc atg cta gtg gtt ggc gga tgg aat tca agt aac acc tct cac 1152

Asp Leu Met Leu Val Val Gly Gly Trp Asn Ser Ser Asn Thr Ser His

370 375 380

ctt cag gaa atc tca gag gca cgg gga atc cca tct tac tgg atc gat 1200

Leu Gln Glu Ile Ser Glu Ala Arg Gly Ile Pro Ser Tyr Trp Ile Asp

385 390 395 400

agt gag aaa cgg ata gga cct ggg aat aaa ata gcc tat aag ctc cac 1248

Ser Glu Lys Arg Ile Gly Pro Gly Asn Lys Ile Ala Tyr Lys Leu His

405 410 415

tat gga gaa ctg gtc gag aag gaa aac ttt ctc cca aag gga cca ata 1296

Tyr Gly Glu Leu Val Glu Lys Glu Asn Phe Leu Pro Lys Gly Pro Ile

420 425 430

aca atc ggt gtg aca tca ggt gca tca acc ccg gat aag gtc gtg gaa 1344

Thr Ile Gly Val Thr Ser Gly Ala Ser Thr Pro Asp Lys Val Val Glu

435 440 445

gat gct ttg gtg aag gtg ttc gac att aaa cgt gaa gag tta ttg cag 1392

Asp Ala Leu Val Lys Val Phe Asp Ile Lys Arg Glu Glu Leu Leu Gln

450 455 460

ctg gct tga 1401

Leu Ala

465

<210>114

<211>466

<212>PRT

＜213〉mouseearcress ISPH

<400>114

Met Ala Val Ala Leu Gln Phe Ser Arg Leu Cys Val Arg Pro Asp Thr

1 5 10 15

Phe Val Arg Glu Asn His Leu Ser Gly Ser Gly Ser Leu Arg Arg Arg

20 25 30

Lys Ala Leu Ser Val Arg Cys Ser Ser Gly Asp Glu Asn Ala Pro Ser

35 40 45

Pro Ser Val Val Met Asp Ser Asp Phe Asp Ala Lys Val Phe Arg Lys

50 55 60

Asn Leu Thr Arg Ser Asp Asn Tyr Asn Arg Lys Gly Phe Gly His Lys

65 70 75 80

Glu Glu Thr Leu Lys Leu Met Asn Arg Glu Tyr Thr Ser Asp Ile Leu

85 90 95

Glu Thr Leu Lys Thr Asn Gly Tyr Thr Tyr Ser Trp Gly Asp Val Thr

100 105 110

Val Lys Leu Ala Lys Ala Tyr Gly Phe Cys Trp Gly Val Glu Arg Ala

115 120 125

Val Gln Ile Ala Tyr Glu Ala Arg Lys Gln Phe Pro Glu Glu Arg Leu

130 135 140

Trp Ile Thr Asn Glu Ile Ile His Asn Pro Thr Val Asn Lys Arg Leu

145 150 155 160

Glu Asp Met Asp Val Lys Ile Ile Pro Val Glu Asp Ser Lys Lys Gln

165 170 175

Phe Asp Val Val Glu Lys Asp Asp Val Val Ile Leu Pro Ala Phe Gly

180 185 190

Ala Gly Val Asp Glu Met Tyr Val Leu Asn Asp Lys Lys Val Gln Ile

195 200 205

Val Asp Thr Thr Cys Pro Trp Val Thr Lys Val Trp Asn Thr Val Glu

210 215 220

Lys His Lys Lys Gly Glu Tyr Thr Ser Val Ile His Gly Lys Tyr Asn

225 230 235 240

His Glu Glu Thr Ile Ala Thr Ala Ser Phe Ala Gly Lys Tyr Ile Ile

245 250 255

Val Lys Asn Met Lys Glu Ala Asn Tyr Val Cys Asp Tyr Ile Leu Gly

260 265 270

Gly Gln Tyr Asp Gly Ser Ser Ser Thr Lys Glu Glu Phe Met Glu Lys

275 280 285

Phe Lys Tyr Ala Ile Ser Lys Gly Phe Asp Pro Asp Asn Asp Leu Val

290 295 300

Lys Val Gly Ile Ala Asn Gln Thr Thr Met Leu Lys Gly Glu Thr Glu

305 310 315 320

Glu Ile Gly Arg Leu Leu Glu Thr Thr Met Met Arg Lys Tyr Gly Val

325 330 335

Glu Asn Val Ser Gly His Phe Ile Ser Phe Asn Thr Ile Cys Asp Ala

340 345 350

Thr Gln Glu Arg Gln Asp Ala Ile Tyr Glu Leu Val Glu Glu Lys Ile

355 360 365

Asp Leu Met Leu Val Val Gly Gly Trp Asn Ser Ser Asn Thr Ser His

370 375 380

Leu Gln Glu Ile Ser Glu Ala Arg Gly Ile Pro Ser Tyr Trp Ile Asp

385 390 395 400

Ser Glu Lys Arg Ile Gly Pro Gly Asn Lys Ile Ala Tyr Lys Leu His

405 410 415

Tyr Gly Glu Leu Val Glu Lys Glu Asn Phe Leu Pro Lys Gly Pro Ile

420 425 430

Thr Ile Gly Val Thr Ser Gly Ala Ser Thr Pro Asp Lys Val Val Glu

435 440 445

Asp Ala Leu Val Lys Val Phe Asp Ile Lys Arg Glu Glu Leu Leu Gln

450 455 460

Leu Ala

465

<210>115

<211>2160

<212>DNA

＜213〉edible tomato

<220>

<221>CDS

<222>(1)..(2160)

