CN100333791C

CN100333791C - Methods for vaccinating against malaria

Info

Publication number: CN100333791C
Application number: CNB2003801038788A
Authority: CN
Inventors: S·L·霍夫曼; R·王; J·E·爱泼斯坦; J·D·科恩
Original assignee: GlaxoSmithKline Biologicals SA; US Department of Navy
Current assignee: GlaxoSmithKline Biologicals SA; US Department of Navy
Priority date: 2002-10-23
Filing date: 2003-10-22
Publication date: 2007-08-29
Anticipated expiration: 2023-10-22
Also published as: CN1713817A; CN101077416A

Abstract

The invention pertains to methods for protecting against malaria infection by vaccination. The method of the invention involves priming an anti-malaria immune response with a DNA-based vaccine and boosting that response with a protein-based vaccine. The method of the invention also relates to broadenin g the resulting immune response by boosting with a protein-based vaccine.

Description

Methods for vaccinating against malaria

The cross reference of related application

The U.S. Provisional Application S.N.60/420 that the application submitted to based on October 23rd, 2002, the U.S. Provisional Application S.N.60/447 that 265 (Attorney Docket No.4012.6001) and on February 13rd, 2003 submit to, 026 (Attorney Docket No.4012.6002), and require its right.The application is based on the whole disclosure of these provisional application, and herein it is incorporated as reference.

Background technology

Malaria is one of the most serious public health problem in the torrid zone and subtropical zone.At developing world, there are every year 300 to 500 million peoples newly to infect plasmodium, die from malaria (110) up to 2.7 million peoples.Plasmodium falciparum (Plasmodium falciparum) is the plasmodium species of the most of death due to the responsible malaria.

There are 4 isolating stages in the life cycle of Plasmodium falciparum, wherein has 3 to be present in the human body.Usually see 115.In the phase I, the mosquito of carrying the infectiousness zygoblast in glandula obtains blood from the people, and when sucking blood these zygoblasts is delivered in people's the blood flow.In case enter the liver parenchyma, zygoblast just duplicates the formation merozoite.In second stage, merozoite navigates within blood flow, infects erythrocyte (RBCs).Erythrocyte will break after being full of by merozoite, discharges to infect new erythrocytic offspring.Anemia is the common sympton that infects in this stage.At last, some in these erythrocyte also will produce male and female gamete body (phase III).In the last stage, the artificial food of the mosquito of Gan Raning to infect do not taken in gametocyte.In mosquito, the fertilization of female gamete body finally causes the generation of infectiousness zygoblast, thus the execution cycle.

When pathogen such as Plasmodium falciparum enter human body, health produces by activating immune system and replys.At first producing generality and reply, is special the replying of pathogen afterwards.The antigen that pathogen is special replys with the pathogen uniqueness of invading is target.Two main weapons of replying that pathogen is special are cell and humoral response.CD8 ⁺And CD4 ⁺The T cell participates in cellullar immunologic response.Concrete is CD8 ⁺The T cell produces the cytokine of IFN-(IFN-γ) and so on, and IFN-has multiple effect of stimulation to immune other component (as macrophage).A kind of special CD8 ⁺T cell---cytotoxic T lymphocyte (CTLs) kills the infection cell in its surface expression pathogen antigen specifically.On the contrary, CD4 ⁺T cell or t helper cell promote the growth of cytotoxic T lymphocyte and induce the B cell division and the final antibody that produces.T helper cell can be divided into two subclass---TH1 and TH2 CD4 ⁺The T cell, the type of the cytokine that produces according to their is differentiated.Second weapon of the immunne response that pathogen is special is made up of humoral response, wherein B cellular replication, differentiation, and the final antibody that produces directly in conjunction with pathogen.Antibody is not particularly useful with the pathogen that any host cell interrelates for the bag quilt.Then, phagocyte (as the macrophage) pathogen of swallowing up antibody sandwich.

With regard to malaria infection, the different weapons of pathogen specific immunne response is the most effective in the moment of Plasmodium falciparum life cycle.When the infectiousness zygoblast was walked liver and entered hepatocyte, this zygoblast became intracellular pathogen, only spent little time in the extracellular of infecting.At this stage, CD8 ⁺T cell and CD4 ⁺T cell particular importance (mainly is responsible for killing the host cell of infection because the cytokine product of these T cells and they as γ-IFN).Show in the Mus malaria that from NavalMedical Research Center (NMRC) malaria project and other breadboard mass data the elimination of liver parasites in the cell depends on the CD8 at the expressed peptide of liver stage parasite ⁺T cell response (45).CD8 ⁺The exhaustion of T cell is resisted protective effect (27,31,90,93,108) that merozoite attacks with abolishment and to the animal adoptive transfer CD8 that is used to first to test ⁺The T cell can be given protective effect (56,85,87,109).

The immunne response of dna vaccination inducing cell mediation comprises the CD8 of antigen-specific ⁺The CD4 of cytotoxic T lymphocyte (CTLs) and deflection Th1 ⁺T cell response, they are main protection mechanisms (6,11,45,63,104,106) of resisting intracellular pathogen and tumor.Yet dna vaccination is proved to be for not being best for inducing protective immune response among the people so far.

On the contrary, after malaria infection reached second stage and infects erythrocyte, infectious merozoite not only duplicated in erythrocyte, and freely circulates in blood flow.Owing to two reasons, it is the most effective that antibody is dealt with this stage of infection.At first, the CTLs host cell that need infect is being called antigen-presenting on the specific proteins of MHC-I.Erythrocyte is not expressed MHC-I, has therefore reduced the effectiveness of CTLs.Secondly, as discussed above, the engulfing of the antibody-mediated pathogen that is not related with host cell.Therefore, in the second stage that infects, the CD4 of B cell and stimulation B cell ⁺The T cell all is important for resisting infection.

At the complexity of the human immune of Plasmodium falciparum, and the multistage parasite life cycle with special protein expression of stage, cause developing difficulty at the vaccine of Plasmodium falciparum.But, still need malaria vaccine.

The zygoblast stage of Plasmodium falciparum has been accredited as the potential target of malaria vaccine.The main surface protein of zygoblast is known as circumsporozoite protein (CS albumen).Clone, express and checked order from the protein (21) of 7G8 strain.It is characterized in that having immunodominant duplicate block, center, this duplicate block comprises 4 peptide Asn-Ala-Asn-Pro of repetition 37 times, but is interspersed by 4 accessory repetition Asn-Val-Asp-Pro.In other strain, the main and quantity of less important duplicate block and their relative position change to some extent.N and C end parts that the both sides of this core are made up of the non-repeatability aminoacid sequence, non-repeatability aminoacid sequence are called as the proteinic non-repeating part of CS.

Vical, Inc.San Diego, CA and Naval Medical Research Center have developed a kind of vaccine based on DNA (47) that contains the plasmid of expressing Plasmodium falciparum circumsporozoite protein (PfCSP) gene.This vaccine is made up of the naked DNA that the concentration with every milliliter 2500 μ g is contained in phosphate buffered saline(PBS) (PBS).Described plasmid contains the full-length gene of the complete PfCSP gene of encoding, and has the expression of being controlled by the enhancer and the promoter of CMVIE gene and has 5 ' untranslated region of CMV IE gene and the transcription terminator (64) of bovine growth hormone gene.For expression and the secretion of enhancement antigen in mammalian cell, the sequence of the people's tissue fibers of will encoding activation of zymogen thing albumen (hTPA) leader peptide is added to 5 ' end of coded sequence.Be contained in two open reading frame coding kanamycin resistance protein and the hTPA leader region/PfCSP fused protein (40) of PfCSP plasmid.The PfCSP plasmid does not contain known virus or carcinogenic protein coded sequence.This plasmid contain 6261 nucleotide bases to and have 4.07 * 10 ⁶The molecular weight of gmu (the average base pair of supposition DNA is 650gmu).

Use the fragment of clone's DNA to make up PfCSP DNA plasmid, the fragment of clone's DNA uses the standard molecule genetic technique to obtain from the plasmid of purification.Described plasmid results from antibacterial (escherichia coli (the E.coli)) cell of selecting culture medium culturing with kanamycin.Plasmid DNA purification behind the zymogenous bacteria cell.

Before clinical trial begins, immunogenicity research before NMRC has carried out PfCSP dna vaccination clinical.Particularly, after by immunoblotting assay assessment antigen presentation, PfCSP plasmid transient transfection is advanced the mammalian cell of cultivation.Also in mice and non-human primates, tested the ability (40,105) that special antibody of plasmid inducing antigen and CTL reply.Studies have shown that in mouse model in induce (30) with the CTL of antigen-specific after the plasmid DNA immunity and antibody response.As reporting in other system, research has further been established immune intramuscular (IM) path for CD8 ⁺Inducing of Th1 immunne response is best (30).In addition; studies show that subsequently, via the IM path with independent PfCSP plasmid or with other four kinds of other erythrocyte of coding before all six Rhesus Macacus (Rhesus monkey) of PfCSP plasmid immunity of the proteinic plasmid of liver stage Plasmodium falciparum combination all have the CTL and/or the antibody response (106) of detectable antigen-specific.

Before being used for clinical trial, carried out clinical widely preceding safety research.These researchs comprise 1) research that distributes of the mouse tissue of the plasmid DNA used via vein (IV) path or IM path; 2) Journal of Sex Research of dosage safety repeatedly in mice and rabbit; With 3) plasmid DNA in the mice integrates research (67,75).These researchs are summarized as follows.

Plasmid distributes and studies: people such as Parker have assessed the plasmid distribution (75) in the different tissues of mice.Mice is accepted the PfCSP plasmid of dose via IV or IM, and this dosage is 25 times of the highest mg/kg dosage of recommending the people.At following time point results tissue and use the existence of PCR assessment plasmid DNA: 1 hour, two days and 4 weeks after IV uses, and 2 day, 4 week and 8 weeks of IM after using.Found that plasmid DNA was distributed in institute in a organized way in 1 hour after IM uses.Plasmid is only found in bone marrow, blood and injection site in after using to IM two days, has top level in injection site.In 1 week after using to IM, only detect plasmid DNA in injection site.After IV uses, find PfCSP DNA plasmid with low-level be distributed in except that gonad and brain in a organized way.IV uses 4 weeks of back, only detects the DNA plasmid in the lung of an animal.

Dosage safety Journal of Sex Research repeatedly: people such as Parker also are devoted to give repeatedly the safety (75) of this vaccine of dosage in mice and rabbit.In the Journal of Sex Research of dosage safety repeatedly of mice, in 28 days period, animals received 8 times IM injection PfCSP DNA plasmids repeatedly, dosage be 1.0 μ g, 10 μ g and 100 μ g (accumulated dose be equivalent to build based on mg/kg justice people's dosage 5-500 doubly).Do not have unusual hematology or serum chemistry, unusual histopathology or induce at the antibody of dsDNA or the sign of antinuclear antibody.In the Journal of Sex Research of dosage safety repeatedly of rabbit, 6 weekly IM plasmid injections of animals received, dosage is 150 μ g and 450 μ g.As the research in Mus, there are not unusual hematology or serum chemistry, unusual histopathology once more or at the antibody of dsDNA or the inductive sign of antinuclear antibody.Therefore, the distribution that studies show that the PfCSP plasmid of Parker is dispersed throughout host tissue, and this plasmid some in these tissues keep permanent period, and this plasmid to be used for the people be safe because side reaction after it is applied to the volunteer, do not occur.

Integrate research: people such as Martin have assessed whether the PfCSP plasmid integration advances host chromosome DNA (67).To the plasmid DNA of each injected in mice single dose, after injection the 30th and 60 day is that the pcr analysis of every micrograms of DNA 1-10 copy is analyzed tissue with sensitivity.In general, do not provide the evidence of plasmid integration, and if hint have the integration of plasmid DNA to genomic DNA, its level is extremely low, and is lower several thousand times than the spontaneous mutation level of expection.

Research worker has confirmed that after the safety of PfCSP vaccine, NMRC has carried out two one clinical trial phases.In first test, adult volunteer healthy, that never infected malaria has accepted PfCSP dna vaccination (33,62,105,106) between 1997 and 1998.Be selected in 20 volunteers altogether, 5 volunteers of every set of dispense give dosage 3 times with the interval in January in 4 dosage groups of 20 μ g, 100 μ g, 500 μ g and 2500 μ g.Described as people such as Le, all these dosage all have good tolerability, violent or serious adverse events (62) do not occur.The adverse events that 4 moderates occurred; All these adverse events all are considered to can not be relevant with using of vaccine.Prevailing complaint is the pain and the tenderness of injection site.This is gentle, continues to be no more than 48 hours, and does not need Drug therapy.There do not have the volunteer to have any significant serum biochemistry to be unusual.

20 subjectss all do not have to occur for anti-dsDNA antibody induce or ANA (antinuclear antibody) tires from the increase of baseline.People such as Wang prove that by assessing at the indirect fluorescent antibody test (IFAT) of air-dry zygoblast with at the enzyme-linked immunosorbent assay (ELISA) of reorganization and synthetic peptide not having the volunteer to develop anti-PfCSP antibody.But, have 11 among 20 volunteers and have CTL activity antigen-specific, the heredity restriction.Particularly, ctl response be that the CD8+T cell relies on, peptide is special with heritability HLA-restriction because do not have or the identification of the I type HLA-mispairing target of hatching of almost not hatching with control peptide from the identification of body target or with special peptide.In addition, the inductive CTLs of DNA-is by multiple HLA allele heritability restriction (105,107).The CTL positive is that dosage is relevant.In all the other 9 volunteers, all do not detect CTLs in any test of after each immunity, carrying out.

In second clinical trial that starts from April, 1999, by three kinds of paths, using 14 healthy adult volunteers of PfCSP dna vaccination immunity 0,4 and 8 weeks, three kinds of paths are respectively: conventional needles IM (intramuscular), Biojector ^_IM and Biojector ^_IM (dosage 70%) adds ID (Intradermal) (dosage 30%).Biojector ^_It is a kind of jet injection device of needleless.Consider the small scale of research, volunteer's HLA multiformity is limited in prevailing I type HLA hypotype---HLA A2 in this colony, with between the group of the ctl response that allows the heritability restriction relatively.Participate in 10 other experiments that participated in using the inventive method subsequently among the volunteer of this research.This experiment and its result are further described in following " embodiment " part.

In general, this vaccine is safe and well tolerable.The volunteer does not experience any violent or serious adverse events (AEs) relevant with vaccine.Do not have the volunteer experienced with 3 kinds of paths passing through to be tested in the relevant remarkable laboratory abnormalities (33) of any PfCSP of using vaccine.

With regard to regard to the immunoreation of vaccine,, do not have the volunteer to develop and anti-PfCSP antibody (107) by at the IFAT of air-dry zygoblast with at the ELISA assessment of reorganization and synthetic peptide.The shortage of the antibody that PfCSP is special is astonishing to a certain extent because Biojector jet injection device and the immunity of ID path all with animal model in the antibody that improves produce relevant (1,37,62).In the ELISPOT test, measure t cell response by IFN-γ.In order to finish these tests, used the peptide of the proteinic t cell epitope of CSP that comprises that PfCSP is plasmid-encoded.

All 4 volunteers of entry needle IM group respond 7/9 peptide in 17.6% (26/148) test.All 5 volunteers of Biojector IM group respond 9/9 peptide in 26.5% (49/185) test.4 people among 5 volunteers of Biojector IM/ID group respond 7/9 peptide in 17.3% (32/185) test.Having 8 people to have among 14 volunteers can reply by detected CTL.In this 8 people, two people are arranged at entry needle IM group (peptide of response 4/7 in 5/126 test altogether), 3 people are at Biojector IM group (peptide of response 6/8 in 11/168 test altogether), and 3 people are in Biojector IM/ID group (peptide of response 6/6 in 14/162 test altogether) (107).In general, these tests have determined that the inoculation of Biojector IM path is the most effective for the special IFN-γ of inducing antigen replys, and Biojector IM or IM/ID path are the most effective for the special CTL of inducing antigen replys.

In a word, by to peptide-special, the heritability restriction, that the CD8+T cell relies on active measurement of CTL and measurement (105 by IFN-γ is produced, 107), these two clinical trial proof PfCSP polynucleotide vaccines can cause CD8+T cell response antigen-specific, the heritability restriction.In 1 year when test after using last PfCSP polynucleotide vaccine, in above-mentioned measurement, do not show the t cell response of any CD8+ antigen-specific from the volunteer of second clinical experiment.

As discussed above, except the CD8+T cell response, in the control malaria infection, also playing the part of important role (1,78,99) at the antibody of the proteinic any peptide of PfCSP.Though the receptor of many PfCSP dna vaccinations is developed the t cell response that the CD8+ antigen-specific, nobody is developed the specific antibody that any resisting-CSP.On the contrary, research worker has proved RTS, and S can cause the powerful antibody of CSP is replied (53,99,100).RTS, S also are the inducers of effective TH-1 type cell and humoral immunization, RTS wherein, and the special CD4+T cell response of S-mainly concentrates on the polymorphic district of Th2R immundominance (61).

Use twice or 3 RTS; S dosage; for the volunteer of attacking in two to 3 weeks after the immunity the last time with Plasmodium falciparum; there are 60 volunteers (average 44%) of surpassing to be protected (8; 54; 99), and the last time the immunity back provides the spy the bimestrial protection (8) that continues for 70% half immune Gambian.Yet, the persistent period of this protection short (8,100).Use RTS, the IFN-γ that anti-PfCSP antibody of S immune induction and CD4+T cell rely on replys, but the CTL or the IFN-γ that do not detect the dependence of CD8+T cell reply (61).

The present invention

The invention provides new vaccine method, described method uses the initiation vaccine (priming vaccine) of the polynucleotide that contain at least a first malaria antigen of encoding to cause (prime) immunne response, use then and contain replying that at least a reinforcement vaccine (boosting vaccine) that comprises the antigenic polypeptide of at least a second malaria strengthens that (boost) cause, the wherein said second malaria antigen has at least a common epi-position with at least a first malaria antigen that causes vaccine.This is combined as present malaria vaccination strategies 3 important improvement is provided.

At first, two kinds of weapons of the combination activating immune system of two kinds of heterogenous vaccines---CD8+T cell, CD4+T cell and antibody.Particularly, based on using PfCSP vaccine or RTS, the clinical test results of S vaccine, any vaccine all can not be set up the continuable CD8+T of evoking cell, CD4+T cell separately and at the immunne response of the antibody of CSP.The present invention improves this result by making up these two kinds of vaccines, causes all 3 types reply thus.Particularly, the PfCSP vaccine causes the CD8+T cell response, RTS, and the S vaccine is strengthened this t cell response.Because RTS, S vaccine also cause anti-CSP antibody and CD4+T cell, so the immunne response at CSP that produces comprises CD8+ and CD4+T cell response and antibody response.We claim the vaccination strategies that this is overall---cause with a kind of vaccine, use then with the different vaccines that cause the shared at least a common epitope of vaccine and strengthen---be called " initiation/reinforcement " strategy.

The present invention is to use the fact of protein vaccine at people's moderate stimulation CD8+T cell response to second important improvement of existing vaccination strategies.Method of the present invention is strengthened t cell response by using based on proteinic vaccine, and being considered to for stimulating the CD8+T cell response so far based on proteinic vaccine is invalid (61).

At last, the 3rd important improvement to existing malaria vaccination strategies provided by the invention is that it has widened immunne response aspect two.At first, by DNA initiation/RTS, S has strengthened inducing the T cell colony (Tcl and Th1) of forming wideer generation IFN-γ, because the CD8+1 type (Tcl) and CD4+1 type (Th1) the IFN-γ that use DNA to cause that the CD4+T cell relies on reply, and independent RTS, the Th1 IFN-γ that S only induces the CD4+T cell to rely on replys.The second, when using separately, the CD8+T cell colony that the PfCSP vaccine causes-determines.Equally, RTS, the B cell of the antibody that CD4+T cell colony that the S vaccine only causes-determines and manufacturing one cover are determined.Yet after combination, the CD8+T cell response of generation not only covers the epi-position that is caused by the PfCSP vaccine at first, and this is replied and also covers other epi-position that this PfCSP initiation inoculation back does not identify at first.To the existing understanding of protein vaccine, protein vaccine can be strengthened and the notion of widening the CD8+T cell response of having set up is unexpected according to this area.

The invention summary

The present invention relates to resist the method for malaria, comprise step: a) cause immunne response by the initiation vaccine of using the polynucleotide that contain at least a malaria antigen of encoding by immune people; And b) by using the immunne response that the reinforcement vaccine that contains at least a polypeptide is strengthened causing subsequently, wherein said polypeptide comprises malaria antigen at least a and the total at least a identical epi-position of one or more malaria antigens that cause vaccine, thereby evokes cellullar immunologic response and humoral immunoresponse(HI) at malaria.

In one embodiment of the invention, cause the vaccine coding and be present in the same polypeptide of strengthening in the vaccine.In other embodiments, cause the vaccine coding and be present in a part of strengthening the malaria antigen in the vaccine, perhaps being present in the polypeptide of strengthening in the vaccine is a part that causes the malaria antigen of vaccine coding.In another embodiment, described vaccine is shared at least a malaria t cell epitope.And in another embodiment, described vaccine is shared at least a malaria CD8+T cell epitope.In an alternate embodiment, two kinds of vaccines are shared several malaria epi-positions.

Any pathogen of malaria that causes all can be used to method of the present invention.In one embodiment, pathogen is a Plasmodium falciparum.In other embodiments, pathogen can be Plasmodium vivax (P.vivax), Plasmodium ovale (P.ovale) or malariae (P.malariae).Equally, method of the present invention can be used any malaria antigen of expressing in any stage of pathogen life cycle.In one embodiment, cause the antigen that vaccine coding and reinforcement vaccine contain one or more proerythrocyte stages in pathogen (comprising the liver stage) expression.And in another embodiment, at least a portion of the circumsporozoite protein that the polynucleotide encoding that causes vaccine was expressed in the liver stage of infecting and strengthen at least a portion that vaccine contains circumsporozoite protein.Also in another embodiment, cause the whole basically circumsporozoite protein of the polynucleotide encoding of vaccine and strengthen vaccine and contain the circumsporozoite protein of some.The proteic least part of CS is the immunogenicity part that contains at least one epi-position or several epi-positions.In a specific embodiment, the initiation vaccine contains PfCSP and the reinforcement vaccine contains RTS, S.In another embodiment, causing vaccine is that PfCSP vaccine and reinforcement vaccine are RTS, the S vaccine.

