CN100344753C

CN100344753C - Preparation of pseudomonas stutzeri strain and its use in desulfurization of organic sulfur compounds

Info

Publication number: CN100344753C
Application number: CNB031567584A
Authority: CN
Inventors: 孔瑛; 侯影飞; 杨金荣; 史德青; 王云芳; 赵金生
Original assignee: China National Petroleum Corp; China University of Petroleum East China
Current assignee: China National Petroleum Corp; China University of Petroleum East China
Priority date: 2003-09-10
Filing date: 2003-09-10
Publication date: 2007-10-24
Anticipated expiration: 2023-09-10
Also published as: CN1594549A

Abstract

The present invention relates to the preparation of a Steinmann pseudomonad strain and an application technique in the desulphurization of an organic compound containing sulfur. The strain is Pseudomonas stutzeri UP-1 and is preserved at the 'CCCCM common microbial preservation center' on June 31 2003, and the preservation number is CGMCC NO. 0974. The strain is mainly derived from oil field polluted water with higher sulfur content, oil field sludge and the soil polluted by oil. The strain can be obtained by specific means of cultivation, separation and preparation. A culture medium liquid cell, a resting cell and an immobilized cell act on the organic compound containing sulfur through a Kodama route to generate a watersoluble organic substance containing sulfur.

Description

A kind of preparation of pseudomonas stutzeri strain and to the application in the organic compounds containing sulfur desulfurization

Technical field

The present invention relates to a kind of preparation of pseudomonas stutzeri strain and to the application in the organic compounds containing sulfur desulfurization, this bacterial strain is Pseudomonas stutzeri UP-1, in on June 31st, 2003 be preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms preservation " center ", its preserving number CGMCC NO.0974; It is mainly derived from the higher oilfield sewage of sulfur-bearing, oil field sludge and by in the soil of oil pollution, this bacterial strain can obtain by specific cultivation, separation and preparation means, its liquid medium somatocyte, resting cell and immobilized cell all can act on organic compounds containing sulfur by the Kodama route, generates water-soluble sulfurous organic compound.

Prior art

21 century is environmental protection century, and world refining industry all faces many challenges and opportunity in environmental protection and process aspect.Contain mercaptan, disulphide, sulfone, thioether, thiophene and the more complicated organic sulfide of other structure in the crude oil.Although taked the several different methods desulfurization at oil refining process, in processed oils such as gasoline, diesel oil, still can contain certain sulfide.In the use of petroleum productss such as gasoline, diesel oil, sulphur can enter environment in every way, causes severe contamination, destroys the eubiosis.So various countries, the world today to the restriction of the sulphur content of petroleum products day stricter (Xu Chengen. oil refining design, 2000,31 (3): 1-4).For example, the U.S. came into effect reformulated gasoline subordinate phase specification from January 1st, 2000, and gasoline sulfure content is from original 340 * 10 ^-6G/g is reduced to 200 * 10 ^-6Below the g/g; European Union in 2000 also regulation gasoline sulfure content will be reduced to 150 * 10 ^-6G/g will further be reduced to 50 * 10 in 2005 ^-6G/g.Yet in more and more higher to the restriction of processed oil sulphur content, the sulphur content that the present world exploits out oil is also more and more higher.And refinery also polluted environment simultaneously in desulfurization, therefore, explores and the friendly process of research economical and effective and environment amenable petroleum sweetening technology has become 21 century petrochemical complex one of urgent task the most.

In recent years, developing a kind of new desulfurization technology---biocatalytic desulfurization (BDS) (Daniel J.Monticello.Chemtech, 1998,28 (7): 38-45) abroad.This technology is the brand-new technology that is based upon on the biotechnology basis, is described as the petroleum sweetening technology of 21 century.Oil biocatalytic desulfurization technology is to utilize sulfur component in the biological intravital enzymatic oxidation oil, makes it transform into water miscible compound (as sulfonated petro-leum or vitriol), by realizing the purpose of petroleum sweetening after the oily water separation.The total sulfur content of oil except that elementary sulfur, sulfide, also has mercaptan, thiophene, thionaphthene, dibenzothiophene class and more complicated sulfur-bearing to organise and about 200 kinds between 0.03%～7.89%.In experiment, often study the performance of various microorganism organic sulfide removals as model compound with dibenzothiophene (DBT) for the convenience of investigating mechanism.