<223>

<400>115

atg gct ttg tgt gct tat gca ttt cct ggg att ttg aac agg act ggt 48

Met Ala Leu Cys Ala Tyr Ala Phe Pro Gly Ile Leu Asn Arg Thr Gly

1 5 10 15

gtg gtt tca gat tct tct aag gca acc cct ttg ttc tct gga tgg att 96

Val Val Ser Asp Ser Ser Lys Ala Thr Pro Leu Phe Ser Gly Trp Ile

20 25 30

cat gga aca gat ctg cag ttt ttg ttc caa cac aag ctt act cat gag 144

His Gly Thr Asp Leu Gln Phe Leu Phe Gln His Lys Leu Thr His Glu

35 40 45

gtc aag aaa agg tca cgt gtg gtt cag gct tcc tta tca gaa tct gga 192

Val Lys Lys Arg Ser Arg Val Val Gln Ala Ser Leu Ser Glu Ser Gly

50 55 60

gaa tac tac aca cag aga ccg cca acg cct att ttg gac act gtg aac 240

Glu Tyr Tyr Thr Gln Arg Pro Pro Thr Pro Ile Leu Asp Thr Val Asn

65 70 75 80

tat ccc att cat atg aaa aat ctg tct ctg aag gaa ctt aaa caa cta 288

Tyr Pro Ile His Met Lys Asn Leu Ser Leu Lys Glu Leu Lys Gln Leu

85 90 95

gca gat gaa cta agg tca gat aca att ttc aat gta tca aag act ggg 336

Ala Asp Glu Leu Arg Ser Asp Thr Ile Phe Asn Val Ser Lys Thr Gly

100 105 110

ggt cac ctt ggc tca agt ctt ggt gtt gtt gag ctg act gtt gct ctt 384

Gly His Leu Gly Ser Ser Leu Gly Val Val Glu Leu Thr Val Ala Leu

115 120 125

cat tat gtc ttc aat gca ccg caa gat agg att ctc tgg gat gtt ggt 432

His Tyr Val Phe Asn Ala Pro Gln Asp Arg Ile Leu Trp Asp Val Gly

130 135 140

cat cag tct tat cct cac aaa atc ttg act ggt aga agg gac aag atg 480

His Gln Ser Tyr Pro His Lys Ile Leu Thr Gly Arg Arg Asp Lys Met

145 150 155 160

tcg aca tta agg cag aca gat ggt ctt gca gga ttt act aag cga tcg 528

Ser Thr Leu Arg Gln Thr Asp Gly Leu Ala Gly Phe Thr Lys Arg Ser

165 170 175

gag agt gaa tat gat tgc ttt ggc acc ggc cac agt tcc acc acc atc 576

Glu Ser Glu Tyr Asp Cys Phe Gly Thr Gly His Ser Ser Thr Thr Ile

180 185 190

tca gca ggc cta ggg atg gct gtt ggt aga gat cta aaa gga aga aac 624

Ser Ala Gly Leu Gly Met Ala Val Gly Arg Asp Leu Lys Gly Arg Asn

195 200 205

aac aat gtt att gcc gta ata ggt gat ggt gcc atg aca gca ggt caa 672

Asn Asn Val Ile Ala Val Ile Gly Asp Gly Ala Met Thr Ala Gly Gln

210 215 220

gct tat gaa gcc atg aat aat gct ggt tac ctg gac tct gac atg att 720

Ala Tyr Glu Ala Met Asn Asn Ala Gly Tyr Leu Asp Ser Asp Met Ile

225 230 235 240

gtt atc tta aac gac aat aga caa gtt tct tta cct act gct act ctg 768

Val Ile Leu Asn Asp Asn Arg Gln Val Ser Leu Pro Thr Ala Thr Leu

245 250 255

gat ggg cca gtt gct cct gtt gga gct cta agt agt gct ttg agc agg 816

Asp Gly Pro Val Ala Pro Val Gly Ala Leu Ser Ser Ala Leu Ser Arg

260 265 270

tta cag tct aat agg cct ctc aga gaa cta aga gaa gtc gca aag gga 864

Leu Gln Ser Asn Arg Pro Leu Arg Glu Leu Arg Glu Val Ala Lys Gly

275 280 285

gtt act aag cag att ggt ggt cct atg cat gag ctt gct gca aaa gtt 912

Val Thr Lys Gln Ile Gly Gly Pro Met His Glu Leu Ala Ala Lys Val

290 295 300

gat gaa tat gct cgt ggc atg att agt ggt tct gga tca aca ttg ttt 960

Asp Glu Tyr Ala Arg Gly Met Ile Ser Gly Ser Gly Ser Thr Leu Phe

305 310 315 320

gaa gaa ctt gga ctt tac tat att ggt cct gtg gat ggt cac aac att 1008

Glu Glu Leu Gly Leu Tyr Tyr Ile Gly Pro Val Asp Gly His Asn Ile

325 330 335

gat gat cta att gcg att ctc aaa gag gtt aga agt act aaa aca aca 1056

Asp Asp Leu Ile Ala Ile Leu Lys Glu Val Arg Ser Thr Lys Thr Thr

340 345 350

ggt cca gta ctg atc cat gtt gtc act gag aaa ggc aga ggt tat cca 1104

Gly Pro Val Leu Ile His Val Val Thr Glu Lys Gly Arg Gly Tyr Pro

355 360 365

tat gct gag aga gct gca gat aag tat cat gga gtt gcc aag ttt gat 1152

Tyr Ala Glu Arg Ala Ala Asp Lys Tyr His Gly Val Ala Lys Phe Asp

370 375 380

cca gca aca gga aag caa ttc aaa gcc agt gcc aag aca cag tcc tat 1200

Pro Ala Thr Gly Lys Gln Phe Lys Ala Ser Ala Lys Thr Gln Ser Tyr

385 390 395 400

aca aca tat ttt gcc gag gct tta att gca gaa gca gaa gca gat aaa 1248

Thr Thr Tyr Phe Ala Glu Ala Leu Ile Ala Glu Ala Glu Ala Asp Lys

405 410 415

gac att gtt gca atc cat gct gcc atg ggg ggt ggg acc gga atg aac 1296

Asp Ile Val Ala Ile His Ala Ala Met Gly Gly Gly Thr Gly Met Asn

420 425 430

ctt ttc cat cgt cgc ttc cca aca agg tgt ttt gat gtt gga ata gca 1344

Leu Phe His Arg Arg Phe Pro Thr Arg Cys Phe Asp Val Gly Ile Ala

435 440 445

gaa caa cat gca gta acc ttt gct gct gga ttg gct tgt gaa ggc att 1392

Glu Gln His Ala Val Thr Phe Ala Ala Gly Leu Ala Cys Glu Gly Ile

450 455 460

aaa cct ttc tgt gca atc tat tcg tct ttc atg cag agg gct tat gac 1440

Lys Pro Phe Cys Ala Ile Tyr Ser Ser Phe Met Gln Arg Ala Tyr Asp

465 470 475 480

cag gta gtg cat gac gtt gat ttg caa aag ctg ccc gtg agg ttt gca 1488

Gln Val Val His Asp Val Asp Leu Gln Lys Leu Pro Val Arg Phe Ala

485 490 495

atg gac aga gca ggt ctt gtt gga gca gat ggt cca aca cat tgt ggt 1536

Met Asp Arg Ala Gly Leu Val Gly Ala Asp Gly Pro Thr His Cys Gly

500 505 510

gca ttt gat gtt act tac atg gca tgt ctt cct aac atg gtt gta atg 1584

Ala Phe Asp Val Thr Tyr Met Ala Cys Leu Pro Asn Met Val Val Met

515 520 525

gct cct tct gat gaa gcg gag cta ttt cac atg gta gca act gct gcc 1632

Ala Pro Ser Asp Glu Ala Glu Leu Phe His Met Val Ala Thr Ala Ala

530 535 540

gcc att gat gac aga cca agt tgt ttt aga tac cca aga gga aat ggg 1680

Ala Ile Asp Asp Arg Pro Ser Cys Phe Arg Tyr Pro Arg Gly Asn Gly

545 550 555 560

atc ggt gta gag ctt ccg gct gga aac aaa gga att cct ctt gag gtt 1728

Ile Gly Val Glu Leu Pro Ala Gly Asn Lys Gly Ile Pro Leu Glu Val

565 570 575

ggt aaa ggt agg ata ttg att gag ggg gag aga gtg gct cta ttg gga 1776

Gly Lys Gly Arg Ile Leu Ile Glu Gly Glu Arg Val Ala Leu Leu Gly

580 585 590

tat ggc tca gca gtg cag aac tgt ttg gat gct gct att gtg cta gaa 1824

Tyr Gly Ser Ala Val Gln Asn Cys Leu Asp Ala Ala Ile Val Leu Glu

595 600 605

tcc cgc ggc tta caa gta aca gtt gca gat gca cgt ttc tgc aaa cca 1872

Ser Arg Gly Leu Gln Val Thr Val Ala Asp Ala Arg Phe Cys Lys Pro

610 615 620

ctg gac cat gcc ctc ata agg agc ctt gca aaa tca cat gaa gtg cta 1920

Leu Asp His Ala Leu Ile Arg Ser Leu Ala Lys Ser His Glu Val Leu

625 630 635 640

atc act gtc gaa gaa gga tca att gga ggt ttt gga tct cat gtt gtt 1968

Ile Thr Val Glu Glu Gly Ser Ile Gly Gly Phe Gly Ser His Val Val

645 650 655

cag ttc atg gcc tta gat ggg ctt ctt gat ggc aag ttg aag tgg aga 2016

Gln Phe Met Ala Leu Asp Gly Leu Leu Asp Gly Lys Leu Lys Trp Arg

660 665 670

cca ata gtt ctt cct gat cga tac att gac cat gga tct cct gtt gat 2064

Pro Ile Val Leu Pro Asp Arg Tyr Ile Asp His Gly Ser Pro Val Asp

675 680 685

cag ttg gcg gaa gct ggc cta aca cca tct cac att gca gca aca gta 2112

Gln Leu Ala Glu Ala Gly Leu Thr Pro Ser His Ile Ala Ala Thr Val

690 695 700

ttt aac ata ctt gga caa acc aga gag gct cta gag gtc atg aca taa 2160

Phe Asn Ile Leu Gly Gln Thr Arg Glu Ala Leu Glu Val Met Thr

705 710 715

<210>116

<211>719

<212>PRT

＜213〉edible tomato

<400>116

Met Ala Leu Cys Ala Tyr Ala Phe Pro Gly Ile Leu Asn Arg Thr Gly

1 5 10 15

Val Val Ser Asp Ser Ser Lys Ala Thr Pro Leu Phe Ser Gly Trp Ile

20 25 30

His Gly Thr Asp Leu Gln Phe Leu Phe Gln His Lys Leu Thr His Glu

35 40 45

Val Lys Lys Arg Ser Arg Val Val Gln Ala Ser Leu Ser Glu Ser Gly

50 55 60

Glu Tyr Tyr Thr Gln Arg Pro Pro Thr Pro Ile Leu Asp Thr Val Asn

65 70 75 80

Tyr Pro Ile His Met Lys Asn Leu Ser Leu Lys Glu Leu Lys Gln Leu

85 90 95

Ala Asp Glu Leu Arg Ser Asp Thr Ile Phe Asn Val Ser Lys Thr Gly

100 105 110

Gly His Leu Gly Ser Ser Leu Gly Val Val Glu Leu Thr Val Ala Leu

115 120 125

His Tyr Val Phe Asn Ala Pro Gln Asp Arg Ile Leu Trp Asp Val Gly

130 135 140

His Gln Ser Tyr Pro His Lys Ile Leu Thr Gly Arg Arg Asp Lys Met

145 150 155 160

Ser Thr Leu Arg Gln Thr Asp Gly Leu Ala Gly Phe Thr Lys Arg Ser

165 170 175

Glu Ser Glu Tyr Asp Cys Phe Gly Thr Gly His Ser Ser Thr Thr Ile

180 185 190

Ser Ala Gly Leu Gly Met Ala Val Gly Arg Asp Leu Lys Gly Arg Asn

195 200 205

Asn Asn Val Ile Ala Val Ile Gly Asp Gly Ala Met Thr Ala Gly Gln

210 215 220

Ala Tyr Glu Ala Met Asn Asn Ala Gly Tyr Leu Asp Ser Asp Met Ile

225 230 235 240

Val Ile Leu Asn Asp Asn Arg Gln Val Ser Leu Pro Thr Ala Thr Leu

245 250 255

Asp Gly Pro Val Ala Pro Val Gly Ala Leu Ser Ser Ala Leu Ser Arg

260 265 270

Leu Gln Ser Asn Arg Pro Leu Arg Glu Leu Arg Glu Val Ala Lys Gly

275 280 285

Val Thr Lys Gln Ile Gly Gly Pro Met His Glu Leu Ala Ala Lys Val

290 295 300

Asp Glu Tyr Ala Arg Gly Met Ile Ser Gly Ser Gly Ser Thr Leu Phe

305 310 315 320

Glu Glu Leu Gly Leu Tyr Tyr Ile Gly Pro Val Asp Gly His Asn Ile

325 330 335

Asp Asp Leu Ile Ala Ile Leu Lys Glu Val Arg Ser Thr Lys Thr Thr

340 345 350

Gly Pro Val Leu Ile His Val Val Thr Glu Lys Gly Arg Gly Tyr Pro

355 360 365

Tyr Ala Glu Arg Ala Ala Asp Lys Tyr His Gly Val Ala Lys Phe Asp

370 375 380

Pro Ala Thr Gly Lys Gln Phe Lys Ala Ser Ala Lys Thr Gln Ser Tyr

385 390 395 400

Thr Thr Tyr Phe Ala Glu Ala Leu Ile Ala Glu Ala Glu Ala Asp Lys

405 410 415

Asp Ile Val Ala Ile His Ala Ala Met Gly Gly Gly Thr Gly Met Asn

420 425 430

Leu Phe His Arg Arg Phe Pro Thr Arg Cys Phe Asp Val Gly Ile Ala

435 440 445

Glu Gln His Ala Val Thr Phe Ala Ala Gly Leu Ala Cys Glu Gly Ile

450 455 460

Lys Pro Phe Cys Ala Ile Tyr Ser Ser Phe Met Gln Arg Ala Tyr Asp

465 470 475 480

Gln Val Val His Asp Val Asp Leu Gln Lys Leu Pro Val Arg Phe Ala

485 490 495

Met Asp Arg Ala Gly Leu Val Gly Ala Asp Gly Pro Thr His Cys Gly

500 505 510

Ala Phe Asp Val Thr Tyr Met Ala Cys Leu Pro Asn Met Val Val Met

515 520 525

Ala Pro Ser Asp Glu Ala Glu Leu Phe His Met Val Ala Thr Ala Ala

530 535 540

Ala Ile Asp Asp Arg Pro Ser Cys Phe Arg Tyr Pro Arg Gly Asn Gly

545 550 555 560

Ile Gly Val Glu Leu Pro Ala Gly Asn Lys Gly Ile Pro Leu Glu Val

565 570 575

Gly Lys Gly Arg Ile Leu Ile Glu Gly Glu Arg Val Ala Leu Leu Gly

580 585 590

Tyr Gly Ser Ala Val Gln Asn Cys Leu Asp Ala Ala Ile Val Leu Glu

595 600 605

Ser Arg Gly Leu Gln Val Thr Val Ala Asp Ala Arg Phe Cys Lys Pro

610 615 620

Leu Asp His Ala Leu Ile Arg Ser Leu Ala Lys Ser His Glu Val Leu

625 630 635 640

Ile Thr Val Glu Glu Gly Ser Ile Gly Gly Phe Gly Ser His Val Val

645 650 655

Gln Phe Met Ala Leu Asp Gly Leu Leu Asp Gly Lys Leu Lys Trp Arg

660 665 670

Pro Ile Val Leu Pro Asp Arg Tyr Ile Asp His Gly Ser Pro Val Asp

675 680 685

Gln Leu Ala Glu Ala Gly Leu Thr Pro Ser His Ile Ala Ala Thr Val

690 695 700

Phe Asn Ile Leu Gly Gln Thr Arg Glu Ala Leu Glu Val Met Thr

705 710 715

<210>117

<211>1434

<212>DNA

＜213〉mouseearcress

<220>

<221>CDS

<222>(1)..(1434)

<223>

<400>117

atg atg aca tta aac tca cta tct cca gct gaa tcc aaa gct att tct 48

Met Met Thr Leu Asn Ser Leu Ser Pro Ala Glu Ser Lys Ala Ile Ser

1 5 10 15

ttc ttg gat acc tcc agg ttc aat cca atc cct aaa ctc tca ggt ggg 96

Phe Leu Asp Thr Ser Arg Phe Asn Pro Ile Pro Lys Leu Ser Gly Gly

20 25 30

ttt agt ttg agg agg agg aat caa ggg aga ggt ttt gga aaa ggt gtt 144

Phe Ser Leu Arg Arg Arg Asn Gln Gly Arg Gly Phe Gly Lys Gly Val

35 40 45

aag tgt tca gtg aaa gtg cag cag caa caa caa cct cct cca gca tgg 192

Lys Cys Ser Val Lys Val Gln Gln Gln Gln Gln Pro Pro Pro Ala Trp

50 55 60

cct ggg aga gct gtc cct gag gcg cct cgt caa tct tgg gat gga cca 240

Pro Gly Arg Ala Val Pro Glu Ala Pro Arg Gln Ser Trp Asp Gly Pro

65 70 75 80

aaa ccc atc tct atc gtt gga tct act ggt tct att ggc act cag aca 288

Lys Pro Ile Ser Ile Val Gly Ser Thr Gly Ser Ile Gly Thr Gln Thr

85 90 95

ttg gat att gtg gct gag aat cct gac aaa ttc aga gtt gtg gct cta 336

Leu Asp Ile Val Ala Glu Asn Pro Asp Lys Phe Arg Val Val Ala Leu

100 105 110

gct gct ggt tcg aat gtt act cta ctt gct gat cag gta agg aga ttt 384

Ala Ala Gly Ser Asn Val Thr Leu Leu Ala Asp Gln Val Arg Arg Phe

115 120 125

aag cct gca ttg gtt gct gtt aga aac gag tca ctg att aat gag ctt 432

Lys Pro Ala Leu Val Ala Val Arg Asn Glu Ser Leu Ile Asn Glu Leu

130 135 140

aaa gag gct tta gct gat ttg gac tat aaa ctc gag att att cca gga 480

Lys Glu Ala Leu Ala Asp Leu Asp Tyr Lys Leu Glu Ile Ile Pro Gly

145 150 155 160

gag caa gga gtg att gag gtt gcc cga cat cct gaa gct gta acc gtt 528

Glu Gln Gly Val Ile Glu Val Ala Arg His Pro Glu Ala Val Thr Val

165 170 175

gtt acc gga ata gta ggt tgt gcg gga cta aag cct acg gtt gct gca 576

Val Thr Gly Ile Val Gly Cys Ala Gly Leu Lys Pro Thr Val Ala Ala

180 185 190

att gaa gca gga aag gac att gct ctt gca aac aaa gag aca tta atc 624

Ile Glu Ala Gly Lys Asp Ile Ala Leu Ala Asn Lys Glu Thr Leu Ile

195 200 205

gca ggt ggt cct ttc gtg ctt ccg ctt gcc aac aaa cat aat gta aag 672

Ala Gly Gly Pro Phe Val Leu Pro Leu Ala Asn Lys His Asn Val Lys

210 215 220

att ctt ccg gca gat tca gaa cat tct gcc ata ttt cag tgt att caa 720

Ile Leu Pro Ala Asp Ser Glu His Ser Ala Ile Phe Gln Cys Ile Gln

225 230 235 240

ggt ttg cct gaa ggc gct ctg cgc aag ata atc ttg act gca tct ggt 768

Gly Leu Pro Glu Gly Ala Leu Arg Lys Ile Ile Leu Thr Ala Ser Gly

245 250 255

gga gct ttt agg gat tgg cct gtc gaa aag cta aag gaa gtt aaa gta 816

Gly Ala Phe Arg Asp Trp Pro Val Glu Lys Leu Lys Glu Val Lys Val

260 265 270

gcg gat gcg ttg aag cat cca aac tgg aac atg gga aag aaa atc act 864

Ala Asp Ala Leu Lys His Pro Asn Trp Asn Met Gly Lys Lys Ile Thr

275 280 285

gtg gac tct gct acg ctt ttc aac aag ggt ctt gag gtc att gaa gcg 912

Val Asp Ser Ala Thr Leu Phe Asn Lys Gly Leu Glu Val Ile Glu Ala

290 295 300

cat tat ttg ttt gga gct gag tat gac gat ata gag att gtc att cat 960

His Tyr Leu Phe Gly Ala Glu Tyr Asp Asp Ile Glu Ile Val Ile His

305 310 315 320

ccg caa agt atc ata cat tcc atg att gaa aca cag gat tca tct gtg 1008

Pro Gln Ser Ile Ile His Ser Met Ile Glu Thr Gln Asp Ser Ser Val

325 330 335

ctt gct caa ttg ggt tgg cct gat atg cgt tta ccg att ctc tac acc 1056

Leu Ala Gln Leu Gly Trp Pro Asp Met Arg Leu Pro Ile Leu Tyr Thr

340 345 350

atg tca tgg ccc gat aga gtt cct tgt tct gaa gta act tgg cca aga 1104

Met Ser Trp Pro Asp Arg Val Pro Cys Ser Glu Val Thr Trp Pro Arg

355 360 365

ctt gac crt tgc aaa ctc ggt tca ttg act ttc aag aaa cca gac aat 1152

Leu Asp Leu Cys Lys Leu Gly Ser Leu Thr Phe Lys Lys Pro Asp Asn

370 375 380

gtg aaa tac cca tcc atg gat ctt gct tat gct gct gga cga gct gga 1200

Val Lys Tyr Pro Ser Met Asp Leu Ala Tyr Ala Ala Gly Arg Ala Gly

385 390 395 400

ggc aca atg act gga gtt ctc agc gcc gcc aat gag aaa gct gtt gaa 1248

Gly Thr Met Thr Gly Val Leu Ser Ala Ala Asn Glu Lys Ala Val Glu

405 410 415

atg ttc att gat gaa aag ata agc tat ttg gat atc ttc aag gtt gtg 1296

Met Phe Ile Asp Glu Lys Ile Ser Tyr Leu Asp Ile Phe Lys Val Val

420 425 430

gaa tta aca tgc gat aaa cat cga aac gag ttg gta aca tca ccg tct 1344

Glu Leu Thr Cys Asp Lys His Arg Asn Glu Leu Val Thr Ser Pro Ser

435 440 445

ctt gaa gag att gtt cac tat gac ttg tgg gca cgt gaa tat gcc gcg 1392

Leu Glu Glu Ile Val His Tyr Asp Leu Trp Ala Arg Glu Tyr Ala Ala

450 455 460

aat gtg cag ctt tct tct ggt gct agg cca gtt cat gca tga 1434

Asn Val Gln Leu Ser Ser Gly Ala Arg Pro Val His Ala

465 470 475

<210>118

<211>477

<212>PRT

＜213〉mouseearcress

<400>118

Met Met Thr Leu Asn Ser Leu Ser Pro Ala Glu Ser Lys Ala Ile Ser

1 5 10 15

Phe Leu Asp Thr Ser Arg Phe Asn Pro Ile Pro Lys Leu Ser Gly Gly

20 25 30

Phe Ser Leu Arg Arg Arg Asn Gln Gly Arg Gly Phe Gly Lys Gly Val

35 40 45

Lys Cys Ser Val Lys Val Gln Gln Gln Gln Gln Pro Pro Pro Ala Trp

50 55 60

Pro Gly Arg Ala Val Pro Glu Ala Pro Arg Gln Ser Trp Asp Gly Pro

65 70 75 80

Lys Pro Ile Ser Ile Val Gly Ser Thr Gly Ser Ile Gly Thr Gln Thr

85 90 95

Leu Asp Ile Val Ala Glu Asn Pro Asp Lys Phe Arg Val Val Ala Leu

100 105 110

Ala Ala Gly Ser Asn Val Thr Leu Leu Ala Asp Gln Val Arg Arg Phe

115 120 125

Lys Pro Ala Leu Val Ala Val Arg Asn Glu Ser Leu Ile Asn Glu Leu

130 135 140

Lys Glu Ala Leu Ala Asp Leu Asp Tyr Lys Leu Glu Ile Ile Pro Gly

145 150 155 160

Glu Gln Gly Val Ile Glu Val Ala Arg His Pro Glu Ala Val Thr Val

165 170 175

Val Thr Gly Ile Val Gly Cys Ala Gly Leu Lys Pro Thr Val Ala Ala

180 185 190

Ile Glu Ala Gly Lys Asp Ile Ala Leu Ala Asn Lys Glu Thr Leu Ile

195 200 205

Ala Gly Gly Pro Phe Val Leu Pro Leu Ala Asn Lys His Asn Val Lys

210 215 220

Ile Leu Pro Ala Asp Ser Glu His Ser Ala Ile Phe Gln Cys Ile Gln

225 230 235 240

Gly Leu Pro Glu Gly Ala Leu Arg Lys Ile Ile Leu Thr Ala Ser Gly

245 250 255

Gly Ala Phe Arg Asp Trp Pro Val Glu Lys Leu Lys Glu Val Lys Val

260 265 270

Ala Asp Ala Leu Lys His Pro Asn Trp Asn Met Gly Lys Lys Ile Thr

275 280 285

Val Asp Ser Ala Thr Leu Phe Asn Lys Gly Leu Glu Val Ile Glu Ala

290 295 300

His Tyr Leu Phe Gly Ala Glu Tyr Asp Asp Ile Glu Ile Val Ile His

305 310 315 320

Pro Gln Ser Ile Ile His Ser Met Ile Glu Thr Gln Asp Ser Ser Val

325 330 335

Leu Ala Gln Leu Gly Trp Pro Asp Met Arg Leu Pro Ile Leu Tyr Thr

340 345 350

Met Ser Trp Pro Asp Arg Val Pro Cys Ser Glu Val Thr Trp Pro Arg

355 360 365

Leu Asp Leu Cys Lys Leu Gly Ser Leu Thr Phe Lys Lys Pro Asp Asn

370 375 380

Val Lys Tyr Pro Ser Met Asp Leu Ala Tyr Ala Ala Gly Arg Ala Gly

385 390 395 400

Gly Thr Met Thr Gly Val Leu Ser Ala Ala Asn Glu Lys Ala Val Glu

405 410 415

Met Phe Ile Asp Glu Lys Ile Ser Tyr Leu Asp Ile Phe Lys Val Val

420 425 430

Glu Leu Thr Cys Asp Lys His Arg Asn Glu Leu Val Thr Ser Pro Ser

435 440 445

Leu Glu Glu Ile Val His Tyr Asp Leu Trp Ala Arg Glu Tyr Ala Ala

450 455 460

Asn Val Gln Leu Ser Ser Gly Ala Arg Pro Val His Ala

465 470 475

<210>119

<211>884

<212>DNA

＜213〉John Burroughs is carried and is received adonis amurensis (Adonis palaestina) clone ApIPI28

<220>

<221>CDS

<222>(180)..(884)