The present invention also provides and contains the pharmaceutical kit that causes as described herein and strengthen vaccine.

The present invention also provides and causes and strengthen vaccine is used for preventing or alleviating the vaccine of malaria seriousness in preparation purposes as described herein.

Therefore, the invention provides at least a malaria antigen of coding, particularly CS albumen or its segmental polynucleotide---as causing vaccine---and contain at least a malaria antigen, particularly CS albumen or its segmental polypeptide---as strengthening vaccine---are used for the purposes of the initiation-reinforcement vaccine of malaria in manufacturing.In a specific embodiment, polynucleotide are the form of DNA plasmid, the CS albumen of preferred expression total length or its fragment.Coding CS albumen or segmental polynucleotide can be under the control of allogeneic promoter known in the art.In one embodiment, promoter is a HCMV IE promoter, randomly comprises exons 1.In a specific embodiment, the polypeptide of strengthening vaccine is the hybrid protein that contains CS protein carboxyl groups end parts, and described part be c-terminus at least 160 aminoacid partly for example, randomly gets rid of 12 aminoacid of carboxyl terminal.In initiation and the reinforcement compositions any or both can be contained extra malaria antigen or other antigen.

In an embodiment according to this aspect of the invention, cause vaccine and comprise the proteic polynucleotide of coding total length CS, these polynucleotide are present under the allogeneic promoter control and are in the DNA plasmid, and strengthen vaccine and contain the RTS that makes up with Th1 inducing adjuvant (adjuvant that particularly contains QS21,3D-MPL and oil in water emulsion), S.Can provide with the pharmaceutical kit form and cause and strengthen vaccine.

The present invention provides part, enhanced or protection completely to not exposing the pathogen that causes malaria before or having exposed the people who is not still protected fully to some extent.Chance, the reduction people that the present invention also can be used to reduce the generation malaria infection infects the ill chance in back, the reduction people infects the back disease seriousness of (as having a fever), the parasite concentration among reduction the infected, or reduces the mortality rate of malaria when the people is exposed to malarial parasite.Become the zone of local epidemic disease in malaria, even the protection of part also is favourable.For example, cause about 30% the protected vaccine therapy strategy of population to have significant effects to a community.

The accompanying drawing summary

Fig. 1 only shows after DNA causes (Fig.la), only use RTS, and before S strengthens (Fig.lb) and at RTS, after the S reinforcement (Fig.lc), the CTL of each positive subjects and every kind of positive peptide replys.Black vaginal discharge represents to contain the sample that test peptides and correct MHC present.Point band (stippled bar) expression contains the sample that control peptide and correct MHC present.Striped band (stripled bar) expression contains test peptides but the sample that do not have correct MHC to present.With the ALVAC that expresses PfCSP to take from DNA cause after (a), strengthen before (b), or first dose (volunteer 6=V6) or second dose of (V2,3,8 and 9) RTS, the fresh PBMCs stimulated in vitro 7 days in second week (c) behind the S, and discharge at 5 hours chromium and to analyze, at the amino acid whose PfCSP derived peptide of 8-10 or the control peptide (HLA-A of experiment ^*0201 restricted of HIV gag) target (MHC+ peptide) of (MHC+ contrast) the I type HLA-coupling of hatching together or the target (non-MHC+ peptide) of mispairing are analyzed.Have only when (at that time, during the ratio of effector lymphocyte and target cell (E: T) be at least 2), thinking that just it is male replying with cracking percent difference 〉=10% of the experiment and the target cell of control peptide pulse.With single E: T ratio (20: 1 or 40: 1) provides the cracking percent of the contrast that various peptides and its assess simultaneously.

Fig. 2 characterizes respectively inducing with effector phase and relates to the T cell that external IFN-γ replys.Use is from 3 doses of independent PfCSP DNA (V1 and V5) or two doses of independent RTS, the volunteer's of S (V 19, V21 and V22) immunity the PBMCs that freezes carries out the ELISPOT test, this PBMC or handle with contrast Dynabeads, perhaps face with peptide (a) Flu M A2, (b) TT-DR, (c) PfCSP DR.363 or (d) PfCSP DR.316 cultivate and exhaust CD4 before ⁺Or CD8 ⁺The T cell.Abreast, being right after, by the T cell colony (CD4 of PCR in real time measurement from identical volunteer's selective enrichment with the same search time point of testing after the identical peptide group of ELISPOT test is cultivated 36 hours ⁺/ CD45RA ⁺, CD4 ⁺/ CD45RA ^-, CD8 ⁺/ CD45RA ⁺And CD8 ⁺/ CD45RA ^-) IFN-γ mRNA expression (e).

Fig. 3 shows the IFN-γ mRNA expression in the T cell subsets of measuring by PCR in real time IFN-γ.Studied from two through 3 doses of PfCSP DNA (independent DNA) and caused and two doses of RTS, S vaccine (DNA/RTS, S) the freezing cell that obtains among the strengthened volunteer (V1 and V5).Cell was hatched 36 hours with PfCSP DR.363 peptide, and was expressed by selectivity enrichment and assessment IFN-γ mRNA.After the dna immunization, in the CD4+T cell of the CD45RA+ subgroup of the CD45RA-of volunteer V1 subgroup and volunteer V5, rather than IFN-γ mRNA expresses appropriateness (5-10 doubly) and raises in the CD8+T cell.Significantly (80-100 doubly) increase that RTS, S strengthen (rather than in CD8+T cell) IFN-γ mRNA expression in the rise CD4+T subgroup with two volunteers is relevant.

Fig. 4 shows that the IFN-γ to peptide DR.316 replys by first dose of RTS, and the pattern of inducing of the DNA behind the S (only has CD8 ⁺Tcl) to using RTS once more, the mixing (CD8 of two kinds of patterns behind the S vaccine ⁺Tcl and CD4 ⁺Th1) change.In the stripped ELISPOT that the cell of using from volunteer V2 carries out, first dose of RTS, behind the S by before cultivating, exhausting CD4 ⁺And CD8 ⁺The T cell significantly reduces IFN-γ and replys (feature that the inductive IFN-γ of DNA replys).At second dose RTS, after the S vaccine, have only the CD4+T cell to exhaust and just significantly reduce activity.Abreast, record (b) first dose of RTS in effector phase by PCR in real time, IFN-γ mRNA expression is at CD8 behind the S ⁺Rather than CD4 ⁺Raise in the T cell, second dose of RTS, behind the S at CD8 ⁺And CD4 ⁺All raise in the T cell.Two weeks after " 2wkpl " refers to first dose, two weeks after " 2wkp2 " refers to second dose.

Fig. 5 shows that DNA causes/RTS, and the antibody I FAT among the volunteer that S strengthens tires.At the RTS first time, before the S dosage, DNA cause (+) and cause (-), have (+) and do not have among the volunteer of (-) anti-HbsAg antibody, antibody titer with geometrical mean+/-SE (95% confidence interval) represents.Using RTS, S has carried out antibody analysis for the first time and after the immunity for the second time.Except second week behind first time dosage, DNA-/HBsAg+ volunteer has outside significantly higher the tiring (P＜0.02) than DNA+/HBsAg+, and tiring between any group does not have significant difference.

Detailed Description Of The Invention

Such as here door screen release, can cause the sick many means immune response that infects of antimalarial by the initiation vaccine immunity people receptor with the polynucleotides that contain at least a malaria antigen of encoding, then strengthen by replying this with the reinforcement vaccine immunity that contains at least a polypeptide, wherein said polypeptide comprises the malaria antigen that at least a one or more malaria antigens with causing vaccine have at least a identical epi-position. It is shocking, use polypeptide vaccine, this immunization method is strengthened and has been widened replying of causing.

" vaccine " is the composition that contains the material of the molecule of energy induce immune response when being applied to the subject. Vaccine can contain polynucleotide molecule, peptide molecule and carbohydrate molecule, with and derivative and combination, such as fusions of glycoprotein, lipoprotein, carbohydrate-protein conjugate, two or more polypeptide or polynucleotides etc. Can be easy to understand such as those skilled in the art, vaccine can further contain diluent, adjuvant, carrier or their combination (83).

Polynucleotide vaccine or protein vaccine are transmitted to people receptor in method or the path that can be used alone or in combination any inoculation. The path of using comprises intravenous, intramuscular, subcutaneous, intracutaneous or mucous membrane. The mode of transmitting can change, and for example, can inject to the people via IV, IM, subcutaneous or ID path. Can inoculate to people receptor via the mucous membrane path. Can alternatively can transmit via the means of needle-less, as using " particle gun " of needle-less, such as Biojector_, or other jet injection device, or via biological blast technique transmission. Polynucleotides can be with the bacterium of the DNA that contains the PfCSP vaccine, or contains the virus transmission of the DNA of PfCSP vaccine.

The example of suitable viral vectors comprises herpes simplex virus vector, vaccinia virus or Alphavirus carrier and retrovirus, comprises slow virus, adenovirus and adeno-associated virus. In one embodiment, these carriers are replication-defective virus carriers. Those skilled in the art understand these viral gene transfer techniques of use. For example, can polynucleotides stable integration of the present invention be advanced host genome with retroviral vector, although may not build this class restructuring of justice. Compare, replication-defective adenoviral vector remains sequestered and therefore allows transient expression.

In a specific embodiment, the adenovirus that is used as the liver carrier is replication deficient human or simian adenovirus. Usually these viruses contain the E1 disappearance, can grow in the clone that has transformed the E1 gene. Suitable simian adenovirus is the virus of for example separating from chimpanzee. Be suitable for viral example of the present invention and comprise C68 (being also referred to as Pan 9) (US Patent No 6,083 716, be incorporated herein be with reference to) and Pan 5,6 and Pan 7 (WO03/046124, being incorporated herein is reference). Therefore, can operate to insert heterologous gene of the present invention to these carriers, so that can the expressing gene product. The use preparation of this class recombinant adenovirus poisonous carrier and making are disclosed in the WO 03/046142 that is introduced as reference in detail.

Vaccine can be comprised of the component of separating. As used herein, " component of separating " refers to a kind of like this situation, and in fact wherein said vaccine contains two kinds of separate administration to the vaccine of subject's separation. With regard to this meaning, the vaccine that is grouped into by separate groups can be regarded as containing kit or the packing of vaccine component separately. For example, in the context of the present invention, packing can contain polynucleotide vaccine component and polypeptide vaccine component.

When one or more antigens in being present in vaccine caused the experimenter that is vaccinated that these one or more antigens are produced immune responses, vaccine " had been induced " immune response. As confirming by immune activation, the experimenter who is vaccinated will produce immune response, and described immune activation comprises antibody that vaccine antigen special T cell, vaccine antigen special B cell, vaccine antigen are special and the generation of cell factor. Can measure the immune response that produces by some methods, these methods comprise ELISPOT, ELISA, chromium-release test, the dyeing of the cell within a cell factor, facs analysis and MHC tetramer staining (to identify the special cell of peptide). The technical staff also can measure primary immune response and secondary immune response with these methods.

" antigen " is the material that can cause immune response in being exposed to subject's body of antigen. Antigen is polypeptide and be the focus of host immune response normally. " epi-position " or " antigenic determinant " is the antigen position of T cell and antibody specific binding. Antigen can contain a plurality of epi-positions.

The initiation vaccine that uses in the inventive method contains the polynucleotides of the malaria antigen discussed below of encoding. Cause vaccine and can be independent DNA or be in bacterium or virus in exogenous promoter control under DNA. The polynucleotides that cause vaccine are present in suitable delivery vector, such as plasmid or other carrier, in bacterium or viral vectors. Polynucleotides can be under the control of suitable promoter (such as the promoter from HCMV IE gene). Use the initiation vaccine with effective initiation for the amount of the immune response of malaria antigen. As used herein, when antigen is when passing T cell or B cell, " initiation " of immune response occured. As a result of, in immune response again subsequently, the cell of initiation can be replied same antigen again as memory cell. Therefore, initiation causes primary immune response and sets up immunological memory. Those skilled in the art will recognize that primary immune response is the adaptive immune response when being exposed at first the antigen that is in (in pathogen or vaccine) in the special environment. Yet those skilled in the art can be appreciated that also the present invention is not limited to use the initiation vaccine in the inmature individuality of immunology. On the contrary, also can expose antigen but do not accept to cause to produce in the individuality of vaccine and cause.

" effectively " amount of initiator can change between the DNA of 0.01 μ g to 50mg. Can be alternatively, dosage can between between 1 μ g to 10mg DNA or 2.5mg to 5mg DNA. Before using polypeptide reinforcement vaccine, can use polynucleotide vaccine one time. In another embodiment, can use and cause several times vaccine. " effectively " number of times of inoculation can be between 1 to 5 dosage. Can be alternatively, before using the reinforcement vaccine, the number of times of dosage can be between 1 to 3 dose or 1 to 2 dose.

" polynucleotides " are often referred to any polybribonucleotide (RNA) or polydeoxyribonucleotide (DNA), and they can be RNA or DNA unmodified or that modify. Polynucleotides comprise DNA, strand and double-stranded RNA that (being not limited to) strand and double-stranded DNA, strand and double stranded region mix, and the RNA that mixes of strand and double stranded region. Polynucleotides also comprise the hybrid molecule that contains DNA and RNA, and this molecule can be strand, or the mixture of more common two strands or strand and double stranded region. In addition, " polynucleotides " relate to and contain the two 3 sequences of RNA or DNA or RNA and DNA. Polynucleotides also comprise former for stability or other thereby contain DNA or the RNA of one or more modified bases, and have DNA or the RNA that modifies skeleton. The base of " modification " comprises such as tritylation base and rare bases, such as inosine. Can carry out various modifications to DNA and RNA; Therefore, " polynucleotides " comprise the polynucleotides form of chemistry, enzyme or the metabolism modification usually found at occurring in nature, and virus and the DNA of cells characteristic and the chemical species of RNA. Oligonucleotides is the polynucleotides of relatively lacking.

" fragment " of polynucleotide sequence refers to shorter than canonical sequence, but keeps biological function or the active sequence that is considered to identical with the reference polynucleotide sequence. Fragment coding is with reference at least one epi-position with reference to polypeptide of polynucleotide sequence coding. As used herein, when be used for describing polynucleotides or polypeptide, " basically whole " encode or represent the molecule of total length polynucleotides completely or polypeptide if not refer to less nucleotide base or the amino acid residue disappearance.

The employed reinforcement vaccine of the inventive method can comprise the fused protein that contains at least a malaria antigen polypeptide discussed below. The polypeptide that uses in this vaccine can separate from natural origin, results from external source biology (such as bacterium) with recombinant protein, or synthetic via chemical means. Strengthen vaccine and can further contain extra non-malaria polypeptide, to strengthen the immunogenicity of malaria polypeptide. For example, can use part or all of HBsAg. Cause vaccine and strengthen the shared at least a common malaria epi-position of vaccine.

According to the present invention, the suitable fusion rotein that is used to strengthen vaccine can comprise the hybrid protein that contains whole basically CS PROTEIN C end parts, 4 or the multiple immunodominant region of more a plurality of series connection, hepatitis B virus surface antigen (HbsAg).Described hybrid protein comprises and contains and homologous substantially at least 160 the amino acid whose sequences of CS PROTEIN C end parts.In one embodiment, CS albumen can lack 12 last aminoacid from the C end.Suitable hybrid protein comprises basic corresponding to the amino acid whose Plasmodium falciparum CS of the 210-398 of Plasmodium falciparum 7G8 protein part, and this protein part N end via linear joint and HbsAg in framework merges.Joint can comprise the part from the preS2 of HbsAg.

Another embodiment is called after RTS, and the heterozygosis granule of S, this granule are described in United States Patent (USP) 5,928,902 and the International Patent Application WO 93/10152 that is introduced as reference here.Consisting of of this heterocomplex: the 1.) methionine residues from saccharomyces cerevisiae TDH3 gene order (71) of encoding by nucleotide 1059 to 1061; 2.) from 3 aminoacid---the Met Ala Pro of the nucleotide sequence of creating by the cloning process that is used to make up heterozygous genes (1062 to 1070); 3.) by nucleotide 1071 to 1637 coding, represent 210 to 398 amino acid whose one sections 189 amino acid whose chains (21) of Plasmodium falciparum 7G8 strain circumsporozoite protein (CSP); 4.) by nucleotide 1638 to 1640 amino acids coding of creating by the cloning process that is used to make up heterozygous genes (Arg); 5.) by nucleotide 1641 to 1,652 4 aminoacid---Pro Val Thr Asn (103) coding, that represent 4 c-terminus residues of hepatitis B virus (adw serotype) pre S2 albumen; With 6.) by nucleotide 1653 to 2330 encode, proteic one section 226 amino acid whose chain of regulation hepatitis B virus (adw serotype) S.

Use the reinforcement vaccine with effective " reinforcement " at the amount of the initiation immunne response of malaria antigen.As used herein, " reinforcement " immunne response refers to inducing secondary immune response by being exposed at first among (promptly being exposed) subjects that antigen is initiated (sensitization).Secondary immune response is a feature with the memory T cell and the B cell of activation and amplifying specific.Therefore, the reinforcement that specific immune is replied can be bred after being exposed to this antigen subsequently and breaks up by inducing immune cells, and improves the immunne response that causes.As discussed below, the total length CS albumen of PfCSP vaccine contains 9 t cell epitopes, and RTS, S contains 5 t cell epitopes (61).4 RTS are wherein arranged, and the S epi-position is present in the PfCSP vaccine.For example, when using, cause vaccine and cause malaria CD8+T cell.Can realize one or more following effects and strengthen vaccine: induce the CD4+T cell, induce malaria antibody, strengthen and induce the extra CD8+T cell of in initial initiation immunne response, originally not identifying by the CD8+T cell activity that causes the vaccine initiation.Strengthening vaccine can also induce the CD4+T cell and induce malaria antibody.Booster immunization is replied and is also referred to as " memory " immunne response in this area.

" effectively " booster dose can between 1 μ g to 100 μ g or between 10 μ g to 75 μ g or between the scope of 40 μ g to 60 μ g.In another embodiment, booster dose can be 50 μ g.And in another embodiment, booster dose can be 25 μ g.Strengthen that vaccine can be applied 1 time or repeatedly.Strengthen " effectively " number of times of administration and can strengthen vaccine between 1 to 5 dose.Can be alternatively, can be to people receptor's administration number of times between 1 to 3 dose or 1 to 2 dose.In another embodiment, dna vaccination and protein vaccine may be used to strengthen primary immune response.

" polypeptide " refers to any two or more peptide bonds by peptide bond or modification (being the peptide isostere) amino acid whose polypeptide connected to one another that contains." polypeptide " both referred to short chain, was commonly referred to peptide, oligopeptide or oligomer, also referred to be commonly referred to protein by long-chain.Polypeptide can contain normal by the aminoacid outside the codon amino acids coding.

Polypeptide comprises the aminoacid sequence of being modified by natural method (as transcribing post-treatment) or chemical modification technology well-known in the art.This class is modified in the basic material and is fully described, and describes more in detail in monograph and big quantity research document.Modification can betide any position of polypeptide, comprises peptide backbone, amino acid side chain and amino or c-terminus.These modifications can exist with identical or different degree in some sites of given polypeptide.And given polypeptide can contain the modification of many types.Polypeptide can be used as the result of ubiquitinization and is branched, and they can or not have cyclisation under the branch in branch.The natural process that cyclisation, ramose and ramose cyclisation polypeptide can result from after transcribing maybe can be by the manual method manufacturing.Modification comprises acetylation; acidylate; the ADP-ribosylation; amidatioon; biotinylation; the covalent attachment of flavin; the covalent attachment of heme moiety; the covalent attachment of nucleotide or nucleotide derivative; the covalent attachment of fat or fat derivant; the covalent attachment of phosphatidylinositols; crosslinked; cyclisation; disulfide bond forms; demethylation; the formation of covalent cross-linking; the formation of cystine; the formation of pyroglutamic acid; formylated; gamma-carboxylation; glycosylation; the formation of GPI anchor; hydroxylating; iodate; methylate; myristoylation; oxidation; the Proteolytic enzyme process; phosphorylation; isoprenylation; racemization; selenoylation; sulphation; what transfer RNA mediated adds aminoacid (as arginylization) and ubiquitinization (79 to protein; 82; 94; 113).

" fragment " of peptide sequence is meant shorter than canonical sequence, but keep be considered to with reference to polypeptide identical biological function or active peptide sequence.This class activity can comprise the ability of replying as immune stimulatory.Fragment keeps at least one epi-position with reference to polypeptide." part " of polypeptide refers to the subclass with reference to amino acid sequence of polypeptide.Can a part be described by its relative position in polypeptide, for example C end parts or N end parts.

The present invention can use any malaria antigen, as is shown in the antigen of Table A and table B.

Table A: preceding RBC antigen

Antigen	Reference
Antigen	Reference	CSP	13、14、29、32、41、55、66、69、78、85、87、91、99、 114
SSP2	1、13、14、29、55、56、86、104、111、112	CSP	13、14、29、32、41、55、66、69、78、85、87、91、99、 114
SSP2	1、13、14、29、55、56、86、104、111、112	Exp1/Hep-17	15、16、27、28、29
PfLSA1	29 and 44	Exp1/Hep-17	15、16、27、28、29
PfLSA1	29 and 44	PfLSA3	22

Table B

The RBC stage antigens

Antigen	Reference
Antigen	Reference	MSP-1	7、10、12、20、34、35、46、58、59、65、95、96
MSP-2	3、4、17、80、81、88	MSP-1	7、10、12、20、34、35、46、58、59、65、95、96
MSP-2	3、4、17、80、81、88	MSP-3	72 and 73
MSP-4	50	MSP-3	72 and 73
MSP-4	50	MSP-5	7
AMA1	5、18、19、24、 25、 101、 102	MSP-5	7
AMA1	5、18、19、24、 25、 101、 102	EBA175 II district	97 and 98
SERA	26、48、49、76、77	EBA175 II district	97 and 98
SERA	26、48、49、76、77	RAP2	39、76、84、89

" circumsporozoite protein " or " CSP " is the main surperficial polypeptide on malaria zygoblast surface.Cloning and sequencing and expressed CSP (PfCSP) (21) from Plasmodium falciparum 7G8 strain.Other CSPs from other malarial parasite also has been described feature and has been contained in Table A.