As far back as nineteen thirty-five just the someone carry out the research of biological desulphurization aspect, and the patent at first oil biological desulfurizing technology in 1948 is delivered in the U.S., the industrialization but these technology fail to realize always, major cause is that these microorganisms also consume a large amount of alkane in organic sulfide removal, and biological catalyst lacks the most basic effect Substratspezifitaet condition.Up to 1988 U.S. gas technology research institute (IGT) obtaining great breakthrough aspect the biocatalytic desulfurization, two kinds of special bacterial classifications have been separated, can optionally from dibenzothiophene (DBT), remove sulphur, and obtain United States Patent (USP) (USA5002888 and USA5104801) in 1992.But, the shortcoming of this technology is that the desulfurization specific activity is lower, its grown cell is 80% (DBT content 500ppm) to the degradation rate of model compound dibenzothiophene (DBT), the activity of resting cell is lower, it uses the viable cell of microorganism strains simultaneously, cause reaction system later separation difficulty, microorganism is easily run off and is difficult to and reclaims.

At present, for the degraded of DBT, made them substantially clear and acted on intermediate metabolites in the metabolic process of DBT, its pathways metabolism has following several: the carbon skeleton of (1) DBT is by single-minded oxidation and the C-S key still keeps.(2) DBT is degraded to carbonic acid gas, water and inorganic sulfur up hill and dale.(3) the C-S key that cuts off DBT generates the biphenyl approach single-mindedly.Yet three kinds of approach respectively have relative merits, the present invention relates to bacterial strain and belong to first kind of pathways metabolism, can reduce the loss of carbon value, shorten the reaction times, improve the economic worth of metabolic by-prods.

Summary of the invention

Purpose of the present invention provides a kind of preparation of pseudomonas stutzeri strain and to the utilisation technology in the organic compounds containing sulfur desulfurization with regard to being to avoid above-mentioned the deficiencies in the prior art part.It mainly is by at the higher oilfield sewage of sulfur-bearing, oil field sludge and the natural bacterial classification that screening has degraded organic sulfide ability in by the soil of oil pollution, carry out mutagenesis on this basis, obtain the biological catalyst of the catalyzed oxidation organic sulfide of efficient stable, and developed the application of its immobilized cell and prozyme system organosulfur in removing fossil oil.Its technical characterstic is the higher oilfield sewage of sulfur-bearing, oil field sludge and by in the soil of oil pollution, and obtains bacterial strain by specific cultivation and isolation technique, and this bacterial strain suits to cultivate in the weakly alkaline substratum, 31 ℃ of culture temperature; Its bacterial characteristics: colonial morphology is a milk yellow; Gram-negative, not antiacid; Cell presents straight or crooked shaft-like, but is not spirrillum, not chaining; Size 0.6～0.8 * 1.4～2.0 μ m; Polar flagella is arranged, can move; Do not form gemma, no sheath or thrust; Do not observe poly--β hydroxybutyric acid particle; Do not produce fluorochrome; This bacterial strain was Pseudomonas stutzeri UP-1, was preserved in " China Committee for Culture Collection of Microorganisms's common micro-organisms preservation " center ", its preserving number CGMCC NO.0974 on June 31st, 2003.Its cultivation, separation and screening step are as follows:

1. sample collecting: from oilfield sewage, oil field sludge and by collected specimens the soil of oil pollution;

