CN100350038C

CN100350038C - Lactic acid bacillus genic engineering body of expressing green fluorescent protein

Info

Publication number: CN100350038C
Application number: CNB200510126291XA
Authority: CN
Inventors: 杨倩; 庾庆华
Original assignee: Nanjing Agricultural University
Current assignee: Nanjing Agricultural University
Priority date: 2005-12-02
Filing date: 2005-12-02
Publication date: 2007-11-21
Anticipated expiration: 2025-12-02
Also published as: CN1793336A

Abstract

The present invention relates to a lactobacillus gene engineering body for expressing green fluorescent protein (GFP), which comprises: building a gene gfp insertion plasmid pLEM415 into an expression plasmid gfp; electrically transforming lactobacillus separated from chicken's small intestines to obtain the gene engineering body-lactobacillus-pLEM415-gfp of the present invention. The green fluorescent protein is expressed in a transformant, and the fluorescence intensity is maximum at 30 DEG C. The gene engineering body provided by the present invention can be used for large amplification culture and be used for researching motion situation of lactobacillus in vivo and the interaction mechanism of the lactobacillus with intestinal tracts. After the plasmid of the lactobacillus is extracted, the lactobacillus can insert various antigens, active peptides, medicines, etc. and can be widely used in the various fields of scientific research, production, etc. The lactobacillus is hopeful to become an expression vector of oral administration gene engineering seedlings.

Description

The lactic acid bacillus genic engineering body of expressing green fluorescent protein

One, technical field

The present invention relates to expressing green fluorescent protein (green fluorescent protein, GFP) lactic acid bacillus genic engineering body, for structure is used to study the lactic acid bacillus genic engineering body of doing mutually between lactobacillus and animal body, belong to the front line science of basic life science.

Two, background technology

For centuries, lactobacillus has been widely used in food and beverage processing industry as important probiotic bacterium, account for 20%. thousands of years of the total fermentation based food in the whole world as the economic worth that zymogenic foodstuffs industry was createed with lactobacillus, lactobacillus is edible in a large number by the mankind, do not cause any known health problem, but its to immune mechanism of body and with animal intestinal be that a series of problems such as how to interact it be unclear that, simultaneously lactobacillus can be used as the antigen delivery vectors mucosa immunity-inducing and replys with general immunity and reply, this has caused the very big interest of investigators. for motion conditions and the immune mechanism that observes lactobacillus in the body, at first needs it is carried out mark.

1 lactobacillus is to the influence of mucosa-immune

Lactobacillus is a kind of normal probiotic bacterium in human body and the animal intestinal, has different physiological roles, as control intestinal tract infections, increase the nutritive value of some food, the control serum cholesterol level, improve lactose metabolism, functions such as inductor internal specific and nonspecific immune response and anti-tumor activity, more and more demonstrate great vitality in scientific circles. as a kind of important probiotic bacterium, lactobacillus is used for the manufacturing of food in a large number for many years, as cheese, yogourt and saveloy. a large amount of these food of consumption of people over thousands of years, never cause any health problem. as oral vaccine, lactobacillus also has good security. and therefore, lactobacillus is very suitable to the oral vaccine of safety and the antigen vectors of other pathogenic agent.

The lactobacillus that enters in the gi tract possesses anti-bile acide and the ability that continues to exist in gi tract. and the same with general microbial antigen, lactobacillus is when inducing mucosal immune response or through little gauffer cell (the microfold cell between the small intestine epithelium, the M cell), perhaps by subepithelial dendritic cell (dendritic cell, DC) enter lamina propria, activate the Th2 lymphocyte, produce a large amount of interleukins (IL)-5, the latter is an effective I gA stimulating factor, can activate the B cell, secretion IgA, IgA combines with the secretory piece that the intestinal mucosa epithelium produces, form mucous membrane surface antibody sIgA (secretory IgA), stoping absorption and the invasion of pathogenic bacterium. many lactobacilluss are because antiacid, anti-biliary salts, can be present in the upstream end of small intestine and large intestine in a large number smoothly by stomach and ileum. lactobacillus enters sustainablely behind the gi tract induces local cells immunity and humoral immunization, and has the minimizing transformation reactions, strengthen functions such as gut barrier function and treatment autoimmune disease.

