CN100345979C - Molecular marker SK17 for detecting rice blast resistant gene Pi25(t) - Google Patents
Molecular marker SK17 for detecting rice blast resistant gene Pi25(t) Download PDFInfo
- Publication number
- CN100345979C CN100345979C CNB2003101008888A CN200310100888A CN100345979C CN 100345979 C CN100345979 C CN 100345979C CN B2003101008888 A CNB2003101008888 A CN B2003101008888A CN 200310100888 A CN200310100888 A CN 200310100888A CN 100345979 C CN100345979 C CN 100345979C
- Authority
- CN
- China
- Prior art keywords
- pestilence
- molecular marker
- spike
- rice
- gene
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Fee Related
Links
Images
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
Abstract
The present invention provides a molecular marker SK17 for detecting the spike pestilence resistance gene Pi25(t) of paddy rice. A nucleotide sequence of a specific PCR primer at the upstream end from the 5' end to the 3' end is CAGCTGTGGACTCAGACCTCTC; the nucleotide sequence at the downstream end from the 5' end to the 3' end is GCGAACAAGCGATGAATCTATC. The molecular marker SK17 can carry out marker identification to DNA extracted in the seedling stage of paddy rice, and detect whether the gene Pi25(t) resisting leaf pestilence and spike pestilence exists or not, i.e. whether the gene Pi25(t) has the capability of resisting leaf pestilence and spike pestilence. The molecular marker has the advantages of high detection accuracy and simple operation. Because Gumei No. 2 is a universally-applied parent of hybrid varieties of resisting rice pestilence, the molecular marker also detects whether the universal significance of resisting leaf pestilence and spike pestilence exists or not. The molecular marker can be used as a detection tool of breeding materials using the Gumei No. 2 as a parent.
Description
Technical field
The present invention relates to the detection technique field in the rice breeding, particularly detect the molecule marker of paddy rice rice blast resistant gene.
Background technology
Rice blast is one of most important rice disease that extensively betides in each rice district, the world.Wherein the fringe pest are particularly serious to the influence of rice yield.Plantation anti-rice blast rice kind is the most economical effective means that address this problem.In the back cross breeding of transformation disease-resistant gene, must before heading, finish the evaluation of fringe pest resistance, conventional fringe pest are identified and must just can be carried out after heading, can't satisfy this condition.
Summary of the invention
Technical problem to be solved by this invention provides the molecule marker SK17 that detects paddy rice rice blast resistant gene Pi25 (t), raises the efficiency.For this reason, the present invention is by the following technical solutions: its specific PCR primer, upstream extremity is classified CAGCTGTGGACTCAGACCTCTC from 5 ' end as to the nucleotides sequence of 3 ' end, and downstream end is classified GCGAACAAGCGATGAATCTATC as from 5 ' end to the nucleotides sequence of 3 ' end.
Generally, often will resist rice blast kind and high-yield variety to hybridize and obtain the anti-pest kind of high yield.Gumei2 is that China paddy rice pathologist screens from 38000 parts of seed rice resources unique semi-dwarf mutant material with lasting anti-pest (Peng Shaoqiu, Scientia Agricultura Sinica, 1996,29:52-58).The contriver is under study for action in 3 years repeated inoculations 156 and the Gumei2 recombinant inbred lines, analyzed the dna marker genotype of each strain system, a gene Pi 25 (t) that has leaf blast resistance and fringe pest concurrently is positioned the 6th karyomit(e) of paddy rice, and its resistance allele derives from Gumei2.
In process of the present invention, the contriver has designed specific PCR primer, and it can be to the DNA that rice seedling extracted, carry out mark and identify, detect the gene Pi 25 (t) that whether has leaf blast resistance and fringe pest, promptly whether have leaf blast resistance and fringe pest ability, the accuracy height of its detection, simple to operate.Because Gumei2 is the parent of the anti-rice blast Hybrid of widespread usage, therefore, this molecule marker also has the universal significance whether detection has leaf blast resistance and fringe pest, can be used as other with the testing tool of Gumei2 as parent's breeding material.
Description of drawings
Fig. 1 is the result that molecule marker SK17 centering 156/ Gumei2 RIL of the present invention detects.Among the figure, in the P1 representative 156; P2 represents Gumei2; Other materials is a RIL; R is anti-fringe pest; S is sense fringe pest.