2. the preparation of pregnant solution: sample thief 5 grams or 5ml put into the basic salts solution of the 50ml that is added with 50mgDBT and (add 4g Na at every liter of distilled water ₂HPO ₄, 2g (NH ₄) ₂SO ₄, 0.2g MgSO ₄7H ₂O, 0.001g CaCl ₂, 0.001g FeSO ₄7H ₂O, PH is 7.0,20 minutes 121 ℃ of autoclavings) in, under 31 ℃, the condition of 200r/min, cultivated 10 days, change over to then in the NBYE substratum that contains 50mgDBT (adding 0.8% beef extract and 0.5% yeast extract in the basic salts solution again) and under same condition, cultivated 4 days, the above-mentioned culture of getting 5ml inserts in the same substratum cultivated continuous 4 this culture pregnant solutions of operating to the end again 4 days;

3. the preparation of bacterium colony: the enrichment culture thing that obtains is diluted to 10 ¹²Getting 1 μ L then is coated on and fills solid Sang Tasi substratum (peptone 10g, glucose 10g, enzymic hydrolysis casein food grade 2g, yeast soaks powder 2g, NaCl 6g, distilled water 1000ml, pH 7.5) culture dish in, put into then under 31 ℃ of conditions of biochemical incubator and to cultivate 4 days, treat that bacterium colony on the flat board grows the back and sprays one deck DBT at the bacterium colony on plate culture medium in the clean work station, cultivated 2 days in the biochemical incubator under 31 ℃ of conditions then, under visible light and fluorescence, observe change in color respectively then, select the bacterium colony that the color that can make dibenzothiophene changes;

4. the separation of bacterium colony: the method purifying that the bacterium colony that obtains is adopted plate streaking, concrete operations: calcination on spirit lamp with transfering loop or inoculating needle, from bacterium colony to be purified or slant strains to be separated, pick a small amount of bacterium sample then, line separates in corresponding culture medium flat plate, the method of line mainly contains continuous method of scoring and sectional streak method, repeat the operation of this step, till obtaining single bacterium colony, can obtain a kind of Pseudomonas stutzeri Pseudomonas Stutzeri UP-1 that dibenzothiophene is had single-minded sweetening effectiveness this moment.

The pseudomonas stutzeri strain that adopts aforesaid method to separate preparation can be acted on the biological desulphurization catalyzer and be applied in the sweetening process of organic compounds containing sulfur, its method is that this Pseudomonas Stutzeri UP-1 bacterial strain is acted on organic compounds containing sulfur according to the Kodama route, generate water-soluble organic compounds containing sulfur, reach the purpose of desulfurization by later separation, mainly contain following several mode:

1. the grown cell nutrient solution that with preserving number is the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generates water-soluble sulfurous organic compound.

2. the resting cell that with preserving number is the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generates water-soluble sulfurous organic compound.

3. the immobilized cell that with preserving number is the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generates water-soluble sulfurous organic compound.

4. the prozyme system that with preserving number is the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generates water-soluble sulfurous organic compound.

Description of drawings

The transmission electron microscope photo of Fig. 1 bacterial strain UP-1;

Fig. 2 bacterial strain UP-1 degraded DBT route;

Fig. 3 bacterial strain UP-1 degraded DBT curve;

Fig. 4 immobilization UP-1 degraded DBT curve:

Wherein, ■--be DBT add-on 500ppm; ●--be DBT add-on 625ppm;

▲--be DBT add-on 750ppm.

Embodiment

Further describe technical characterstic of the present invention below in conjunction with drawings and Examples:

Embodiment 1: preserving number of the present invention is the screening of the UP-1 bacterial strain of CGMCC NO.0974:

Near oilfield sewage, oil field sludge and the oil well in Gudao area of Shengli Oilfield oil district by collected specimens the soil of oil pollution, be further separated and screen usefulness.Sample thief 5 grams (or 5ml) are put into the basic salts solution of the 50ml that is added with 50mgDBT and (are formed: add 4g Na at every liter of distilled water ₂HPO ₄, 2g (NH ₄) ₂SO ₄, 0.2g MgSO ₄7H ₂O, 0.001gCaCl ₂, 0.001g FeSO ₄7H ₂O, PH is 7.0,20 minutes 121 ℃ of autoclavings) in, under 31 ℃, the condition of 200r/min, cultivated 10 days, change over to then in the NBYE substratum that contains 50mgDBT (adding 0.8% beef extract and 0.5% yeast extract in the basic salts solution again) and under same condition, cultivated 4 days, the above-mentioned culture of getting 5ml inserts in the same substratum cultivated continuous 4 this culture pregnant solutions of operating to the end again 4 days;