<223>

<400>119

cgtcgatcag gattaatcct ttatatagta tcttctccac caccactaaa acattatcag 60

cttcgtgttc ttctcccgct gttcatcttc agcagcgttg tcgtactctt tctatttctt 120

cttccatcac taacagtcct cgccgagggt tgaatcggct gttcgcctca acgtcgact 179

atg ggt gaa gtc gct gat gct ggt atg gat gcc gtc cag aag cgg ctt 227

Met Gly Glu Val Ala Asp Ala Gly Met Asp Ala Val Gln Lys Arg Leu

1 5 10 15

atg ttc gac gat gaa tgt att ttg gtg gat gag aat gac aag gtc gtc 275

Met Phe Asp Asp Glu Cys Ile Leu Val Asp Glu Asn Asp Lys Val Val

20 25 30

gga cat gat tcc aaa tac aac tgt cat ttg atg gaa aag ata gag gca 323

Gly His Asp Ser Lys Tyr Asn Cys His Leu Met Glu Lys Ile Glu Ala

35 40 45

gaa aac ttg ctt cac aga gcc ttc agt gtt ttc tta ttc aac tca aaa 371

Glu Asn Leu Leu His Arg Ala Phe Ser Val Phe Leu Phe Asn Ser Lys

50 55 60

tac gag ttg ctt ctt cag caa cga tct gca acg aag gta aca ttc ccg 419

Tyr Glu Leu Leu Leu Gln Gln Arg Ser Ala Thr Lys Val Thr Phe Pro

65 70 75 80

ctc gta tgg aca aac acc tgt tgc agc cat ccc ctc ttc cgt gat tcc 467

Leu Val Trp Thr Asn Thr Cys Cys Ser His Pro Leu Phe Arg Asp Ser

85 90 95

gaa ctc ata gaa gaa aat ttt ctc ggg gta cga aac gct gca caa agg 515

Glu Leu Ile Glu Glu Asn Phe Leu Gly Val Arg Asn Ala Ala Gln Arg

100 105 110

aag ctt tta gac gag cta ggc att cca gct gaa gac gta cca gtt gat 563

Lys Leu Leu Asp Glu Leu Gly Ile Pro Ala Glu Asp Val Pro Val Asp

115 120 125

gaa ttc act cct ctt ggt cgc att ctt tac aaa gct cca tct gac gga 611

Glu Phe Thr Pro Leu Gly Arg Ile Leu Tyr Lys Ala Pro Ser Asp Gly

130 135 140

aaa tgg gga gag cac gaa ctg gac tat ctt ctg ttt att gtc cga gat 659

Lys Trp Gly Glu His Glu Leu Asp Tyr Leu Leu Phe Ile Val Arg Asp

145 150 155 160

gtg aaa tac gat cca aac cca gat gaa gtt gct gac gct aag tac gtt 707

Val Lys Tyr Asp Pro Asn Pro Asp Glu Val Ala Asp Ala Lys Tyr Val

165 170 175

aat cgc gag gag ttg aaa gag ata ctg aga aaa gct gat gca ggt gaa 755

Asn Arg Glu Glu Leu Lys Glu Ile Leu Arg Lys Ala Asp Ala Gly Glu

180 185 190

gag gga ata aag ttg tct cct tgg ttt aga ttg gtt gtg gat aac ttt 803

Glu Gly Ile Lys Leu Ser Pro Trp Phe Arg Leu Val Val Asp Asn Phe

195 200 205

ttg ttc aag tgg tgg gat cat gta gag gag ggg aag att aag gac gtc 851

Leu Phe Lys Trp Trp Asp His Val Glu Glu Gly Lys Ile Lys Asp Val

210 215 220

gcc gac atg aaa act atc cac aag ttg act taa 884

Ala Asp Met Lys Thr Ile His Lys Leu Thr

225 230

<210>120

<211>234

<212>PRT

＜213〉John Burroughs is carried and is received adonis amurensis clone ApIPI28

<400>120

Met Gly Glu Val Ala Asp Ala Gly Met Asp Ala Val Gln Lys Arg Leu

1 5 10 15

Met Phe Asp Asp Glu Cys Ile Leu Val Asp Glu Asn Asp Lys Val Val

20 25 30

Gly His Asp Ser Lys Tyr Asn Cys His Leu Met Glu Lys Ile Glu Ala

35 40 45

Glu Asn Leu Leu His Arg Ala Phe Ser Val Phe Leu Phe Asn Ser Lys

50 55 60

Tyr Glu Leu Leu Leu Gln Gln Arg Ser Ala Thr Lys Val Thr Phe Pro

65 70 75 80

Leu Val Trp Thr Asn Thr Cys Cys Ser His Pro Leu Phe Arg Asp Ser

85 90 95

Glu Leu Ile Glu Glu Asn Phe Leu Gly Val Arg Asn Ala Ala Gln Arg

100 105 110

Lys Leu Leu Asp Glu Leu Gly Ile Pro Ala Glu Asp Val Pro Val Asp

115 120 125

Glu Phe Thr Pro Leu Gly Arg Ile Leu Tyr Lys Ala Pro Ser Asp Gly

130 135 140

Lys Trp Gly Glu His Glu Leu Asp Tyr Leu Leu Phe Ile Val Arg Asp

145 150 155 160

Val Lys Tyr Asp Pro Asn Pro Asp Glu Val Ala Asp Ala Lys Tyr Val

165 170 175

Asn Arg Glu Glu Leu Lys Glu Ile Leu Arg Lys Ala Asp Ala Gly Glu

180 185 190

Glu Gly Ile Lys Leu Ser Pro Trp Phe Arg Leu Val Val Asp Asn Phe

195 200 205

Leu Phe Lys Trp Trp Asp His Val Glu Glu Gly Lys Ile Lys Asp Val

210 215 220

Ala Asp Met Lys Thr Ile His Lys Leu Thr

225 230

<210>121

<211>1402

<212>DNA

＜213〉mouseearcress＜220 〉

<221>CDS

<222>(52)..(1317)

<223>

<400>121

aagtctttgc ctctttggtt tactttcctc tgttttcgat ccatttagaa a atg tta 57

Met Leu

1

ttc acg agg agt gtt gct cgg att tct tct aag ttt ctg aga aac cgt 105

Phe Thr Arg Ser Val Ala Arg Ile Ser Ser Lys Phe Leu Arg Asn Arg

5 10 15

agc ttc tat ggc tcc tct caa tct ctc gcc tct cat cgg ttc gca atc 153

Ser Phe Tyr Gly Ser Ser Gln Ser Leu Ala Ser His Arg Phe Ala Ile

20 25 30

att ccc gat cag ggt cac tct tgt tct gac tct cca cac aag ggt tac 201

Ile Pro Asp Gln Gly His Ser Cys Ser Asp Ser Pro His Lys Gly Tyr

35 40 45 50

gtt tgc aga aca act tat tca ttg aaa tct ccg gtt ttt ggt gga ttt 249

Val Cys Arg Thr Thr Tyr Ser Leu Lys Ser Pro Val Phe Gly Gly Phe

55 60 65

agt cat caa ctc tat cac cag agt agc tcc ttg gtt gag gag gag ctt 297

Ser His Gln Leu Tyr His Gln Ser Ser Ser Leu Val Glu Glu Glu Leu

70 75 80

gac cca ttt tcg ctt gtt gcc gat gag ctg tca ctt ctt agt aat aag 345

Asp Pro Phe Ser Leu Val Ala Asp Glu Leu Ser Leu Leu Ser Asn Lys

85 90 95

ttg aga gag atg gta ctt gcc gag gtt cca aag ctt gcc tct gct gct 393

Leu Arg Glu Met Val Leu Ala Glu Val Pro Lys Leu Ala Ser Ala Ala

100 105 110

gag tac ttc ttc aaa agg ggt gtg caa gga aaa cag ttt cgt tca act 441

Glu Tyr Phe Phe Lys Arg Gly Val Gln Gly Lys Gln Phe Arg Ser Thr

115 120 125 130

att ttg ctg ctg atg gcg aca gct ctg gat gta cga gtt cca gaa gca 489

Ile Leu Leu Leu Met Ala Thr Ala Leu Asp Val Arg Val Pro Glu Ala

135 140 145

ttg att ggg gaa tca aca gat ata gtc aca tca gaa tta cgc gta agg 537

Leu Ile Gly Glu Ser Thr Asp Ile Val Thr Ser Glu Leu Arg Val Arg

150 155 160

caa cgg ggt att gct gaa atc act gaa atg ata cac gtc gca agt cta 585

Gln Arg Gly Ile Ala Glu Ile Thr Glu Met Ile His Val Ala Ser Leu

165 170 175

ctg cac gat gat gtc ttg gat gat gcc gat aca agg cgt ggt gtt ggt 633

Leu His Asp Asp Val Leu Asp Asp Ala Asp Thr Arg Arg Gly Val Gly

180 185 190

tcc tta aat gtt gta atg ggt aac aag atg tcg gta tta gca gga gac 681

Ser Leu Asn Val Val Met Gly Asn Lys Met Ser Val Leu Ala Gly Asp

195 200 205 210

ttc ttg ctc tcc cgg gct tgt ggg gct ctc gct gct tta aag aac aca 729

Phe Leu Leu Ser Arg Ala Cys Gly Ala Leu Ala Ala Leu Lys Asn Thr

215 220 225

gag gtt gta gca tta ctt gca act gct gta gaa cat ctt gtt acc ggt 777

Glu Val Val Ala Leu Leu Ala Thr Ala Val Glu His Leu Val Thr Gly

230 235 240

gaa acc atg gag ata act agt tca acc gag cag cgt tat agt atg gac 825

Glu Thr Met Glu Ile Thr Ser Ser Thr Glu Gln Arg Tyr Ser Met Asp

245 250 255

tac tac atg cag aag aca tat tat aag aca gca tcg cta atc tct aac 873

Tyr Tyr Met Gln Lys Thr Tyr Tyr Lys Thr Ala Ser Leu Ile Ser Asn

260 265 270

agc tgc aaa gct gtt gcc gtt ctc act gga caa aca gca gaa gtt gcc 921

Ser Cys Lys Ala Val Ala Val Leu Thr Gly Gln Thr Ala Glu Val Ala

275 280 285 290

gtg tta gct ttt gag tat ggg agg aat ctg ggt tta gca ttc caa tta 969

Val Leu Ala Phe Glu Tyr Gly Arg Asn Leu Gly Leu Ala Phe Gln Leu

295 300 305

ata gac gac att ctt gat ttc acg ggc aca tct gcc tct ctc gga aag 1017

Ile Asp Asp Ile Leu Asp Phe Thr Gly Thr Ser Ala Ser Leu Gly Lys

310 315 320

gga tcg ttg tca gat att cgc cat gga gtc ata aca gcc cca atc ctc 1065

Gly Ser Leu Ser Asp Ile Arg His Gly Val Ile Thr Ala Pro Ile Leu

325 330 335

ttt gcc atg gaa gag ttt cct caa cta cgc gaa gtt gtt gat caa gtt 1113

Phe Ala Met Glu Glu Phe Pro Gln Leu Arg Glu Val Val Asp Gln Val

340 345 350

gaa aaa gat cct agg aat gtt gac att gct tta gag tat ctt ggg aag 1161

Glu Lys Asp Pro Arg Asn Val Asp Ile Ala Leu Glu Tyr Leu Gly Lys

355 360 365 370

agc aag gga ata cag agg gca aga gaa tta gcc atg gaa cat gcg aat 1209

Ser Lys Gly Ile Gln Arg Ala Arg Glu Leu Ala Met Glu His Ala Asn

375 380 385

cta gca gca gct gca atc ggg tct cta cct gaa aca gac aat gaa gat 1257

Leu Ala Ala Ala Ala Ile Gly Ser Leu Pro Glu Thr Asp Asn Glu Asp

390 395 400

gtc aaa aga tcg agg cgg gca ctt att gac ttg acc cat aga gtc atc 1305

Val Lys Arg Ser Arg Arg Ala Leu Ile Asp Leu Thr His Arg Val Ile

405 410 415

acc aga aac aag tgagattaag taatgtttct ctctatacac caaaacattc 1357

Thr Arg Asn Lys

420

ctcatttcat ttgtaggatt ttgttggtcc aattcgtttc acgaa 1402

<210>122

<211>422

<212>PRT

＜213〉mouseearcress

<400>122

Met Leu Phe Thr Arg Ser Val Ala Arg Ile Ser Ser Lys Phe Leu Arg

1 5 10 15

Asn Arg Ser Phe Tyr Gly Ser Ser Gln Ser Leu Ala Ser His Arg Phe

20 25 30

Ala Ile Ile Pro Asp Gln Gly His Ser Cys Ser Asp Ser Pro His Lys

35 40 45

Gly Tyr Val Cys Arg Thr Thr Tyr Ser Leu Lys Ser Pro Val Phe Gly

50 55 60

Gly Phe Ser His Gln Leu Tyr His Gln Ser Ser Ser Leu Val Glu Glu

65 70 75 80

Glu Leu Asp Pro Phe Ser Leu Val Ala Asp Glu Leu Ser Leu Leu Ser

85 90 95

Asn Lys Leu Arg Glu Met Val Leu Ala Glu Val Pro Lys Leu Ala Ser

100 105 110

Ala Ala Glu Tyr Phe Phe Lys Arg Gly Val Gln Gly Lys Gln Phe Arg

115 120 125

Ser Thr Ile Leu Leu Leu Met Ala Thr Ala Leu Asp Val Arg Val Pro

130 135 140

Glu Ala Leu Ile Gly Glu Ser Thr Asp Ile Val Thr Ser Glu Leu Arg

145 150 155 160

Val Arg Gln Arg Gly Ile Ala Glu Ile Thr Glu Met Ile His Val Ala

165 170 175

Ser Leu Leu His Asp Asp Val Leu Asp Asp Ala Asp Thr Arg Arg Gly

180 185 190

Val Gly Ser Leu Asn Val Val Met Gly Asn Lys Met Ser Val Leu Ala

195 200 205

Gly Asp Phe Leu Leu Ser Arg Ala Cys Gly Ala Leu Ala Ala Leu Lys

210 215 220

Asn Thr Glu Val Val Ala Leu Leu Ala Thr Ala Val Glu His Leu Val

225 230 235 240

Thr Gly Glu Thr Met Glu Ile Thr Ser Ser Thr Glu Gln Arg Tyr Ser

245 250 255

Met Asp Tyr Tyr Met Gln Lys Thr Tyr Tyr Lys Thr Ala Ser Leu Ile

260 265 270

Ser Asn Ser Cys Lys Ala Val Ala Val Leu Thr Gly Gln Thr Ala Glu

275 280 285

Val Ala Val Leu Ala Phe Glu Tyr Gly Arg Asn Leu Gly Leu Ala Phe

290 295 300

Gln Leu Ile Asp Asp Ile Leu Asp Phe Thr Gly Thr Ser Ala Ser Leu

305 310 315 320

Gly Lys Gly Ser Leu Ser Asp Ile Arg His Gly Val Ile Thr Ala Pro

325 330 335

Ile Leu Phe Ala Met Glu Glu Phe Pro Gln Leu Arg Glu Val Val Asp

340 345 350

Gln Val Glu Lys Asp Pro Arg Asn Val Asp Ile Ala Leu Glu Tyr Leu

355 360 365

Gly Lys Ser Lys Gly Ile Gln Arg Ala Arg Glu Leu Ala Met Glu His

370 375 380

Ala Asn Leu Ala Ala Ala Ala Ile Gly Ser Leu Pro Glu Thr Asp Asn

385 390 395 400

Glu Asp Val Lys Arg Ser Arg Arg Ala Leu Ile Asp Leu Thr His Arg

405 410 415

Val Ile Thr Arg Asn Lys

420

<210>123

<211>1155

<212>DNA

＜213〉mouseearcress

<220>

<221>CDS

<222>(1)..(1155)