Embodiment
In rice blast lesion, Fujian plantation is above-mentioned 156 and Gumei2 reorganization inbreeding population.Adopt molecule marker provided by the present invention to carry out leaf blast resistance and the detection of fringe pest in seedling stage.The specific PCR primer of this molecule marker, upstream extremity is classified CAGCTGTGGACTCAGACCTCTC from 5 ' end as to the nucleotides sequence of 3 ' end, and downstream end is classified GCGAACAAGCGATGAATCTATC as from 5 ' end to the nucleotides sequence of 3 ' end.
One DNA extraction:
1 long blade tip of 2cm is cut in the 1.5-ml centrifuge tube, covers tight lid, puts on number, places on ice.
2 blade tips are cut into the long segment of 0.5cm, put into mortar.
3 addings, 400 μ l extracting solutions (Tris-Hcl 50mM, pH 8.0; EDTA 25mM, pH 8.0; NaCl 300mM; SDS 1%), grind.
4 add 400 μ l extracting solutions again, and mixing is drawn 400 μ l in original 1.5-ml centrifuge tube.
5 add 400 μ l chloroforms, mixing, centrifugal 30 seconds of 12000rpm.
6 careful absorptions in the new 1.5-ml centrifuge tube of supernatant to are put on number.
7 add 800 μ l dehydrated alcohols, mixing, and centrifugal 3 minutes of 12000rpm abandons supernatant.
8 precipitate with after 75% washing with alcohol natural air drying.
9 usefulness, 50 μ lTE (Tris-Hcl 10mM, pH 8.0; EDTA 1mM, pH 8.0) dissolution precipitation.Be stored in-20 ℃.
10 get 1 μ l is used for pcr amplification reaction.
Two pcr amplifications:
Pcr amplification reaction carries out on the pcr amplification instrument.
1 reaction system is as follows:
67mM Tris-Hcl, pH 8.8; 16mM (NH
4)
2SO
41.5mM MgCl; 0.01%TWEEN-20; 200 μ M dNTPs; 0.5 μ M upstream primer; 0.5 μ M downstream primer; 1 Taq of unit archaeal dna polymerase/10 μ l; 1 μ l DNA/10 μ l
2 temperature cycle conditions are as follows:
94 ℃ 1 minute; 94 ℃ 45 seconds, 42 ℃ 45 seconds, 72 ℃ 1 minute, 35 the circulation; 72 ℃ 8 minutes
Three PCR products detect:
With amplified production, be splined on 2.5% sepharose, electrophoresis to tetrabromophenol sulfonphthalein is run out of bottom line, uses gel images analytical system GDS-7600 (UVP) record result behind ethidium bromide staining.
Extract DNA in 236 strain systems altogether, carry out above-mentioned testing process, the result shows that wherein 126 have Gumei2 resistance allele (Fig. 1).
Above-mentioned 236 strains system is carried out after blast resisting identifies, finding has 110 to show as resistance in above-mentioned 126 strains system, and 16 show as susceptible.The goodness of fit of mark and phenotype is 87.3%.
If in conjunction with another molecule marker SA7, its specific PCR primer, upstream extremity is classified CGGGTGAGTAAAACTTATCTGG as from 5 ' end to the nucleotides sequence of 3 ' end, downstream end is classified TAGTGATTGAAACGGGTGCACT from 5 ' end as to the nucleotides sequence of 3 ' end, and then the goodness of fit of mark and phenotype can be up to 98.1%.
Claims (1)
1, detects the molecule marker SK17 of paddy rice rice blast resistant gene Pi25 (t), it is characterized in that, it is to use upstream extremity 5 ' to 3 ' nucleotides sequence to classify the specific PCR primer that CAGCTGTGGACTCAGACCTCTC, downstream end 5 ' to 3 ' nucleotides sequence classify GCGAACAAGCGATGAATCTATC as, the dna fragmentation that derives from disease-resistant parent that is obtained through amplification.