2. the enrichment culture thing that obtains is diluted to 10 ¹², get 1 μ L then and be coated in the culture dish that fills solid Sang Tasi substratum, put into then under 31 ℃ of conditions of biochemical incubator and cultivated 4 days.According to bibliographical information, it is the metabolite of yellow or brown that some bacterial classification of Rhodopseudomonas can be degraded to dibenzothiophene under visible light; Some bacterial classification of Rhod can be degraded to the material that sends red fluorescence under ultraviolet wavelength to dibenzothiophene, therefore come strain screening according to these characteristics, treat that bacterium colony on the flat board grows the back and sprays one deck DBT at the bacterium colony on plate culture medium in the clean work station, cultivated 2 days in the biochemical incubator under 31 ℃ of conditions then, under visible light and fluorescence, observe change in color respectively then, select the bacterium colony that the color that can make dibenzothiophene changes and do further research;

3. the bacterium colony that obtains is adopted the method purifying of plate streaking.Concrete operations: calcination on spirit lamp with transfering loop or inoculating needle, from bacterium colony to be purified or slant strains to be separated, pick a small amount of bacterium sample then, line separates in corresponding culture medium flat plate, the method of line mainly contains continuous method of scoring and sectional streak method, its objective is to obtain single bacterium colony.

But this step repetitive operation is till obtaining single bacterium colony.As a result, choose and a kind of dibenzothiophene is had the Pseudomonas stutzeri of single-minded sweetening effectiveness, promptly preserving number is the UP-1 of CGMCC NO.0974.

This preserving number is that the UP-1 bacterial strain of CGMCC NO.0974 suits to cultivate in the weakly alkaline substratum, 31 ℃ of culture temperature.

Its bacterial characteristics: Gram-negative, not antiacid; Cell presents straight or crooked shaft-like, but is not spirrillum, not chaining; Size 0.6～0.8 * 1.4～2.0 μ m; Polar flagella is arranged, can move; Do not form gemma, no sheath or thrust; Do not observe poly--β hydroxybutyric acid particle; Do not produce fluorochrome.

Its cultural characteristic: yeast extract paste peptone agar, cultivate observation colonial morphology and color after 1-3 days for 31 ℃ on nutrient agar medium and the Sang Tesi nutrient agar; Table 1 as a result.

Table 1

Substratum	Colonial morphology
Substratum	Colonial morphology	Glucose yeast cream agar	The bacterium colony milk yellow, thick, smooth surface
Nutrient agar medium	Bacterium colony is shallow isabelline, mucus shape, smooth surface.	Glucose yeast cream agar	The bacterium colony milk yellow, thick, smooth surface
Nutrient agar medium		Ox meat extract agar	Bacterium colony is shallow isabelline, mucus shape, smooth surface
Sang Tasi agar	The bacterium colony milk yellow glues shape, smooth surface more	Ox meat extract agar

It physiological and biochemical property: carry out Physiology and biochemistry with reference to the associated viscera of " Bergey ' s Manual of Systematic Bacteriology " Vol.III and " common bacteria system identification handbook " and measure; The results are shown in Table 2.