Lactobacillus can significantly increase non-specific and specific antibody level in the enteron aisle. and to discovering of 0-6 month healthy newborn, the lactobacillus in the enteron aisle and the time of bifidus bacillus field planting, more early the IgA committed cell occurred just more early in the peripheral blood; Along with the increase of lactobacillus in the intestines and bifidus bacillus number, the quantity of the IgA committed cell in the peripheral blood also increases; In the diarrhoea baby that rotavirus causes, the course of disease is shortened, the state of an illness alleviates; Behind the Salmonella typhi infecting mouse of attenuation, if the oral L.acidophilus Lal fermented-milk that contains, serum total Ig A level at S.typhi in the mouse body all raises. and lactobacillus also can obviously promote cell immune response in the small intestine, can strengthen enteric epithelium lymphocyte cytotoxic activity as lactobacillus, induce to produce multiple lymphokine; Excite lamina propria CD4+ cell to produce Interferon, rabbit; Strengthen monokaryon-cytophagous phagolysis, thereby kill other bacteriums in enterovirus and the enteron aisle, the oral Kefir milk that contains a large amount of lactobacilluss of mouse can assist specific antigens to improve the reaction of small intestine specificity mucosa-immune. contain a large amount of unmethylated CpG DNA in the lactobacillus, lipoteichoicacid (lipoteichoic acids, LTA) and peptidoglycan, usually these materials can with Toll sample acceptor (Toll like receptors, TLRs) combination is so the stimulating innate immunity system produces stress reaction. and small intestine is special all to have vital role with nonspecific immune response to orally administering lactobacillus to strengthening.

2 oral mucosa-immune progress

Oral mucosa-immune method is easy; safety; not only produce immunne responses in mucous membrane part and other mucous membrane tissues; also can cause the general humoral immunoresponse(HI); being subjected to domestic and international immunologist's close attention for many years. the extensive oral poliomyelitis sugar-pill of children is exactly the example of digestive tube mucosa-immune success at present. the application of sabin's oral vaccine; global poliomyelitis morbidity is effectively controlled; for directive function has been played in the development and the application of oral vaccine. but in practice; oral vaccine is subjected to the degraded of Digestive system often through digestive tube; vaccine is easy to destroyed; influence the effect of immunizing power; the application and the popularization of digestive tube mucosa-immune method are restricted. the vaccine delivery system becomes one of focus of research transmissible disease defence field new technology in recent years. and especially the bacterial live vector vaccine is cultivated conveniently because of having; the foreign gene capacity is big; advantages such as irritation cell immunizing power is strong have huge application potential. and the bacteria carrier vaccine is the important development direction of emerging modern vaccination; so-called bacteria carrier vaccine is that the dna fragmentation with required coding pathogenic bacteria specific antigens inserts in the pathogenic bacteria or fungal component of attenuation; offer to express coded antigen; in the hope of reaching the purpose of one or more diseases of prevention. not only can stimulate the enteron aisle local immune response by live vector delivery of vaccines antigen; can produce specific immune response at specific antigens again, make body can obtain comprehensive protection.

Some attenuated bacterias that studies show that in the past can be used as the carrier of vaccine antigen, as Salmonellas, weak malicious listeria bacteria etc. the foreign scholar with the attenuation salmonella be carrier in eukaryotic cell successful expression lacZ gene, green fluorescent protein (GFP) gene, HIV-gp140 gene, listeria bacteria hemolysin gene etc. also have potentially dangerous but Salmonellas is the carrier transfer dna vaccination. at first, attenuated bacteria may exist virulence to return strong danger; Secondly, plasmid DNA may be incorporated into the host cell gene group, thereby a series of problems such as the expression that causes genetic disorder, proto-oncogene and cancer suppressor gene that regulating cell is grown is out of control, somatocyte canceration, cell transition. in addition, attenuated bacteria has potential pathogenic to some the old,weak,sick and disabled's individualities. therefore, selecting ideal vaccine antigen carrier is the key of setting up the biology new technology. ideal carry antigenic carrier should be in vivo the long period exist, itself is to body not only safety but also can produce some microorganisms that continue immunizing power.