<223>

<400>123

atg agt gtg agt tgt tgt tgt agg aat ctg ggc aag aca ata aaa aag 48

Met Ser Val Ser Cys Cys Cys Arg Asn Leu Gly Lys Thr Ile Lys Lys

1 5 10 15

gca ata cct tca cat cat ttg cat ctg aga agt ctt ggt ggg agt ctc 96

Ala Ile Pro Ser His His Leu His Leu Arg Ser Leu Gly Gly Ser Leu

20 25 30

tat cgt cgt cgt atc caa agc tct tca atg gag acc gat ctc aag tca 144

Tyr Arg Arg Arg Ile Gln Ser Ser Ser Met Glu Thr Asp Leu Lys Ser

35 40 45

acc ttt ctc aac gtt tat tct gtt ctc aag tct gac ctt ctt cat gac 192

Thr Phe Leu Asn Val Tyr Ser Val Leu Lys Ser Asp Leu Leu His Asp

50 55 60

cct tcc ttc gaa ttc acc aat gaa tct cgt ctc tgg gtt gat cgg atg 240

Pro Ser Phe Glu Phe Thr Asn Glu Ser Arg Leu Trp Val Asp Arg Met

65 70 75 80

ctg gac tac aat gta cgt gga ggg aaa ctc aat cgg ggt ctc tct gtt 288

Leu Asp Tyr Asn Val Arg Gly Gly Lys Leu Asn Arg Gly Leu Ser Val

85 90 95

gtt gac agt ttc aaa ctt ttg aag caa ggc aat gat ttg act gag caa 336

Val Asp Ser Phe Lys Leu Leu Lys Gln Gly Asn Asp Leu Thr Glu Gln

100 105 110

gag gtt ttc ctc tct tgt gct ctc ggt tgg tgc att gaa tgg ctc caa 384

Glu Val Phe Leu Ser Cys Ala Leu Gly Trp Cys Ile Glu Trp Leu Gln

115 120 125

gct tat ttc ctt gtg ctt gat gat att atg gat aac tct gtc act cgc 432

Ala Tyr Phe Leu Val Leu Asp Asp Ile Met Asp Asn Ser Val Thr Arg

130 135 140

cgt ggt caa cct tgc tgg ttc aga gtt cct cag gtt ggt atg gtt gcc 480

Arg Gly Gln Pro Cys Trp Phe Arg Val Pro Gln Val Gly Met Val Ala

145 150 155 160

atc aat gat ggg att cta ctt cgc aat cac atc cac agg att ctc aaa 528

Ile Asn Asp Gly Ile Leu Leu Arg Asn His Ile His Arg Ile Leu Lys

165 170 175

aag cat ttc cgt gat aag cct tac tat gtt gac ctt gtt gat ttg ttt 576

Lys His Phe Arg Asp Lys Pro Tyr Tyr Val Asp Leu Val Asp Leu Phe

180 185 190

aat gag gtt gag ttg caa aca gct tgt ggc cag atg ata gat ttg atc 624

Asn Glu Val Glu Leu Gln Thr Ala Cys Gly Gln Met Ile Asp Leu Ile

195 200 205

acc acc ttt gaa gga gaa aag gat ttg gcc aag tac tca ttg tca atc 672

Thr Thr Phe Glu Gly Glu Lys Asp Leu Ala Lys Tyr Ser Leu Ser Ile

210 215 220

cac cgt cgt att gtc cag tac aaa acg gct tat tac tca ttt tat ctc 720

His Arg Arg Ile Val Gln Tyr Lys Thr Ala Tyr Tyr Ser Phe Tyr Leu

225 230 235 240

cct gtt gct tgt gcg ttg ctt atg gcg ggc gaa aat ttg gaa aac cat 768

Pro Val Ala Cys Ala Leu Leu Met Ala Gly Glu Asn Leu Glu Asn His

245 250 255

att gac gtg aaa aat gtt ctt gtt gac atg gga atc tac ttc caa gtg 816

Ile Asp Val Lys Asn Val Leu Val Asp Met Gly Ile Tyr Phe Gln Val

260 265 270

cag gat gat tat ctg gat tgt ttt gct gat ccc gag acg ctt ggc aag 864

Gln Asp Asp Tyr Leu Asp Cys Phe Ala Asp Pro Glu Thr Leu Gly Lys

275 280 285

ata gga aca gat ata gaa gat ttc aaa tgc tcg tgg ttg gtg gtt aag 912

Ile Gly Thr Asp Ile Glu Asp Phe Lys Cys Ser Trp Leu Val Val Lys

290 295 300

gca tta gag cgc tgc agc gaa gaa caa act aag ata tta tat gag aac 960

Ala Leu Glu Arg Cys Ser Glu Glu Gln Thr Lys Ile Leu Tyr Glu Asn

305 310 315 320

tat ggt aaa ccc gac cca tcg aac gtt gct aaa gtg aag gat ctc tac 1008

Tyr Gly Lys Pro Asp Pro Ser Asn Val Ala Lys Val Lys Asp Leu Tyr

325 330 335

aaa gag ctg gat ctt gag gga gtt ttc atg gag tat gag agc aaa agc 1056

Lys Glu Leu Asp Leu Glu Gly Val Phe Met Glu Tyr Glu Ser Lys Ser

340 345 350

tac gag aag ctg act gga gcg att gag gga cac caa agt aaa gca atc 1104

Tyr Glu Lys Leu Thr Gly Ala Ile Glu Gly His Gln Ser Lys Ala Ile

355 360 365

caa gca gtg cta aaa tcc ttc ttg gct aag arc tac aag agg cag aag 1152

Gln Ala Val Leu Lys Ser Phe Leu Ala Lys Ile Tyr Lys Arg Gln Lys

370 375 380

tag 1155

<210>124

<211>384

<212>PRT

＜213〉mouseearcress

<400>124

Met Ser Val Ser Cys Cys Cys Arg Asn Leu Gly Lys Thr Ile Lys Lys

1 5 10 15

Ala Ile Pro Ser His His Leu His Leu Arg Ser Leu Gly Gly Ser Leu

20 25 30

Tyr Arg Arg Arg Ile Gln Ser Ser Ser Met Glu Thr Asp Leu Lys Ser

35 40 45

Thr Phe Leu Asn Val Tyr Ser Val Leu Lys Ser Asp Leu Leu His Asp

50 55 60

Pro Ser Phe Glu Phe Thr Asn Glu Ser Arg Leu Trp Val Asp Arg Met

65 70 75 80

Leu Asp Tyr Asn Val Arg Gly Gly Lys Leu Asn Arg Gly Leu Ser Val

85 90 95

Val Asp Ser Phe Lys Leu Leu Lys Gln Gly Asn Asp Leu Thr Glu Gln

100 105 110

Glu Val Phe Leu Ser Cys Ala Leu Gly Trp Cys Ile Glu Trp Leu Gln

115 120 125

Ala Tyr Phe Leu Val Leu Asp Asp Ile Met Asp Asn Ser Val Thr Arg

130 135 140

Arg Gly Gln Pro Cys Trp Phe Arg Val Pro Gln Val Gly Met Val Ala

145 150 155 160

Ile Asn Asp Gly Ile Leu Leu Arg Asn His Ile His Arg Ile Leu Lys

165 170 175

Lys His Phe Arg Asp Lys Pro Tyr Tyr Val Asp Leu Val Asp Leu Phe

180 185 190

Asn Glu Val Glu Leu Gln Thr Ala Cys Gly Gln Met Ile Asp Leu Ile

195 200 205

Thr Thr Phe Glu Gly Glu Lys Asp Leu Ala Lys Tyr Ser Leu Ser Ile

210 215 220

His Arg Arg Ile Val Gln Tyr Lys Thr Ala Tyr Tyr Ser Phe Tyr Leu

225 230 235 240

Pro Val Ala Cys Ala Leu Leu Met Ala Gly Glu Asn Leu Glu Asn His

245 250 255

Ile Asp Val Lys Asn Val Leu Val Asp Met Gly Ile Tyr Phe Gln Val

260 265 270

Gln Asp Asp Tyr Leu Asp Cys Phe Ala Asp Pro Glu Thr Leu Gly Lys

275 280 285

Ile Gly Thr Asp Ile Glu Asp Phe Lys Cys Ser Trp Leu Val Val Lys

290 295 300

Ala Leu Glu Arg Cys Ser Glu Glu Gln Thr Lys Ile Leu Tyr Glu Asn

305 310 315 320

Tyr Gly Lys Pro Asp Pro Ser Asn Val Ala Lys Val Lys Asp Leu Tyr

325 330 335

Lys Glu Leu Asp Leu Glu Gly Val Phe Met Glu Tyr Glu Ser Lys Ser

340 345 350

Tyr Glu Lys Leu Thr Gly Ala Ile Glu Gly His Gln Ser Lys Ala Ile

355 360 365

Gln Ala Val Leu Lys Ser Phe Leu Ala Lys Ile Tyr Lys Arg Gln Lys

370 375 380

<210>125

<211>1101

<212>DNA

＜213〉sinapsis alba (sinabs alba)

<220>

<221>CDS

<222>(1)..(1101)

<223>

<400>125

atg gct tct tca gtg act cct cta ggt tca tgg gtt ctt ctt cac cat 48

Met Ala Ser Ser Val Thr Pro Leu Gly Ser Trp Val Leu Leu His His

1 5 10 15

cat cct tca act atc tta acc caa tcc aga tcc aga tct cct cct tct 96

His Pro Ser Thr Ile Leu Thr Gln Ser Arg Ser Arg Ser Pro Pro Ser

20 25 30

ctc atc acc ctt aaa ccc atc tcc ctc act cca aaa cgc acc gtt tcg 144

Leu Ile Thr Leu Lys Pro Ile Ser Leu Thr Pro Lys Arg Thr Val Ser

35 40 45

tct tct tcc tcc tct tcc ctc atc acc aaa gaa gac aac aac ctc aaa 192

Ser Ser Ser Ser Ser Ser Leu Ile Thr Lys Glu Asp Asn Asn Leu Lys

50 55 60

tcc tct tcc tct tcc ttc gat ttc atg tct tac atc atc cgc aaa gcc 240

Ser Ser Ser Ser Ser Phe Asp Phe Met Ser Tyr Ile Ile Arg Lys Ala

65 70 75 80

gac tcc gtc aac aaa gcc tta gac tcc gcc gtc cct ctc cgg gag cca 288

Asp Ser Val Asn Lys Ala Leu Asp Ser Ala Val Pro Leu Arg Glu Pro

85 90 95

ctc aag atc cac gaa gcg atg cgt tac tct ctc ctc gcc gga gga aaa 336

Leu Lys Ile His Glu Ala Met Arg Tyr Ser Leu Leu Ala Gly Gly Lys

100 105 110

cgc gtc aga cca gtt ctc tgc atc gcc gcg tgc gag cta gtc gga gga 384

Arg Val Arg Pro Val Leu Cys Ile Ala Ala Cys Glu Leu Val Gly Gly

115 120 125

gaa gag tct tta got atg ccg gcg cgt tgc gcc gtg gaa atg atc cac 432

Glu Glu Ser Leu Ala Met Pro Ala Arg Cys Ala Val Glu Met Ile His

130 135 140

acc atg tcg ttg atc cac gac gac ttg cct tgt atg gat aac gac gat 480

Thr Met Ser Leu Ile His Asp Asp Leu Pro Cys Met Asp Asn Asp Asp

145 150 155 160

ctc cgc cgc gga aag ccc acg aat cac aaa gtt tac ggc gaa gac gtg 528

Leu Arg Arg Gly Lys Pro Thr Asn His Lys Val Tyr Gly Glu Asp Val

165 170 175

gcg gtt tta gcc gga gsc gcg ctt ctt tcg ttc gcc ttc gag cat tta 576

Ala Val Leu Ala Gly Asp Ala Leu Leu Ser Phe Ala Phe Glu His Leu

180 185 190

gcg tcg gct acg agc tcg gag gtt tct ccg gcg aga gtg gtt aga gct 624

Ala Ser Ala Thr Ser Ser Glu Val Ser Pro Ala Arg Val Val Arg Ala

195 200 205

gtg gga gag ttg gct aaa gcc atc ggc acc gaa ggg ctc gtg gcg gga 672

Val Gly Glu Leu Ala Lys Ala Ile Gly Thr Glu Gly Leu Val Ala Gly

210 215 220

caa gtg gtg gat ata agc agt gaa ggg ttg gac tta aac aac gtc gga 720

Gln Val Val Asp Ile Ser Ser Glu Gly Leu Asp Leu Asn Asr Val Gly

225 230 235 240

ttg gag cat ttg aag ttt ata cat ttg cat aaa scg gcg gcg ttg ctt 768

Leu Glu His Leu Lys Phe Ile His Leu His Lys Thr Ala Ala Leu Leu

245 250 255

gaa gct tca gcg gtt ttg ggt ggg atc atc ggt gga ggg agt gat gaa 816

Glu Ala Ser Ala Val Leu Gly Gly Ile Ile Gly Gly Gly Ser Asp Glu

260 265 270

gag atc gag agg ctg agg aag ttc gcg agg tgt att ggg ttg ttg ttt 864

Glu Ile Glu Arg Leu Arg Lys Phe Ala Arg Cys Ile Gly Leu Leu Phe

275 280 285

cag gtg gtt gat gat atc ttg gac gtg acg aaa tcg tct caa gaa ctg 912

Gln Val Val Asp Asp Ile Leu Asp Val Thr Lys Ser Ser Gln Glu Leu

290 295 300

ggg aaa acc gct ggg aaa gat ttg att gct gat aag ttg act tat ccg 960

Gly Lys Thr Ala Gly Lys Asp Leu Ile Ala Asp Lys Leu Thr Tyr Pro

305 310 315 320

aag ctc atg ggt ttg gag aaa tcg aga gag ttc gct gag aag ttg aat 1008

Lys Leu Met Gly Leu Glu Lys Ser Arg Glu Phe Ala Glu Lys Leu Asn

325 330 335

aca gag gca cgt gat cag ctt tta ggg ttt gat tcc gac aag gtt gct 1056

Thr Glu Ala Arg Asp Gln Leu Leu Gly Phe Asp Ser Asp Lys Val Ala

340 345 350

cct ttg ttg gct ttg gct aat tac att gcc aat aga cag aac tga 1101

Pro Leu Leu Ala Leu Ala Asn Tyr Ile Ala Asn Arg Gln Asn

355 360 365

<210>126

<211>366

<212>PRT

＜213〉sinapsis alba

<400>126

Met Ala Ser Ser Val Thr Pro Leu Gly Ser Trp Val Leu Leu His His

1 5 10 15

His Pro Ser Thr Ile Leu Thr Gln Ser Arg Ser Arg Ser Pro Pro Ser

20 25 30

Leu Ile Thr Leu Lys Pro Ile Ser Leu Thr Pro Lys Arg Thr Val Ser

35 40 45

Ser Ser Ser Ser Ser Ser Leu Ile Thr Lys Glu Asp Asn Asn Leu Lys

50 55 60

Ser Ser Ser Ser Ser Phe Asp Phe Met Ser Tyr Ile Ile Arg Lys Ala

65 70 75 80

Asp Ser Val Asn Lys Ala Leu Asp Ser Ala Val Pro Leu Arg Glu Pro

85 90 95

Leu Lys Ile His Glu Ala Met Arg Tyr Ser Leu Leu Ala Gly Gly Lys

100 105 110

Arg Val Arg Pro Val Leu Cys Ile Ala Ala Cys Glu Leu Val Gly Gly

115 120 125

Glu Glu Ser Leu Ala Met Pro Ala Arg Cys Ala Val Glu Met Ile His

130 135 140

Thr Met Ser Leu Ile His Asp Asp Leu Pro Cys Met Asp Asn Asp Asp

145 150 155 160

Leu Arg Arg Gly Lys Pro Thr Asn His Lys Val Tyr Gly Glu Asp Val

165 170 175

Ala Val Leu Ala Gly Asp Ala Leu Leu Ser Phe Ala Phe Glu His Leu

180 185 190

Ala Ser Ala Thr Ser Ser Glu Val Ser Pro Ala Arg Val Val Arg Ala

195 200 205

Val Gly Glu Leu Ala Lys Ala Ile Gly Thr Glu Gly Leu Val Ala Gly

210 215 220

Gln Val Val Asp Ile Ser Ser Glu Gly Leu Asp Leu Asn Asn Val Gly

225 230 235 240

Leu Glu His Leu Lys Phe Ile His Leu His Lys Thr Ala Ala Leu Leu

245 250 255

Glu Ala Ser Ala Val Leu Gly Gly Ile Ile Gly Gly Gly Ser Asp Glu

260 265 270

Glu Ile Glu Arg Leu Arg Lys Phe Ala Arg Cys Ile Gly Leu Leu Phe

275 280 285

Gln Val Val Asp Asp Ile Leu Asp Val Thr Lys Ser Ser Gln Glu Leu

290 295 300

Gly Lys Thr Ala Gly Lys Asp Leu Ile Ala Asp Lys Leu Thr Tyr Pro

305 310 315 320

Lys Leu Met Gly Leu Glu Lys Ser Arg Glu Phe Ala Glu Lys Leu Asn

325 330 335

Thr Glu Ala Arg Asp Gln Leu Leu Gly Phe Asp Ser Asp Lys Val Ala

340 345 350

Pro Leu Leu Ala Leu Ala Asn Tyr Ile Ala Asn Arg Gln Asn

355 360 365

<210>127

<211>930

<212>DNA

＜213〉Erwinia uredovora (Erwinia uredovora)

<220>

<221>CDS

<222>(1)..(930)