Table 2

Feature		The result	Feature	The result
Feature		The result	Feature	The result	Gelatine liquefication		-	Acetate utilizes	+
Class Hu Luosu produces		-	Propionic salt utilizes	-	Gelatine liquefication		-	Acetate utilizes	+
Class Hu Luosu produces		-	Propionic salt utilizes	-	The starch hydrolysis		+	Histidine salt utilizes	-
Nitrate reduction		-	Arginic acid salt utilizes	+	The starch hydrolysis		+	Histidine salt utilizes	-
Nitrate reduction		-	Arginic acid salt utilizes	+	Grow on the Mierocrystalline cellulose		-	Lysine salt utilizes	+
Indole reaction		-	Phenylalanine salt utilizes	-	Grow on the Mierocrystalline cellulose		-	Lysine salt utilizes	+
Indole reaction		-	Phenylalanine salt utilizes	-	Catalase		+	Ethanol utilizes	-
Oxydase		+	Malate utilizes	+	Catalase		+	Ethanol utilizes	-
Oxydase		+	Malate utilizes	+	Growth experiment	20℃	-	Seminose produces the acid experiment	-
31℃	+	Melibiose produces the acid test	-			20℃	-	Seminose produces the acid experiment	-
31℃	+	Melibiose produces the acid test	-	40℃		+	Semi-lactosi produces the acid experiment	-
50℃	-	Glucose produces the acid experiment	+	40℃		+	Semi-lactosi produces the acid experiment	-

Annotate "+" expression positive reaction "-" expression negative reaction

The sequence of the thymus nucleic acid of its 16S rDNA analysis gained is as follows:

＞3.1 (complete sequences)

GCCTAACACATGCAAGTCGAGCGGATGAGTGGAGCTTGCTCCATGATTCAGCGGCGGACGGGTGAGTAATGCC

TAGGAATCTGCCTGGTAGTGGGGGACAACGTTTCGAAAGGAACGCTAATACCGCATACGTCCTACGGGAGAAAGTGG

GGGATCTTCGGACCTCACGCTATCAGATGAGCCTAGGTCGGATTAGCTAGTTGGTGAGGTAAAGGCTCACCAAGGCG

ACGATCCGTAACTGGTCTGAGAGGATGATCAGTCACACTGGAACTGAGACACGGTCCAGACTCCTACGGGAGGCAGC

AGTGGGGAATATTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGTCTTCGGATTGTAAA

GCACTTTAAGTTGGGAGGAAGGGCAGTAAGTTAATACCTTGCTGTTTTGACGTTACCGACAGAATAAGCACCGGCTA

ACTTCGTGCCAGCAGCCGCGGTAATACGAAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGCGCGTAGGT

GGTTCGTTAAGTTGGATGTGAAAGCCCCGGGCTCAACCTGGGAACTGCATCCAAAACTGGCGAGCTAGAGTATGGCA

GAGGGTGGTGGAATTTCCTGTGTAGCGGTGAAATGCGTAGATATAGGAAGGAACACCAGTGGCGAAGGCGACCACCT

GGGCTAATACTGACACTGAGGTGCGAAAGCGTGGGGAGCAAACAG

Table 3

P.alcaligenes isolate LB19	97％
P.alcaligenes isolate LB19	97％	P.putida	97％
P.Sp.MT-1	97％	P.putida	97％
P.Sp.MT-1	97％	P.monteilii	97.8％
P.Putida strain ATCC17390	97.2％	P.monteilii	97.8％
P.Putida strain ATCC17390	97.2％	P.Stutzeri CCUG 11256	100％
P.Stutzeri fragi	98％	P.Stutzeri CCUG 11256	100％
P.Stutzeri fragi	98％	P.Stutzeri strain DNSP21	99.3％
P.Stutzeri strain phen8	99％	P.Stutzeri strain DNSP21	99.3％
P.Stutzeri strain phen8	99％	P.Stutzeri strain DSM 50238	99％

According to the 16s rDNA sequence of this bacterial strain and the correlated series Blast among the GenBank relatively the results are shown in Table 3, compare with the relevant bacterial strain of having delivered at present, the sequence homology of this bacterial strain and Pseudomonas stutzeri CCUG is the highest, is 100%, and as seen this bacterial strain belongs to pseudomonas evolution branch.According to the cell Gram-negative of this bacterial strain, not antiacid, it is shaft-like that cell is again, and polar flagella does not form gemma, and no sheath or thrust belong to Rhodopseudomonas (Pseudomonas).According to multinomial principle of classification, take all factors into consideration cultural characteristic, physiological and biochemical property and 16S rDNA The sequencing results and show: the feature of this bacterial strain is different with Pseudomonas stutzeri CCUG, so this bacterial strain is named the UP-1 into Pseudomonas Stutzeri.