Lactobacillus is safe probiotic bacterium, utilize some lactobacilluss at gi tract, uropoiesis, in the reproductive system or mucous membrane position is sticked survival and is not had characteristics such as pathogenicity bo, carry out the research of viable bacteria oral vaccine and mucous membrane vaccine carrier, being subjected to day by day paying attention to widely. ideal vaccine carrier system can be secreted into the extracellular to the extrinsic protein antigen of expressing. and foreign protein being expressed on the biotechnology in bacterium is a challenge always. and some bacterial strains of lactobacillus have S layer (S-layer), class crystalline network by single protein subunit composition rule arrangement. compare with intestinal bacteria, lactobacillus only has one deck cytolemma, target protein can direct secretion arrive the extracellular under the guiding of S layer protein signal peptide, thereby obtain target protein easily. purpose antigen and lactobacillus S layer protein signal peptide sequence are merged, it is cloned in lactobacillus expression plasmid promotor downstream, though can obtain the antigenic lactobacillus of stably express by the electricity conversion. some Gram-negative bacterias also have the S layer, but there is certain shortcoming in Gram-negative bacteria, as in intestinal bacteria, recombinant protein is easily also easily piled up in tenuigenin with insoluble inclusion body form by contaminated with endotoxins; Lactobacillus then can be stable with the heterology expression of recombinant proteins in the extracellular. but several years ago the heredity and the Progress on Molecular Biology of lactobacillus is comparatively slow, mainly is because the conversion system research of lactobacillus not deep enough.

The mark of 3 lactobacilluss

When the research lactobacillus starts small intestine immunne response machine-processed, need carry out mark so that observe to lactobacillus. the molecular biology research to lactobacillus has had very big development, many instruments are developed and have been applied on the lactobacillus. be used in complex environment, confirming some microorganisms as a kind of specificity method as dna probe. and the bacterium in the food can be confirmed by pcr amplification specificity segment. these technology have species specificity and good susceptibility, but can not observe the situation of single bacterium. in addition, owing to will from complex environment, extract nucleic acid and PCR efficiency, these all can limit the utilization of these labeling techniques. made up a series of exogenous protein expression system in recent years, make lactobacillus become the good engineering strain of expression alien gene. many reporter genes, as escherichia coli (Escherichiacoli) β-Portugal's thuja acid enzyme (gene of β-glucoronidase), leuconostoc mesentroides (Leuconostocmesenteroides) beta-galactosidase enzymes (gene of β-galactosidase), Bacillus licheniformis (Bacilluslicheniformis) α-Dian Fenmei (gene of α-amylase), Vibrio bacterium (Vibrio fischeri) luciferase (luciferase) gene and streptococcus aureus (S.aureus) nuclease (nuclease) gene have been used for the functional expression of lactobacillus and the location of bacterium. in order to detect the recombination lactic acid bacillus that these express reporter gene, usually need depend on exogenous substrate, therefore they are difficult to apply in vivo test. green fluorescent protein (the green fluorescent protein that is separated to from jellyfish Aequorea Victoria, GFP) reporting system can well address this problem, GFP is a kind of perfect fluorescent tag molecule, luminous with other biological or the fluorescence indication molecule is different, this albumen can autocatalysis form ray structure and ultraviolet or blue-light excited under send green fluorescence. as fluorescent tag molecule, GFP has lot of advantages, as easy to detect, fluorescence is stable, be easy to carrier construction and to the viable cell toxicological harmless, not influence of function to goal gene, transforming the back cell can continue to go down to posterity. therefore, GFP is the tagged molecule that stable non-kind limits, and can detect the motion of active somatic cell.