As used herein, " RTS, S " refers to a kind of specific malaria antigen and represents one embodiment of the invention.RTS, S and generation more detailed description thereof are in the U.S. Patent No. 5,928,902 and the International Patent Application WO 93/10152 that are incorporated herein to reference.

" widen " composition (repertoire) that refers to increase t cell response.In this case, by DNA initiation/RTS, the T cell colony (Tcl and Th1) that the generation IFN-γ with wideer composition (repertoire) has been induced in the S reinforcement is because use dna immunization/initiation to evoke CD4 ⁺The CD8 that the T cell relies on ⁺1 type (Tcl) and CD4 ⁺1 type (Th1) IFN-γ replys, and independent RTS, S only induces CD4 ⁺The Th1 IFN-γ that the T cell relies on replys.The technical staff can test by the detection of antigen-specific and detect the immunne response of widening.For example, the technical staff can use ELISPOT, the dyeing of the MHC tetramer or chromium to discharge the repertoire that CTL tests to determine the T cell mass.

" widen " scope that also refers to increase the epi-position that will react with immunne response.Except the immunocyte of initial initiation, do not caused or quantity is little is also induced amplification and activate to the immunocyte that can not be detected.Therefore, the immunne response of widening has not only been amplified initiating response originally, also comprises the replying new epi-position of a part that is not primary response.The technical staff can test by the detection of using antigen-specific and detect the immunne response of widening.For example, the technical staff can use ELISPOT or the dyeing of the MHC tetramer to come compare definite the composition with all epi-positions compositions of primary immune response reaction and with this composition with all epi-positions of secondary immune response reaction.If secondary immune response is than the epi-position reaction of primary immune response with bigger quantity, then secondary immune response is widened.

" CD8+T cell " represents a class to have the T lymphocyte that the cd8 cell surface markers is a feature.The CD8+T cell is MHC I type restriction " CTLs " or " suppressor T lymphocyte ".

" CD4+T cell " represents a class to have the T lymphocyte that the cd4 cell surface markers is a feature.The CD4+T cell is the T lymphocyte of MHC II type restriction.There is two types CD4+T cell, is called as 1 type or 2 types " helper T lymphocyte ".

As discussed above, by the interaction of antigen and immune system cell, produced at antigenic immunne response.The immunne response that produces can be by rough two the extreme classifications that are divided into, i.e. body fluid or cell-mediated immune responses (being made as feature with the antibody mechanism and the cytological effect handset of protection respectively traditionally).These classes are replied and are named as the Th1 type and reply (cell-mediated replys) and Th2 type immunne response (humoral response).It is feature that extreme Th1 type immunne response can be replied with the generation of CTLs antigen-specific, haplotype-restriction and natural killer cell.In mice, it is feature with IgG2a hypotype production of antibodies usually that the Th1 type is replied, and in the people these corresponding to IgG1 type antibody.Th2 type immunne response is characterised in that and produces wide spectrum immunoglobulin isotype, comprises IgG1 in the mice, IgA and IgM.

The development driving force behind that is positioned at this immunne response of two types is a cytokine, the protein courier of some evaluations, and it helps immune cell and handles final immunne response and reply development to Th1 or Th2.Therefore, high-caliber Th1 cytokines tends to support at the inducing of given antigenic cell-mediated immune responses, and high-caliber Th2 cytokines tends to support inducing at antigenic humoral immunoresponse(HI).The difference of importantly remembeing Th1 and Th2 type immunne response is not absolute.In fact, individually the immunne response of main Th1 or main Th2 will be supported to be described to.Yet, usually easily according to Mosmann and Coffman (70) description in Mus CD4+T cell clone consider cytokine family.Traditionally, the Th1 type is replied with relevant by the generation of lymphocytic INF-γ of T and IL-2.Other usually can't help the generation of T cell with the directly related cytokine of inducing of Th1 type immunne response, as IL-12.Relative, it is relevant with the secretion of IL-4, IL-5, IL-6, IL-10 and tumor necrosis factor-β (TNF-β) that the Th2 type is replied.

Be used for proper adjuvant of the present invention and comprise aluminum salt; as alumine hydroxide colloid (alum) or aluminum phosphate; but also can be calcium, ferrum or zinc salt; maybe can be the insoluble suspension of acidylate tyrosine, or cation or anionic derivative, Polyphosphazenes or the montanide liposome of the sugar of acidylate, polysaccharide.

Being used for bacterin preparation of the present invention, under the situation of PfCSP plasmid, can use or not use adjuvant.At RTS, under the situation of S, adjunvant composition can induce preferential Th1 to reply.In addition, can also induce other to reply, comprise other humoral response.

Some vaccine adjuvant is particularly suited for stimulating Th1 or Th2 cytokines to reply.Traditionally, the equilibrated preferably indication of the Th1 that inoculation or premunition are replied: Th2 comprises with antigen stimulates the back to the Th1 of the external generation of T lymphocyte or the direct measurement of Th2 cytokine again, and/or the IgG1 of the antibody response of antigen-specific: the measurement of IgG2a ratio.Therefore, Th1 type adjuvant is a kind of adjuvant that stimulates isolating T-cell colony to produce high-caliber Th1 cytokines after accepting the external stimulation again of antigen, and this adjuvant also induces the antigen specific immune globulin relevant with Th1 type isotype to reply.For example, can be produced the Th1 type immunostimulant of the adjuvant that is suitable among the present invention, can comprise that monophosphoryl lipid A, particularly 3-take off-the monophosphoryl lipid A (3D-MPL) of O-acidylate by preparation.3D-MPL is well-known by Ribi Immunochem, the adjuvant that Montana produces.Chemically provide 3-to take off-the monophosphoryl lipid A and 4 of O-acidylate, the mixture of 5 or 6 acidylate chains usually.It can be by the method purification and the preparation of GB 2122204B instruction, and this list of references is also discussed the preparation of two phosphinylidyne fat A and its 3-O-deacylation variant.Other purification and synthetic lipopolysaccharide (USPat.6,005,099,42,43, EP 0 729 473 B1, EP 0549 074B1) have been described.In one embodiment, 3D-MPL has the granular preparation form of diameter less than the small particle diameter of 0.2 μ m, and its manufacture method is disclosed in E P 0 689 454.

Saponins compound is another example that can be used to Th1 immunostimulant of the present invention.Saponins compound is well-known adjuvant (60).For example, Quil A (from South America QuillajaSaponaria Molina bark) and its fraction be by US Pat.5, and 057,540, EP 0 362 279 B1 and Kensil (52) describe.Haemolysis saponin QS21 and QS17 (the Quil A fraction of HPLC purification) have been described to effective general adjuvant (systemic adjuvant), and their production method is disclosed in US Pat.5, and 057,540 and EP 0 362 279 B1.These lists of references have also been described the purposes of QS7 (the non-hemolytic fraction of Quil A) in the general vaccine as effective adjuvant.People such as Kensil have further described the purposes (51) of QS21.The combination of QS21 and polysorbate or cyclodextrin also known (WO 99/10008).The fraction that comprises Quil A, as the particulate adjuvants system description of QS21 and QS7 in WO 96/33739 and WO 96/11711.

Another example of immunostimulant is the immunostimulatory oligonucleotide that contains unmethylated CpG dinucleotide (" CpG).CpG is the abbreviation that is present in the cytosine-guanine dinucleotide motif among the DNA.CpG known in the art is the adjuvant of using by general and mucosa path (WO96/02555, EP 468520,23,68).(bacillus Calmette-Guerin, DNA part BCG) can be brought into play antitumous effect once to observe bacillus calmette-guerin vaccine.In further studying, synthetic oligonucleotide from the BCG gene order shows can induction of immunity irritant effects (body is interior and external all like this).The author of these researchs draws a conclusion: some palindrome that comprises center C G motif carries this activity.Krieg (57) has explained CG motif central role in immunostimulation afterwards.Detail analysis has shown that the CG motif must be in certain sequence background, and these sequences are common in DNA of bacteria, and seldom is present among the vertebrates DNA.The immunostimulating sequence usually is: purine, purine, C, G, pyrimidine, pyrimidine; Wherein the CG motif is not methylated, but also known other unmethylated CpG sequence is also had an immunostimulating, and can be used to the present invention.

In the combination of some 6 nucleotide, can there be palindrome.Can be in same oligonucleotide and have some these motifs with the form of the combination of a kind of repetition of motif or different motifs.The existence of the oligonucleotide that contains the immunostimulating sequence that one or more are such can activate the panimmunity subgroup, comprises natural killer cell (produce IFN-also have dissolved cell activity) and macrophage people such as (, 1997) Wooldrige.Other contains methylated CpG not but the sequence that do not have this consensus sequence also has been proved now and has immune regulative.When being mixed with vaccine, CpG is applied (WO 96/02555,68) with free antigen usually or puts together (WO 98/16247) with the antigen covalency in free solution, or prepares (hepatitis surface antigen) (9,23) with the carrier as aluminium hydroxide and so on.

Above-mentioned these immunostimulant can be prepared with carrier, and described carrier such as liposome, oil in water emulsion, and/or slaine comprise aluminum salt (as aluminium hydroxide).For example, 3D-MPL can be with aluminium hydroxide (EP 0 689454) or oil in water emulsion (WO 95/17210) preparation.QS21 may be favourable with the liposome that contains cholesterol (WO 96/33739), oil in water emulsion (WO 95/17210) or alum (WO98/15287) preparation; CpG can prepare together with alum (9,23) or other cation carrier.

Also can use the combination of immunostimulant, as the combination (WO 94/00153, WO 95/17210, WO 96/33739, WO 98/56414, WO 98/05355, WO 99/12565, WO 99/11241) of monophosphoryl lipid A and saponin derivative or as being described in the combination of QS21 and the 3D-MPL of WO94/00153.Can be alternatively, the present invention also can use CpG to add the combination of saponin (as QS21).Therefore, suitable adjuvant system comprises the combination with aluminum salt as monophosphoryl lipid A (as 3D-MPL).Another embodiment combination monophosphoryl lipid A and saponin derivative, as be disclosed in the combination of QS21 and the 3D-MPL of WO 94/00153, or as be disclosed in the low reaction originality compositions of WO 96/33739, wherein QS21 in containing the liposome of cholesterol (DQ) by cancellation.In oil in water emulsion, comprise the adjuvant formulation of QS21,3D-MPL and tocopherol and described another among the WO 95/17210.In another embodiment, the CpG oligonucleotide is together used separately or with aluminum salt.The extra adjuvant and/or the example of carrier combinations comprise: the QS21+ oil in water emulsion among the QS21+3D-MPL among the QS21 among the 3D-MPL+DQ, Alum+3D-MPL, the Alum+DQ, Alum+CpG, the 3D-MPL+DQ, and CpG.

In another embodiment, combination 3D-MPL and QS21 have or do not have CpG.The ratio of QS21: 3D-MPL can be about 1: 10 to 10: 1; 1: 5 to 5: 1; Or 1: 1.In one embodiment, the ratio of D MPL: QS21 is 2.5: 1 to 1: 1.Usually, for human administration, QS21 and 3D MPL will the scope with 1 pig-200 4g exist in vaccine, as every dose of 1-1004g or 10～Lg-50～tg.Usually oil-in-water will comprise 2 to 10% zamene, 2 to 10% alpha tocopherol and 0.33 to 3% Tween80.Zamene: the ratio of alpha tocopherol is equal to or less than 1, because more stable Emulsion is provided like this.Can also there be Span85 with 1% level.In some cases, to contain stabilizing agent may be favourable to vaccine of the present invention.

Strengthen the adjuvant that vaccine uses together with the polypeptide of the present invention that contains CS albumen or its immunogenicity position (randomly as RTS, in the hybrid protein of S and so on), can contain the combination of 3D-MPL and QS21 and have or do not have CpG.

The generality of front is described and the following detailed description all only is exemplary and indicative, desired the present invention is not construed as limiting.In addition, the present invention is not restricted to described particular, and these embodiments certainly change itself.In addition, be used to describe the term and the unrestriction intention of particular, because scope of the present invention only is subjected to the restriction of its claim.

About numerical range, unless in addition clear and definite pointing out in context, otherwise the present invention includes between between the upper and lower bound of described scope each be worth between two parties, be accurate at least ten of lower limit unit/one.In addition, the present invention includes the value between two parties of any other statement.In addition, unless specifically get rid of from described scope, the present invention also comprises the scope of upper and lower bound of getting rid of described scope one or both of.

Unless otherwise defined, otherwise the meaning of all technology used herein and scientific and technical terminology is the common meaning of understanding of those skilled in the art.Those of ordinary skill in the art will recognize that also method and material that method any and described herein is similar or of equal value with material also can be used for practice of the present invention and test.In addition, all publications of mentioning here are incorporated as reference.

Must be pointed out, as pointed with appended claims here, unless clear and definite pointing out arranged in context in addition, otherwise singulative " " (" a "), " or " and " this " (" the ") comprise plural indicant.Therefore, for example, with regard to " a kind of tested polypeptide ", comprise multiple this class polypeptide, with regard to " this reagent ", comprise one or more reagent and its equivalent well known by persons skilled in the art, or the like.

In addition, unless indication is arranged in addition, the numeral of amount, reaction condition, % purity, polypeptide and the polynucleotide length etc. of all expression compositions that use in description and claim is modified by term " approximately ".Therefore, the digital parameters of listing in description and claim is character of the present invention that can be as required and the approximation that changes.At least the not application of intended doctrine of equivalents on the claim scope, each digital parameters should be used conventional approximation technique and understand according to the significant digits of report at least.But the numerical value of listing in specific embodiment is as much as possible accurately to report.Yet any numerical value all contains some error from the standard deviation of its experiment measuring inherently.

Following examples further illustrate the present invention.They only are the multiple advantageous feature that illustrates the present invention and disclose certain embodiments of the invention.It is limitation of the present invention that following examples should not be understood that.

Embodiment

Embodiment 1

Use RTS, anti--PfCSP that the S vaccine is strengthened having caused replys

For 24 HLA-A have been recruited in this research ^*0201 positive volunteer.In order to compare between the group that can carry out hereditary restricted t cell responses, volunteer's HLA multiformity is restricted to modal I type HLA hypotype in this colony.Previous unmanned contacted malaria among these volunteers.Among these 24 experimenters, 10 second PfCSP vaccine clinical trials that participation is above-mentioned are excessively arranged.In this process of the test, these volunteers accepted altogether three doses of PfCSP dna vaccinations (VCL-2510, by Vical, Inc (SanDiego, CA) preparation (62) as previously mentioned), dosage is 2500 μ g/ agent, every dose of 4 weeks of interval (62).Therefore, in this test, these 10 volunteers are at the RTS that accepts to strengthen, and 12-14 accepted their last potion dna vaccination in individual month before the S vaccine.Remaining 14 volunteers do not accept the PfCSPDNA vaccine in advance, therefore as undischarged contrast.All 24 volunteers are being negative with PfCSP dna vaccination and RTS aspect the antibody of anti-PfCSP, HIV, HBV cAg, HCV, vaccinia virus and dsDNA before the two immunity inoculation of S vaccine.In among the volunteer that 10 DNA cause 6 and 14 the undischarged contrasts 8 is called the anti-HBsAg antibody positives.

All 24 volunteers accept two doses of RTS, S vaccine by left side triangular muscle intramuscular injection when 0 week and 8 weeks.RTS, S vaccine comprise Plasmodium falciparum (NF54/3D7) the proteic 207-395 amino acids of CSP (8) that merges with hbs antigen (HBsAg).In brief, RTS, S albumen is a kind of heterocomplex, comprises the proteic C end parts of whole basically CS, 4 or multiple immunodominant region of more a plurality of series connection and HBsAg.Relevant RTS, the generality of S preparation is described and is consulted WO 93/10152 and United States Patent (USP) 5,928,902, and they are all incorporated into own forces in this as a reference in full.

The reorganization RTS that produces, S protein expression in yeast (99) and with immunostimulant monophosphoryl lipid A and QS21 (in oil in water emulsion) (Glaxo SmithKline Inc, Rixensart, Belgium) combined preparation RTS, S vaccine.Particularly, lyophilized formulations comprises RTS, S precipitation and adjuvant diluent.Precipitation comprises RTS, S (50 μ g) and as the lactose (3.15%) of antifreezing agent.The adjuvant diluent comprises MPL (50 μ g), QS-21 (50 μ g) and oil/aqueous emulsion.The bacterin preparation that produces comprises the RTS of 50 μ g in the Emulsion of 1ml volume, S and in injection preparation in preceding 30 minutes.Three unmatched volunteers of HLA do not accept PfCSP dna vaccination and RTS, the S vaccine.The sample that obtains from these three volunteers is as the negative control in this test.A volunteer in undischarged group withdrawed from from test after the immunity inoculation in the first time.

In the upstream of total length PfCSP sequence, comprise many t cell epitopes, be included in the PfCSPDNA vaccine, but be not present in RTS, in the S vaccine.But enough overlapping assurances RTS are arranged between these two kinds of vaccines, and the S vaccine is given previous correctness with the immune volunteer who crosses of PfCSP dna vaccination as potential " reinforcement " vaccine administration.Particularly, RTS, S comprise and the part of the HBsAg coexpression that does not merge PfCSP in yeast, that merge with hepatitis B virus surface antigen (HBsAg), wherein comprise the c-terminus (36) with 19 multiple high conservative region of NANP and CSP.The total length CS albumen of PfCSP vaccine comprises 9 t cell epitopes, and RTS, S comprises 5 t cell epitopes (61).RTS has 4 and comes across in the PfCSP vaccine in the S epi-position.

Embodiment 2-7 has described the analysis of using the blood sample from each volunteer to carry out subsequently in detail.In brief, for accepting volunteer that the PfCSP dna vaccination causes after it accepts last potion PfCSP dna vaccination 12-14 month, and for all volunteers at first and second doses of RTS, the 1st week, 2 week and 6 weeks behind the S vaccine, research t cell responses.With every dose of RTS, the 2nd, 4,6 and 8 weeks were detected antibody behind the S vaccine administration before immunity inoculation.

Embodiment 2

Ctl response

As mentioned above, use RTS separately, the S vaccine carries out immunity inoculation and brought out antibody and CD4 in human body ⁺T cell dependency IFN-gamma reaction, but report that also meeting cause antigenic specificity CTL (61) in human body.In order to determine that whether memory CTL that DNA brings out can detect the cytotoxic activity of antigenic specificity CTL among the different volunteers by use RTS, S vaccine to strengthen to recall and strengthenedly whether widelyer than replying of initial DNA initiation replying.Using RTS, 1-2 week and first dose and/or second dose of RTS before the S immunity, 1 or 2 weeks were collected peripheral blood lymphocytes (PBMC) after the S immunity from DNA initiation or undischarged volunteer's blood.Then these PBMC are used for the cracking (105) that chromium-release test detects the antigen presentation target cell.

Carry out external chromium release assay (105) as previously mentioned.Particularly, in order to produce the effector lymphocyte, with the ALVAC (vCP182) that expresses PfCSP with in 37 ℃ of total PBMC of infection 20%90 minutes of the amount of 5pfu/ cell.After the rinsing 2 times, these PBMC were also cultivated 7-10 days with remaining PBMC mixing.The human IL-2 (Cetus, Emeryville, CA) (20U/ml) that add reorganization after 48 hours.Target cell is the PHA blast from body or MHC mispairing that spends the night with the PfCSP specific CTL epi-position of 10 μ g/ml or control peptide sensitization.6 hours chromium release assay methods with routine detect the CTL activity.The cracking percentage rate is defined as (experimental group burst size-culture medium contrast burst size)/(maximum burst size-culture medium contrast burst size) x100.Obtain the cracked percentage rate of specificity by the cracking percentage rate that from the cracking percentage rate of the target cell that is incubated altogether with experimental peptide, deducts the target cell of cultivating with negative control HIV gag A2-restricted peptides.Only in same mensuration at least 2 effector: target (E: T) ratio, specificity cracking percentage rate＜10% after the immunity inoculation before specificity cracking percentage rate 〉=10% and the immunity inoculation, it is male that ctl response just is considered to.