This bacterial strain can be cultivated in the Sang Tesi substratum, also can cultivate in the substratum in sulfur-bearing source, and bacterial strain carries out the aerobic cultivation of weakly alkaline under 31 ℃.

Embodiment 2: preserving number is the utilization of carbon source experiment of the UP-1 bacterial strain of CGMCC NO.0974:

Table 4 is utilization of carbon source experimental results, it has shown that fully this bacterial strain can not be the sole carbon source growth with dodecane, the tetradecane, n-Hexadecane, whiteruss, naphthalene, this illustrates that this bacterial strain can not be to account for the saturated part of main component and fragrance part as unique carbon source in the oil product, and experimental result has proved that this bacterial strain has good Degradation to the model compound dibenzothiophene, comprehensive above experimental result, this bacterial strain have the potentiality of industrial biocatalytic desulfurization with bacterium.

Table 4

Embodiment 3: the preparation preserving number is the liquid medium of the UP-1 strain cell of CGMCC NO.0974:

1. Sang Tesi substratum: glucose 10g, yeast soak powder 2g, enzymic hydrolysis casein food grade 2g, and soy peptone 10g, sodium-chlor 6g, water 1000ml (solid Sang Tesi substratum add 2% agar), pH value is 7.2 (regulating with NaOH).

2. connecing preserving number with inoculating needle from solid Sang Tesi medium slant is that the UP-1 bacterial strain of CGMCC NO.0974 is to the Erlenmeyer flask of 250ml, fill the 100ml liquid Sang Tesi substratum of the bacterium of going out in the Erlenmeyer flask, in 31 ℃, cultivated 20-24 hour in the constant temperature shaking table under 200 rev/mins, making preserving number is the liquid medium of the UP-1 strain cell of CGMCC NO.0974.

Embodiment 4: the preparation preserving number is the UP-1 bacterial strain resting cell liquid of CGMCC NO.0974:

Supernatant liquid is outwelled in the liquid medium centrifugation (10000 rev/mins, 4 ℃) of the bacterial strain UP-1 that method obtained that will be by embodiment 3 15 minutes, obtains the accumulative strain cell.With phosphate buffered saline buffer washing centrifugation 4 times, the substratum nutrient of flush away remnants, the centrifugation cell that obtains is suspended in the phosphate buffered saline buffer, and freezing is standby in refrigerator, and promptly obtaining preserving number is the UP-1 bacterial strain resting cell liquid of CGMCC NO.0974.

Embodiment 5: the preparation preserving number is the immobilized cell (entrapping method prepares immobilized cell) of the UP-1 bacterial strain of CGMCC NO.0974:

1. polyvinyl alcohol embedding: by the bacterial strain UP-1 that method obtained of embodiment 3; Take by weighing wet cell weight 1 gram, be suspended in 20 ml physiological salines (0.9%); The polyvinyl alcohol solution for preparing 0.1 grams per milliliter, the heated and stirred dissolving is left standstill cooling under the room temperature; Bacterium is added 20 milliliters of polyvinyl alcohol solutions, be added drop-wise to saturated boric acid solution, make its bead that forms 3～5 millimeters of diameters, and soaked 24 hours with syringe; Standby with physiological saline washing 3 times.

2. agar embedding: by the bacterial strain UP-1 that method obtained of embodiment 3, take by weighing weight in wet base 5 grams, add 2% agar-agar soln of 200 heating for dissolving, pour dull and stereotyped cooling gel into, cut into pieces standby then.