Many scholars express GFP in different bacteriums, the .Dhandayuthapani etc. of connecting each other that observe to express between these reorganization bacterium of GFP and host has successfully expressed GFP at the Mycobacterium tuberculosis of ox, and the interaction .Stephan K  hler etc. that has studied this mycobacterium and scavenger cell in brucella successful expression GFP, this brucella infects scavenger cell, behind 24h and 48h, successfully in scavenger cell, observed brucellar propagation situation, this will help us, and better to understand brucella be bactericidal mechanism how to eliminate scavenger cell. Salmonella typhimurium can pass the GI epithelium barrier of a lot of animals (comprising the people), near submucosa and lymphoglandula, to breed. mycobacterium marinum can cause that the chronic system of cold blooded animal infects, the infection .Valdivia RH etc. that also can cause simultaneously the human body acra has expressed GFP in Salmonella typhimurium and mycobacterium marinum, and Salmonella typhimurium and mycobacterium marinum can't change along with the expression of GFP the intrusion and the multiplication capacity of host cell. the mycobacterium marinum infection frog of expressing GFP can observe this bacterium at spleen and the lung of frog after five weeks.

In a word, one of frontier that lactobacillus is the most interesting is to utilize lactobacillus to prove that as the successful expression of carrier .TTFC in lactobacillus of oral vaccine it is fully feasible that lactobacillus is applied to mucosa-immune. the research of the mucous membrane vaccine that in many animal models, carries out, all obtained immune effect preferably, but can these results and conclusion be applicable to the mankind, still there is certain distance. the condition of expression vector that makes up the oral gene engineering vaccine of lactobacillus now is all perfect gradually, just how lactobacillus induces the mechanism of small intestine generation local immunity reaction it be unclear that. and the huge challenge that we faced is how to make body to expressing the immunne response that any antigenic lactobacillus can both produce to be needed. the Mk system of lactobacillus arranged, understood fully that how lactobacillus induces the mechanism of mucosa-immune reaction is temporal problem. lactobacillus gets a good chance of becoming the expression vector of oral gene engineering vaccine.

Three, summary of the invention

Technical problem

The lactobacillus engineering body that the purpose of this invention is to provide expressing green fluorescent protein (GFP), green fluorescent protein is transformed from the isolating lactobacillus of chicken, as a kind of tagged molecule, observe the distribution of movement situation of lactobacillus in enteron aisle after helping. lactobacillus provides basic technology as antigen delivery vectors more in the future.

Technical scheme

Engineering body of the present invention is characterised in that: the gfp gene is inserted plasmid pLEM415, be built into the gfp expression plasmid, electricity transforms the lactobacillus that is separated to from the chicken small intestine, engineering body-lactobacillus-pLEM415-gfp. of the present invention

Bacterium classification: lactobacillus delbruckii breast subspecies

Name :-lactobacillus-pLEM415-gfp

Its oligogene is the gfp gene

The engineering body of lactobacillus of the present invention is characterized in that: form in order to following method structure:

1) pldhL-gfp is segmental obtains

According to the gene order of plasmid pRV85, design 1 couple of primer L that comprises the gfp gene of promotor pldhL ₁And L ₂

L1 5’TTA? GGGCCC?ACTGAGAAGTTGCTCTC?3’

Apa?I

L2 5’TTA ATCGAT?TTATTTGTAGAGCTCATCC?3’

Cla?1

For touching plate, go out segment pldhL-gfp with the pRV85 plasmid with pcr amplification;

2) structure of gfp::pLEM415 plasmid

The pldhL-gfp gene of said extracted is inserted the pLEM415 plasmid, make up the gfp::pLEM415 recombinant plasmid, the transformed competence colibacillus intestinal bacteria, carry out enzyme and cut evaluation and PCR evaluation, with Kpn I and EcoR I double digestion recombinant plasmid is three bands, size is respectively 6288bp, 727bp and 279bp, and pcr amplification obtains the pldhL-gfp gene fragment into 1006bp, shows to successfully construct;