<223>

<400>127

atg aat aat ccg tcg tta ctc aat cat gcg gtc gaa acg atg gca gtt 48

Met Asn Asn Pro Ser Leu Leu Asn His Ala Val Glu Thr Met Ala Val

1 5 10 15

ggc tcg aaa agt ttt gcg aca gcc tca aag tta ttt gat gca aaa acc 96

Gly Ser Lys Ser Phe Ala Thr Ala Ser Lys Leu Phe Asp Ala Lys Thr

20 25 30

cgg cgc agc gta ctg atg ctc tac gcc tgg tgc cgc cat tgt gac gat 144

Arg Arg Ser Val Leu Met Leu Tyr Ala Trp Cys Arg His Cys Asp Asp

35 40 45

gtt att gac gat cag acg ctg ggc ttt cag gcc cgg cag cct gcc tta 192

Val Ile Asp Asp Gln Thr Leu Gly Phe Gln Ala Arg Gln Pro Ala Leu

50 55 60

caa acg ccc gaa caa cgt ctg atg caa ctt gag atg aaa acg cgc cag 240

Gln Thr Pro Glu Gln Arg Leu Met Gln Leu Glu Met Lys Thr Arg Gln

65 70 75 80

gcc tat gca gga tcg cag atg cac gaa ccg gcg ttt gcg gct ttt cag 288

Ala Tyr Ala Gly Ser Gln Met His Glu Pro Ala Phe Ala Ala Phe Gln

85 90 95

gaa gtg gct atg gct cat gat atc gcc ccg gct tac gcg ttt gat cat 336

Glu Val Ala Met Ala His Asp Ile Ala Pro Ala Tyr Ala Phe Asp His

100 105 110

ctg gaa ggc ttc gcc atg gat gta cgc gaa gcg caa tac agc caa ctg 384

Leu Glu Gly Phe Ala Met Asp Val Arg Glu Ala Gln Tyr Ser Gln Leu

115 120 125

gat gat acg ctg cgc tat tgc tat cac gtt gca ggc gtt gtc ggc ttg 432

Asp Asp Thr Leu Arg Tyr Cys Tyr His Val Ala Gly Val Val Gly Leu

130 135 140

atg atg gcg caa atc atg ggc gtg cgg gat aac gcc acg ctg gac cgc 480

Met Met Ala Gln Ile Met Gly Val Arg Asp Asn Ala Thr Leu Asp Arg

145 150 155 160

gcc tgt gac ctt ggg ctg gca ttt cag ttg acc aat att gct cgc gat 528

Ala Cys Asp Leu Gly Leu Ala Phe Gln Leu Thr Asn Ile Ala Arg Asp

165 170 175

att gtg gac gat gcg cat gcg ggc cgc tgt tat ctg ccg gca agc tgg 576

Ile Val Asp Asp Ala His Ala Gly Arg Cys Tyr Leu Pro Ala Ser Trp

180 185 190

ctg gag cat gaa ggt ctg aac aaa gag aat tat gcg gca cct gaa aac 624

Leu Glu His Glu Gly Leu Asn Lys Glu Asn Tyr Ala Ala Pro Glu Asn

195 200 205

cgt cag gcg ctg agc cgt atc gcc cgt cgt ttg gtg cag gaa gca gaa 672

Arg Gln Ala Leu Ser Arg Ile Ala Arg Arg Leu Val Gln Glu Ala Glu

210 215 220

cct tac tat ttg tct gcc aca gcc ggc ctg gca ggg ttg ccc ctg cgt 720

Pro Tyr Tyr Leu Ser Ala Thr Ala Gly Leu Ala Gly Leu Pro Leu Arg

225 230 235 240

tcc gcc tgg gca atc gct acg gcg aag cag gtt tac cgg aaa ata ggt 768

Ser Ala Trp Ala Ile Ala Thr Ala Lys Gln Val Tyr Arg Lys Ile Gly

245 250 255

gtc aaa gtt gaa cag gcc ggt cag caa gcc tgg gat cag cgg cag tca 816

Val Lys Val Glu Gln Ala Gly Gln Gln Ala Trp Asp Gln Arg Gln Ser

260 265 270

acg acc acg ccc gaa aaa tta acg ctg ctg ctg gcc gcc tct ggt cag 864

Thr Thr Thr Pro Glu Lys Leu Thr Leu Leu Leu Ala Ala Ser Gly Gln

275 280 285

gcc ctt act tcc cgg atg cgg gct cat cct ccc cgc cct gcg cat ctc 912

Ala Leu Thr Ser Arg Met Arg Ala His Pro Pro Arg Pro Ala His Leu

290 295 300

tgg cag cgc ccg ctc tag 930

Trp Gln Arg Pro Leu

305

<210>128

<211>309

<212>PRT

＜213〉Erwinia uredovora

<400>128

Met Asn Asn Pro Ser Leu Leu Asn His Ala Val Glu Thr Met Ala Val

1 5 10 15

Gly Ser Lys Ser Phe Ala Thr Ala Ser Lys Leu Phe Asp Ala Lys Thr

20 25 30

Arg Arg Ser Val Leu Met Leu Tyr Ala Trp Cys Arg His Cys Asp Asp

35 40 45

Val Ile Asp Asp Gln Thr Leu Gly Phe Gln Ala Arg Gln Pro Ala Leu

50 55 60

Gln Thr Pro Glu Gln Arg Leu Met Gln Leu Glu Met Lys Thr Arg Gln

65 70 75 80

Ala Tyr Ala Gly Ser Gln Met His Glu Pro Ala Phe Ala Ala Phe Gln

85 90 95

Glu Val Ala Met Ala His Asp Ile Ala Pro Ala Tyr Ala Phe Asp His

100 105 110

Leu Glu Gly Phe Ala Met Asp Val Arg Glu Ala Gln Tyr Ser Gln Leu

115 120 125

Asp Asp Thr Leu Arg Tyr Cys Tyr His Val Ala Gly Val Val Gly Leu

130 135 140

Met Met Ala Gln Ile Met Gly Val Arg Asp Asn Ala Thr Leu Asp Arg

145 150 155 160

Ala Cys Asp Leu Gly Leu Ala Phe Gln Leu Thr Asn Ile Ala Arg Asp

165 170 175

Ile Val Asp Asp Ala His Ala Gly Arg Cys Tyr Leu Pro Ala Ser Trp

180 185 190

Leu Glu His Glu Gly Leu Asn Lys Glu Asn Tyr Ala Ala Pro Glu Asn

195 200 205

Arg Gln Ala Leu Ser Arg Ile Ala Arg Arg Leu Val Gln Glu Ala Glu

210 215 220

Pro Tyr Tyr Leu Ser Ala Thr Ala Gly Leu Ala Gly Leu Pro Leu Arg

225 230 235 240

Ser Ala Trp Ala Ile Ala Thr Ala Lys Gln Val Tyr Arg Lys Ile Gly

245 250 255

Val Lys Val Glu Gln Ala Gly Gln Gln Ala Trp Asp Gln Arg Gln Ser

260 265 270

Thr Thr Thr Pro Glu Lys Leu Thr Leu Leu Leu Ala Ala Ser Gly Gln

275 280 285

Ala Leu Thr Ser Arg Met Arg Ala His Pro Pro Arg Pro Ala His Leu

290 295 300

Trp Gln Arg Pro Leu

305

<210>129

<211>1479

<212>DNA

＜213〉Erwinia uredovora

<220>

<221>CDS

<222>(1)..(1479)

<223>

<400>129

atg aaa cca act acg gta att ggt gca ggc ttc ggt ggc ctg gca ctg 48

Met Lys Pro Thr Thr Val Ile Gly Ala Gly Phe Gly Gly Leu Ala Leu

1 5 10 15

gca att cgt cta caa gct gcg ggg atc ccc gtc tta ctg ctt gaa caa 96

Ala Ile Arg Leu Gln Ala Ala Gly Ile Pro Val Leu Leu Leu Glu Gln

20 25 30

cgt gat aaa ccc ggc ggt cgg gct tat gtc tac gag gat cag ggg ttt 144

Arg Asp Lys Pro Gly Gly Arg Ala Tyr Val Tyr Glu Asp Gln Gly Phe

35 40 45

acc ttt gat gca ggc ccg acg gtt atc acc gat ccc agt gcc att gaa 192

Thr Phe Asp Ala Gly Pro Thr Val Ile Thr Asp Pro Ser Ala Ile Glu

50 55 60

gaa ctg ttt gca ctg gca gga aaa cag tta aaa gag tat gtc gaa ctg 240

Glu Leu Phe Ala Leu Ala Gly Lys Gln Leu Lys Glu Tyr Val Glu Leu

65 70 75 80

ctg ccg gtt acg ccg ttt tac cgc ctg tgt tgg gag tca ggg aag gtc 288

Leu Pro Val Thr Pro Phe Tyr Arg Leu Cys Trp Glu Ser Gly Lys Val

85 90 95

ttt aat tac gat aac gat caa acc cgg ctc gaa gcg cag att cag cag 336

Phe Asn Tyr Asp Asn Asp Gln Thr Arg Leu Glu Ala Gln Ile Gln Gln

100 105 110

ttt aat ccc cgc gat gtc gaa ggt tat cgt cag ttt ctg gac tat tca 384

Phe Asn Pro Arg Asp Val Glu Gly Tyr Arg Gln Phe Leu Asp Tyr Ser

115 120 125

cgc gcg gtg ttt aaa gaa ggc tat cta aag ctc ggt act gtc cct ttt 432

Arg Ala Val Phe Lys Glu Gly Tyr Leu Lys Leu Gly Thr Val Pro Phe

130 135 140

tta tcg ttc aga gac atg ctt cgc gcc gca cct caa ctg gcg aaa ctg 480

Leu Ser Phe Arg Asp Met Leu Arg Ala Ala Pro Gln Leu Ala Lys Leu

145 150 155 160

cag gca tgg aga agc gtt tac agt aag gtt gcc agt tac atc gaa gat 528

Gln Ala Trp Arg Ser Val Tyr Ser Lys Val Ala Ser Tyr Ile Glu Asp

165 170 175

gaa cat ctg cgc cag gcg ttt tct ttc cac tcg ctg ttg gtg ggc ggc 576

Glu His Leu Arg Gln Ala Phe Ser Phe His Ser Leu Leu Val Gly Gly

180 185 190

aat ccc ttc gcc acc tca tcc att tat acg ttg ata cac gcg ctg gag 624

Asn Pro Phe Ala Thr Ser Ser Ile Tyr Thr Leu Ile His Ala Leu Glu

195 200 205

cgt gag tgg ggc gtc tgg ttt ccg cgt ggc ggc acc ggc gca tta gtt 672

Arg Glu Trp Gly Val Trp Phe Pro Arg Gly Gly Thr Gly Ala Leu Val

210 215 220

cag ggg atg ata aag ctg ttt cag gat ctg ggt ggc gaa gtc gtg tta 720

Gln Gly Met Ile Lys Leu Phe Gln Asp Leu Gly Gly Glu Val Val Leu

225 230 235 240

aac gcc aga gtc agc cat atg gaa acg aca gga aac aag att gaa gcc 768

Asn Ala Arg Val Ser His Met Glu Thr Thr Gly Asn Lys Ile Glu Ala

245 250 255

gtg cat tta gag gac ggt cgc agg ttc ctg acg caa gcc gtc gcg tca 816

Val His Leu Glu Asp Gly Arg Arg Phe Leu Thr Gln Ala Val Ala Ser

260 265 270

aat gca gat gtg gtt cat acc tat cgc gac ctg tta agc cag cac cct 864

Asn Ala Asp Val Val His Thr Tyr Arg Asp Leu Leu Ser Gln His Pro

275 280 285

gcc gcg gtt aag cag tcc aac aaa ctg cag act aag cgc atg agt aac 912

Ala Ala Val Lys Gln Ser Asn Lys Leu Gln Thr Lys Arg Met Ser Asn

290 295 300

tct ctg ttt gtg ctc tat ttt ggt ttg aat cac cat cat gat cag ctc 960

Ser Leu Phe Val Leu Tyr Phe Gly Leu Asn His His His Asp Gln Leu

305 310 315 320

gcg cat cac acg gtt tgt ttc ggc ccg cgt tac cgc gag ctg att gac 1008

Ala His His Thr Val Cys Phe Gly Pro Arg Tyr Arg Glu Leu Ile Asp

325 330 335

gaa att ttt aat cat gat ggc ctc gca gag gac ttc tca ctt tat ctg 1056

Glu Ile Phe Asn His Asp Gly Leu Ala Glu Asp Phe Ser Leu Tyr Leu

340 345 350

cac gcg ccc tgt gtc acg gat tcg tca ctg gcg cct gaa ggt tgc ggc 1104

His Ala Pro Cys Val Thr Asp Ser Ser Leu Ala Pro Glu Gly Cys Gly

355 360 365

agt tac tat gtg ttg gcg ccg gtg ccg cat tta ggc acc gcg aac ctc 1152

Ser Tyr Tyr Val Leu Ala Pro Val Pro His Leu Gly Thr Ala Asn Leu

370 375 380

gac tgg acg gtt gag ggg cca aaa cta cgc gac cgt att ttt gcg tac 1200

Asp Trp Thr Val Glu Gly Pro Lys Leu Arg Asp Arg Ile Phe Ala Tyr

385 390 395 400

ctt gag cag cat tac atg cct ggc tta cgg agt cag ctg gtc acg cac 1248

Leu Glu Gln His Tyr Met Pro Gly Leu Arg Ser Gln Leu Val Thr His

405 410 415

cgg atg ttt acg ccg ttt gat ttt cgc gac cag ctt aat gcc tat cat 1296

Arg Met Phe Thr Pro Phe Asp Phe Arg Asp Gln Leu Asn Ala Tyr His

420 425 430

ggc tca gcc ttt tct gtg gag ccc gtt ctt acc cag agc gcc tgg ttt 1344

Gly Ser Ala Phe Ser Val Glu Pro Val Leu Thr Gln Ser Ala Trp Phe

435 440 445

cgg ccg cat aac cgc gat aaa acc att act aat ctc tac ctg gtc ggc 1392

Arg Pro His Asn Arg Asp Lys Thr Ile Thr Asn Leu Tyr Leu Val Gly

450 455 460

gca ggc scg cat ccc ggc gca ggc att cct ggc gtc atc ggc tcg gca 1440

Ala Gly Thr His Pro Gly Ala Gly Ile Pro Gly Val Ile Gly Ser Ala

465 470 475 480

aaa gcg aca gca ggt ttg atg ctg gag gat ctg ata tga 1479

Lys Ala Thr Ala Gly Leu Met Leu Glu Asp Leu Ile

485 490

<210>130

<211>492

<212>PRT

＜213〉Erwinia uredovora

<400>130

Met Lys Pro Thr Thr Val Ile Gly Ala Gly Phe Gly Gly Leu Ala Leu

1 5 10 15

Ala Ile Arg Leu Gln Ala Ala Gly Ile Pro Val Leu Leu Leu Glu Gln

20 25 30

Arg Asp Lys Pro Gly Gly Arg Ala Tyr Val Tyr Glu Asp Gln Gly Phe

35 40 45

Thr Phe Asp Ala Gly Pro Thr Val Ile Thr Asp Pro Ser Ala Ile Glu

50 55 60

Glu Leu Phe Ala Leu Ala Gly Lys Gln Leu Lys Glu Tyr Val Glu Leu

65 70 75 80

Leu Pro Val Thr Pro Phe Tyr Arg Leu Cys Trp Glu Ser Gly Lys Val

85 90 95

Phe Asn Tyr Asp Asn Asp Gln Thr Arg Leu Glu Ala Gln Ile Gln Gln

100 105 110

Phe Asn Pro Arg Asp Val Glu Gly Tyr Arg Gln Phe Leu Asp Tyr Ser

115 120 125

Arg Ala Val Phe Lys Glu Gly Tyr Leu Lys Leu Gly Thr Val Pro Phe

130 135 140

Leu Ser Phe Arg Asp Met Leu Arg Ala Ala Pro Gln Leu Ala Lys Leu

145 150 155 160

Gln Ala Trp Arg Ser Val Tyr Ser Lys Val Ala Ser Tyr Ile Glu Asp

165 170 175

Glu His Leu Arg Gln Ala Phe Ser Phe His Ser Leu Leu Val Gly Gly

180 185 190

Asn Pro Phe Ala Thr Ser Ser Ile Tyr Thr Leu Ile His Ala Leu Glu

195 200 205

Arg Glu Trp Gly Val Trp Phe Pro Arg Gly Gly Thr Gly Ala Leu Val

210 215 220

Gln Gly Met Ile Lys Leu Phe Gln Asp Leu Gly Gly Glu Val Val Leu

225 230 235 240

Asn Ala Arg Val Ser His Met Glu Thr Thr Gly Asn Lys Ile Glu Ala

245 250 255

Val His Leu Glu Asp Gly Arg Arg Phe Leu Thr Gln Ala Val Ala Ser

260 265 270

Asn Ala Asp Val Val His Thr Tyr Arg Asp Leu Leu Ser Gln His Pro

275 280 285

Ala Ala Val Lys Gln Ser Asn Lys Leu Gln Thr Lys Arg Met Ser Asn

290 295 300

Ser Leu Phe Val Leu Tyr Phe Gly Leu Asn His His His Asp Gln Leu

305 310 315 320

Ala His His Thr Val Cys Phe Gly Pro Arg Tyr Arg Glu Leu Ile Asp

325 330 335

Glu Ile Phe Asn His Asp Gly Leu Ala Glu Asp Phe Ser Leu Tyr Leu

340 345 350

His Ala Pro Cys Val Thr Asp Ser Ser Leu Ala Pro Glu Gly Cys Gly

355 360 365

Ser Tyr Tyr Val Leu Ala Pro Val Pro His Leu Gly Thr Ala Asn Leu

370 375 380

Asp Trp Thr Val Glu Gly Pro Lys Leu Arg Asp Arg Ile Phe Ala Tyr

385 390 395 400

Leu Glu Gln His Tyr Met Pro Gly Leu Arg Ser Gln Leu Val Thr His

405 410 415

Arg Met Phe Thr Pro Phe Asp Phe Arg Asp Gln Leu Asn Ala Tyr His

420 425 430

Gly Ser Ala Phe Ser Val Glu Pro Val Leu Thr Gln Ser Ala Trp Phe

435 440 445

Arg Pro His Asn Arg Asp Lys Thr Ile Thr Asn Leu Tyr Leu Val Gly

450 455 460

Ala Gly Thr His Pro Gly Ala Gly Ile Pro Gly Val Ile Gly Ser Ala

465 470 475 480

Lys Ala Thr Ala Gly Leu Met Leu Glu Asp Leu Ile

485 490

<210>131

<211>1725

<212>DNA

＜213〉daffodil (Narcissus pseudonarcissus)

<220>

<221>CDS

<222>(1)..(1725)