Purity is that the synthetic peptide of 80-95% is used for the sensitization of CTL target cell and available from ChironTechnologies (Clayton Victoria, Australia).8 kinds have been used from PfCSP and be included in RTS, the peptide in the S sequence.These 8 kinds of peptides comprise the CTL I class MHC restricted epitope of determining of 4 kinds of 9-10 amino acid longs.These 4 kinds of CTL epi-positions are subjected to HLA-A ^*0201 (peptide A2.319; Amino acid residue 319-327, YLNKIQNSL; SEQ.ID.NO.1) ,-A ^*0101 (peptide A1.310; Amino acid residue 310-319, EPSDKHIKEY; SEQ.ID.NO.2) ,-A ^*0301 (peptide A3/11.336; Amino acid residue 336-345, VTCGNGIQVR; SEQ.ID.NO.3) and-B ^*3501 (peptide B35.353; Amino acid residue 353-360, KPKDELDY; SEQ.ID.NO.4) limit.Other 4 kinds of peptides are DR binding peptide DR.316 (amino acid residue 316-335, IKEYLNKIQNSLSTEWSPCS; SEQ.ID.NO.5), DR.318 (amino acid residue 318-332, EYLNKIQNSLSTEW; SEQ.ID.NO.6), DR.363 (amino acid residue 363-383, DIEKKICKMEKCSSVFNVVNS; SEQ.ID.NO.7) and DR.346 (amino acid residue 346-365, IKPGSANKPKDELDYANDIE; SEQ.ID.NO.8), they are 15-20 amino acid long (107) as previously mentioned.Glaxo Smith Kline Inc (Rixensart, Belgium) provides a set and the set with 20 kinds of HBsAg derived peptide with 13 kinds of PfCSP derived peptide, and length is 15 aminoacid.The aminoacid sequence of 13 kinds of PfCSP peptides is as follows: NEEPSDKHIKEYLNK (SEQ.ID.NO.9), DKHIKEYLNKIQNSL (SEQ.ID.NO.10), EYLNKIQNSLSTEWS (SEQ.ID.NO.11), IQNSLSTEWSPCSVT (SEQ.ID.NO.12), STEWSPCSVTCGNGI (SEQ.ID.NO.13), PCSVTCGNGIQVRIK (SEQ.ID.NO.14), CGNGIQVRIKPGSAN (SEQ.ID.NO.15), QVRIKPGSANKPKDE (SEQ.ID.NO.16), PGSANKPKDELDYEN (SEQ.ID.NO.17), KPKDELDYENDIEKK (SEQ.ID.NO.18), LDYANDIEKKICKME (SEQ.ID.NO.19), DIEKKICKMEKCSSVF (SEQ.ID.NO.20) and ICKMEKCSSVFNVVN (SEQ.ID.NO.21).Peptide (58-66 position residue, GILGFVFTL, HLA-A2.1 from the influenza stroma protein; SEQ.ID.NO.22) or tetanus toxin versatility t helper cell epi-position P30 (DR-and DP-are restricted for 947-969 position residue, FNNFTVSFWLRVPKVSASHLET; SEQ.ID.NO.23) as positive control (74).(HLA-A2.1 is restricted for 77-85 position residue, SLYNTVATL from the proteinic peptide of HIV gag; SEQ.ID.NO.24) or Plasmodium falciparum albumen Exp-1 (82-96 position residue, A GLLGNVSTVLLGGV, DR is restricted; SEQ.ID.NO.25) as negative control.

By using RTS, S strengthens recalling the inductive memory-type CTL of DNA

Use RTS facing, detect before the S vaccine that DNA causes or undischarged volunteer in do not have CTL.Only accept RTS at 14, all do not detect ctl response among the not initiation volunteer of S vaccine.In the volunteer that 10 DNA cause, there are 5 to detect antigenic specificity and hereditary Restricted CTL reaction (Fig. 1 c).One of 5 persons of responding are using first dose of RTS, and CTL (V6) has been arranged in a week behind the S, and other several all is to use second dose of RTS, CTL has been arranged behind the S.Ctl response frequency among the volunteer that DNA causes (7/113 time measure 6.2%) is significantly higher than the ctl response frequency that do not cause among the volunteer (0/125 time measure 0%) (P=0.0047).Described ctl response frequency is comparable among 15 volunteers that accepted 3 doses of PfCSP dna vaccinations before 12-14 month only with the observed ctl response frequency in dna immunization inoculation back (30/458 mensuration, 6.6%) (107).

Causing with DNA and use RTS, the intensity (magnitude) of CTL among the volunteer that S strengthens (the percentile scope of specificity cracking [geometrical mean]: 11.4-28.1[15.4]) also with is separately inoculated the CTL intensity of bringing out (10.5-90.0[15.6]) in same scope with dna immunization.RTS, S vaccine are not included in previous two researchs (105,107) and the highest relevant CD8+T cell epitope of universality of replying.

Detect at being present in RTS, the ctl response of 4 kinds of definite PfCSP specificity I class MHC restricted epitopes of all in the S sequence.In 5 CTL reactors, 4 CTL that have at HLA-A2-restricted epitope A2.319,1 responds to HLA-A1-restricted epitope A1.310 (V2), has two respectively HLA-A3 and HLA-B7-restricted epitope A3.336 (V8) and B7.285 (V9) to be responded in 4 A2.319 responders.Do not detect and be oriented to the CD4 that reported ⁺CTL epi-position DR.318 (sequence E YLNKIQNSLSTEWS; SEQ ID NO.26) CTL, said epi-position D comprise CD8 in R.318 ⁺CTL epi-position A2.319 (underscore sign place) (69).Do not accept PfCSP DNA but accepted 2 doses of RTS, do not detecting the CTL activity among 14 volunteers of S vaccine yet.In these volunteers the active shortage of CTL meet show in the previous research use the result that this vaccine can not be induced CD8+T cytoactive (that is CTL activity) separately.

2 weeks and 6 weeks, RTS after second and the 3rd dose of PfCSP dna immunization inoculation, when S reinforcement precontract detected in 1 year, use RTS for 5, have after the S vaccine is strengthened among the volunteer that the DNA of positive ctl response causes 3 CTL activity (107) that before do not detect at same epi-position are arranged.On the contrary, after only with the dna immunization inoculation, there are 2 before just to detect among 5 volunteers, the CTL activity of contained peptide among the S at RTS.These two volunteers do not add strong production to RTS.S and reply.

RTS, the ctl response that S strengthens is wideer than the ctl response that DNA causes

Using RTS, having after the S vaccine is strengthened among the volunteer that 5 DNA of positive ctl response cause, 3 (V3, V6 and V8) are being arranged through RTS, the epi-position that S strengthens not responding after cause DNA the back has produced reaction.Particularly, has only the background high 10% of two kinds of negative controls of specificity cracking percentage after immunity inoculation (MHC+ contrast and non-MHC+ peptide) or more for a long time, it is male that ctl response just is considered to.Among V3 and the V6, carrying out after DNA causes epi-position A2.319 not being had ctl response (Fig. 1 a and 1b) with the PfCSP vaccine.But, using RTS, after S strengthened, two volunteers had demonstrated the ctl response (Fig. 1 c) to this epi-position.V8 causes the back at DNA does not have ctl response to epi-position A2.319 and A3.336, but is using RTS, after the S vaccine is strengthened the volunteer of this initiation, the ctl response (Fig. 1 a, 1b and 1c) to these epi-positions occurred.

As mentioned above, those skilled in the art do not think can the effective stimulus ctl response based on the vaccine of albumen.Same, RTS, S are as a kind of vaccine based on protein, and still being considered to up to now for stimulating the CD8+T cell effect is invalid (61).With known opposite, above data have clearly confirmed after DNA causes, RTS, and S can excite the ctl response for new CTL epi-position.

Definitely check the t-check (bilateral) of (bilateral) or Student to analyze the frequency and the intensity of peptide specific IFN-γ (below) and ctl response with X 2 test, Fisher.The ratio that compares IFN-γ mRNA expression in the T cell subsets with the t-check of paired samples.Significance level is P value＜0.05.

Embodiment 3

T cell IFN-γ to PfCSp replys

With following standard ELISPOT test assessment IFN-gamma reaction.(107) stimulated in vitro under the condition that 10 μ g/ml peptides exist is measured the number of the PfCSP-specific cell that produces IFN-γ with ELISPOT after 36 hours as previously mentioned.((speckle forms cell VA) to check in the hole speckle number corresponding to the cell that produces cytokine for Scanalytics, Fairfax with the automatic dot number system; SFC).Reaction table is shown SFC/10 ⁶The average of PMBC just is considered to significant if meet following condition: the average number that 1) contains cell in the hole of experimental peptide is significantly greater than the hole that contains control peptide (p＜0.05, student ' s T check); 2) clean SFCs/ hole (the average SFC number in the test peptides hole deducts the average SFC number in the control peptide hole) 〉=5 SFC/ holes; With 3) the stimulation index ratio of SFC number (in the average SFC number in the test peptides hole and the control peptide hole average) is greater than 2.0.In addition, if the cell that obtains before the immunity inoculation has positive reaction to aforesaid PfCSP-specific peptide, after the immunity inoculation this reaction with a kind of peptide just is not considered to male.

When being used for herein, " the reactor's frequency " among the IFN-γ ELISPOT is for the volunteer's of the positive test of particular peptide the number sum divided by volunteer in the test group." positive IFN-γ ELISPOT test frequency " is to the positive reaction number of the peptide sum divided by the test of carrying out for this peptide.For example, if everyone carries out the test of 6 kinds of peptides on one's body in 10 patients, total number measured is exactly 60.If 36 tests are male, the frequency of positive test is that the positive is arranged in 60 times 36 times so." intensity of IFN-gamma reaction " is represented by the number of SFC among each 1,000,000 PBMC.

At first dose and second dose of RTS, 1-2 week and 1,2 separate PBMC with 6 weeks and be used for ELISPOT mensuration afterwards before the S vaccine administration.In these are measured, PfCSP peptide (4 kinds of peptides that comprise 9 amino acid longs of I type HLA restricted epitope with PBMC and 8 kinds of regulations as described in example 2 above, the peptide of 4 kinds of 15-20 amino acid longs, every kind all comprises II type restricted epitope in back 4 kinds, wherein 3 kinds also comprise I type restricted epitope) and RTS, the set of 13 kinds of contained PfCSP peptides is incubated together in the S sequence.These peptides have also carried out further detailed description in embodiment 2 above.

The volunteer that DNA caused or do not cause is at RTS, and not having before the S immunity inoculation can detected PfCSP specificity IFN-gamma reaction.In the mensuration of only carrying out with the peptide that only contains 9 amino acid longs of I type MHC restricted epitope, any time after immunity inoculation does not all detect the IFN-gamma reaction.These are and identical peptide described in the embodiment 2.After the immunity first time, 6 PfCSP peptides to all 4 kinds of 15-20 amino acid longs IFN-gamma reaction that is positive is arranged in the volunteer that 10 DNA caused, and by contrast, in 14 volunteers that do not cause, have only 2 to a kind of such peptide IFN-gamma reaction (p=0.019) (table 1) that is positive.The reactor is at least a volunteer who reacts in these 4 kinds of peptides.In addition, the responder in the initiation group reacts to all 4 kinds of tested peptides, and the responder in the not initiation group is only to a kind of the reacting in 4 kinds of tested peptides.Experimenter's HBsAg antibody what state no matter, the response frequency in the DNA initiation group be significantly higher than in the not initiation group (positive test number of times/overall test number of times: 20/116[18.1%] to 4/164[2.4%], p=0.00001).

The sum frequency and the intensity of the IFN-gamma reaction of table 1 pair PfCSP specific peptide

Group	Responder number/testee's number	Positive test number/overall test number (%)	Clean SFCs/10 ⁶The scope of PBMcs (geometrical mean)
	Responder number/testee's number	Positive test number/overall test number (%)	Clean SFCs/10 ⁶The scope of PBMcs (geometrical mean)	The volunteer that DNA-caused	The volunteer who did not cause	The volunteer that DNA caused	The trouble person of hope who did not cause	P value between two groups	DNA causes the volunteer of the Liao Dynasty	The volunteer who did not cause
	For the first time after the immunity inoculation				The volunteer who did not cause	The volunteer that DNA caused	The trouble person of hope who did not cause	P value between two groups	DNA causes the volunteer of the Liao Dynasty	The volunteer who did not cause
HBsAg (+) HBsAg () adds up to	For the first time after the immunity inoculation				4/6(66.7) 2/4(50.0) 6/10(60.0) ^*	2/8(25.0) 0/66(0) 2/14(14.3) ^*	13/69(18.8) 7/47(14.9) 20/116(18.1)	4/95(4.2) 0/69(0) 4/164(2.4)	0.001 0.0009 ＜0.00001	13.1-105.5(38.5) 13.8-82.5(32.7) 13.1-105.5(36.3)	20.0-63.1 (39.6) 20.0-63.1 (39.6) that ignores
HBsAg (+) HBsAg () adds up to	For the second time after the immunity inoculation				4/6(66.7) 2/4(50.0) 6/10(60.0) ^*	2/8(25.0) 0/66(0) 2/14(14.3) ^*	13/69(18.8) 7/47(14.9) 20/116(18.1)	4/95(4.2) 0/69(0) 4/164(2.4)	0.001 0.0009 ＜0.00001	13.1-105.5(38.5) 13.8-82.5(32.7) 13.1-105.5(36.3)	20.0-63.1 (39.6) 20.0-63.1 (39.6) that ignores
HBsAg (+) HBsAg (-) adds up to	For the second time after the immunity inoculation				5/6(83.0) 3/4(75.0) 8/10(80.0)	6/8(75.0) 6/6(100.0) 11/14(84.6)	23/72(31.9) 18/48(37.5) 41/120(34.2)	11/84(13.1) 29/72(40.3) 40/156(25.6)	0.0078 0.76 0.12	11.9-82.5(32.1) 11.7-122.5(33.4) 11.7-122.5(32.6)	14.4-96.9(37.8) 17.5-125.6(41.0) 14.4-125.6(39.6)
HBsAg (+) HBsAg (-) adds up to	Totally				5/6(83.0) 3/4(75.0) 8/10(80.0)	6/8(75.0) 6/6(100.0) 11/14(84.6)	23/72(31.9) 18/48(37.5) 41/120(34.2)	11/84(13.1) 29/72(40.3) 40/156(25.6)	0.0078 0.76 0.12	11.9-82.5(32.1) 11.7-122.5(33.4) 11.7-122.5(32.6)	14.4-96.9(37.8) 17.5-125.6(41.0) 14.4-125.6(39.6)
HBaAg (+) HBsAg (-) adds up to	Totally				5/6(83.0) 3/4(75.0) 8/10(80.0)	6/8(75.0) 6/6(100.0) 11/14(84.6)	36/141(25.5) 25/95(26.3) 61/238(25.6)	15/179(8.4) 29/141(20.6) 44//320(13.8)	0.00003 0.3 0.0004	11.9-105.0(34.3) 11.7-1225(33.2) 11.7-122.5(33.9)	14.4-96.9(38.1) 17.5-125.6(41.0) 14.4-125.6(39.6)

^*For the first time after the immunity, in the volunteer that DNA caused reactor's number be significantly higher than reactor's number of not causing among the volunteer (6/10 pair 2/14, p=0.019).

For the second time use RTS, behind the S vaccine, 11 among in the volunteer that 10 DNA caused 8 and 14 volunteers that do not cause have detected IFN-gamma reaction (table 1).Although using second dose of RTS, two groups are not having difference (seeing positive test number/overall test number (%)) behind the S vaccine aspect the number of responder, but among the volunteer that DNA caused the total positives number of trials be significantly higher than statistically among the undischarged volunteer (positive test number of times/overall test number of times: 61/238[25.6%] to 44/320[13.8%], p=0.0004) (table 1).Frequency according to positive test is shown, and this species diversity in the total positives number of trials is directly related with volunteer's HbS Ag antibody situation.RTS for the second time, after the S immunity inoculation, among the volunteer that DNA caused in HBsAg antibody positive experimenter the number of positive test in the undischarged volunteer (23/72 [31.9%] to 11/84[13.1%], but then really not so in HbsAg negative antibody experimenter (3715% pair 40.3% positive test) p=0.0078).

At the IFN-gamma reaction of that caused and the group that do not cause of epitope levels comparison dna to peptide DR.316, DR.318 and DR.363.DR.316 and DR.318 comprise eclipsed CD4 ⁺And CD8 ⁺T cell epitope, DR.363 then only comprise CD4 ⁺T cell epitope (107).

As shown in the table 2, use first dose of RTS, behind the S vaccine, 4 IFN-gamma reactions that detected peptide DR.316 are arranged in the volunteer that 10 DNA caused, 14 undischarged volunteers then all reactionless (p=0.0095) use first dose and second dose of RTS, behind the S vaccine, 6 IFN-gamma reactions that detected peptide DR.316 are arranged in the volunteer that 10 DNA caused, and have 5 this reaction (p=0.35) is arranged among 13 undischarged volunteers.When all tests of overall consideration, (using first and second doses of RTS, behind the S vaccine), higher (the positive test number/overall test number of the positive test frequency of DNA initiation group, 17/60 pair 8/81, p=0.0046), but the intensity zero difference of IFN-gamma reaction (scope of SFC: 11.9-106.3[33.0] to 17.5-58.1[28.4], p=0.21).

Table 2 epitope levels is at the IFN-gamma reaction frequency of PfCSP

Group	Responder number/testee's number (%)	Positive test number/overall test number (%)
	Responder number/testee's number (%)	Positive test number/overall test number (%)	DR.316	DR.318	DR.363	DR.316	DR.318	DR.363
	For the first time after the immunity inoculation			DR.318	DR.363	DR.316	DR.318	DR.363
DNA caused and did not cause the P value	For the first time after the immunity inoculation			4/10(40) 0/14(0) 0.0095	3/10(30.0) 0/14(0) 0.028	3/10(30.0) 2/14(14.3) 0.35	6/30(20.0) 0/42(0) 0.0025	4/30(13.3) 0/42(0) 0.015	4/30(13.3) 2/42(4.8) 0.195
DNA caused and did not cause the P value	For the second time after the immunity inoculation			4/10(40) 0/14(0) 0.0095	3/10(30.0) 0/14(0) 0.028	3/10(30.0) 2/14(14.3) 0.35	6/30(20.0) 0/42(0) 0.0025	4/30(13.3) 0/42(0) 0.015	4/30(13.3) 2/42(4.8) 0.195
DNA caused and did not cause the P value	For the second time after the immunity inoculation			5/10(50.0) 5/13(38.5) 0.58	6/10(60) 1/13(7.7) 0.0069	2/10(20) 7/13(54) 0.099	11/30(36.7) 8/39(20.5) 0.136	10/30(33.3) 1/39(20.5) 0.00054	4/30(13.3) 16/39(41.0) 0.012
DNA caused and did not cause the P value	Totally			5/10(50.0) 5/13(38.5) 0.58	6/10(60) 1/13(7.7) 0.0069	2/10(20) 7/13(54) 0.099	11/30(36.7) 8/39(20.5) 0.136	10/30(33.3) 1/39(20.5) 0.00054	4/30(13.3) 16/39(41.0) 0.012
DNA caused and did not cause the P value	Totally			6/10(60) 5/13(38.5) 0.35	6/10(60) 1/13(7.7) 0.0069	4/10(40) 9/14(64) 0.24	17/60(28.3) 8/81(9.9) 0.0046	14/60(23.3) 1/81(1.2) ＜0.00003	8/60(13.3) 18/81(22.2) 0.178

In addition, as shown in table 2, use first dose of RTS, behind the S vaccine, in the volunteer that 10 DNA caused, there are 3 to detect to not containing the IFN-gamma reaction of DR.316 two amino acid whose peptide DR.318,14 undischarged volunteers then all reactionless (p=0.028), use first dose and second dose of RTS, behind the S vaccine, 6 IFN-gamma reactions that detected peptide DR.318 are arranged in the volunteer that 10 DNA caused, and have 1 this reaction (p=0.0069) is arranged among 13 undischarged volunteers.At first dose and second dose of RTS, the ELISPOT that carries out after the S vaccination measures and shows that totally the group that DNA caused has high positive test frequency (positive test number/overall test number, 14/60 pair 1/81, p＜0.00003).Consider and only accepting RTS in the group of S vaccine this peptide to be had only one reaction, therefore the intensity that can not relatively react.

Use first dose of RTS, behind the S vaccine, 3 IFN-gamma reactions that detected the peptide DR.363 that does not contain known CD8+T cell epitope are arranged in the volunteer that 10 DNA caused, and have 2 this reaction (p=0.35) is arranged among 14 undischarged volunteers, use first dose and second dose of RTS, totally 4 IFN-gamma reactions that detected peptide DR.363 are arranged in the volunteer that 10 DNA caused behind the S vaccine, and have 9 this reaction (p=0.24) (table 2) is arranged among 14 undischarged volunteers.At first dose and second dose of RTS, the mensuration of carrying out after S vaccination is finished shows the group that DNA caused and only applied RTS, between the group of S the positive test frequency do not have evident difference (positive test number/overall test number, 8/60 pair 18/81, p=0.178).But applying second dose of RTS, behind the S, among the undischarged volunteer intensity of IFN-gamma reaction be significantly higher than response strength among the volunteer that DNA caused (scope of SFC: 13.1-58.8[geometrical mean 26.4]/10 ⁶Individual cell is to 14.0-140.6[geometrical mean 47.9]/10 ⁶Individual cell, p=0.004).

Similarly, applying two doses of RTS, behind the S vaccine, DNA initiation group and only apply RTS, positive reaction experimenter's frequency zero difference (8/10 pair 11/13) in the group of S.See Table 1.Experimenter in the DNA initiation group is than only accepting RTS, and the volunteer of S vaccine responds to significantly more test peptides.Among the people that 8 respond in the volunteer that 10 DNA caused, the test peptides to all 4 kinds of 15-20 amino acid longs reacts, and 1 reacts to 3 kinds of peptides, and 5 react to two kinds of peptides, has only 1 a kind of peptide reacted.In 13 volunteers that do not cause among 11 people that respond, 1 reacts to 3 kinds of peptides, and 2 react to two kinds of peptides, and 8 only to a kind of peptide react (2/8 pair DR.316 respond and 6/8 couple of DR.363 responds).Generally speaking, 3 among 7 among the volunteer that caused of 8 DNA and 11 volunteers that do not cause are at least two kinds of tested peptides respond (p=0.0094).

Embodiment 4

T cell IFN-γ to HBsAg replys

RTS, S are the part of PfCSP and the fusion rotein of hbs antigen (HBsAg).Be used in the RTS in the adjuvant, S carries out immunity inoculation, and to bring out the efficient of t cell responses in the experimenter who carries anti-HBsAg antibody obviously lower.This effect is then much not remarkable in the volunteer that DNA caused.Because the state of HBsAg antibody has a significant effect to the replying of peptide of four kinds of 15-20 amino acid longs, we have expanded content of the test.By at RTS for the first time and for the second time, all test period points use one group 13 kinds PfCSP peptides (pPfCSP) and one group of 19 kinds of HBsAg peptide to carry out ELISPOT mensuration as mentioned above in PBMC simultaneously after the S immunity, compare the IFN-gamma reaction for PfCSP and HBsAg.In experimenter naivety, that cause without DNA, the HBsAg component for t cell responses be immunodominant (be 0/6 and be 6/6 to the PfCSP person of responding among the not initiation volunteer of HBsAg feminine gender to the HBsAg person of responding, among the male volunteer of initiation of HBsAg to the PfCSP person of responding be 1/8 and be 7/8 to the HBsAg person of responding), but the initiation of PfCSP DNA has seemed balance this immunodominance makes t cell responses towards PfCSP (table 3; Be 2/4 and be 2/4 to the PfCSP person of responding among the negative and volunteer that caused of HBsAg to the HBsAg person of responding, among the HBsAg positive and the volunteer that caused to the PfCSP person of responding be 4/6 and be 6/6 to the HBsAg person of responding).