3) electricity transforms lactobacillus

The gfp::pLEM415 recombinant plasmid electricity that newly makes up is transformed from the isolating lactobacillus of chicken gi tract, transforming the back selects the evaluation of resistance bacterium colony can obtain transformant, extracting plasmid from the lactobacillus transformant carries out enzyme and cuts and identify and the PCR evaluation, with Kpn I and EcoR I double digestion recombinant plasmid is three bands, size is respectively 6288bp, 727bp and 279bp, and pcr amplification obtains showing that for the pldhL-gfp gene fragment of 1006bp the electricity of lactobacillus transforms successfully;

4) observation of egfp expression

The centrifugal back of lactobacillus in liquid nutrient medium collecting precipitation, use the salts solution rinse, spread upon on the slide glass, the Leica fluorescent microscope is observed down, simultaneously in contrast with the lactobacillus of unconverted any plasmid, the result observes green fluorescence, proves the expression of green fluorescent protein, proves successfully constructing of engineering body-lactobacillus of the present invention (lactobacillus delbruckii breast subspecies)-pLEM415-gfp.

The lactobacillus engineering body of beneficial effect expressing green fluorescent protein provided by the invention (GFP), green fluorescent protein is transformed from the isolating lactobacillus of chicken, as a kind of tagged molecule, observe the distribution of movement situation of lactobacillus in enteron aisle after helping.

Engineering body of the present invention has the expression of green fluorescent protein, and 30 ℃ of following fluorescence intensity maximums.

Engineering body provided by the present invention can be used a large amount of amplification cultivation, be used to study lactobacillus motion conditions in vivo and with the interaction mechanism of enteron aisle. after extracting the plasmid of this lactobacillus, can insert various antigens, bioactive peptide and medicine etc., be widely used in scientific research, various fields such as production.For future lactobacillus provide basic technology as antigen delivery vectors.

The present invention has made up the Mk system of lactobacillus, helps understanding fully how lactobacillus induces the mechanism of mucosa-immune reaction.Lactobacillus is expected to become the expression vector of very attractive oral gene engineering vaccine very much.

Four, description of drawings

The PCR product of Fig. 1 pLEM415::gfp and digestion with restriction enzyme are identified electrophoretogram

A 1Marker DL2000 2 PCR products

B 1Marker DL2000 2 pLEM415::gfp, 3 pLEM415::gfp Kpn I and EcoRI double digestion 4 Marker λ-HindIII

Observation 10 * 40 under Fig. 2 fluorescent microscope

The lactobacillus delbruckii breast subspecies R4 of A expressing green fluorescent protein

The lactobacillus delbruckii breast subspecies R4 (negative control) of the unconverted any plasmid of B

Fig. 3 Kpn I and EcoR I double digestion recombinant plasmid

Five, embodiment

1 pldhL-gfp is segmental to be obtained

According to pRV85 (public carrier, Gory L, Montel MC, Zagorec M.Use of green fluorescentprotein to monitor Lactobacillus sakei in fermented meat products.FEMS Micobiol Lett2001; 194:127-133) and pLEM415 (public carrier, Serror, P., T.sasaki, S.D.Ehrlich, and E.Maguin.Electrotransformation of Lactobacillus delbrueckii subsp.bulgaricus and L.delbrueckii subsp.lactis with various plasmids.Appl.Environ.Microbiol 2002; 68:46-52.) gene order of two plasmids designed a pair of primer L1, L2, primer and the restriction enzyme site that comprises thereof are as follows:

L1?5’TTA GGGCCCACTGAGAAGTTGCTCTC 3’(Apa?I)，

L2?5’TTA ATCGATTTATTTGTAGAGCTCATCC?3’(Cla?I)，

Pcr amplification goes out the pldhL-gfp segment, altogether 1006bp.