<223>

<400>131

atg gct tct tcc act tgt tta att cat tct tcc tct ttt ggg gtt gga 48

Met Ala Ser Ser Thr Cys Leu Ile His Ser Ser Ser Phe Gly Val Gly

1 5 10 15

gga aag aaa gtg aag atg aac acg atg att cga tcg aag ttg ttt tca 96

Gly Lys Lys Val Lys Met Asn Thr Met Ile Arg Ser Lys Leu Phe Ser

20 25 30

att cgg tcg gct ttg gac act aag gtg tct gat atg agc gtc aat gct 144

Ile Arg Ser Ala Leu Asp Thr Lys Val Ser Asp Met Ser Val Asn Ala

35 40 45

cca aaa gga ttg ttt cca cca gag cct gag cac tac agg ggg cca aag 192

Pro Lys Gly Leu Phe Pro Pro Glu Pro Glu His Tyr Arg Gly Pro Lys

50 55 60

ctt aaa gtg gct atc att gga gct ggg ctc gct ggc atg tca act gca 240

Leu Lys Val Ala Ile Ile Gly Ala Gly Leu Ala Gly Met Ser Thr Ala

65 70 75 80

gtg gag ctt ttg gat caa ggg cat gag gtt gac ata tat gaa tcc aga 288

Val Glu Leu Leu Asp Gln Gly His Glu Val Asp Ile Tyr Glu Ser Arg

85 90 95

caa ttt att ggt ggt aaa gtc ggt tct ttt gta gat aag cgt gga aac 336

Gln Phe Ile Gly Gly Lys Val Gly Ser Phe Val Asp Lys Arg Gly Asn

100 105 110

cat att gaa atg gga ctc cat gtg ttt ttt ggt tgc tat aac aat ctt 384

His Ile Glu Met Gly Leu His Val Phe Phe Gly Cys Tyr Asn Asn Leu

115 120 125

ttc aga ctt atg aaa aag gta ggt gca gat gaa aat tta ctg gtg aag 432

Phe Arg Leu Met Lys Lys Val Gly Ala Asp Glu Asn Leu Leu Val Lys

130 135 140

gat cat act cat acc ttt gta aac cga ggt gga gaa att ggt gaa ctt 480

Asp His Thr His Thr Phe Val Asn Arg Gly Gly Glu Ile Gly Glu Leu

145 150 155 160

gat ttc cga ctt ccg atg ggt gca cca tta cat ggt att cgt gca ttt 528

Asp Phe Arg Leu Pro Met Gly Ala Pro Leu His Gly Ile Arg Ala Phe

165 170 175

cta aca act aat caa ctg aag cct tat gat aaa gca agg aat gct gtg 576

Leu Thr Thr Asn Gln Leu Lys Pro Tyr Asp Lys Ala Arg Asn Ala Val

180 185 190

gct ctt gcc ctt agc cca gtt gta cgt gct ctt att gat cca aat ggt 624

Ala Leu Ala Leu Ser Pro Val Val Arg Ala Leu Ile Asp Pro Asn Gly

195 200 205

gca atg cag gat ata agg aac tta gat aat att agc ttt tct gat tgg 672

Ala Met Gln Asp Ile Arg Asn Leu Asp Asn Ile Ser Phe Ser Asp Trp

210 215 220

ttc tta tcc aaa ggc ggt acc cgc atg agc atc caa agg atg tgg gat 720

Phe Leu Ser Lys Gly Gly Thr Arg Met Ser Ile Gln Arg Met Trp Asp

225 230 235 240

cca gtt gct tat gcc ctc gga ttt att gac tgt gat aat atc agt gcc 768

Pro Val Ala Tyr Ala Leu Gly Phe Ile Asp Cys Asp Asn Ile Ser Ala

245 250 255

cgt tgt atg ctt act ata ttt tct cta ttt gct act aag aca gaa gct 816

Arg Cys Met Leu Thr Ile Phe Ser Leu Phe Ala Thr Lys Thr Glu Ala

260 265 270

tct ctg ttg cgt atg ttg aag ggt tcg cct gat gtt tac tta agc ggt 864

Ser Leu Leu Arg Met Leu Lys Gly Ser Pro Asp Val Tyr Leu Ser Gly

275 280 285

cct ata aga aag tat att aca gat aaa ggt gga agg ttt cac cta agg 912

Pro Ile Arg Lys Tyr Ile Thr Asp Lys Gly Gly Arg Phe His Leu Arg

290 295 300

tgg ggg tgt aga gag ata ctt tat gat gaa cta tca aat ggc gac aca 960

Trp Gly Cys Arg Glu Ile Leu Tyr Asp Glu Leu Ser Asn Gly Asp Thr

305 310 315 320

tat atc aca ggc att gca atg tcg aag gct acc aat aaa aaa ctt gtg 1008

Tyr Ile Thr Gly Ile Ala Met Ser Lys Ala Thr Asn Lys Lys Leu Val

325 330 335

aaa gct gac gtg tat gtt gca gca tgt gat gtt cct gga ata aaa agg 1056

Lys Ala Asp Val Tyr Val Ala Ala Cys Asp Val Pro Gly Ile Lys Arg

340 345 350

ttg atc cca tcg gag tgg aga gaa tgg gat cta ttt gac aat atc tat 1104

Leu Ile Pro Ser Glu Trp Arg Glu Trp Asp Leu Phe Asp Asn Ile Tyr

355 360 365

aaa cta gtt gga gtt cca gtt gtc act gtt cag ctt agg tac aat ggt 1152

Lys Leu Val Gly Val Pro Val Val Thr Val Gln Leu Arg Tyr Asn Gly

370 375 380

tgg gtg aca gag atg caa gat ctg gaa aaa tca agg cag ttg aga gct 1200

Trp Val Thr Glu Met Gln Asp Leu Glu Lys Ser Arg Gln Leu Arg Ala

385 390 395 400

gca gta gga ttg gat aat ctt ctt tat act cca gat gca gac ttt tct 1248

Ala Val Gly Leu Asp Asn Leu Leu Tyr Thr Pro Asp Ala Asp Phe Ser

405 410 415

tgt ttt tct gat ctt gca ctc tcg tcg cct gaa gat tat tat att gaa 1296

Cys Phe Ser Asp Leu Ala Leu Ser Ser Pro Glu Asp Tyr Tyr Ile Glu

420 425 430

gga caa ggg tcc cta ata cag gct gtt ctc acg cca ggg gat cca tac 1344

Gly Gln Gly Ser Leu Ile Gln Ala Val Leu Thr Pro Gly Asp Pro Tyr

435 440 445

atg ccc cta cct aat gat gca att ata gaa aga gtt cgg aaa cag gtt 1392

Met Pro Leu Pro Asn Asp Ala Ile Ile Glu Arg Val Arg Lys Gln Val

450 455 460

ttg gat tta ttc cca tcc tct caa ggc ctg gaa gtt cta tgg tct tcg 1440

Leu Asp Leu Phe Pro Ser Ser Gln Gly Leu Glu Val Leu Trp Ser Ser

465 470 475 480

gtg gtt aaa atc gga caa tcc cta tat cgg gag ggg cct gga aag gac 1488

Val Val Lys Ile Gly Gln Ser Leu Tyr Arg Glu Gly Pro Gly Lys Asp

485 490 495

cca ttc aga cct gat cag aag aca cca gta aaa aat ttc ttc ctt gca 1536

Pro Phe Arg Pro Asp Gln Lys Thr Pro Val Lys Asn Phe Phe Leu Ala

500 505 510

ggt tca tac acc aaa cag gat tac att gac agt atg gaa gga gcg acc 1584

Gly Ser Tyr Thr Lys Gln Asp Tyr Ile Asp Ser Met Glu Gly Ala Thr

515 520 525

cta tcg ggg aga caa gca gct gca tat atc tgc agc gcc ggt gaa gat 1632

Leu Ser Gly Arg Gln Ala Ala Ala Tyr Ile Cys Ser Ala Gly Glu Asp

530 535 540

ctg gca gca ctt cgc aag aag atc gct gct gat cat cca gag caa ctg 1680

Leu Ala Ala Leu Arg Lys Lys Ile Ala Ala Asp His Pro Glu Gln Leu

545 550 555 560

atc aac aaa gat tct aac gtg tcg gat gaa ctg agt ctc gta taa 1725

Ile Asn Lys Asp Ser Asn Val Ser Asp Glu Leu Ser Leu Val

565 570

<210>132

<211>574

<212>PRT

＜213〉daffodil

<400>132

Met Ala Ser Ser Thr Cys Leu Ile His Ser Ser Ser Phe Gly Val Gly

1 5 10 15

Gly Lys Lys Val Lys Met Asn Thr Met Ile Arg Ser Lys Leu Phe Ser

20 25 30

Ile Arg Ser Ala Leu Asp Thr Lys Val Ser Asp Met Ser Val Asn Ala

35 40 45

Pro Lys Gly Leu Phe Pro Pro Glu Pro Glu His Tyr Arg Gly Pro Lys

50 55 60

Leu Lys Val Ala Ile Ile Gly Ala Gly Leu Ala Gly Met Ser Thr Ala

65 70 75 80

Val Glu Leu Leu Asp Gln Gly His Glu Val Asp Ile Tyr Glu Ser Arg

85 90 95

Gln Phe Ile Gly Gly Lys Val Gly Ser Phe Val Asp Lys Arg Gly Asn

100 105 110

His Ile Glu Met Gly Leu His Val Phe Phe Gly Cys Tyr Asn Asn Leu

115 120 125

Phe Arg Leu Met Lys Lys Val Gly Ala Asp Glu Asn Leu Leu Val Lys

130 135 140

Asp His Thr His Thr Phe Val Asn Arg Gly Gly Glu Ile Gly Glu Leu

145 150 155 160

Asp Phe Arg Leu Pro Met Gly Ala Pro Leu His Gly Ile Arg Ala Phe

165 170 175

Leu Thr Thr Asn Gln Leu Lys Pro Tyr Asp Lys Ala Arg Asn Ala Val

180 185 190

Ala Leu Ala Leu Ser Pro Val Val Arg Ala Leu Ile Asp Pro Asn Gly

195 200 205

Ala Met Gln Asp Ile Arg Asn Leu Asp Asn Ile Ser Phe Ser Asp Trp

210 215 220

Phe Leu Ser Lys Gly Gly Thr Arg Met Ser Ile Gln Arg Met Trp Asp

225 230 235 240

Pro Val Ala Tyr Ala Leu Gly Phe Ile Asp Cys Asp Asn Ile Ser Ala

245 250 255

Arg Cys Met Leu Thr Ile Phe Ser Leu Phe Ala Thr Lys Thr Glu Ala

260 265 270

Ser Leu Leu Arg Met Leu Lys Gly Ser Pro Asp Val Tyr Leu Ser Gly

275 280 285

Pro Ile Arg Lys Tyr Ile Thr Asp Lys Gly Gly Arg Phe His Leu Arg

290 295 300

Trp Gly Cys Arg Glu Ile Leu Tyr Asp Glu Leu Ser Asn Gly Asp Thr

305 310 315 320

Tyr Ile Thr Gly Ile Ala Met Ser Lys Ala Thr Asn Lys Lys Leu Val

325 330 335

Lys Ala Asp Val Tyr Val Ala Ala Cys Asp Val Pro Gly Ile Lys Arg

340 345 350

Leu Ile Pro Ser Glu Trp Arg Glu Trp Asp Leu Phe Asp Asn Ile Tyr

355 360 365

Lys Leu Val Gly Val Pro Val Val Thr Val Gln Leu Arg Tyr Asn Gly

370 375 380

Trp Val Thr Glu Met Gln Asp Leu Glu Lys Ser Arg Gln Leu Arg Ala

385 390 395 400

Ala Val Gly Leu Asp Asn Leu Leu Tyr Thr Pro Asp Ala Asp Phe Ser

405 410 415

Cys Phe Ser Asp Leu Ala Leu Ser Ser Pro Glu Asp Tyr Tyr Ile Glu

420 425 430

Gly Gln Gly Ser Leu Ile Gln Ala Val Leu Thr Pro Gly Asp Pro Tyr

435 440 445

Met Pro Leu Pro Asn Asp Ala Ile Ile Glu Arg Val Arg Lys Gln Val

450 455 460

Leu Asp Leu Phe Pro Ser Ser Gln Gly Leu Glu Val Leu Trp Ser Ser

465 470 475 480

Val Val Lys Ile Gly Gln Ser Leu Tyr Arg Glu Gly Pro Gly Lys Asp

485 490 495

Pro Phe Arg Pro Asp Gln Lys Thr Pro Val Lys Asn Phe Phe Leu Ala

500 505 510

Gly Ser Tyr Thr Lys Gln Asp Tyr Ile Asp Ser Met Glu Gly Ala Thr

515 520 525

Leu Ser Gly Arg Gln Ala Ala Ala Tyr Ile Cys Ser Ala Gly Glu Asp

530 535 540

Leu Ala Ala Leu Arg Lys Lys Ile Ala Ala Asp His Pro Glu Gln Leu

545 550 555 560

Ile Asn Lys Asp Ser Asn Val Ser Asp Glu Leu Ser Leu Val

565 570

<210>133

<21l>1848

<212>DNA

＜213〉edible tomato

<220>

<221>CDS

<222>(1)..(1848)