The frequency and the intensity of IFN-gamma reaction between table 3 HBsAg seropositivity and the seronegative volunteer

^*The frequency of the IFN-gamma reaction of HBsAg and intensity are all obviously increased than immunity back for the first time in immunity back for the second time from the seropositive volunteer of the HBsAg of not initiation group, the P value is respectively 0.035 and 0.00003.

In the volunteer who did not cause, no matter whether they have anti-HBsAg antibody, and all experimenters have high IFN-gamma reaction (table 3 and 4 to HBsAg; Consult the volunteer who did not cause).As shown in table 3, applying first dose of RTS, behind the S vaccine, the experimenter who has had anti-HBsAg antibody is to the response strength of the HbsAg peptide set response strength (SFC/10 apparently higher than the experimenter who does not have these antibody ⁶The scope of PBMC [geometrical mean]: 13.1-222.9[60.1] to 13.1-132.5[33.9], p=0.013).But, at the RTS second time, behind the S vaccine immunity, the intensity of IFN γ has not just had difference (consulting the response strength data) between these two groups.With the RTS first time, compare behind the S vaccine immunity, RTS for the second time, behind the S vaccine immunity, the reaction to HBsAg among the HBsAg negative antibody experimenter significantly increases (table 3).Particularly, twice RTS, the frequency of positive test is 17/18 behind the S vaccine immunity, and RTS for the first time then is 9/15 (p=0.035) (seeing Table 3 footnote) after the S immunity.And the intensity of IFN-gamma reaction is 12.5-317.5[geometrical mean=97.3], only immunity IFN-gamma reaction intensity once is 13.1-132.5[geometrical mean=533.9] (p=0.024) (consult the footnote of table 3).RTS for the second time, after the S immunity, the number of the number of SFC SFC in the HbsAg antibody positive experimenter among the HbsAg negative antibody experimenter (12.5-317.5[97.3] to 20.0-278.8[62.3], p=0.013) (table 3).

As providing in the table 3, the IFN-gamma reaction of PfCSP is demonstrated and different mode to the reaction of HbsAg.A RTS behind the S vaccine immunity, has 13 HBsAg is responded among the volunteer that 14 were not caused, comprising 7 among the positive volunteer of 8 HBsAg and all negative volunteers of 6 HBsAg.On the contrary, have only 1 PfCSP reacted (p=0.0049) in these 14 experimenters, this name person of reacting is one of positive volunteers of 8 HBsAg, and the negative volunteers of all 6 HBsAg all do not have this reaction.Generally speaking, according to first and second doses of RTS, the reactor who detects after the S immunity and the frequency of positive test, RTS in all volunteers that do not cause with DNA, the IFN-gamma reaction to PfCSP that S brings out significantly is lower than the reaction to HBsAg that it brings out, in the experimenter who has originally had anti-HBsAg antibody even lower (table 3).Referring to p value for undischarged volunteer.Same, in HBsAg antibody positive (p＜0.05-0.0032) and among the negative antibody experimenter (p=0.0001), the intensity of IFN-gamma reaction also lower (table 3) after the immunity inoculation each time.The p value that partly marks referring to response strength in the table 3.These data confirm, in undischarged experimenter, RTS, S have caused to PfCSP with to the t cell responses of HBsAg, and the reaction of HBsAg significantly is better than reaction (table 4) to PfCSP.

DNA caused and the volunteer of HbsAg antibody positive in, first dose of RTS, after the S immunity to the number of the positive test of HBsAg be higher than number to the positive test of PfCSP (12/15 pair 4/15, p=0.0034) (table 3).But, using second dose of RTS, behind the S vaccine, in the volunteer of HBsAg antibody positive to the frequency of the positive test of PfCSP and frequency zero difference to the positive test of HBsAg.Consult the volunteer's who caused at DNA frequency data.DNA caused and the volunteer of HbsAg negative antibody in, these frequencies are at first dose and second dose of RTS, zero difference after the S vaccination.The what state of HbsAg antibody no matter, at first dose of RTS, the response strength to PfCSP and HbsAg after the S vaccination is similar (table 3).But DNA caused and the experimenter of HBsAg antibody positive in use second dose of RTS, behind the S, compare with response strength to PfCSP, the response strength of HBsAg is significantly increased (SFC/10 ⁶The scope of PBMC [geometrical mean]: 18.1-68.8[33.8] to 18.8-131.3[52.8], p=0.024).These results show, if use multi-agent RTS, the S vaccine is finally preponderated to the reaction that the reaction of HBsAg can be compared PfCSP.

Embodiment 5

Dna vaccination has brought out Tc1 (CD8 in human body ⁺) and Th1 (CD4 ⁺) the type reaction, and RTS, S have only brought out the Th1 reaction

Separately with the PfCSP dna vaccination or use RTS separately, the S vaccine can bring out the IFN-gamma reaction, so using second dose of RTS, behind the S vaccine, the IFN-gamma reaction is suitable (8/10 pair 11/14) (table 1) with regard to the reactor in two groups.But, report that separately with the PfCSP dna vaccination or use RTS separately, the vaccine-induced IFN-gamma reaction of S is decided with different T cell subsets as preceding.Dna immunization has been induced CD4 ⁺And CD8 ⁺T cell dependent type IFN-gamma reaction (107), and RTS, S has only induced CD4 ⁺T cell dependent type reaction (61).

Use from independent with DNA, use RTS separately, the volunteer of S immunity or from DNA initiation/RTS, the volunteer's that S strengthens PBMC characterizes by ELISPOT and the PCR in real time T cell spectrum to IFN-gamma reaction in external evoked phase and effector phase respectively.

Carry out the ELISPOT test with PBMC, before peptide is cultivated, using anti-CD4 ⁺Or anti-CD8 ⁺The Dynabeads M-450 of bag quilt (Dynal, Inc., Great Neck, NY) CD4 among the exhaustion PBMC ⁺Or CD8 ⁺The T cell.In the T of selective enrichment cell mass, measure IFN-γ mRNA expression: CD4 with PCR in real time ⁺/ CD45RA ⁺, CD4 ⁺/ CD45RA ^-, CD8 ⁺/ CD45RA ⁺And CD8 ⁺/ CD45RA-T cell.In these are measured, to have 3 * 10 in the complete RPMI culture medium of 2ml that contains 10% people AB serum ⁶The amount of individual cells/well is recovered frozen PBMC overnight incubation in 24 orifice plates, uses small peptide (9-10 aminoacid A2 peptide sequence GILGFVFTL then; SEQ IDNO.27) stimulated 2 hours, or stimulated 4 hours with long peptide (15-20 aminoacid), peptide concentration is 10 μ g/ml.Then, use MACS MultiSort test kit at CD8 ⁺Or CD4 ⁺T cell harvesting and enrichment PBMC make the CD4 of enrichment then ⁺Or CD8 ⁺The T cell is by CD45RAMicroBeads (Miltenyi Biotec, Auburn, CA) separation of C D45RA ⁺And CD45RA ^-Cell.

For quantitative to IFN-γ mRNA with PCR in real time, (Qiagen, Valencia CA) separate total RNA from the T cell subsets of enrichment with the RNeasy test kit.With hexamer and TaqMan reverse transcription test kit at random (PE Applied Biosystems, Foster City, CA) synthetic cDNA from total RNA.By PCR in real time IFN-γ mRNA is carried out relative quantification according to the description of manufacturer at ABI PRISM 7700 Sequence Detection instrument (Perkin-Elmer) TaqMan last week PCR test kits.Be designed for primer, probe and the reference material of amplification IFN-γ and GAPDH mRNA and carry out internal standardization.Upward by PCR in real time IFN-γ mRNA is carried out relative quantification according to the description of manufacturer at ABI PRISM7700 Sequence Detection instrument (Perkin-Elmer) with TaqMan PCR test kit.Be designed for primer (hIFN-g-F, TTGGTGATGATTTGAACATTGGA, the SEQ.ID.NO.28 of amplification IFN-g and GAPDH mRNA; HIFN-g-R, CCCAGTTCCTGCAGAGTAGAAAA, SEQ.ID.NO.29; HGAPDH-F, 5 ' GAAGGTGAAGGTCGGAGTC, SEQ.ID.NO.30; HGAPDH-R, GAAGATGGTGATGGGATTTC, SEQ.ID.NO.31), probe (hIFN-g probe: TGTCACTTGCAAACACACAGCTTGTCGAA, SEQ.ID.NO.32; HGAPDH probe: CAAGCTTCCCGTTCTCAGCC SEQ.ID.NO.33) and by the explanation of manufacturer undertaken internal standardization.All carry out the GAPDH amplification for each test specimen and explain the amount of the total RNA that adds each reaction and the difference of matter as endogenic contrast.Thermal cycle conditions is 50 ℃ of 2 minutes and 95 ℃ 10 minutes, carries out 2 step of 50 circulation PCR (95 ℃ 15 seconds and 60 ℃ 1 minute) then.All samples all increases with the three equal parts sample.Definite cycle threshold (Ct) with the horizontal negative correlation of said target mrna is such period, is increased to more than the threshold level in this period reporter molecule fluorescent emission.With GAPDH expression of gene value serves as that standardization is carried out to target gene expression between two different samples in the basis.

For which T cell subsets the induction period of identifying external IFN-gamma reaction relates to, the T cell mass after will exhausting before carrying out ELISPOT mensuration is incubated with the PfCSP peptide of qualification.Walk abreast, the peptide that PBMC is identical with being used for ELISPOT mensuration is incubated the back together and measures the mRNA expression of IFN-γ by PCR in real time in the enrichment subgroup of T cell mass, thereby understands the effector T cell of real secretion of gamma-IFN.Detection is to the reaction of peptide DR.363 (only containing the restricted CD4+T cell epitope of II type) and DR.316 (closing eclipsed I type and restricted CD4+ of II type and CD8+ epi-position), thereby relatively by the potential mechanism of different vaccine delivery systems at the IFN-gamma reaction of PfCSP.Also parallel simultaneously mensuration to, immundominance restricted and conservative CD8+T cell epitope and to reaction from the restricted CD4+T cell epitope of HLA-DR of tetanus toxin (TT-DR) from the HLA-A2 of influenza stroma protein (Flu M A2), thus the unified standard of the inherence between different epi-positions, test and the volunteer is provided.

To the IFN-gamma reaction of Flu M A2 peptide external evoked is CD8+T cell dependent type but not CD4+T cell dependent type, because exhausted CD8+ but not the CD4+T cell stops fully or significantly reduced all 17 the IFN-gamma reactions that tried in the individuality before PBMC faces cultivation, no matter they accept is that (Fig. 2 a) for which kind anti-malaria vaccine.On the contrary, in all 3 tested reactors, then be CD4+ but not (Fig. 2 b) of CD8+T cell dependent type fully for the reaction of peptide TT-DR.

T cell mass (CD4 with the detected 4 kinds of enrichments of PCR in real time ⁺/ CD45RA ⁺, CD4 ⁺/ CD45RA ^-, CD8 ⁺/ CD45RA ⁺And CD8 ⁺/ CD45RA ^-) in IFN-γ mRNA expression consistent with result available from ELISPOT test.After the stimulation of Flu M A2 peptide, mainly IFN-γ mRNA raises (Fig. 2 e: standard) in the CD8+T cell.IFN-γ mRNA expression improves 6.8 times (scopes, 3.4-12.9 doubly) in the CD8+T cell, by contrast, improved 2.2 times (scopes, 0.98-7.58 doubly) (p=0.03) in the CD4+T cell.The percentage rate that IFN-γ mRNA raises in the CD8+T cell surpasses in the CD4+T cell, average out to 78% (scope 62-99%).On the contrary, stimulate with TT-DR after mainly in the CD4+T cell IFN-γ mRNA raise (Fig. 2 e: standard).IFN-γ mRNA level is at CD4 ⁺Improve in the T cell 7.6 times (scope, 2.4-18.3), by contrast, at CD8 ⁺2.2 times (scope 1.1-4.6) have been improved in the T cell (p=0.02).CD4 ⁺The percentage rate that IFN-γ mRNA raises in the T cell surpasses CD8 ⁺In the T cell, average out to 79% (between 74-100%).These results show CD8 ⁺The T cell is the functional effect device at the IFN-gamma reaction of Flu M A2 peptide, and CD4 ⁺The T cell then is the effector at the TT-DR peptide.

By measuring abreast with above-mentioned two standards, we have illustrated with DNA PfCSP vaccine or RTS, the T cell spectrum at the IFN-gamma reaction of two kinds of different PfCSP peptides (DR.363 and DR.316) that S is vaccine-induced.Comprise the CD4+T cell epitope with DR.363 and do not contain the true consistent of CD8+T cell epitope and be, the ELISPOT measurement result of carrying out with the T cell mass after exhausting shows, only accepting PfCSP dna vaccination (2/2 testee, V1 and V5) or only accepted RTS, among the volunteer of S vaccine (6/6 testee), be (Fig. 2 c) of CD4+T cell dependent type fully to the IFN-gamma reaction of peptide DR.363.Measure discovery by ELISPOT, IFN-γ mRNA expression is relevant with T cell dependency in the T cell mass of enrichment.At PfCSP DNA and RTS, IFN-γ mRNA mainly raises (Fig. 2 e:DR.363) among the volunteer of S vaccine immunity in the CD4+T cell.In the tested person volunteer that 5 dna immunizations are crossed, IFN-γ mRNA level is at CD4 ⁺Improve in the T cell 5.3 times (scope, 2.6-11.5), by contrast, at CD8 ⁺1.7 times of (scope, 0.99-3.2) (p=0.01 4) have been improved in the T cell.At CD4 ⁺IFN-γ mRNA raises and surpasses CD8 in the T cell ⁺In the T cell, be 74% (scope, 64-91%).At 4 RTS, observe same pattern (Fig. 2 e) among the tested person volunteer that the S immunity is crossed, IFN-γ mRNA level is at CD4 ⁺Improve in the T cell 9.2 times (scope, 2.9-53.5), by contrast, at CD8 ⁺Improved in the T cell 0.9 times (scope, 0.6-1.1), at CD4 ⁺IFN-γ mRNA raises and surpasses CD8 in the T cell ⁺In the T cell, be 86% (scope, 73-98%).These results provide first-hand evidence, show except CD8+T cell dependent type IFN-gamma reaction, and DNA PfCSP vaccine has brought out the IFN-gamma reaction of the special and CD4+T cell dependent type of PfCSP in human body.

The IFN-gamma reaction of DR.316 (eclipsed CD4+ and CD8+T cell epitope) only accepting the PfCSP dna vaccination or only accepting RTS, is depended on the different subgroups of T cell among the volunteer of S vaccine.As former (107) reported, in the volunteer who only accepts DNA (V1) (Fig. 2 d) reaction be CD4+ be again (107) of CD8+T cell dependent type, by contrast, only accepting RTS, just CD4+ but not (volunteer of 3/3 tested person) (Fig. 2 d) of CD8+T cell dependent type of reaction then among the volunteer of S vaccine.In addition, IFN-γ mRNA raises (Fig. 2 e:DR.316) in the CD8+T cell in the volunteer of dna immunization, is again the CD8+T cell dependent type although the mensuration of ELISPOT demonstration reaction is CD4+.

IFN-γ mRNA expression is at CD8 ⁺Improve 64.7 times in the T cell, by contrast, at CD4 ⁺Improved 0.36 times in the T cell, at CD8 ⁺IFN-γ mRNA raises and surpasses CD4 in the T cell ⁺In the T cell, be 99.6%.On the contrary, at RTS, transcribing of IFN-γ mRNA mainly is at CD4 among the volunteer of S vaccine immunity ⁺Raise in the T cell (Fig. 2 e:DR.316).IFN-γ mRNA expression is at CD4 ⁺Improve 24.7 times (scopes, 5.3-176.7 is doubly) in the T cell, by contrast, at CD8 ⁺2.5 times (scopes, 1.1-5.6 doubly) have been improved in the T cell.At CD4 ⁺IFN-γ mRNA raises and surpasses CD8 in the T cell ⁺In the T cell, be 86% (scope, 69-98%).These results show, by dna immunization inoculation, CD4 ⁺The T cell is only related to CD8 in the external evoked interim of IFN-gamma reaction ⁺The T cell is the cell at the real secretion of gamma-IFN of DR.316.On the contrary, at RTS, among the experimenter of S vaccine immunity, these results show CD4 ⁺The T cell is at the effector T cell that produces IFN-γ with a kind of peptide (DR.316).

Embodiment 6

DNA-initiation/RTS, S have strengthened widening the composition that produces the T cell mass of IFN-γ

By RTS, the S vaccine is strengthened in the volunteer that DNA caused, and delineates out the composition of T cell mass of the generation IFN-γ of memory.With the PfCSP dna vaccination or only use RTS, among the volunteer of S vaccine immunity peptide DR.363 (is not contained CD8 only ⁺T cell epitope) IFN-gamma reaction is CD4 ⁺The T cell dependent type.The group that DNA caused detects the same type reaction to DR.363 at RTS in 2/3 responder (V1 and V5) after S strengthens.Surprising is, through RTS, after S strengthens, the response strength of estimating by IFN-γ mRNA expression in the CD4+T cell has improved 94.9 times in volunteer V1, in V5, improved 46.7 times, by contrast, after only with dna immunization 3 times, in V1, only increase by 7.6 times, and in V5, only increased by 12.5 times.See the pillar of " only using DNA " among Fig. 3.Compare with the postvaccinal situation of dna immunization, RTS, S have strengthened the intensity height that reacts among the V1 of back 12.5 times, and in V5 high 3.7 times of (Fig. 3; Post and " DNA/RTS, S " post of comparing " only using DNA ").

Only accept the PfCSP dna vaccination or only accept RTS, the volunteer of S vaccine is depended on different T cell subsets to the IFN-gamma reaction of peptide DR.316.DNA brings out be reflected at induction period be the CD4+T cell dependent type be again the CD8+T cell dependent type, but at effector phase CD8+T cell dependent type just then.When detecting effector phase, stimulating the back that the T cell mass is exhausted with peptide.On the contrary, the reaction that RTS, S bring out all is the CD4+T cell dependent type in induction period and effector phase then.Therefore, not surprisingly, the volunteer that DNA caused is at RTS, and it is separately with DNA or RTS to the reaction of DR.316 that S strengthens the back, the mixing of observed two kinds of patterns among the volunteer of S immunity (Fig. 2 d).

In the external evoked phase, RTS has detected the CD4 to DR.316 in 3/5 the responder after the S immunity (4/6 mensuration) for the first time ⁺And CD8 ⁺T cell dependent type IFN-gamma reaction.RTS has for the second time detected completely the CD4+T cell dependent type but the IFN-gamma reaction of portion C D8+T cell dependent type just in 4/6 the responder after the S immunity (7/12 time measure).Exhaust the CD8+T cell do not stop the generation of IFN-γ (Fig. 4 a) shows at RTS, after S strengthens, the same IFN-γ that produces of CD4+T cell with the CD8+T cell.Simultaneously, in effector phase, IFN-γ mRNA expression not only raises (8/8 responder) in the CD8+T cell, also (first time, RTS had 4/8 responder after the S immunity in rise in the CD4+T cell, after the immunity for the second time 6/8 responder is arranged), by contrast, in only with the volunteer of dna immunization, only in the CD8+T cell, raise, and only using RTS, only in the CD4+T cell, raise (Fig. 2 e: compare V1 (DNA) and V22 (RTS, S)) among the volunteer of S immunity with DR.316.

Generally speaking, using RTS, after S strengthens, the rise that has all detected IFN-γ mRNA in 6 CD8+ and the CD4+T cell is being arranged, in 8 responders at CD4 ⁺The scope that IFN-γ mRNA raises in the T cell is 3.0-28.3 doubly (geometrical mean is 6.6 times), at CD8 ⁺The scope that IFN-γ mRNA raises in the T cell is 4.0-281.03 doubly (geometrical mean is 19.7 times).The rise percentage rate of IFN-γ mRNA surpasses in the CD8+T cell in the CD4+T cell, be 23.5% (scope, 6.5-45.1%).Result herein proves, through RTS, after S strengthens, DR.316 specific C D4+T cell among the volunteer that DNA caused not only produces the t helper cell (feature of the inductive IFN-gamma reaction of DNA) of IFN-γ as the CD8+T cell, but also be the effector lymphocyte's (RTS, the feature of the inductive IFN-gamma reaction of S) (table 5) who produces IFN-γ.

Above data acknowledgement at DNA initiation-RTS, the CD8+T cell dependent type IFN-gamma reaction among the volunteer that S strengthens, but in undischarged volunteer, then do not have this reaction.These data have also confirmed the CD4 of same epi-position and CD8 dependent form IFN-gamma reaction.Based on the dependency of IFN-gamma reaction to different T cell subsets, peptide DR.316 is accredited as CD4 and the overlapping epi-position of CD8.