3. sodium alginate to embed: by the bacterial strain UP-1 that method obtained of embodiment 3; Take by weighing 1 gram, be suspended in 20 ml physiological salines, join in 20 milliliter 4% the sodium alginate glue, mix, splash into syringe in 2% the calcium chloride solution, 4 ℃ of crosslinked balling-up, 3～5 millimeters of bead diameters, crosslinked 24 hours, it was standby to move into the refrigerator preservation.

Embodiment 6: the application of liquid medium of the present invention organosulfur in degradation of dibenzothiophene:

1. sterilized DBT is made into DBT-N, dinethylformamide (DMF) liquid storage;

2. liquid storage is added in 50 milliliters of embodiment 3 cultured cells liquid mediums, the concentration that makes DBT is 2.7mM;

3. the cell liquid medium that will contain DBT moves into 250 milliliters of Erlenmeyer flasks, puts into the constant temperature shaking table, and 31 ℃, 200 rev/mins of reactions down;

4. after reacting 24 hours, the HCL that adds 2M in nutrient solution makes the PH=2 of nutrient solution, and then add the ethyl acetate of 0.8 volume, fully after the concussion, centrifugal mixed solution, dibenzothiophene and oxidative metabolism product thereof be extracted superincumbent ethyl acetate mutually in, get 1 μ l and carry out the GC-MS analysis, obtain its degraded route as shown in Figure 2 in conjunction with thin-layer chromatographic analysis again.

Embodiment 7: the application of resting cell of the present invention organosulfur in degradation of dibenzothiophene:

1. resting cell 1 gram that embodiment 4 is made is suspended in 250 milliliters of Erlenmeyer flasks that fill 50 ml phosphate buffers, adds DBT again, and making its concentration is 780ppm;

2. make 8 same samples according to (1), put into the constant temperature shaking table simultaneously, 31 ℃, 200 rev/mins of reactions down; At set intervals, take out a sample determination, obtain its degradation curve (as Fig. 3), when the reaction times was 24 hours as seen from the figure, degradation rate no longer increased, and reached maximum value;

3. reacted 24 hours, regulating pH value is 2, remains DBT with n-hexane extraction, and its concentration is 87ppm, and degradation rate is 88.8%.

Embodiment 8: the application of immobilized cell of the present invention organosulfur in degradation of dibenzothiophene:

Immobilized cell 10g and 0.02mg that embodiment 5 is made add 250 milliliters of Erlenmeyer flasks that fill 50 ml waters, put into the constant temperature shaking table then, 31 ℃, 200 rev/mins of reactions down, react after 6 days, remain DBT with n-hexane extraction, the DBT starting point concentration is 780ppm, residue 270ppm, degradation rate is 65.4%.Fig. 4 is a UP-1 degraded DBT curve.

Embodiment 9: the application of the present invention's dibenzothiophene sulphur in removing simulation fuel oil system:

1. simulated oil system to be processed adds DBT by the tetradecane and constitutes;

2. 40 milliliters of simulated oil systems are moved into 250 milliliters of Erlenmeyer flasks, 121 ℃ of sterilizations 20 minutes;

3. resting cell 1 gram that embodiment 4 is made is suspended in 10 ml waters, making in the Erlenmeyer flask that cell suspension solution adds 2 steps, making DBT concentration is 0.27mM, puts into the constant temperature shaking table then, 31 ℃, 200 rev/mins of reactions down, after reaction finished, regulating pH value was 2, remain DBT with n-hexane extraction, with its concentration of chromatographic determination, DBT starting point concentration 500ppm, degraded back simulated oil system residue DBT concentration 270ppm degradation rate is 46%.

Embodiment 10: the application of the organosulfur of the present invention in removing hydrogenating desulfurization diesel oil:

Change the simulated oil system among the embodiment 9 into after the sterilization hydrogenating desulfurization diesel oil, other operation steps and method are constant, and behind biocatalytic desulfurization of the present invention, the sulphur content of diesel oil drops to 176 from 231, and desulfurization degree is 23.8%.