PCR reaction system (50 μ L): 10 * buffer5 μ L; Mg ²⁺4 μ L, dNTP (2.5mmpl/L) 1 μ L; Primers F (20pmol/L) 0.25 μ L, R0.25 μ L; Taq enzyme (1U/ μ L) 0.5 μ L; Template DNA is plasmid pRV85 (50ng/ μ L) 1uL; DdH ₂O38 μ L. primer is synthetic by the biological company limited of three rich polygala roots, and the PCR reaction conditions is: 94 ℃ of pre-sex change 5min, and 94 ℃ of 30sec, 50 ℃ of 30sec, 72 ℃ of 1min, 32 circulations are extended 5min. for back 72 ℃

The enzyme of 2gfp gene is cut

The pldhL-gfp segment is digested (37 ℃ with restriction enzyme A pa I and Cla I, 6h)), behind agarose gel electrophoresis, downcut pldhL-gfp gene segment in the gel, the dna fragmentation that downcuts is reclaimed test kit with DNA to be reclaimed, the gfp gene of the band sticky end that obtains (GenBank accession no.U62636) promptly can be used for ligation.

The enzyme of 3pLEM415 plasmid cuts back to close

Plasmid pLEM415 is lactobacillus and colibacillary shuttle plasmid, one multiple clone site is arranged, having amicillin resistance and erythromycin resistance. vector plasmid pLEM415 digests (37 ℃ with restriction enzyme A pa I and Cla I, 6h)), getting 10 μ l enzymes cuts product and carries out 1% agarose electrophoresis, the pLEM415. that downcuts the gel neutral lineization reclaims test kit with the dna fragmentation that downcuts with DNA and reclaims, put-20 ℃ frozen standby.

4 connect

The linearization plasmid pLEM415 that reclaims mixes with 1: 3 (amount of substance ratio) with the pldhL-gfp gene segment, adds the T4DNA ligase enzyme, connects the medicine box specification sheets by DNA and carries out, and its reaction system is as follows:

PLEM415 plasmid double digestion reclaims product 5 μ l

Gfp Gene Double enzyme cuts back to close product 9 μ l

T4 ligase enzyme 3 μ l

T4 ligase enzyme damping fluid 2 μ l

ddH ₂O 1μl

Behind the mixing, put 16 ℃ of reaction overnight, be recombinant expression plasmid pLEM415::gfp, can be used for immediately transforming.

The preparation of 5 competent escherichia coli cells

The method of introducing with reference to " molecular cloning experiment guide " (third edition) (2002,96-98, Science Press) prepares the bacillus coli DH 5 alpha competent cell.

6 transform

Get 10 μ l and connect product conversion DH5 α competent cell, the method that concrete operations are introduced with reference to " molecular cloning experiment guide " (third edition) (2002,99-102, Science Press) is carried out.Get 200 μ l transformed into escherichia coli, coating contains the LB agar plate of Amp 50mg/ml, establish unconverted competence intestinal bacteria simultaneously and compare (negative control), the rearmounted 37 ℃ of overnight incubation of inoculation are cultivated 18h, observe control board (competence DH5a bacterium) and go up no bacterium, and on the DH5 α plate after transforming bacterium is arranged.

The screening of 7 recombinant expression plasmid pLEM415::gfp clone strains

Select the single bacterium colony in the above-mentioned culture plate, in the LB substratum that contains penbritin (50ug/ml), the plasmid in 37 ℃ of shaking culture 12h. alkaline lysis method of extracting intestinal bacteria is further that PCR identifies and enzyme is cut evaluation (Fig. 1).

The PCR of 8 recombinant plasmids identifies and enzyme is cut evaluation

Plasmid pLEM415 has 1 multiple clone site, after Apa I and Cla I digestion, the gfp gene that reclaims is directionally inserted carrier, transformed into escherichia coli DH5 α, extracting recombinant plasmid pLEM415::gfp. is template with this recombinant plasmid, show that through the fragment that pcr amplification obtains being about 1006bp the gfp gene has been cloned in the vector plasmid with primer, the results are shown in Figure 1 (Figure 1A). with Kpn I and EcoR I double digestion digestion pLEM415::gfp, electrophoresis result shows: recombinant plasmid (Fig. 3) is cut to three bands, size is respectively 6288bp, 727bp and 279bp. checking result and restriction enzyme mapping (Figure 1B) match, and show the plasmid construction success.