Table 4:RTS, the comparison of IFN-gamma reaction between the group that DNA caused and do not cause after the S immunity

The object of IFN-gamma reaction	Specific antigen PfCSP		Trunk antigen HBsAg
The object of IFN-gamma reaction	Specific antigen PfCSP		Trunk antigen HBsAg		The HBsAg serology at baseline place	HBsAg (+)	HBsAg (-)	HBsAg (+)	HBsAg (-)
The group that DNA caused					The HBsAg serology at baseline place	HBsAg (+)	HBsAg (-)	HBsAg (+)	HBsAg (-)
The group that DNA caused					After first dose of immunity	++	++	++	++
After second dose of immunity	++	++	++	++	After first dose of immunity	++	++	++	++
After second dose of immunity	++	++	++	++	The group that did not cause
After first dose of immunity	+/-	-	+++	+++	The group that did not cause
After first dose of immunity	+/-	-	+++	+++	After second dose of immunity	+	++	++++	++++

The standard of reactive score is based on the increase (p＜0.05) of the significance,statistical of relevant following factor: (1) reactor's frequency, (2) frequency of positive test, (3) compare the intensity of positive reaction with baseline, and the significance of (4) IFN-gamma reaction of comparing increases after immunity back for the second time and immunity for the first time.-, reactionless; +/-increases but not remarkable statistically; +, ++, +++and ++ ++ be illustrated respectively in 4 kinds of

standards

1,2,3 or 4 kind in remarkable increase.

Embodiment 7

Caused/RTS the antibody response among the volunteer that S strengthens at DNA

Using RTS, RTS before the S immunity and for the first time, 2,4,6 and 8 weeks and the antibody responses that detect anti-air dried Plasmodium falciparum zygoblast for the second time in 1,2,4 and 6 weeks of immunity back after the S immunity.(33) measure antibody titer with indirect fluorescent antibody test (IFAT) as previously mentioned.Just as expected, although antibody response has some variations, antibody titer still fabulous (Fig. 5) between group.At the RTS second time, tiring in 4 weeks after the S immunity reaches the highest, and geometric mean titer is between 5120-20480.But, except an exception, putting antibody titer at whole zygoblast does not at any time have significant difference on the statistics.Two weeks of back of immunity for the first time, at never received PfCSP and geometric mean titer with antibody that IFAT measures in the volunteer group of anti-HBsAg antibody (DNA-/HB+) is 3225, than accepting PfCSP and having geometric mean titer 718.4 height (p=0.02) among the volunteer of anti-HBsAg antibody (DNA+/HB+).This mainly be since in the DNA-/HB+ group volunteer's height tire and 10240 cause, he promptly just at the predetermined RTS second time, has withdrawed from this research before the S immunity after 6 weeks.At the RTS second time, the significant difference on the statistics does not appear between two groups after the S immunity.

Conclusion

At infection such as similar Plasmodium falciparum, mycobacterium tuberculosis and HIV effectively and can persistent developing vaccines process be proved slower, more difficult and complicated than what estimate.Above analytical proof of the present invention cause and with RTS, S strengthens can causing bringing out reaction by immune cell and humoral immunization with PfCSP DNA.And in the experimenter who carries anti-HBsAg antibody, those are using RTS with the experimenter that PfCSP caused, and have produced the significantly better t cell responses than the volunteer of never received PfCSP DNA behind the S Adjuvanted vaccines.Because immunity or infection, most of receiver of malaria vaccine or other vaccine has anti-HBsAg antibody, and this may provide considerable advantage for the immunization strategy that this initiation is strengthened.

This analysis demonstration is used RTS by 12-14 after DNA inoculates the last time in the time of individual month, and S strengthens, and the PfCSP specific CTL of having recalled the DNA initiation in 50% volunteer reacts, and shows that dna vaccination is very effective for bringing out long-lived memory-type t cell responses.At injection RTS, having behind the S has 2 not detect CTL after only with dna immunization among 5 volunteers that recall ctl response, explanation is carried out immunity for inducing memory-type CTL to have superiority with dna vaccination in these experimenters, but may then also not best (38,92) for the response facilitation effect t cell responses.Owing to only accepting RTS, do not detect ctl response among the not initiation volunteer of S, so RTS, S can not cause the PfCSP-specific CTL, but has the ability of strengthening the ctl response that dna vaccination caused.The PfCSP specificity IFN-gamma reaction that DNA causes is also by RTS, and S strengthens strongly, especially after first dose of immunity.There are 6 people to have IFN-gamma reaction among the volunteer that 10 DNA caused, and in the volunteer who did not cause, have only two people only a kind of the responding in 4 kinds of peptides at all 4 kinds of test peptides.Apply RTS twice, behind the S, although the frequency and the intensity of reaction do not have significant difference, the IFN-gamma reaction width of epitope levels is significantly greater than among the undischarged volunteer among the volunteer that DNA caused.There are 7 among the volunteer that 8 DNA caused, and have only 3 among 11 volunteers that do not cause at least 2 kinds of test peptides respond (p=0.0094).

The result has also shown DNA initiation/RTS, and S strengthens widening the composition of the T cell mass that produces IFN-γ.DNA causes the T cells spectrum of having opened two kinds of generation IFN-γ: (1) is at eclipsed CD4 ⁺/ CD8 ⁺The CD4 of t cell epitope (DR.316 and DR.318) ⁺T cell dependent type CD8 ⁺Class1 reaction and (2) are at the restricted CD4 of DR ⁺The CD4 of t cell epitope (DR.363) ⁺Class1 IFN-gamma reaction.On the other hand, use RTS separately, S has only brought out CD4 ⁺Class1 IFN-gamma reaction (Fig. 2).As for DR.316, a kind of eclipsed CD4 ⁺/ CD8 ⁺T cell epitope is used DNA separately and has been brought out CD4 at this peptide ⁺Dependent form CD8 ⁺The Class1 reaction, and use RTS separately, S has brought out the CD4 at this peptide ⁺The Class1 reaction.But, cause and use RTS with DNA, the IFN-gamma reaction (Fig. 4, table 4) at two kinds of patterns of DR.31 6 has been brought out in the S reinforcement simultaneously.In addition, RTS, S have stimulated the ctl response that causes the undetected new CTL epi-position in back at DNA.

The CD4+T cell may produce IFN-γ to the CD8+T cell and play onlooker's miscellaneous function.By stimulate at the external use peptide before the PBMC with afterwards after exhaustion or enrichment after the T cell mass in the parallel respectively ELISPOT that carries out measure and PCR in real time, above result has confirmed this hypothesis.Before or after peptide stimulates the cell number and relatively having sketched the contours of IFN-γ mRNA expression that produce IFN-γ are used dna vaccination separately and used RTS separately, the functional T cell spectrum that relates in the IFN-gamma reaction that the S vaccine brings out.

The results suggest here DNA cause can be with strengthened reaction orientation in the antigen that has caused.As if for using RTS, S carries out immunity, and this point is particularly important.With HBsAg as carrier design RTS, S, it can strengthen the reaction of T cell to malaria antigen PfCSP.The experimenter that baseline values carries anti-HBsAg antibody has used hepatitis b vaccination in advance.The anti-malaria vaccine expection of transmitting in the sub-Saharan Africa has such target colony, and this obvious Natural Exposure of target colony is in HBsAg or use the HBsAg immunity inoculation in advance.

Between the volunteer that DNA caused and do not cause relatively demonstrating in there has been the experimenter of anti-HBsAg antibody in those of the IFN-gamma reaction of PfCSP there is significant difference (table 1,3 and 5).With regard to each individuality the IFN-gamma reaction of HBsAg and PfCSP parallel relatively shown RTS in all volunteers who does not cause with DNA, the inductive IFN-gamma reaction to PfCSP of S significantly is lower than the reaction to HbsAg, has formerly existed among the experimenter of anti-HBsAg even lower.Although 13/14 contrast volunteer reacts to HBsAg after the S immunity at potion RTS, the IFN-gamma reaction of PfCSP is only detected among the people in 14 experimenters.On the other hand, in the volunteer that DNA caused to the antigenic reaction of trunk for inducing IFN-gamma reaction to have only faint influence or do not have influence to PfCSP, because using RTS, frequency and intensity that S strengthens between back HBsAg seropositivity and the seronegative experimenter the IFN-gamma reaction of PfCSP are suitable (tables 5).These results have confirmed that DNA causes t cell responses and makes it be oriented to specific antigen, and the immunity and the background of balance expectation are replied.Regardless of the serum reactivity of its anti-HBsAg, the IFN-gamma reaction that the volunteer that DNA caused is suitable with the two tool of HBsAg to PfCSP; Undischarged volunteer is significantly higher than reaction (table 4) to PfCSP to the IFN-gamma reaction of HBsAg.

The recombinant virus and the antibacterial that have considerable research to be devoted to produce recombinant fusion protein and to express target protein at present.In many cases, for HBsAg, vaccine, poliovirus and salmonella typhi (Salmonella typhi), will be had the antibody of anti-these vaccine trunk components that are pre-existing in by the individuality of immunity.In the experimenter of the antibody that carries anti-these vaccine trunk components (as HBsAg), compare with situation about causing with recombinant protein separately, DNA initiation with the coding target protein has significantly strengthened these proteinic t cell immune responses, and this fact may be this advantage that causes the immunization strategy of strengthening.

The T cell mass of table 5 antigenic specificity IFN-gamma reaction is formed

Peptide	Apply DNA separately	Apply RTS separately, S	DNA initiation/RTS, S strengthens
Peptide	Apply DNA separately	Apply RTS separately, S	DNA initiation/RTS, S strengthens	Flu M A2(CD8 ⁺The T epi-position)
Induction period	CD8+	CD8+	CD8+	Flu M A2(CD8 ⁺The T epi-position)
Induction period	CD8+	CD8+	CD8+	Effector phase	CD8+	CD8+	CD8+
TT-DR(CD4 ⁺The T epi-position)				Effector phase	CD8+	CD8+	CD8+
TT-DR(CD4 ⁺The T epi-position)				Induction period	CD4+	CD4+	CD4+
Effector phase	CD4+	CD4+	CD4+	Induction period	CD4+	CD4+	CD4+
Effector phase	CD4+	CD4+	CD4+	PfCSP DR.363(CD4 ⁺The T epi-position)
Induction period	CD4+	CD4+	CD4+	PfCSP DR.363(CD4 ⁺The T epi-position)
Induction period	CD4+	CD4+	CD4+	Effector phase	CD4+	CD4+	CD4+
PfCSP D is (eclipsed CD4 R.316 ⁺And CD8 ⁺The T epi-position)				Effector phase	CD4+	CD4+	CD4+
				Induction period	CD4+ and CD8+	CD4+	CD4+ and CD8+
Effector phase	CD8+	CD4+	CD8+ and CD4+	Induction period	CD4+ and CD8+	CD4+	CD4+ and CD8+

With DNA as vaccine carrier cause immunoreation can make initial t cell responses concentrate on recombinant immune former on, this only is because that is the unique foreign protein that is expressed in the dna vaccination.Although as vaccine carrier, reorganization RTS, S or poxvirus may have more immunogenicity than dna vector in essence, and the cell of viral infection can produce viral source epi-position many and the former competition of recombinant immune T cellular immunization advantage.Many experimenter's most probables of accepting vaccine are Natural Exposure overload isoantigen, or accepted in recombinant virus or protein, to contain this antigenic other vaccination, therefore antigenic effect reaction will be disturbed bringing out at the t cell responses of specific antigen at carrier.

In this research, by the immunization strategy that DNA initiation/recombinant protein is strengthened, antigenic specificity CD4+ accessory cell, CD8+T cell dependent type CTL and IFN-gamma reaction and Th1 type CD4+T cell dependent type IFN-gamma reaction in human volunteer, have been realized simultaneously.Two weapons of this strategy energy induction of immunity reaction are for preventative and therapeutic vaccine provide unique superiority.

The document that any part is mentioned among following publication and the application all is incorporated herein by reference especially at this:

1.Aguiar JC, Hedstrom RC, Rogers WO, Charoenvit Y, Sacci JB Jr, Lanar DE, Majam VF, Stout RR and Hoffman SL. utilize the Needleless jet device to strengthen immunne response (Enhancement of theimmune response in rabbits to a malaria DNA vaccine by immunizationwith a needle-free jet device) the .Vaccine 20:275-80 (2001) of rabbit to the malaria dna vaccination by immunity inoculation.

2.Aidoo, M., Lalvani, A., Allsopp, C.E., Plebanski, M., Meisner, S.J., Krausa, P., Browning, M., Morris Jones, S., Gotch, F., Fidock, D.A. etc., be used for determining (Identification of conserved antigenic components for a cytotoxic Tlymphocyte-inducing vaccine against malaria) .Lancet 345:1003 (1995) at the conservative antigen component of the cytotoxic T lymphocyte inductivity vaccine of malaria.

3.al Yaman, F., Genton, B., Anders, R., Falk M, Triglia T, Lewis, D. etc., to relation (the Relationship between humoral response toPlasmodium falciparum merozoite surface antigen-2 and malariamorbidity in a highly endemic area of Papua New Guinea) .Am.J.Trop.Med.Hyg.51:593 (1994) between the high local lesion of humoral response and Papua New Guinea malaria morbidity rate of Plasmodium falciparum merozoite surface antigen-2.

4.al Yaman, F., Genton, B., Anders R, Taraika J, Ginny M, Mellor S etc., with RESA and SPf66 compare at the humoral response of Plasmodium falciparum MSP2 effect (Assessment of the role of thehumoral response to Plasmodium falciparum MSP2 compared to RESAand SPf66 in protecting Papua New Guinean children from clinicalmalaria) the .Parsite Immunol 17:493 (1995) in the clinical malaria protection of Papua New Guinea child.

5.Anders RF; Crewther PE; Edwards S; Margetts M; Matthew ML; Pollock B, Pye D. carry out the immunoprotection mice with reorganization AMA-1 and avoid plasmodium infection (Immunisation with recombinant AMA-1 protects mice against infectionwith Plasmodium chabaudi) .Vaccine 16 (2-3): 240-7 (1998).

6.Barouch, D.H. etc. inoculate the control of Rhesus Macacus viremia and the prevention of clinical AIDS (Control of viremia and prevention ofclinical AIDS in rhesus monkeys by cytokine-augmented DNAvaccination) .Science 290,486-92. (2000) by the dna vaccination that cytokine increases.

7.Blackman, M.J., Heidrich, H.G., Donachie, S., McBride, J.S. and Holder, a single fragment of A.A. malaria merozoite surface protein is stayed on the parasite and is target (the A single fragment of a malariamerozoite surface protein remains on the parasite during red cell invasionand is the target of invasion-inhibiting antibodies) .J.Exp.Med.172:379 (1990) that suppresses the antibody of invading at erythrocyte between stage of invasion.

8.Bojang KA, Milligan PJ, Pinder M, Vigneron L, Alloueche A, Kester KE, Ballou WR, Conway DJ, Reece WH, Gothard P, Yamuah L, Delchambre M, Voss G, Greenwood BM, Hill A, McAdam KP, TornieporthN, Cohen JD, Doherty T; RTS, S Malaria Vaccine Trial Team. uses RTS in the adult man of Gambia's half immunity, the S/AS02 malaria vaccine is resisted the efficient of falciparum infection: a random experiment (Efficacy of RTS, S/AS02 malaria vaccine againstPlasmodium falciparum infection in semi-immune adult men in TheGambia:a randomised trial) .Lancet 358:1927-34 (2001).

9.Brazolot Millan CL, Weeratna R, Krieg AM, Sieg rist CA, DavisHL.CpG DNA can bring out in young mice at the strong Th1 body fluid of hepatitis B surface antigen and cell-mediated immunoreation (CpG DNA can induce strong Thl humoral andcell-mediated immune responses against hepatitis B surface antigen inyoung mice) .Proc Natl Acad Sci U SA.95:15553-8 (1998).

10.Burns; J.M.; Daly; T.M.; Vaidya; A.B. and Long, 3 ' of C.A. Plasmodium yoelii merozoite surface antigen encoding gene part epi-position (The 3 ' portion of the gene for a Plasmodium yoelii merozoite surfaceantigen encodes the epitope recognized by a protective monoclonalantibody) the .Proc.Natl.Acad.Sci.USA 5:602 (1988) of protectiveness monoclonal antibody identification that encoded.

11.Calarota, S. etc., cell-cytotoxic reaction (Cellular cytotoxic response induced by DNA vaccinationin HIV-1-infected patients) the .Lancet 351:1320-25 (1998) that the dna vaccination inoculation is brought out in the patient that HIV-1 infects.

12.Chang, S.P., Case; S.E.; Gosnell, W.L., Hashimoto; A.; Kramer, K.J., Tam; L.Q.; Hashiro, C.Q., Nikaido; C.M.; Gibson, H.L., Lee Ng; C.T.; Barr, P.J., Yokota; B.T. and Hut, the C-terminal fragment of the recombinant baculovirus 42KD of G.S. plasmodium falciparum merozoite surface proteins 4 and 5 white 1 protection douroucouli avoids malaria infection (A recombinant baculovirus 42-kilodalton C-terminal fragment ofPlasmodium falciparum merozoite surface protein 1 protects Aotusmonkeys against malaria) .Infect.Immun.64:253 (1996).

13.Charoenvit, Y., Leef, M.L., Yuan, L.F., Sedegah, M. and Beaudoin, R.L. is oriented to characteristic (the Characterization of plasmodium yoelii monoclonal antibodies directedagainst stage-specific sporozoite antigens) .Infect.Immun.55:604 (1987) of the antigenic plasmodium monoclonal antibody of phase specificity sporinite.

14.Charoenvit, Y., Collins; W.E., Jones, T.R.; Millet, P., Yuan; L., Campbell, G.H.; Beaudoin, R.L., Broderson; J.R. and Hoffman, the S.L. malaria vaccine can not be induced at the antibody of protective epitope in its sequence (Inability of malariavaccine to induce antibodies to a protective epitope within its sequence) .Science 251:668 (1991).

15.Charoenvit, Y., Mellouk, S., Cole, C., Bechara R. etc. Plasmodium yoelii: the hepatitis of molecular weight 17kD and erythrocyte stage albumen are target (Plasmoclium yoelii:17-kD hepatic and erythrocytic stage protein is thetarget of an inhibitory monoclonal antibody) the .Exp Parasitol.80:419-429 (1995) of inhibition monoclonal antibody.

16.Charoenvit; Y.; Fallarme Majam; V.; Corradin; G.P. etc., using from plasmodial and molecular weight is that the synthetic peptide of the proteic linearity of hepatocyte erythrocyte of 17kD carries out immunity CD4+T cell and IFN-dependent form protection (CD4+T-cell-andgamma interferon dependent protection against murine malaria byimmunization with linear synthetic peptide from plasmodium yoelii17-kilodaldon hepatocyte erythrocyte protein) .Infect.Immun.67:5604-5614 (1999) at the mice malaria.

17.Clark, J.T, Donachi S., Anand R. etc. are glycoprotein (46-53 kD glycoprotein from the surfaceof Plasmodium falciparum merozoites) the .Mol Biochem.32:15-24 (1988) of 46-53kD from Plasmodium falciparum merozoite surface and molecular weight.

18.Collins, W.E., Galland, G.G., Sullivan, J.S. and Morris, C.L. selects the plasmodium of different strains to be used for testing Peru's vaccine in douroucouli blood stage (Selection ofdifferent strains of Plasmodium falciparum for testing blood-stage vaccinesin Aotus nancymai monkeys) .Am.J.Trop.Med.Hyg.51:224-232 (1994).

19.Collins, W.E., Pye, D., Crewther, P.E., Vandenberg, K.L., Galland, G.G., Sulzer, A.J., Kemp, D.J., Edwards, S.J., Coppel, R.L., Sullivan, J.S., Morris, C.L. and Anders, the epidemic prevention (Protective immunity induced insquirrel monkeys with recombinant apical membrane antigen-1 ofPlasmo dium fragile) brought out Squirrel monkey with the reorganization teleblem antigen-1 of Plasmodium fragile of R.F..Am.J.Trop.Med.Hyg 51：711-719(1994)。

20.Daly; T.M. and Long; C.A., the reorganization carboxyl terminal fragment of the 15kD of Plasmodium yoelii yoelli17XL merozoite surface protein 1 has been brought out protective immunological reaction (Arecombinant 15-kilodalton carboxyl-terminal fragment of plasmodiumyoelii 17XL merozoite surface protein 1 induces a protective immuneresponse in mice) in mice.Infect.Immun.61：2462-2467(1993)。

21.Dame JB, Williams JL, McCutchan TF, Weber JL, Wirtz RA, Hockmeyer WT, Maloy WL, Haynes JD, SchneiderI, Roberts D etc., the structure of immundominance surface antigen encoding gene on people's malarial parasite Plasmodium falciparum sporinite (Structure of the gene encoding the immunodominant surface antigen onthe sporozoite of the human malaria parasite Plasmodium falciparum) .Science 225 (4662): 593-9 (1984).

22.Daubersies P, Thomas AW, Millet P, Brahimi K, LangermansJA, Ollomo B, BenMohamed L, Slierendregt B, Eling W, Van Belkum A, Dubreuil G, Meis JF, Guerin Ma rchand C, Cayphas S, Cohen J, Gras-Masse H, Druilhe P and Mohamed LB are with conservative proerythrocyte liver stage antigen 3 immune chimpanzee prevention Plasmodium falciparum malaria (Protection against Plasmodiumfalciparum malaria in chimpanzees by immunization with the conservedpre-erythrocytic liver-stage antigen 3) .Nat Med.6:1258-63 (2000).

23.Davis HL, Weeratna R, Waldschmidt TJ, Tygrett L, Schorr J, Krieg AM, Weeranta R. CpGDNA in reorganization hepatitis B surface antigen mice immunized is effective enhancer (CpG DNA is a potent enhancer ofspecific immunity in mice immunized with recombinant hepatitis B surfaceantigen) .J Immunol.160:870-6 (1998) of specific immune.

24.Deans, the parasitic preventative antigen of J.A. blood stage Plasmodium knowlesi (Protective antigens of blood stage plasmodium knowlesi parasites) .Philos.Trans.R.Soc.Lond.Biol. 307:159-169 (1984).

25.Deans, J.A., Knight, A.M., Jean, W.C., Waters, A.P., vaccination test (the Vaccination trials in rhesus monkeys with aminor that Cohen, S. and Mitchell, G.H. carry out with the 66kD merozoite antigen of less unconverted Plasmodium knowlesi in macaque, invariant, plasmo dium knowlesi 66 kD merozoite antigen) .ParasiteImmunol.10:535-552 (1988).