The invention effect

Because the present invention is the brand-new technology that is based upon on the bioengineering basis, it mainly is sulfur component in the enzymatic oxidation oil that utilizes in the organism, make it transform into water miscible compound (such as petroleum sulfonate or sulfate), by realizing the purpose of petroleum sweetening after the water-oil separating. This biocatalytic desulfurization is compared with the hydrodesulfurization (HDS) of prior art has many advantages:

1. it is to react under low temperature (20～60 ℃), normal pressure and do not need hydrogen, thereby can save device for producing hydrogen.

2.BDS the sulphur of deviating from exists with the water soluble compound form, thereby increases economic benefit, simultaneously discharging of waste liquid is arranged seldom, and is very favourable to environmental protection.

3. it can remove the dibenzothiophenes (DBT) that HDS is difficult to remove effectively.

4. for the material of common difficult treatment, such as FCC gasoline, crude oil and residual oil, BDS can both carry out desulfurization, can so that FCC gasoline not behind the reason hydrogenation hydrogen saturated and loss of octane number occurs. According to estimates, equipment investment BDS is lower by 50% than HDS, and operating cost reduces by 15%. Therefore BDS is extremely promising petroleum sweetening new technology.

Preserving number provided by the invention is that the UP-1 bacterial strain of CGMCC NO.0974 can be used as desulfurization biocatalyst selective oxidation sulfurous organic compound, reaches the desulfurization purpose thereby generate 3-hydroxyl-2 carboxaldehyde radicals-benzothiophene; This invention is particularly useful for removing of the middle organic sulfur of oil and products thereof, this preserving number is that the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur according to the Kodama route, generate water-soluble organic compounds containing sulfur, dibenzothiophenes is had good degradation capability, be expected to solve the deficiency that present oil hydrodesulfurization is difficult for removing thiophene class heterocycle sulfide; This bacterial strain extensively is present in the sewage and soil of high sulfur-bearing oilfield, wide material sources, and heritability is stable, and catabolite is easy to separate.

Claims

1. pseudomonas stutzeri strain, it is to derive from the higher oilfield sewage of sulfur-bearing, oil field sludge and by in the soil of oil pollution, and obtain by specific cultivation and isolation technique, it is characterized in that this bacterial strain suits to cultivate in the weakly alkaline substratum, 31 ℃ of culture temperature; Its bacterial characteristics: colonial morphology is a milk yellow; Gram-negative, not antiacid; Cell presents straight or crooked shaft-like, but is not spirrillum, not chaining; Size 0.6～0.8 * 1.4～2.0 μ m; Polar flagella is arranged, can move; Do not form gemma, no sheath or thrust; Do not observe poly--β hydroxybutyric acid particle; Do not produce fluorochrome; This bacterial strain is pseudomonas stutzeri strain (Pseudomonas stutzeri) UP-1, its preserving number CGMCC NO.0974.

2. the application of pseudomonas stutzeri strain sulphur in removing organic compounds containing sulfur, it is characterized in that with preserving number being that the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur according to the Kodama route, generate water-soluble organic compounds containing sulfur, reach the purpose of desulfurization by later separation.

3. the application of a kind of pseudomonas stutzeri strain according to claim 2 sulphur in removing organic compounds containing sulfur, it is characterized in that with preserving number being that the grown cell nutrient solution of the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generate water-soluble sulfurous organic compound.

4. the application of a kind of pseudomonas stutzeri strain according to claim 2 sulphur in removing organic compounds containing sulfur, it is characterized in that with preserving number being that the resting cell of the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generate water-soluble sulfurous organic compound.

5. the application of a kind of pseudomonas stutzeri strain according to claim 2 sulphur in removing organic compounds containing sulfur, it is characterized in that with preserving number being that the immobilized cell of the UP-1 bacterial strain of CGMCC NO.0974 acts on organic compounds containing sulfur by the Kodama route, generate water-soluble sulfurous organic compound.