<223>

<400>133

atg tgt acc ttg agt ttt atg tat cct aat tca ctt ctt gat ggt acc 48

Met Cys Thr Leu Ser Phe Met Tyr Pro Asn Ser Leu Leu Asp Gly Thr

1 5 10 15

tgc aag act gta gct ttg ggt gat agc aaa ccs aga tac aat aaa cag 96

Cys Lys Thr Val Ala Leu Gly Asp Ser Lys Pro Arg Tyr Asn Lys Gln

20 25 30

aga agt tct tgt ttt gac cct ttg ata att gga aat tgt act gat cag 144

Arg Ser Ser Cys Phe Asp Pro Leu Ile Ile Gly Asn Cys Thr Asp Gln

35 40 45

cag cag ctt tgt ggc ttg agt tgg ggg gtg gac aag gct aag gga aga 192

Gln Gln Leu Cys Gly Leu Ser Trp Gly Val Asp Lys Ala Lys Gly Arg

50 55 60

aga ggg ggt act gtt tcc aat ttg aaa gca gtt gta gat gta gac aaa 240

Arg Gly Gly Thr Val Ser Asn Leu Lys Ala Val Val Asp Val Asp Lys

65 70 75 80

aga gtg gag agc tat ggc agt agt gat gta gaa gga aat gag agt ggc 288

Arg Val Glu Ser Tyr Gly Ser Ser Asp Val Glu Gly Asn Glu Ser Gly

85 90 95

agc tat gat gcc att gtt ata ggt tca gga ata ggt gga ttg gtg gca 336

Ser Tyr Asp Ala Ile Val Ile Gly Ser Gly Ile Gly Gly Leu Val Ala

100 105 110

gcg acg cag ctg gcg gtt aag gga gct aag gtt tta gtt ctg gag aag 384

Ala Thr Gln Leu Ala Val Lys Gly Ala Lys Val Leu Val Leu Glu Lys

115 120 125

tat gtt att cct ggt gga agc tct ggc ttt tac gag agg gat ggt tat 432

Tyr Val Ile Pro Gly Gly Ser Ser Gly Phe Tyr Glu Arg Asp Gly Tyr

130 135 140

aag ttt gat gtt ggt tca tca gtg atg ttt gga ttc agt gat aag gga 480

Lys Phe Asp Val Gly Ser Ser Val Met Phe Gly Phe Ser Asp Lys Gly

145 150 155 160

aac ctc aat tta att act caa gca ttg gca gca gta gga cgt aaa tta 528

Asn Leu Asn Leu Ile Thr Gln Ala Leu Ala Ala Val Gly Arg Lys Leu

165 170 175

gaa gtt ata cct gac cca aca act gta cat ttc cac ctg cca aat gac 576

Glu Val Ile Pro Asp Pro Thr Thr Val His Phe His Leu Pro Asn Asp

180 185 190

ctt tct gtt cgt ata cac cga gag tat gat gac ttc att gaa gag ctt 624

Leu Ser Val Arg Ile His Arg Glu Tyr Asp Asp Phe Ile Glu Glu Leu

195 200 205

gtg agt aaa ttt cca cat gaa aag gaa ggg att atc aaa ttt tac agt 672

Val Ser Lys Phe Pro His Glu Lys Glu Gly Ile Ile Lys Phe Tyr Ser

210 215 220

gaa tgc tgg aag atc ttt aat tct ctg aat tca ttg gaa ctg aag tct 720

Glu Cys Trp Lys Ile Phe Asn Ser Leu Asn Ser Leu Glu Leu Lys Ser

225 230 235 240

ttg gag gaa ccc atc tac ctt ttt ggc cag ttc ttt aag aag ccc ctt 768

Leu Glu Glu Pro Ile Tyr Leu Phe Gly Gln Phe Phe Lys Lys Pro Leu

245 250 255

gaa tgc ttg act ctt gcc tac tat ttg ccc cag aat gct ggt agc atc 816

Glu Cys Leu Thr Leu Ala Tyr Tyr Leu Pro Gln Asn Ala Gly Ser Ile

260 265 270

gct cgg aag tat ata aga gat cct ggg ttg ctg tct ttt ata gat gca 864

Ala Arg Lys Tyr Ile Arg Asp Pro Gly Leu Leu Ser Phe Ile Asp Ala

275 280 285

gag tgc ttt atc gtg agt aca gtt aat gca tta caa aca cca atg atc 912

Glu Cys Phe Ile Val Ser Thr Val Asn Ala Leu Gln Thr Pro Met Ile

290 295 300

aat gca agc atg gtt cta tgt gac aga cat ttt ggc gga atc aac tac 960

Asn Ala Ser Met Val Leu Cys Asp Arg His Phe Gly Gly Ile Asn Tyr

305 310 315 320

ccc gtt ggt gga gtt ggc gag atc gcc aaa tcc tta gca aaa ggc ttg 1008

Pro Val Gly Gly Val Gly Glu Ile Ala Lys Ser Leu Ala Lys Gly Leu

325 330 335

gat gat cac gga agt cag ata ctt tat agg gca aat gtt aca agt atc 1056

Asp Asp His Gly Ser Gln Ile Leu Tyr Arg Ala Asn Val Thr Ser Ile

340 345 350

att ttg gac aat ggc aaa gct gtg gga gtg aag ctt tct gac ggg agg 1104

Ile Leu Asp Asn Gly Lys Ala Val Gly Val Lys Leu Ser Asp Gly Arg

355 360 365

aag ttt tat gct aaa acc ata gta tcg aat gct acc aga tgg gat act 1152

Lys Phe Tyr Ala Lys Thr Ile Val Ser Asn Ala Thr Arg Trp Asp Thr

370 375 380

ttt gga aag ctt tta aaa gct gag aat ctg cca aaa gaa gaa gaa aat 1200

Phe Gly Lys Leu Leu Lys Ala Glu Asn Leu Pro Lys Glu Glu Glu Asn

385 390 395 400

ttc cag aaa gct tat gta aaa gca cct tct ttt ctt tct att cat atg 1248

Phe Gln Lys Ala Tyr Val Lys Ala Pro Ser Phe Leu Ser Ile His Met

405 410 415

gga gtt aaa gca gat gta ctc cca cca gac aca gat tgt cac cat ttt 1296

Gly Val Lys Ala Asp Val Leu Pro Pro Asp Thr Asp Cys His His Phe

420 425 430

gtc ctc gag gat gat tgg aca aat ttg gag aaa cca tat gga agt ata 1344

Val Leu Glu Asp Asp Trp Thr Asn Leu Glu Lys Pro Tyr Gly Ser Ile

435 440 445

ttc ttg agt att cca aca gtt ctt gat tcc tca ttg gcc cca gaa gga 1392

Phe Leu Ser Ile Pro Thr Val Leu Asp Ser Ser Leu Ala Pro Glu GlV

450 455 460

cac cat att ctt cac att ttt aca aca tcg agc att gaa gat tgg gag 1440

His His Ile Leu His Ile Phe Thr Thr Ser Ser Ile Glu Asp Trp Glu

465 470 475 480

gga ctc tct ccg aaa gac tat gaa gcg aag aaa gag gtt gtt gct gaa 1488

Gly Leu Ser Pro Lys Asp Tyr Glu Ala Lys Lys Glu Val Val Ala Glu

485 490 495

agg att ata agc aga ctt gaa aaa aca ctc ttc cca ggg ctt aag tca 1536

Arg Ile Ile Ser Arg Leu Glu Lys Thr Leu Phe Pro Gly Leu Lys Ser

500 505 510

tct att ctc ttt aag gag gtg gga act cca aag acc cac aga cga tac 1584

Ser Ile Leu Phe Lys Glu Val Gly Thr Pro Lys Thr His Arg Arg Tyr

515 520 525

ctt gct cgt gat agt ggt acc tat gga cca atg cca cgc gga aca cct 1632

Leu Ala Arg Asp Ser Gly Thr Tyr Gly Pro Met Pro Arg Gly Thr Pro

530 535 540

aag gga ctc ctg gga atg cct ttc aat acc act gct ata gat ggt cta 1680

Lys Gly Leu Leu Gly Met Pro Phe Asn Thr Thr Ala Ile Asp Gly Leu

545 550 555 560

tat tgt gtt ggc gat agt tgc ttc cca gga caa ggt gtt ata gct gta 1728

Tyr Cys Val Gly Asp Ser Cys Phe Pro Gly Gln Gly Val Ile Ala Val

565 570 575

gcc ttt tca gga gta atg tgc gct cat cgt gtt gca gct gac tta ggg 1776

Ala Phe Ser Gly Val Met Cys Ala His Arg Val Ala Ala Asp Leu Gly

580 585 590

ttt gaa aaa aaa tca gat gtg ctg gac agt gct ctt ctt aga cta ctt 1824

Phe Glu Lys Lys Ser Asp Val Leu Asp Ser Ala Leu Leu Arg Leu Leu

595 600 605

ggt tgg tta agg aca cta gca tga 1848

Gly Trp Leu Arg Thr Leu Ala

610 615

<210>134

<211>615

<212>PRT

＜213〉edible tomato

<400>134

Met Cys Thr Leu Ser Phe Met Tyr Pro Asn Ser Leu Leu Asp Gly Thr

1 5 10 15

Cys Lys Thr Val Ala Leu Gly Asp Ser Lys Pro Arg Tyr Asn Lys Gln

20 25 30

Arg Ser Ser Cys Phe Asp Pro Leu Ile Ile Gly Asn Cys Thr Asp Gln

35 40 45

Gln Gln Leu Cys Gly Leu Ser Trp Gly Val Asp Lys Ala Lys Gly Arg

50 55 60

Arg Gly Gly Thr Val Ser Asn Leu Lys Ala Val Val Asp Val Asp Lys

65 70 75 80

Arg Val Glu Ser Tyr Gly Ser Ser Asp Val Glu Gly Asn Glu Ser Gly

85 90 95

Ser Tyr Asp Ala Ile Val Ile Gly Ser Gly Ile Gly Gly Leu Val Ala

100 105 110

Ala Thr Gln Leu Ala Val Lys Gly Ala Lys Val Leu Val Leu Glu Lys

115 120 125

Tyr Val Ile Pro Gly Gly Ser Ser Gly Phe Tyr Glu Arg Asp Gly Tyr

130 135 140

Lys Phe Asp Val Gly Ser Ser Val Met Phe Gly Phe Ser Asp Lys Gly

145 150 155 160

Asn Leu Asn Leu Ile Thr Gln Ala Leu Ala Ala Val Gly Arg Lys Leu

165 170 175

Glu Val Ile Pro Asp Pro Thr Thr Val His Phe His Leu Pro Asn Asp

180 185 190

Leu Ser Val Arg Ile His Arg Glu Tyr Asp Asp Phe Ile Glu Glu Leu

195 200 205

Val Ser Lys Phe Pro His Glu Lys Glu Gly Ile Ile Lys Phe Tyr Ser

210 215 220

Glu Cys Trp Lys Ile Phe Asn Ser Leu Asn Ser Leu Glu Leu Lys Ser

225 230 235 240

Leu Glu Glu Pro Ile Tyr Leu Phe Gly Gln Phe Phe Lys Lys Pro Leu

245 250 255

Glu Cys Leu Thr Leu Ala Tyr Tyr Leu Pro Gln Asn Ala Gly Ser Ile

260 265 270

Ala Arg Lys Tyr Ile Arg Asp Pro Gly Leu Leu Ser Phe Ile Asp Ala

275 280 285

Glu Cys Phe Ile Val Ser Thr Val Asn Ala Leu Gln Thr Pro Met Ile

290 295 300

Asn Ala Ser Met Val Leu Cys Asp Arg His Phe Gly Gly Ile Asn Tyr

305 310 315 320

Pro Val Gly Gly Val Gly Glu Ile Ala Lys Ser Leu Ala Lys Gly Leu

325 330 335

Asp Asp His Gly Ser Gln Ile Leu Tyr Arg Ala Asn Val Thr Ser Ile

340 345 350

Ile Leu Asp Asn Gly Lys Ala Val Gly Val Lys Leu Ser Asp Gly Arg

355 360 365

Lys Phe Tyr Ala Lys Thr Ile Val Ser Asn Ala Thr Arg Trp Asp Thr

370 375 380

Phe Gly Lys Leu Leu Lys Ala Glu Asn Leu Pro Lys Glu Glu Glu Asn

385 390 395 400

Phe Gln Lys Ala Tyr Val Lys Ala Pro Ser Phe Leu Ser Ile His Met

405 410 415

Gly Val Lys Ala Asp Val Leu Pro Pro Asp Thr Asp Cys His His Phe

420 425 430

Val Leu Glu Asp Asp Trp Thr Asn Leu Glu Lys Pro Tyr Gly Ser Ile

435 440 445

Phe Leu Ser Ile Pro Thr Val Leu Asp Ser Ser Leu Ala Pro Glu Gly

450 455 460

His His Ile Leu His Ile Phe Thr Thr Ser Ser Ile Glu Asp Trp Glu

465 470 475 480

Gly Leu Ser Pro Lys Asp Tyr Glu Ala Lys Lys Glu Val Val Ala Glu

485 490 495

Arg Ile Ile Ser Arg Leu Glu Lys Thr Leu Phe Pro Gly Leu Lys Ser

500 505 510

Ser Ile Leu Phe Lys Glu Val Gly Thr Pro Lys Thr His Arg Arg Tyr

515 520 525

Leu Ala Arg Asp Ser Gly Thr Tyr Gly Pro Met Pro Arg Gly Thr Pro

530 535 540

Lys Gly Leu Leu Gly Met Pro Phe Asn Thr Thr Ala Ile Asp Gly Leu

545 550 555 560

Tyr Cys Val Gly Asp Ser Cys Phe Pro Gly Gln Gly Val Ile Ala Val

565 570 575

Ala Phe Ser Gly Val Met Cys Ala His Arg Val Ala Ala Asp Leu Gly

580 585 590

Phe Glu Lys Lys Ser Asp Val Leu Asp Ser Ala Leu Leu Arg Leu Leu

595 600 605

Gly Trp Leu Arg Thr Leu Ala

610 615

<210>135

<211>1233

<212>DNA

＜213〉marigold

<220>

<221>CDS

<222>(1)..(1233)

<223>

<400>135

atg gcc aca cac aaa ctc ctt caa ttc acc acc aat ctc cca cca tct 48

Met Ala Thr His Lys Leu Leu Gln Phe Thr Thr Asn Leu Pro Pro Ser

1 5 10 15

tct tct tca atc tct act ggc tgt tca ctc tcc ccc ttc ttc ctc aaa 96

Ser Ser Ser Ile Ser Thr Gly Cys Ser Leu Ser Pro Phe Phe Leu Lys

20 25 30

tca tct tct cat tcc cct aac cct cgc cga cac cgc cgc tcc gcc gta 144

Ser Ser Ser His Ser Pro Asn Pro Arg Arg His Arg Arg Ser Ala Val

35 40 45

tgc tgc tct ttc gcc tca ctc gac tct gca aaa atc aaa gtc gtt ggc 192

Cys Cys Ser Phe Ala Ser Leu Asp Ser Ala Lys Ile Lys Val Val Gly

50 55 60

gtc ggt ggt ggt ggc aac aat gcc gtt aac cgc atg att ggt agc ggc 240

Val Gly Gly Gly Gly Asn Asn Ala Val Asn Arg Met Ile Gly Ser Gly

65 70 75 80

tta cag ggt gtt gat ttt tac gcc att aac acg gac tca caa gcg ctt 288

Leu Gln Gly Val Asp Phe Tyr Ala Ile Asn Thr Asp Ser Gln Ala Leu

85 90 95

ctg caa tct gtt gca cat aac cct att caa att ggg gag ctt ttg act 336

Leu Gln Ser Val Ala His Asn Pro Ile Gln Ile Gly Glu Leu Leu Thr

100 105 110

cgt gga tta ggt act ggt ggg aac ccg ctt ttg gga gaa cag gct gcg 384

Arg Gly Leu Gly Thr Gly Gly Asn Pro Leu Leu Gly Glu Gln Ala Ala

115 120 125

gag gag tcg aag gaa gcg att ggg aat gcg ctt aaa ggg tcg gat ctt 432

Glu Glu Ser Lys Glu Ala Ile Gly Asn Ala Leu Lys Gly Ser Asp Leu

130 135 140

gtg ttt ata aca gca ggt atg ggt ggt ggg acg ggt tcg ggt gct gct 480

Val Phe Ile Thr Ala Gly Met Gly Gly Gly Thr Gly Ser Gly Ala Ala

145 150 155 160

cca gtt gta gcg cag ata gcg aaa gaa gca ggg tat tta act gtt ggt 528

Pro Val Val Ala Gln Ile Ala Lys Glu Ala Gly Tyr Leu Thr Val Gly

165 170 175

gtt gta acg tac cca ttc agc ttt gaa ggc cgt aaa aga tca gta cag 576

Val Val Thr Tyr Pro Phe Ser Phe Glu Gly Arg Lys Arg Ser Val Gln

180 185 190

gcg tta gag gct att gag aag ctg caa aag aac gtt gac aca ctt ata 624

Ala Leu Glu Ala Ile Glu Lys Leu Gln Lys Asn Val Asp Thr Leu Ile

195 200 205

gtg att cca aat gac cgt ttg ctg gat att gct gat gaa aac acg cct 672

Val Ile Pro Asn Asp Arg Leu Leu Asp Ile Ala Asp Glu Asn Thr Pro

210 215 220

ctt cag gat gct ttt ctt ctt gct gat gat gta ctc cgc caa gga gtt 720

Leu Gln Asp Ala Phe Leu Leu Ala Asp Asp Val Leu Arg Gln Gly Val

225 230 235 240

caa gga atc tca gat ata att aca ata cct ggg ctg gta aat gtg gac 768

Gln Gly Ile Ser Asp Ile Ile Thr Ile Pro Gly Leu Val Asn Val Asp

245 250 255

ttt gca gac gtt aaa gca gtc atg aaa gat tct gga act gca atg ctt 816

Phe Ala Asp Val Lys Ala Val Met Lys Asp Ser Gly Thr Ala Met Lau

260 265 270

ggt gtc ggt gtt tcc tca agt aaa aac cga gct gaa gaa gca gct gaa 864

Gly Val Gly Val Ser Ser Ser Lys Asn Arg Ala Glu Glu Ala Ala Glu

275 280 285

caa gca act ctt gct cct ttg att gga tca tca att caa tct gct aca 912

Gln Ala Thr Leu Ala Pro Leu Ile Gly Ser Ser Ile Gln Ser Ala Thr

290 295 300

ggt gtt gtt tat aat att acc gga ggg aag gac ata act cta caa gaa 960

Gly Val Val Tyr Asn Ile Thr Gly Gly Lys Asp Ile Thr Leu Gln Glu

305 310 315 320

gtc aac agg gtt tct cag gtg gta aca agt ttg gca gat cca tca gca 1008

Val Asn Arg Val Ser Gln Val Val Thr Ser Leu Ala Asp Pro Ser Ala

325 330 335

aac att ata ttc ggg gca gtg gta gat gag aga tac aac ggg gag att 1056

Asn Ile Ile Phe Gly Ala Val Val Asp Glu Arg Tyr Asn Gly Glu Ile

340 345 350

cat gtg acc att gtt gct act ggc ttt gcc cag tcg ttt cag aaa tct 1104

His Val Thr Ile Val Ala Thr Gly Phe Ala Gln Ser Phe Gln Lys Ser

355 360 365

ctt ctt gct gac ccg aaa gga gca aaa ctt gtt gat aga aat caa gaa 1152

Leu Leu Ala Asp Pro Lys Gly Ala Lys Leu Val Asp Arg Asn Gln Glu

370 375 380

cct aca caa cct ttg act tcc gcg aga tct ttg aca aca cct tct cct 1200

Pro Thr Gln Pro Leu Thr Ser Ala Arg Ser Leu Thr Thr Pro Ser Pro

385 390 395 400

gct ccg tct cgg tct agg aaa ctc ttc ttt taa 1233

Ala Pro Ser Arg Ser Arg Lys Leu Phe Phe

405 410

<210>136

<211>410

<212>PRT

＜213〉marigold

<400>136

Met Ala Thr His Lys Leu Leu Gln Phe Thr Thr Asn Leu Pro Pro Ser

1 5 10 15

Ser Ser Ser Ile Ser Thr Gly Cys Ser Leu Ser Pro Phe Phe Leu Lys

20 25 30

Ser Ser Ser His Ser Pro Asn Pro Arg Arg His Arg Arg Ser Ala Val

35 40 45

Cys Cys Ser Phe Ala Ser Leu Asp Ser Ala Lys Ile Lys Val Val Gly

50 55 60

Val Gly Gly Gly Gly Asn Asn Ala Val Asn Arg Met Ile Gly Ser Gly

65 70 75 80

Leu Gln Gly Val Asp Phe Tyr Ala Ile Asn Thr Asp Ser Gln Ala Leu

85 90 95

Leu Gln Ser Val Ala His Asn Pro Ile Gln Ile Gly Glu Leu Leu Thr

100 105 110

Arg Gly Leu Gly Thr Gly Gly Asn Pro Leu Leu Gly Glu Gln Ala Ala

115 120 125

Glu Glu Ser Lys Glu Ala Ile Gly Asn Ala Leu Lys Gly Ser Asp Leu

130 135 140

Val Phe Ile Thr Ala Gly Met Gly Gly Gly Thr Gly Ser Gly Ala Ala

145 150 155 160

Pro Val Val Ala Gln Ile Ala Lys Glu Ala Gly Tyr Leu Thr Val Gly

165 170 175

Val Val Thr Tyr Pro Phe Ser Phe Glu Gly Arg Lys Arg Ser Val Gln

180 185 190

Ala Leu Glu Ala Ile Glu Lys Leu Gln Lys Asn Val Asp Thr Leu Ile

195 200 205

Val Ile Pro Asn Asp Arg Leu Leu Asp Ile Ala Asp Glu Asn Thr Pro

210 215 220

Leu Gln Asp Ala Phe Leu Leu Ala Asp Asp Val Leu Arg Gln Gly Val

225 230 235 240

Gln Gly Ile Ser Asp Ile Ile Thr Ile Pro Gly Leu Val Asn Val Asp

245 250 255

Phe Ala Asp Val Lys Ala Val Met Lys Asp Ser Gly Thr Ala Met Leu

260 265 270

Gly Val Gly Val Ser Ser Ser Lys Asn Arg Ala Glu Glu Ala Ala Glu

275 280 285

Gln Ala Thr Leu Ala Pro Leu Ile Gly Ser Ser Ile Gln Ser Ala Thr

290 295 300

Gly Val Val Tyr Asn Ile Thr Gly Gly Lys Asp Ile Thr Leu Gln Glu

305 310 315 320

Val Asn Arg Val Ser Gln Val Val Thr Ser Leu Ala Asp Pro Ser Ala

325 330 335

Asn Ile Ile Phe Gly Ala Val Val Asp Glu Arg Tyr Asn Gly Glu Ile

340 345 350

His Val Thr Ile Val Ala Thr Gly Phe Ala Gln Ser Phe Gln Lys Ser

355 360 365

Leu Leu Ala Asp Pro Lys Gly Ala Lys Leu Val Asp Arg Asn Gln Glu

370 375 380

Pro Thr Gln Pro Leu Thr Ser Ala Arg Ser Leu Thr Thr Pro Ser Pro

385 390 395 400

Ala Pro Ser Arg Ser Arg Lys Leu Phe Phe

405 410

<210>137

<211>891

<212>DNA

＜213〉marigold

<220>

<221>CDS

<222>(1)..(891)