26.Delplace P, Bhatia A, Cagnard M et al. protein p126: the parasitophorous vacuole antigen relevant (Protein pl26:a parasitophorous vacuoleantigen associated with the release of Plasmodium falciparum merozoites) .Biol Cell64:215 (1987) with the Plasmodium falciparum merozoite.

27.Doolan, D.L., Sedegah, M., Hedstrom, R.C., Hobart, P., Charoenvit, Y. and Hoffman, S.L., the heredity of avoiding in the malaria prevention with the multiple gene DNA immunity inoculation limits: the immunity (Circumventing genetic restriction of protection against malaria withmulti-gene DNA immunization:CD8+T cell, interferon-gamma, andnitric oxide dependent immunity) that CD8+T cell, IFN-and nitric oxide rely on.J.Exp.Med.183：1739-1746(1996)。

28.Doolan, D.L., Hedstrom, R.C., Rogers, W.O., Charoenvit, Y., Rogers, M., De la Vega, P. and Hoffman, S.L., the identification and the evaluation (Identification and characterization of the protective hepatocyteerythrocyte protein 17kDa gene of plasmodium yoelii, homolog ofPlasmodium falciparum exported protein 1) of the homologue of the preventative hepatocyte erythrocyte of Plasmodium yoelii protein 17 kDa gene-Plasmodium falciparum output albumen 1.J. Biol.Chem.271：17861-17868(1996)。

29.Doolan, D.L, Hoffman, S.L., Southwood, S., Wentworth, P.A., Sidney, J., Chestnut, R.W., Keogh, E., Apella, E., Nutman, T.B., Lal, A.A., Gordon, D.M., Oloo, A. and Sette, A., the degenerated cell toxicity T cell epitope that HLA-A and HLA-B supertype allele are limited (Degeneratecytotoxic T cell epitopes from P.falciparum restricted by HLA-A andHLA-B supertypes alleles) from Plasmodium falciparum.Immunity 7：97-112(1997)。

30.Doolan DL, Hedstrom RC, Gardner MJ, Sedegah M, Wang H, GramzinskiRA, Margalith M, Hobart P and Hoffman SL inoculate dna vaccination as a method controlling malaria: present state and strategy (DNA vaccination as anapproach to malaria control:current status and strategies).Curr TopicMicrobiol Immunol226：37-56(1998)。

31.Doolan DL, Hoffinan SL. use antigen-specific adoptive immunity sexual needs IL-12 and NKI cell (the IL-12 and NK cells are required for antigen-specific adaptive immunityagainst malaria initiated by CD8+T cells in the Plasmodium yoelii model of CD8+T cell initiation at malaria in Plasmodium yoelii model.J.Immunol163(2)：884-92(1999)。

32.Egan, J.E., Weber, J.L., Ballou, W.R., Hollingdale, M.R., Majarian, W.R., Gordon, D.M., Maloy, W.L., Hoffman, S.L., Wirtz, R.A., Schneider, I., Woollett, G.R., Young, J.F. and Hockmeyer, W.T., the effectiveness of mice malaria sporinite vaccine: to the meaning (Efficacy of murine malariasporozoite vaccines:implications for human vaccine development) of people's vaccine development.Science 236：453-456(1987)。

33.Epstein J, Gorak E, Y Charoenvit, R Wang, N Freydberg, OOsinowo, TL Richie, E Stoltz, F Trespalacios, J Nerges, J Ng, VFallanne-Majam, E Abot, L Goh, S Parker, S Kumar, R Hedstrom, JNorman, R Stout, SL Hoffman., use the safety of antibody response behind the PfCSPDNA malaria vaccine by the injection of syringe needle or needle-free jet, tolerance and shortage, and the comparison (Safety, Tolerability and Lack of AntibodyResponses following Administration of a PfCSP DNA Mala ria Vaccine viaNeedle or Needle-free Jet Injection, and Comparison of Intramuscular andCombination Intramuscular/Intradennal Routes) of intramuscular and the interior combinatorial path of intramuscular/cortex.Human Gene Therapy13：1551-60(2002)。

34.Etlinger; H.M., Caspers, P.; Matile; H., Schoenfeld, H.J.; Stueber; D. and Takacs, B., reorganization or native protein protection monkey avoid the ability (Ability of recombinant or native proteins to protectmonkeys against heterologous challenge with Plasmodium falciparium) that the Plasmodium falciparum allosome is attacked.Infect.Immun.59：3498-3503(1991)。

35.Freeman; R.R. and Holder; A.A., the characteristic (Characteristics of theprotective response of BALB/c mice immunized with a purifiedplasmodium yoelii schizont antigen) of the protective response of the Plasmodium yoelii schizont antigen immune BALB/c mouse of usefulness purification.Clin.Exp.Immunol.54：609-616(1983)。

36.Gordon DM, McGovern TW, Krzych U, Cohen JC, Schneider I, LaChance R, Heppner DG, Yuan G, Hollingdale M, Slaoui M etc., the safety of Plasmodium falciparum circumsporozoite protein-hepatitis B surface antigen subunit vaccine that reorganization produces, immunogenicity and effectiveness (Safety, immunogenicity, and efficacy of a recombinantlyproduced Plasmodium falciparum circumsporozoite protein-hepatitis Bsurface antigen subunit vaccine).J lnfect Dis 171：1576-85(1995)。

37.Gramzinski RA, Maris DC, Doolan D, Charoenvit Y, Obaldia N, Rossan R, Sedegah M, Wang R, Hobart P, the malaria dna vaccination of Margalith M and Hoffman S. douroucouli (Malaria DNA vaccines in Aotus monkeys.Vaccine 15：913-915(1997)。

38.Gurunathan, S., Wu, C.Y., Freidag, B.L.﹠amp; Seder, R.A., dna vaccination: the means (DNA vaccines:a key for inducinglong-term cellular immunity) of bringing out long-term cellular immunity.Curr Opin Immunol12，442-7(2000)。

39.Harnyuttanakorn P, McBride JS, Donachie S, Heidrich HG, Ridley RG., the inhibition monoclonal antibody identification epi-position (Inhibitory monoclonal antibodies recognise epitopesadjacent to a proteolytic cleavage site on the RAP-1 protein of Plasmodiumfalciparum) in contiguous Proteolytic enzyme site on the Plasmodium falciparum RAP-1 albumen.Mol Biochem Parasitol.55：177-86(1992)。

40.Hedstrom R, Doolan D, immunogenicity (In vitro expression and in vivoimmunogenicity of Plasmodium falciparum pre-erythrocytic stage DNAvaccines) in the Wang R etc., the vivoexpression of Plasmodium falciparum proerythrocyte stage D NA vaccine and body.Int J Molec Med 2：29-38(1998)。

41.Herrington, D., Davis; J., Nardin, E.; Beier, M., Cortese; J., Eddy, H.; Losonsky, G., Hollingdale; M., Sztein, M.; Levine; M., Nussenzweig, R.S.; Clyde; D. and Edelman, R. carries out successfully immunity with the raying sporinite to the people: the body fluid of protected individuality and cell effect (Successful immunization ofhumans with irradiated sporozoites:humoral and cellular responses of theprotected individuals).Am.J Trop.Med.Hyg.45：539-547(1991)。

42.Hilgers LA, Snippe H, Jansze M, Willers JM., synthetic adjuvant is to the potentiation (Synergistic effects of synthetic adjuvants on thehumoral immune response) of humoral immune reaction.Int Arch Allergy Appl Immunol.79：392-6(1986)。

43.Hilgers LA, Snippe H, Jansze M, Willers JM., synthetic thioester polysaccharide: the new adjuvant of humoral immune reaction (Synthetic sulpholipopolysaccharides:noveladjuvants for humoralimmune responses).Immunology.60：141-6(1987)。

44.Hill AVS, Elvin J, Willis AC etc., the analysis of molecules (Molecular analysis of the association of HLA-B53 andresistancc to severe malaria) of getting in touch between HLA-B53 and the anti-serious malaria.Nature 360：434(1992)。

45.Hoffman, S.L. and Doolan, D.L. is oriented to infected hepatocellular malaria vaccine (Malaria vaccines-targeting infected hepatocytes).Nature Med.6：1218-19(2000)。

46.Holder, A.A. and Freeman, R.R. utilizes the immunity inoculation (Immunization against blood-stage rodentmalaria using purified parasite antigens) of the parasite antigen of purification at blood stage rodent malaria.Nature 294：361-364(1981)。

47.Horn NA, Meek JA, Budahazie G, Marquet M., utilize the cancer gene therapy of plasmid DNA: purify DNA is used for human clinical trial (Cancer Gene Therapyusing plasmid DNA:purification of DNA for human clinical trials).Human Gene Therapy 6(5)：565-73(1995)。

48.Inselburg, J., Bzik, D.J., Li, W.B., Green, K.M., Kansopon, J., Hahm, B.K., Bathurst, I.C., Barr, P.J.and Rossan, R.N., the epidemic prevention (Protective immunity inducedin Aotus monkeys by recombinant SERA proteins of Plasmodiurnfalciparum) that Plasmodium falciparum reorganization SERA albumen brings out in douroucouli.Infect.Immun.59：1247-1250(1991)。

49.Inselburg, J., Bathurst, I.C., Kansopon, J., Barchfeld, G.L., Ba rr, P.J. and Rossan, R.N., the epidemic prevention that Plasmodium falciparum reorganization SERA albumen brings out in douroucouli: to the inductive assosting effect of epidemic prevention (Protective immunity induced inAotus monkeys by a recombinant SERA protein of Plasmodiumfalciparum:adj uvant effects on induction of protective immunity).Infect.Immun.61：2041-2047(1993)。

50.Kedzierski L; Black CG and Coppel RL. carry out immunity inoculation protection mice with the Plasmodium yoelii merozoite surface protein 4/5 of recombinating and avoid deadly attack (Immunizationwith recombinant Plasmodium yoelii merozoite surface protein 4/5 protectsmice against lethal challenge).Infect Immun.68：6034-7(2000)。

51.Kensil CR, Patel U, Lennick M, Marciani D. is from Quillajasaponaria Molina cortex and have separation and qualitative (the Separation and characterization of saponins with adj uvant activity fromQuillajasaponaria Molina cortex) of the saponin of adjuvanticity.J Immunol.146：431-7(1991)。

52.Kensil C.R. is as the saponin (Saponins as vaccineadjuvants) of vaccine adjuvant.Crit Rev Ther Drug Carrier Syst，12：1-55(1996)。

53.Kester K.E., McKinney D.A., Tornieporth N, Ockenhouse C.F., Heppner D.G., Hall T., Krzych U., Delchambre M, Voss G, Dowler MG, Palensky J, Wittes J, Cohen J, Ballou WR; RTS, S malaria vaccine (the RTS of appraisal group, S Malaria Vaccine Evaluation Group), the effectiveness of the reorganization circumsporozoite protein vaccine method of anti-experimental character Plasmodium falciparum malaria (Efficacy of Recombinant CircumsporozoiteProtein Vaccine Regimens Against Experimental Plasmo dium falciparumMalaria).J lnfect Dis 183(4)：640-7(2001)。

54.Kester, K.E. etc., the effectiveness of the reorganization circumsporozoite protein vaccine method of anti-experimental character Plasmodium falciparum malaria (Efficacy of recombinant circumsporozoite protein vaccineregimens against experimental Plasmodium falciparum malaria).J.Infect.Dis.183：640-47(2001)。

55.Khusmith, S., Charoenvit, Y., Kumar, S., Sedegah, M., Beaudoin, R.L. and Hoffman, S.L. adds CS protein with sporinite surface protein 2 and carries out vaccination prevention of malaria (Protection against malaria by vaccination with sporozoite surfaceprotein 2 plus CS protein).Science 252：715-718(1991)。

56.Khusmith, S., Sedegah, M. and Hoffman, S.L., the adoptive transfer of cloning by the CD8+ cytotoxic T cell of identification sporinite surface protein 2 prevents the infection (Complete protection against Plasmodium yoelii by adoptivetransfer of a CD8+cytotoxic T cell clone recognizing sporozoite surfaceprotein 2) of Plasmodium yoelii fully.Infect.Immun.62：2979-2983(1994)。

57.Krieg AM, Yi AK, Matson S, Waldschmidt TJ, Bishop GA, Teasdale R, KoretzkyGA, Klinman DM., the CpG primitive in the DNA of bacteria trigger direct B cell activation (CpG motifs in bacterial DNA trigger direct B-cellactivation).Nature.374：546-9(1995)。

58.Kumar, S., Yadava, A., Keister, D.B., Tian, J.H., Ohl, M., Perdue Greenfield, K.A., Miller, L.H. and Kaslow, D.C. renders a service (Immunogenicity andin vivo efficacy of recombinant Plasmo dium falciparum merozoite surfaceprotein-1 in Aotus monkeys) in the immunogenicity of the plasmodium falciparum merozoite surface proteins 4 and 5 of recombinating white-1 and the body in douroucouli.Mol.Med.1：325-332(1995)。

59.Kumar S, Collins W, Egan A, Yadava A, Garraud O, BlackmanMJ, Patino JA, Diggs C, Kaslow DC. is based on immunogenicity and the effectiveness (Immunogenicity and Efficacy in Aotus monkeys of FourRecombinant Plasmodium falciparum Vaccines in Multiple AdjuvantFormulations Based on the 19-Kilodalton C Terminus of MerozoiteSurface Protein 1) of four kinds of recombinant plasmodium falciparum vaccines in douroucouli in the multiple auxiliary reagent of the 19kD end of merozoite surface protein 1.Infect Immun 68：2215-2223(2000)。

60.Lacaille-Dubois M and Wagner H. are about the summary (A review of the biological and pharmacological activities ofsaponins) of saponin biology and pharmaceutical active.Phytomedicine 2：363-386(1996)。

61.Lalvani A, Moris P, Voss G, Pathan A etc., utilize RTS, S/SBAS2-recombinant plasmodium falciparum malaria vaccine is induced the Th1 type cell and the humoral immunoresponse(HI) (Potent induction of focused Thl-Type cellular and humoral immuneresponses by RTS, S/SBAS2, a recombinant Plasmodium falciparummalaria vaccine) of focusing by force.J Infect Dis 180：1656-64(1999)。

62.Le T, Coonan K, Hedstrom R etc., malaria dna vaccination intramuscular is applied to safety, toleration and the humoral immune reaction (Safety behind the healthy adult volunteer, tolerability, and humoral immune responses after intramuscular administration of amalaria DNA vaccine to healthy adult volunteers).Vaccine 18：1893-1901(2000)。

63.Lee, A.Y. etc., be specific to quantitative (the Quantification of thenumber of cytotoxic T cells specific for an immunodominant HCV-specificCTL epitope primed by DNA immunization) that dna immunization is inoculated the cytotoxic T cell number of the immundominance HCV specific CTL epi-position that is caused.Vaccine 18：1962-68(2000)。

64.Luke CJ; Carner K; Liang X, Barbour AG. avoids the infection (An ospA-based DNA vaccine protectsmice against infection with Borrelia burgdorferi) of burgdorferi based on the dna vaccination protection mice of ospA.J lnf Dis 175：191-7(1997)。

65.Majarian WR, Daly TM etc. carry out passive immunity (Passive immunization against murine malaria with an IgG3monocloncal antibody) at the mice malaria with the IgG3 monoclonal antibody.J Immunol132：3131(1984)。

66.Malik, A., Egan, J.E., Houghten, R.A., Sadoff, J.C. and Hoffman, S.L. resists people's cytotoxic T lymphocyte (Humancytotoxic T lymphocytes against the Plasmodium falciparumcircumsporozoite protein) of Plasmodium falciparum circumsporozoite protein.Proc.Natl.Acad.Sci.USA 88：3300-3304(1991)。

67.Martin T, Parker SE, Hedstrom R etc., plasmid DNA malaria vaccine: the probability of gene integration after the intramuscular injection (Plasmid DNA malaria vaccine:thepotential for genomic integration following intramuscular injection).Human Gen Ther 10：759-68(1999)。

68.McCluskie MJ, Davis HL., CpG DNA are at the general of anti-hepatitis B surface antigen and effective enhancer of mucosal immunoreaction (CpG DNA is apotent enhancer of systemic and mucosal immune responses againsthepatitis B surface antigen with intranasal administration to mice) by intranasal administration.JImmunol.161：4463-6(1998)。

69.Moreno, A., Clavijo, P., Edelman, R., Davis, J., Sztein, M., Herrington, D. and Nardin, E., the volunteer's that immunity is crossed from sporinite cytotoxicity CD4+T cell recognition Plasmodium falciparum CS albumen (Cytotoxic CD4+T cells from asporozoite-immunized volunteer recognize the Plasmodiuna falcipafr umCS protein) .Int.Immunol.3：997-1003(1991)。

70.Mosmann, T.R. and Coffman, R.L., TH1 and TH2 cell: the different mode of lymphokine secretion has caused different functional characteristic (TH1 and TH2 cells:differentpatterns of lymphokine secretion lead to different functional properties).Ann.Rev.ofImmunol.7：145-173(1989)。

71.Musti, A.M., Zehner, Z., Bostian, K.A., Paterson, B.M. and Kramer, R.A. separates and the two primary yeast gene transcription location (Transcriptional mapping of two yeast genescoding for glyceraldehyde 3-phosphate dehydrogenase isolated by sequencehomology with the chicken gene) of encoding glycerol aldehyde 3-phosphate dehydrogenase with chicken dna homolog sequence.Gene 25：133-143(1983)。

72.Oeuvray C, Bouharoun Tayoun H, Gras Masse H etc., merozoite surface protein 3: a kind of malaria protein of inducing antibody, strengthen killing Plasmodium falciparum (Merozoite surface protein-3:a malaria protein inducingantibodies that promote Plasmodium falciparum killing by cooperationwith blood monocytes) with the blood mononuclear cell cooperation.Blood 84：1594(1994)。

73.Oeuvray C, Bouharoun Tayoun H, Gras Masse H etc., the new merozoite surface antigen (MSP-3) of Plasmodium falciparum, cell-antibody coordination mechanism antigenicity and biological activity identification (A novel merozoite surface antigen of Plasmodiumfalciparum (MSP-3), identified by cellular-antibody cooperativemechanism antigenicity and biological activity of antibodies) by antibody.Mem InstOswaldo Cruz Supp2：77(1994)。

74.Panina-Bordignon P, Tan A, Termijtelen A, Demotz S, CorradinG, Lanzavecchia A., general immunogenicity t cell epitope: mix with people II MHC and to combine and by the indiscriminate identification of T cell (Universally immunogenic T cell epitopes:promiscuous binding to human MHC class II and promiscuous recognitionby T cells).Eur J lmmunol12：2237-42(1989)。

75.Parker SE, Borellini F, Wenk ML etc., plasmid DNA malaria vaccine: tissue distribution in mice and rabbit and safety research (Plasmid DNA malaria vaccine:tissue distribution and safety studies in mice and rabbits).Human Genether 10(5)：741-58(1999)。

76.Perrin, L.H., Dayal, R. and Rieder, H., from people's immune serum reaction the erythrocyte stage Plasmodium falciparum antigenic characteristic (Characterization of antigens fromerythrocytic stages of Plasmodium falciparum reacting with humanimmune sera).Trans.R.Soc.Trop.Med.Hyg 75：163-165(1981)。

77.Perrin, L.H., Ramirez, E., Lambert, P.H. and Miescher, P.A. suppresses pernicious plasmodial growth (Inhibition of P.falciparumgrowth in human erythrocytes by monoclonal antibodies) in the human red blood cell with monoclonal antibody.Nature 289：301-303(1981)。

78.Potocnjak; P.; Yoshida; N.; Nussenzweig; R.S. and Nussenzweig, V. avoids malaria infection (Monovalent fragments (Fab) of monoclonal antibodiesto a sporozoite surface antigen (Pb44) protect mice against malariainfection) at unit price fragment (Fab) the protection mice of the monoclonal antibody of sporinite surface antigen (Pb44).J.Exp.Med.151：1504-1513(1980)。

79. protein-structure and molecular characterization, second edition (Proteins-Structure andMolecular Properties), 2nd Ed., T.E.Creighton, W.H.Freeman andCompany, New York, 1993.

80.Ramasamy R., the research (Studies on glycoproteins inthe human malaria parasite Plasmodium falciparum-lectin bindingproperties and the possible carbohydrate-protein linkage) that the glycoprotein in people's malarial parasite Plasmodium falciparum-lectin binding characteristic and possible sugar-protein are connected.Immunol CellBiol 65：147(1987)。

81.Ramasamy RJ, Jones G, Lord R., the inhibition monoclonal antibody limits the characteristic (Characterization of an inhibitory monocloncalantibody defined epitope on a malaria vaccine candidate antigen) of epi-position on the malaria vaccine candidate antigens.Immunol Lett 23：305(1990)。

82.Rattan etc., protein synthesis: post translational modification and aging (Protein Synthesis:Post-translational Modifications and Aging).Ann NY Acad Sci 663：48-62(1992)。

83.Remington pharmacopedics, the 18th edition (Remington ' s PharmaceuticalSciences), 18th Edition (A.Gennaro edits, Mack Pub., Easton, Pa., 1990).