The extraction of 9 recombinant plasmids

The method that the extraction of plasmid is introduced by " molecular cloning experiment guide " (third edition) (2002,27-29, Science Press) is carried out.

The preparation of 10 lactobacillus competent cells

Picking lactobacillus lactobacillus delbruckii breast subspecies R4 (public bacterial classification, in Zhuo Teng Mao Shengyong Zhu Wei cloud, the antibacterial ability of chicken intestinal mucosa milk-acid bacteria and to the susceptibility characteristic of antibiotic, Hua Zhong Agriculture University's journal, 24 (4), 2005:376-379) bacterium colony overnight incubation in MRS, overnight culture was diluted with 1: 50, cultivate 3.5-4h (the OD600 value is about 0.5) for 37 ℃. ice bath stops growing bacterium, 4 ℃, abandon supernatant under the centrifugal 10min. aseptic condition of 4000g, ice-cold 10% glycerine solution flushing three times, fully wash impurity and ion in the most centrifuge tube. 10% glycerine that adds 1ml at last suspends again, obtains the milk-acid bacteria competent cell.

The electricity of 11 lactobacilluss transforms

Getting water-soluble plasmid of 2 μ L and 40 μ L milk-acid bacteria competent cell to be transformed mixes, move into then in the pole cup that transforms usefulness (spacing 0.2cm), place 5min. on ice and move into the conversion of shocking by electricity of BioRad gene pulse instrument, this test fixed resistor is 200 Ω, electric capacity is 25 μ F, change strength of electric field conversions of shocking by electricity. in voltage acquisition maximum conversion efficient during for 1.5kV, increasing transformation efficiency with voltage afterwards descends. and this shock parameters when Charlene etc. transforms lactobacillus is consistent. after the electricimpulse conversion, in the electric shock cup, add 400 μ LMRS substratum, be transferred to behind the mixing in the 1.5mLEP pipe in 37 ℃ of static cultivation 2h, bacterium liquid after getting 100 μ L and transforming is coated on and contains on penbritin (50 μ g/mL) the MRS flat board, cultivate 36h, select the resistance bacterium colony to identify and can obtain transformant. from the lactobacillus transformant, extract plasmid according to the method for Anderson and McKay and carry out enzyme and cut evaluation, with Kpn I and EcoR I double digestion recombinant plasmid (Fig. 3) is three bands, size is respectively 6288bp, the pldhL-gfp gene fragment that 727bp and 279bp (Figure 1B), pcr amplification obtain being about 1006bp shows that the electricity of lactobacillus transforms successfully (Figure 1A).

The observation of 12 egfp expressions

The centrifugal back of lactobacillus in liquid nutrient medium collecting precipitation, with salts solution (NaCl 8.5g/L) rinse, spread upon on the wave carrier piece then, observe down in the Leica fluorescent microscope, simultaneously with the lactobacillus of unconverted any plasmid in contrast, found that the expression (Fig. 2) that green fluorescent protein is arranged in the transformant, and 30 ℃ of following fluorescence intensity maximums, under other temperature condition, the brightness of fluorescence decreases.

More than experiment repeats twice, and gained is unanimity as a result.

Use

Engineering body provided by the present invention can be used a large amount of amplification cultivation, be used for research Bacillus acidi lactici motion conditions in vivo and with The interaction mechanism of enteron aisle. after extracting the plasmid of this Bacillus acidi lactici, can insert various antigens, active peptide and medicine etc., widely Be used for scientific research, the various fields such as production.

Claims

1, the lactobacillus engineering body of expressing green fluorescent protein (GFP), it is characterized in that: the gfp gene is inserted among the shuttle plasmid pLEM415 of intestinal bacteria-lactobacillus, be built into gfp::pLEM415 plasmid as shown in Figure 3, transformed into escherichia coli, extract this plasmid then, electricity transforms from the isolating lactobacillus of chicken gi tract, lactobacillus engineering body of the present invention-lactobacillus delbruckii breast subspecies (lactobacillus)-pLEM415-gfp.