Priority Applications (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101008888A CN100345979C (en) | 2003-10-15 | 2003-10-15 | Molecular marker SK17 for detecting rice blast resistant gene Pi25(t) |
Applications Claiming Priority (1)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CNB2003101008888A CN100345979C (en) | 2003-10-15 | 2003-10-15 | Molecular marker SK17 for detecting rice blast resistant gene Pi25(t) |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CN1607255A CN1607255A (en) | 2005-04-20 |
| CN100345979C true CN100345979C (en) | 2007-10-31 |
Family
ID=34756069
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CNB2003101008888A Expired - Fee Related CN100345979C (en) | 2003-10-15 | 2003-10-15 | Molecular marker SK17 for detecting rice blast resistant gene Pi25(t) |
Country Status (1)
| Country | Link |
|---|---|
| CN (1) | CN100345979C (en) |
Families Citing this family (3)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100410390C (en) * | 2006-01-26 | 2008-08-13 | 中国水稻研究所 | Molecule identification and transfer technology for broad-spectrum rice-blast resistant gene of paddy rice |
| CN101643790B (en) * | 2009-09-07 | 2012-03-07 | 中国水稻研究所 | Specific molecular marker of rice blast resistant gene Pi 25 for rice and special primer thereof |
| CN101880708B (en) * | 2009-12-17 | 2012-10-03 | 中国水稻研究所 | Specific PCR molecular markers for detecting rice blast resistance alleles |
-
2003
- 2003-10-15 CN CNB2003101008888A patent/CN100345979C/en not_active Expired - Fee Related
Non-Patent Citations (1)
| Title |
|---|
| 水稻抗穗瘟病基因的分子定位 吴建利等，植物病理学报，第30卷第2期 2000 * |
Also Published As
| Publication number | Publication date |
|---|---|
| CN1607255A (en) | 2005-04-20 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| WO2010056642A2 (en) | Methods for genetic analysis of textiles made of gossypium barbadense and gossypium hirsutum cotton | |
| Bakooie et al. | Development of an SNP marker for sugar beet resistance/susceptible genotyping to root-knot nematode | |
| Bhattramakki et al. | Discovery and application of single nucleotide polymorphism markers in plants. | |
| CN108220402B (en) | Method for identifying pedigree relationship between Chinese cabbage germplasm and variety | |
| Clarke et al. | A standard set of accessions, microsatellites and genotypes for harmonising the fingerprinting of cherry collections for the ECPGR | |
| CN111575400A (en) | Wheat stripe rust resistant QTL molecular marker IWB12253 and application thereof | |
| CN102703443A (en) | Functional specific molecular marker of rice blast resistance gene Pia and method and application thereof | |
| CN100345979C (en) | Molecular marker SK17 for detecting rice blast resistant gene Pi25(t) | |
| CN111961751B (en) | KASP primer for detecting tomato root knot nematode resistance gene Mi-1.2 and application thereof | |
| CN1294278C (en) | Molecular marker SA7 for detecting rice blast resistant gene Pi25(t) | |
| CN101864476B (en) | Method for identifying coilia ectenes and coilia mystus by using PCR | |
| CN111793712A (en) | Application of single nucleotide polymorphism substance of wheat SNP IWA586 site | |
| CN105603083B (en) | Method for carrying out corn-assisted efficient breeding by using two molecular markers including SSR (simple sequence repeat) and SNP (Single nucleotide polymorphism) | |
| CN111560464A (en) | Molecular marker IWB59718 and application thereof in detection of wheat stripe rust resistance | |
| JP2007521003A (en) | Splice site AFLP | |
| CN111607664B (en) | Application of SNP molecular marker on 1DS chromosome related to wheat stripe rust | |
| Verma et al. | Development of EST-SSRs in watermelon (Citrullus lanatus var. lanatus) and their transferability to Cucumis spp. | |
| CN1143896C (en) | Application of rice leaf in polymerase chain reaction | |
| CN110592260B (en) | Competitive allele specific polymerase chain reaction marker of hard wheat adult plant leaf rust resistant locus and application thereof | |
| CN111778346A (en) | Molecular marker for detecting stripe rust resistant QTL QYr. hbaas-4BL.1 and using method thereof | |
| CN101054602A (en) | Method for detecting polyploidy plant gene mononucleotide site mutation | |
| Kajiwara et al. | Detection of Acidovorax avenae subsp. citrulli using PCR and MALDI-TOF MS | |
| CN111635957A (en) | Molecular marker for detecting wheat stripe rust resistance QTL and application of molecular marker in disease-resistant breeding | |
| CN114836556B (en) | Molecular marker closely linked with wheat stripe rust resistance QTL QYr.sicau-6B and application | |
| CN105463120A (en) | RAPD primers for distinguishing radish varieties and application of primers |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| C06 | Publication | ||
| PB01 | Publication | ||
| C10 | Entry into substantive examination | ||
| SE01 | Entry into force of request for substantive examination | ||
| C14 | Grant of patent or utility model | ||
| GR01 | Patent grant | ||
| CF01 | Termination of patent right due to non-payment of annual fee |
Granted publication date: 20071031 Termination date: 20151015 |
|
| EXPY | Termination of patent right or utility model |