<223>

<400>137

atg aca tcc ctg agg ttt cta aca gaa ccc tca ctt gta tgc tca tcc 48

Met Thr Ser Leu Arg Phe Leu Thr Glu Pro Ser Leu Val Cys Ser Ser

1 5 10 15

act ttc ccc aca ttc aat ccc cta cac aaa acc cta act aaa cca aca 96

Thr Phe Pro Thr Phe Asn Pro Leu His Lys Thr Leu Thr Lys Pro Thr

20 25 30

cca aaa ccc tac cca aag cca cca cca att cgc tcc gtc ctt caa tac 144

Pro Lys Pro Tyr Pro Lys Pro Pro Pro Ile Arg Ser Val Leu Gln Tyr

35 40 45

aat cgc aaa cca gag ctc gcc gga gac act cca cga gtc gtc gca atc 192

Asn Arg Lys Pro Glu Leu Ala Gly Asp Thr Pro Arg Val Val Ala Ile

50 55 60

gac gcc gac gtt ggt cta cgt aac ctc gat ctt ctt ctc ggt ctc gaa 240

Asp Ala Asp Val Gly Leu Arg Asn Leu Asp Leu Leu Leu Gly Leu Glu

65 70 75 80

aac cgc gtc aat tac acc gtc gtt gaa gtt ctc aac ggc gat tgc aga 288

Asn Arg Val Asn Tyr Thr Val Val Glu Val Leu Asn Gly Asp Cys Arg

85 90 95

ctc gac caa gcc cta gtt cgt gat aaa cgc tgg tca aat ttc gaa ttg 336

Leu Asp Gln Ala Leu Val Arg Asp Lys Arg Trp Ser Asn Phe Glu Leu

100 105 110

ctt tgt att tca aaa cct agg tca aaa ttg cct tta gga ttt ggg gga 384

Leu Cys Ile Ser Lys Pro Arg Ser Lys Leu Pro Leu Gly Phe Gly Gly

115 120 125

aaa gct tta gtt tgg ctt gat gca tta aaa gat agg caa gaa ggt tgc 432

Lys Ala Leu Val Trp Leu Asp Ala Leu Lys Asp Arg Gln Glu Gly Cys

130 135 140

ccg gat ttt ata ctt ata gat tgt cct gca ggt att gat gcc ggg ttc 480

Pro Asp Phe Ile Leu Ile Asp Cys Pro Ala Gly Ile Asp Ala Gly Phe

145 150 155 160

ata acc gcc att aca ccg gct aac gaa gcc gta tta gtt aca aca cct 528

Ile Thr Ala Ile Thr Pro Ala Asn Glu Ala Val Leu Val Thr Thr Pro

165 170 175

gat att act gca ttg aga gat gca gat aga gtt aca ggc ttg ctt gaa 576

Asp Ile Thr Ala Leu Arg Asp Ala Asp Arg Val Thr Gly Leu Leu Glu

180 185 190

tgt gat gga att agg gat att aaa atg att gtg aac aga gtt aga act 624

Cys Asp Gly Ile Arg Asp Ile Lys Met Ile Val Asn Arg Val Arg Thr

195 200 205

gat ttg ata agg ggt gaa gat atg atg tca gtt ctt gat gtt caa gag 672

Asp Leu Ile Arg Gly Glu Asp Met Met Ser Val Leu Asp Val Gln Glu

210 215 220

atg ttg gga ttg tca ttg ttg agt gat acc cga gga ttc gaa gtg att 720

Met Leu Gly Leu Ser Leu Leu Ser Asp Thr Arg Gly Phe Glu Val Ile

225 230 235 240

cgg agt acg aat aga ggg ttt ccg ctt gtg ttg aac aag cct ccg act 768

Arg Ser Thr Asn Arg Gly Phe Pro Leu Val Leu Asn Lys Pro Pro Thr

245 250 255

tta gca gga ttg gca ttt gag cag gct gct tgg aga ttg gtt gag caa 816

Leu Ala Gly Leu Ala Phe Glu Gln Ala Ala Trp Arg Leu Val Glu Gln

260 265 270

gat agc atg aag gct gtg atg gtg gag gaa gaa cct aaa aag agg gga 864

Asp Ser Met Lys Ala Val Met Val Glu Glu Glu Pro Lys Lys Arg Gly

275 280 285

ttt ttc tcg ttt ttt gga ggt tag tga 891

Phe Phe Ser Phe Phe Gly Gly

290 295

<210>138

<211>295

<212>PRT

＜213〉marigold

<400>138

Met Thr Ser Leu Arg Phe Leu Thr Glu Pro Ser Leu Val Cys Ser Ser

1 5 10 15

Thr Phe Pro Thr Phe Asn Pro Leu His Lys Thr Leu Thr Lys Pro Thr

20 25 30

Pro Lys Pro Tyr Pro Lys Pro Pro Pro Ile Arg Ser Val Leu Gln Tyr

35 40 45

Asn Arg Lys Pro Glu Leu Ala Gly Asp Thr Pro Arg Val Val Ala Ile

50 55 60

Asp Ala Asp Val Gly Leu Arg Asn Leu Asp Leu Leu Leu Gly Leu Glu

65 70 75 80

Asn Arg Val Asn Tyr Thr Val Val Glu Val Leu Asn Gly Asp Cys Arg

85 90 95

Leu Asp Gln Ala Leu Val Arg Asp Lys Arg Trp Ser Asn Phe Glu Leu

100 105 110

Leu Cys Ile Ser Lys Pro Arg Ser Lys Leu Pro Leu Gly Phe Gly Gly

115 120 125

Lys Ala Leu Val Trp Leu Asp Ala Leu Lys Asp Arg Gln Glu Gly Cys

130 135 140

Pro Asp Phe Ile Leu Ile Asp Cys Pro Ala Gly Ile Asp Ala Gly Phe

145 150 155 160

Ile Thr Ala Ile Thr Pro Ala Asn Glu Ala Val Leu Val Thr Thr Pro

165 170 175

Asp Ile Thr Ala Leu Arg Asp Ala Asp Arg Val Thr Gly Leu Leu Glu

180 185 190

Cys Asp Gly Ile Arg Asp Ile Lys Met Ile Val Asn Arg Val Arg Thr

195 200 205

Asp Leu Ile Arg Gly Glu Asp Met Met Ser Val Leu Asp Val Gln Glu

210 215 220

Met Leu Gly Leu Ser Leu Leu Ser Asp Thr Arg Gly Phe Glu Val Ile

225 230 235 240

Arg Ser Thr Asn Arg Gly Phe Pro Leu Val Leu Asn Lys Pro Pro Thr

245 250 255

Leu Ala Gly Leu Ala Phe Glu Gln Ala Ala Trp Arg Leu Val Glu Gln

260 265 270

Asp Ser Met Lys Ala Val Met Val Glu Glu Glu Pro Lys Lys Arg Gly

275 280 285

Phe Phe Ser Phe Phe Gly Gly

290 295

<210>139

<211>332

<212>DNA

＜213〉marigold

<220>

<221>CDS

<222>(1)..(330)

<223>

<400>139

aag ctt gca cga gcc tct ctc tat ttt tac act tca atg gcg gca gca 48

Lys Leu Ala Arg Ala Ser Leu Tyr Phe Tyr Thr Ser Met Ala Ala Ala

1 5 10 15

att gct gtc cct tgt agc tca aga cca ttt ggc tta ggt cga atg cgg 96

Ile Ala Val Pro Cys Ser Ser Arg Pro Phe Gly Leu Gly Arg Met Arg

20 25 30

tta ctt ggt cat aaa ccc aca acc ata act tgt cac ttc ccc ttt tct 144

Leu Leu Gly His Lys Pro Thr Thr Ile Thr Cys His Phe Pro Phe Ser

35 40 45

ttt tct atc aaa tca ttt acc cca att gtt agg ggc aga aga tgt act 192

Phe Ser Ile Lys Ser Phe Thr Pro Ile Val Arg Gly Arg Arg Cys Thr

50 55 60

gtt tgt ttt gtt gcc ggt ggc gac agt aat agt aac agt aat aat aat 240

Val Cys Phe Val Ala Gly Gly Asp Ser Asn Ser Asn Ser Asn Asn Asn

65 70 75 80

agt gac agt aat agt aat aat cog ggt ctg gat tta aac ccg gcg gtt 288

Ser Asp Ser Asn Ser Asn Asn Pro Gly Leu Asp Leu Asn Pro Ala Val

85 90 95

atg aac cgt aac cgt ttg gtt gaa gaa aaa atg gag agg tcg ac 332

Met Asn Arg Asn Arg Leu Val Glu Glu Lys Met Glu Arg Ser

100 105 110

<210>140

<211>110

<212>PRT

＜213〉marigold

<400>140

Lys Leu Ala Arg Ala Ser Leu Tyr Phe Tyr Thr Ser Met Ala Ala Ala

1 5 10 15

Ile Ala Val Pro Cys Ser Ser Arg Pro Phe Gly Leu Gly Arg Met Arg

20 25 30

Leu Leu Gly His Lys Pro Thr Thr Ile Thr Cys His Phe Pro Phe Ser

35 40 45

Phe Ser Ile Lys Ser Phe Thr Pro Ile Val Arg Gly Arg Arg Cys Thr

50 55 60

Val Cys Phe Val Ala Gly Gly Asp Ser Asn Ser Asn Ser Asn Asn Asn

65 70 75 80

Ser Asp Ser Asn Ser Asn Asn Pro Gly Leu Asp Leu Asn Pro Ala Val

85 90 95

Met Asn Arg Asn Arg Leu Val Glu Glu Lys Met Glu Arg Ser

100 105 110

<210>141

<211>332

<212>DNA

＜213〉marigold

<220>

<221>misc_feature

<222>(1)..(332)

＜223〉B-hydroxylase is had a mind to fragment

<400>141

aagcttgcac gagcctctct ctatttttac acttcaatgg cggcagcaat tgctgtccct 60

tgtagctcaa gaccatttgg cttaggtcga atacggttac ttggtcataa acccacaacc 120

ataacttgtc acttcccctt ttctttttct atcaaatcat ttaccccaat tgttaggggc 180

agaagatgta ctgtttgttt tgttgccggt ggcgacagta atagtaacag taataataat 240

agtgacagta atagtaataa tccgggtctg gatttaaacc cggcggttat gaaccgtaac 300

cgtttggttg aagaaaaaat ggagaggtcg ac 332

<210>142

<211>332

<212>DNA

＜213〉marigold

<220>

<221>misc_feature

<222>(1)..(332)

＜223〉B-hydroxylase antisense fragment

<400>142

gaattcggca cgagcctctc tctattttta cacttcaatg gcggcagcaa ttgctgtccc 60

ttgtagctca agaccatttg gcttaggtcg aatgcggtta cttggtcata aacccacaac 120

cataacttgt cacttcccct tttctttttc tatcaaatca tttaccccaa ttgttagggg 180

cagaagatgt actgtttgtt ttgttgccgg tggcgacagt aatagtaaca gtaataataa 240

tagtgacagt aatagtaata atccgggtct ggatttaaac ccggcggtta tgaaccgtaa 300

ccgtttggtt gaagaaaaaa tggagaggat cc 332

Claims

1. the purposes of the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part, or the plants of tagetes species of astaxanthin-containing or plant part is used to be administered orally in animal.

2. purposes according to claim 1, the astaxanthin-containing extract of the wherein plants of tagetes species of astaxanthin-containing or plant part, or the plants of tagetes species of astaxanthin-containing or plant part is used for painted animal and corresponding animal product.

3. purposes according to claim 1 and 2, the astaxanthin-containing extract of the wherein plants of tagetes species of astaxanthin-containing or plant part, or the plants of tagetes species of astaxanthin-containing or plant part mixes with the animal feed goods and these animal feed goods are administered orally in animal.

4. purposes according to claim 3, wherein with before the animal feed goods mix, with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is processed into the form that can mix with the animal feed goods.

5. purposes according to claim 1 and 2, the astaxanthin-containing extract of the wherein plants of tagetes species of astaxanthin-containing or plant part, or the plants of tagetes species of astaxanthin-containing or plant part directly is administered orally in animal.

6. purposes according to claim 5, wherein before using, with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is processed into the form that can directly be administered orally in animal.

7. purposes according to claim 1, wherein the plants of tagetes species of astaxanthin-containing is the plant of genetic modification, wherein said genetic modification makes described plant can produce astaxanthin.

8. purposes according to claim 1, wherein animal is selected from fish, crustacean, Galliformes and Anatridae.

9. purposes according to claim 8, wherein animal is selected from salmonid, shrimp, crab, chicken, duck, goose and flamingo.

10. purposes according to claim 2, wherein animal product is selected from meat, skin, feather and yolk.

11. purposes according to claim 1, wherein employed plant part is capitulum or petal.

12. produce the method for animal feed goods, it is with the plants of tagetes species of astaxanthin-containing or plant part, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part and the combination of conventional animal feed ingredient.

13. method according to claim 12, wherein before making up with animal feed, with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part be processed into can with the form of animal feed combination.

14. be used for the method for painted animal or animal product, it is by with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is administered orally in animal and carries out.

15. be used to produce the painted animal or the method for animal product, it is with the plants of tagetes species of astaxanthin-containing or plant part, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is administered orally in animal.

16. according to claim 14 or 15 described methods, wherein with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part mixes with the animal feed goods and the animal feed goods is administered orally in animal.

17. method according to claim 16, wherein with before the animal feed goods mix, with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is processed into the form that can mix with the animal feed goods.

18. according to claim 14 or 15 described methods, the astaxanthin-containing extract of the wherein plants of tagetes species of astaxanthin-containing or plant part, or the plants of tagetes species of astaxanthin-containing or plant part directly is administered orally in animal.

19. method according to claim 18, before wherein using, with the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is processed into the form that can directly be administered orally in animal.

20. method according to claim 14, wherein the plants of tagetes species of astaxanthin-containing is the plant of genetic modification, and wherein said genetic modification makes described plant can produce astaxanthin.

21. method according to claim 14, wherein animal is selected from fish, crustacean, Galliformes and Anatridae.

22. method according to claim 21, wherein animal is selected from salmonid, shrimp, crab, chicken, duck, goose and flamingo.

23. method according to claim 14, wherein animal product is selected from meat, skin, feather and ovum.

24. method according to claim 14, wherein employed plant part is capitulum or petal.

25. the plants of tagetes species of astaxanthin-containing or plant part, or the purposes of the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part are as animal feed or animal feed additive.

26. the animal feed goods, it comprises the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part.

27. colouring agent, it comprises the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part.

28. colouring agent according to claim 27, it is by the plants of tagetes species or the plant part of astaxanthin-containing, or the astaxanthin-containing extract of the plants of tagetes species of astaxanthin-containing or plant part is formed.

29. according to claim 27 or 28 described colouring agents, wherein employed plant part is capitulum or petal.