84.Ridley RG; Takacs B; Etlinger H, Scaife JG., the clava antigen of Plasmodium falciparum in Squirrel monkey, shield (A rhoptry antigen of Plasmodiumfalciparum is protective in Saimiri monkeys).Parasitology 101：187-92(1990)。

85.Rodrigues, M.M., Cordey, A.-S., Arreaza, G., Corradin, G., Romero, P., Maryanski, J.L., Nussenzweig, R.S. and Zavala, F. is at the CD8+ cytotoxic T cell clone prevention of malaria (CD8+cytolyticT cell clones derived against the Plasmodium yoelii circumsporozoiteprotein protect against malaria) of Plasmodium yoelii circumsporozoite protein.Int.Immunol.3：579-585(1991)。

86.Rogers; W.O. etc., cause strengthening vaccine at the former allos of the multistage multi-resistance of Plasmodium knowlesi malaria and provide partly protection (Multistage multiantigen heterologousprime boost vaccine for Plasmodium knowlesi malaria provides partialprotection in rhesus macaques) for Rhesus Macacus.Infect Immun 69：5565-72(2001)。

87.Romero, P., Maryanski, J.L., Corradin, G., Nussenzweig, R.S., Nussenzweig, V. with Zavala F., epi-position in clone's the cytotoxic T cell identification ring sporozoite protein and prevention of malaria (Cloned cytotoxic T cells recognize an epitope in thecircumsporozoite protein and protect against malaria).Nature 341：323-325(1989)。

88.Saul A, Lord R, Jones GL etc., the preventative immunity of carrying out with the constant peptide of Plasmodium falciparum antigen MSA2 (Protective immunization with invariant peptides ofthe Plasmodium falciparum antigen MSA2).J Immunol 148：208(1992)。

89. Schofield L, Bushell GR, Cooper JA etc., the clava antigen of Plasmodium falciparum have comprised the conservative and variable epi-position (A rhoptry antigen ofPlasmodium falciparum contains conserved and variable epitopesrecognised by inhibitory monoclonal antibodies) of inhibition monoclonal antibody identification.Mol Biochem Parasitol.18：183-95(1986)。

90.Schofield L, Villaquiran J, Ferreira A etc., at the required IFN-of the immunity of malaria sporinite, CD8+T cell and antibody (Gamma-interferon, CD8+Tcells and antibodies required for immunity to malaria sporozoites).Nature.330：664-666(1987)。

91.Sedegah, M. etc., by based on the inductive improved epidemic prevention of the immunity inoculation of DNA: cause and with the recombinant poxvirus reinforcement (Improving protective immunity induced by DNA-basedimmunization:priming with antigen and GM-CSF-encoding plasmid DNAand boosting with antigen-expressing recombinant poxvirus) of antigen expressed with the plasmid DNA of antigen and coding GM-CSF.J Immunol164：5905-12(2000)。

92.Seder, R.A.﹠amp; Hill, A.V. is at the vaccine that infects in the cell that needs cellular immunity (Vaccines against intracellular infections requiring cellularimmunity).Nature 406，793-8.(2000)。

93.Seguin MC, Klotz FW, Schneider I, Weir JP, Goodbary M, Slayter M etc., the mice that helps to be exposed in the raying Bai Shi plasmodium infection mosquito of inducing of nitricoxide synthase is resisted malaria (Induction of nitric oxide synthase protects againstmalaria in mice exposed to irradiated Plasmodium berghei infectedmosquitoes:involvement of interferon gamma and CD8+T cells).J ExpMed 180：353-358(1994)。

94.Seifter etc., the analysis of protein modification and non-albumen cofactor (Analysis forprotein modifications and nonprotein cofactors).Meth Enzymol 182：626-646(1990)。

95.Shi, Y.P., Sayed, U., Qari, S.H., Roberts, J.M., Udhayakumar, V., Oloo, A.J., Hawley, W.A., Kaslow, D.C., Nahlen, B.L. and Lal, A.A. is at the natural immunity reaction (Natural immune response to the C-terminal 19-kilodalton domain ofPlasmodium falciparum merozoite surface protein 1) of the C-terminal 19kD domain of the white l of plasmodium falciparum merozoite surface proteins 4 and 5.Infect.Inamun.64：2716-2723(1996)。

96.Siddiqui, W.A., Tam, L.Q., Kramer, K.J., Hui, G.S., Case, S.E., Yamaga, K.M., Chang, S.P., Chan, E.B. and Kan, S.C., merozoite pan coating precursor protein have prevented douroucouli to suffer from Plasmodium falciparum malaria (Merozoite surface coatprecursor protein completely protects aotus monkeys against Plasmodumfalciparum malaria) fully.Proc.Natl.Acad.Sci.USA 84：3014-3018(1987)。

97.Sim BKL, Orlan di PA, Haynes JD etc., the primary structure of the Plasmodium falciparum erythrocyte binding antigen of 175K and the identification (Primary structure of the 175K Plasmodium falciparum erythrocytebinding antigen and identification of a peptide which eleicits antibodiesthat inhibit malaria merozoite invasion) that causes the peptide of the antibody that suppresses the invasion of malaria merozoite.J Cell Biol III：1877(1990)。

98.Sim BKL, Chitnis CE, Deal CD etc., Plasmodium falciparum: further qualitative (the Plasmodium falcipaum:furthercharacterization of a functionally active region of the merozoite ligandEBA-175) in the functional activity district of merozoite aglucon EBA-175.78：259(1994)。

99.stoute JA, Slaoui M, Heppner DG etc., the preliminary study of the ring sporinite vaccine of anti-plasmodium falciparum malaria (A preliminary evaluation of a recombinantcircumsporozoite protein vaccine against Plasmodium falciparummalaria).N Eng J Med 336：86-91(1997)。

100.Stoute JA, Kester KE, Krzych U etc. use RTS, long-term efficacy after the immunity of S malaria vaccine and immunoreation (Long-term efficacy and immune responses followingimmunization with the RTS, S malaria vaccine).J Infect Dis 178：1139-44(1998)。

101.Thomas AW, Trape JF, Rogier C, Goncalves A, RosarioVE, Narum DL., utilize the baculovirus reorganization PF83/AMA-1 of total length to catch-enzyme-connection immunosorbent assay detects the high universality (High prevalence of natural antibodies againstPlasrnodium falciparum 83-kilodalton apical membrane antigen (PF83/AMA-1) as detected by capture-enzyme-linked immunosorbentassay using full-length baculovirus recombinant PF83/AMA-1) of natural antibody of the teleblem antigen (PF83/AMA-1) of anti-plasmodium falciparum 83kD.Am JTrop Med Hyg 51：730-40(1994)。

102.Thomas AW, Narum D, Waters AP, Trape JF, RogierC, Goncalyes A, Rosario V, Druilhe P, Mitchell GH, Dennis D. is at the immunity overview (Aspects of immunity forthe AMA-1 family of molecules in humans and non-human primatesmalarias) of AMA-1 family molecule in people and the non-human primates malaria.Mem Inst Oswaldo Cruz 89 Suppl 2：67-70(1994)。

103.Valenzuela, P., Gray, P., Quiroga, M. etc., the nucleotide sequence of hepatitis B surface antigen major protein encoding gene (Nucleotide Sequences of the Gene Codingfor the Major Protein of Hepatitis B Virus Surface Antigen).Nature 280：815-819(1979)。

104.Wang, R., Charoenvit, Y., Corradin, G., De la Vega, P., Franke, E.D. and Hoffman, S.L. induces infected hepatocellular CD4+T cell and IFN-γ dependent form to eliminate prevention of malaria (Protectionagainst malaria by Plasmodium yoelii sporozoite surface protein 2 linearpeptide induction of CD4+T cell-and IFN-gamma-dependent eliminationof infected hepatocytes) by Plasmodium yoelii sporinite surface protein 2 linear peptides.J.Immunol. 157：4061-4067(1996)。

105.Wang, R., Doolan, D.L., Le, T.P., Hedstrom, R.C., Coonan, K.M., Charoenvit, Y., Jones, T.R., Hobart, P., Margalith, M., Ng, J., Weiss, W.R., Sedegah, M., de Taisne, C., Norman, J.A. and Hoffman, S.L. brings out antigen-specific cytotoxic T lymphocyte (Induction ofantigen-specific cytotoxic T lymphocytes in humans by a malaria DNAvaccine) with the malaria dna vaccination in human body.Science 282：476-480(1998)。

106.Wang R, Doolan DL, Charoenvit Y, Hedstrom RC, Gardner MJ, Hobart P, Tine J, Sedegah M, Fallarme V, Sacci JB Jr, Kaur M, KlinmanDM, Hoffman SL, Weiss WR. carries out immunity by the mixture with four kinds of Plasmodium falciparum DNA plasmids and bring out multiple antigenic specificity cell toxicity T lymphocyte (Simultaneous induction of multiple antigen-specific cytotoxic Tlymphocytes in nonhuman primates by immunization with a mixture offour Plasmzodium falciparum DNA plasmids) simultaneously in non-human primates.Infect Immun 66：4193-202(1998)。

107.Wang R, Epstein J, Baraceros FM, Gorak EJ, Charoenvit Y, Carucci DJ, Hedstrom RC, Rahardjo N, Gay T, Hobart P, Stout R, JonesTR, Richie TL, Parker SE, Doolan DL, Norman J, Hoffman SL. brings out CD4 (+) T cell dependent type CD8 (+) 1 type reaction (Induction of CD4 (+) T cell-dependent CD8 (+) type 1 responses inhumans by a malaria DNA vaccine) with the malaria dna vaccination in human body.PNAS-USA 98(19)：10817-22(2001)。

108.Weiss WR, Sedegah M, Beaudoin RL, Miller LH, Good MF. needs CD8+T cell (cytotoxicity/mortifier) (CD8+T cells (cytotoxic/suppressors) are required for protection inmice immunized with malaria sporozoites) in the preventative immunity of mice being carried out with the malaria sporinite.PNAS-USA.85(2)：573-6(1988)。

109.Weiss WR, Berzofsky JA, Houghten RA, Sedegah M, HollindaleM, Hoffman SL. is oriented to the T cell clone (A T cell clone directed at the circumsporozoiteprotein which protects mice against both Plasmodium yoelii andPlasmodium berghei) of preventing mouse infection Plasmodium yoelii and the plasmodial circumsporozoite protein of Bai Shi.J Immunol 15；149(6)：2103-9(1992)。

110.WHO Report. world vaccine and immune present situation (State of the World ' sVaccines and Immunization).Geneva：World Health Organization.(1996)。

111.Wizel, B., Rogers, W.O., Houghten, R.A., Lanar, D.E., Tine, J.A. and Hoffman, S.L. is at induce (the Induction of murine cytotoxic T lymphocytes againstPlasmodium falciparum sporozoite surface protein 2) of the mouse cell toxic T lymphocyte of Plasmodium falciparum sporinite surface protein 2.Eur.J.Immunol.24：1487-1495(1994)。

112.Wizel, B., Houghten, R., Church, P., Tine, J.A., Lanar, D.E., Gordon, D.M., Ballou, W.R., Sette, A.and Hoffman, S.L., HLA-A2 restrictive cell toxic T lymphocyte react (HLA-A2-restricted cytotoxic T lymphocyte responsesto multiple Plasmodium falciparum sporozoite surface protein 2 epitopesin sporozoite-immunized volunteers) with multiple pernicious malaria sporinite surface protein 2 epi-positions in the volunteer of sporinite immunity.J.Immunol.155：766-775(1995)。

113.Wold, F., proteinic post translational modification: prospect and prospect, 1-12, proteinic translation back covalent modification (Post-translational Protein Modifications:Perspectivesand Prospects, 1-12, in Post-translational Covalent Modification ofProteins), B.C.Johnson, Ed., Academic Press, New York, 1983.

114.Yang C, Collins WE, Sullivan JS etc. carry out the blood stage infection (Partial protection against Plasmodiumvivax blood-stage infection in Saimiri monkeys by immunization with arecombinant C-terminal fragment of merozoite surface protein 1 in blockcopolymer adjuvant) of immunity local prevention Plasmodium vivax in Squirrel monkey with the recombinant C terminal fragment of the merozoite surface protein 1 in the retardancy copolymer adjuvant.Infect Imm 267：342(1999)。

115.Zinsser Microbiology 1180-83 (D.Bernard Amos and Catherine M.Wilfert edit for Wolfgang K.Joklik, Hilda P.Willett, and the 20th edition, Appletonand Lange 1992).

Apparent other embodiment of the present invention of those skilled in the art in detailed description of the present invention of Gong Buing and the practice from here.Description and embodiment all only play illustrative explanation, and following claim has just been pointed out the scope and spirit that the present invention is real.

Sequence table

＜110〉GlaxoSmithKline Biological Co., Ltd (GLAXOSMITHKLINE BIOLOGICALS, S.A.)

The United States of America (THE UNITED STATES OF AMERICA REPRESENTED BY THESECRETARY OF THE NAVY) by Secretary of the Navy's representative

＜120〉methods for vaccinating against malaria

<130>04012.0374-00304

<140>

<141>

<150>60/447，026

<151>2003-02-13

<150>60/420，265

<151>2002-10-23

<160>33

<170>PatentIn Ver.2.1

<210>1

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>1

Tyr Leu Asn Lys Ile Gln Asn Ser Leu

1 5

<210>2

<211>10

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>2

Glu Pro Ser Asp Lys Hi s Ile Lys Glu Tyr

1 5 10

<210>3

<211>10

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>3

Val Thr Cys G Ly Asn Gly Ile Gln Val Arg

1 5 10

<210>4

<211>8

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>4

Lys Pro Lys Asp Glu Leu Asp Tyr

1 5

<210>5

<211>20

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>5

Ile Lys Glu Tyr Leu Asn Lys Ile Gln Asn Ser Leu Ser Thr Glu Trp

1 5 10 15

Ser Pro Cys Ser

20

<210>6

<211>14

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>6

Glu Tyr Leu Asn Lys Ile Gln Asn Ser Leu Ser Thr Glu Trp

1 5 10

<210>7

<211>21

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>7

Asp Ile Glu Lys Lys Ile Cys Lys Met Glu Lys Cys Ser Ser Val Phe

1 5 10 15

Asn Val Val Asn Ser

20

<210>8

<211>20

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>8

Ile Lys Pro Gly Ser Ala Asn Lys Pro Lys Asp Glu Leu Asp Tyr Ala

1 5 10 15

Asn Asp Ile Glu

20

<210>9

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>9

Asn Glu Glu Pro Ser Asp Lys His Ile Lys Glu Tyr Leu Asn Lys

1 5 10 15

<210>10

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>10

Asp Lys His Ile Lys Glu Tyr Leu Asn Lys Ile Gln Asn Ser Leu

1 5 10 15

<210>11

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>11

Glu Tyr Leu Asn Lys Ile Gln Asn Ser Leu Ser Thr Glu Trp Ser

1 5 10 15

<210>12

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>12

Ile Gln Asn Ser Leu Ser Thr Glu Trp Ser Pro Cys Ser Val Thr

1 5 10 15

<210>13

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>13

Ser Thr Glu Trp Ser Pro Cys Ser Val Thr Cys Gly Asn Gly Ile

1 5 10 15

<210>14

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>14

Pro Cys Ser Val Thr Cys Gly Asn Gly Ile Gln Val Arg Ile Lys

1 5 10 15

<210>15

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>15

Cys Gly Asn Gly Ile Gln Val Arg Ile Lys Pro Gly Ser Ala Asn

1 5 10 15

<210>16

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>16

Gln Val Arg Ile Lys Pro Gly Ser Ala Asn Lys Pro Lys Asp Glu

1 5 10 15

<210>17

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>17

Pro Gly Ser Ala Asn Lys Pro Lys Asp Glu Leu Asp Tyr Glu Asn

1 5 10 15

<210>18

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>18

Lys Pro Lys Asp Glu Leu Asp Tyr Glu Asn Asp Ile Glu Lys Lys

1 5 10 15

<210>19

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>19

Leu Asp Tyr Ala Asn Asp Ile Glu Lys Lys Ile Cys Lys Met Glu

1 5 10 15

<210>20

<211>16

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>20

Asp Ile Glu Lys Lys Ile Cys Lys Met Glu Lys Cys Ser Ser Val Phe

1 5 10 15

<210>21

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>21

Ile Cys Lys Met Glu Lys Cys Ser Ser Val Phe Asn Val Val Asn

1 5 10 15

<210>22

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>22

Gly Ile Leu Gly Phe Val Phe Thr Leu

1 5

<210>23

<211>22

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>23

Phe Asn Asn Phe Thr Val Ser Phe Trp Leu Arg Val Pro Lys Val Ser

1 5 10 15

Ala Ser His Leu Glu Thr

20

<210>24

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>24

Ser Leu Tyr Asn Thr Val Ala Thr Leu

1 5

<210>25

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>25

Ala Gly Leu Leu Gly Asn Val Ser Thr Val Leu Leu Gly Gly Val

1 5 10 15

<210>26

<211>15

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>26

Glu Tyr Leu Asn Lys Ile Gln Asn Ser Leu Ser Thr Glu Trp Ser

1 5 10 15

<210>27

<211>9

<212>PRT

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic peptide

<400>27

Gly Ile Leu Gly Phe Val Phe Thr Leu

1 5

<210>28

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic primer

<400>28

ttggtgatga tttgaacatt gga 23

<210>29

<211>23

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic primer

<400>29

cccagttcct gcagagtaga aaa 23

<210>30

<211>19

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic primer

<400>30

gaaggtgaag gtcggagtc 19

<210>31

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic primer

<400>31

gaagatggtg atgggatttc 20

<210>32

<211>29

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic primer

<400>32

tgtcacttgc aaacacacag cttgtcgaa 29

<210>33

<211>20

<212>DNA

＜213〉artificial sequence

<220>

＜223〉description of artificial sequence: synthetic primer

<400>33

caagcttccc gttctcagcc 20

Claims

1. following vaccine causes purposes in the medicine of pathogen of malaria the immune people of preparation with opposing, described vaccine comprises:

A) contain the initiation vaccine of at least a polynucleotide of at least a first malaria antigen of encoding; With

B) contain the reinforcement vaccine of at least a polypeptide, wherein said polypeptide comprises second malaria antigen of the total at least a epi-position of at least a and described at least a first malaria antigen,

Wherein cause using of vaccine and caused the CD8+T cell, cause memory and strengthen using subsequently of vaccine to the CD8+T cell that causes, widen the CD8+T cell response of initiation, and cause malaria CD8+T cell, malaria CD4+T cell and malaria production of antibodies.

2. the purposes of claim 1, wherein second malaria antigen contains all or part of of first malaria antigen.

3. the purposes of claim 1, wherein amount of initiator is between 0.01 μ g to 50mg.

4. the purposes of claim 3, wherein amount of initiator is 2500 μ g.

5. the purposes of claim 3, wherein before using second vaccine, amount of initiator is applied 1 to 5 time.

6. the purposes of claim 1, wherein booster dose is between 1 μ g to 100 μ g.

7. the purposes of claim 6, wherein booster dose is 50 μ g.

8. the purposes of claim 6, wherein booster dose is 25 μ g.

9. the purposes of claim 1, wherein by being selected from IM, IV, ID, subcutaneous, mucosa, recombinant bacteria, recombinant virus, or particle gun, or the method for its combination is used the initiation vaccine.

10. the purposes of claim 1, wherein by being selected from IM, IV, ID, subcutaneous, mucosa, recombinant bacteria, recombinant virus, or the method for particle gun or its combination is used the reinforcement vaccine.

11. the purposes of claim 1, wherein the CD8+T cell comprises cytotoxic T lymphocyte.

12. the purposes of claim 1, wherein first malaria antigen comprises a fragment of ring spore polypeptide at least.

13. the purposes of claim 1, wherein second malaria antigen comprises a fragment of ring spore polypeptide at least.

14. the purposes of claim 1 wherein causes vaccine and comprises PfCSP.

15. the purposes of claim 1 is wherein strengthened vaccine and is comprised RTS, S.

16. the purposes of claim 1, wherein first malaria antigen comprises whole basically circumsporozoite proteins, and second malaria antigen comprises RTS, S.

17. the purposes of claim 1, the pathogen that wherein causes malaria is a Plasmodium falciparum.

Cause the test kit of the pathogen of malaria 18. be used for immune people with opposing, it comprises:

A) contain the initiation vaccine of at least a polynucleotide of at least a first malaria antigen of encoding; Know

B) contain at least a reinforcement vaccine that further comprises the polypeptide of at least a second malaria antigen, described at least a second malaria antigen and described at least a first malaria antigen have at least a epi-position,

Wherein cause using of vaccine and cause the CD8+T cell, cause memory and strengthen using subsequently of vaccine to the CD8+T cell that causes, widen the CD8+T cell response of initiation, and cause malaria CD8+T cell, malaria CD4+T cell and malaria production of antibodies.

19. the test kit of claim 18 wherein causes vaccine and contains PfCSP.

20. the test kit of claim 18 is wherein strengthened vaccine and is contained RTS, the S vaccine.

21. the test kit of claim 18, wherein:

A) cause vaccine and contain the whole basically CS albumen of at least a coding or its segmental polynucleotide; And

B) strengthen vaccine and contain at least a whole basically CS albumen or its segmental polypeptide of comprising.

22. the test kit of claim 21 is wherein strengthened vaccine and is contained and comprise the proteic C-end parts of whole basically CS, 4 or the multiple immunodominant region of more a plurality of series connection and from the hybrid protein of the surface antigen (HbsAg) of hepatitis B virus.

23. the test kit of claim 22 is wherein strengthened vaccine and is contained RTS, S and Th1 inductivity adjuvant.

24. following vaccine causes purposes in the medicine of pathogen of malaria the immune people of preparation with opposing, described vaccine comprises:

A) contain the initiation vaccine of the whole basically CS protein of at least a coding or its segmental polynucleotide; With

B) contain at least a whole basically CS albumen or the reinforcement vaccine of its segmental polypeptide of comprising,

25. the purposes of claim 24 wherein causes vaccine and contains PfCSP.

26. the purposes of claim 24 is wherein strengthened vaccine and is contained and comprise the proteic C-end parts of whole basically CS, 4 or the multiple immunodominant region of more a plurality of series connection and from the hybrid protein of the surface antigen (HbsAg) of hepatitis B virus.

27. the purposes of claim 26 is wherein strengthened vaccine and is contained RTS, S and Th1 inductivity adjuvant.

28. the purposes of claim 24, wherein booster dose is between 0.01 μ g to 50mg.

29. the purposes of claim 28, wherein amount of initiator is 2500 μ g.

30. the purposes of claim 28, wherein before using second vaccine, amount of initiator is applied 1 to 5 time.

31. the purposes of claim 24, wherein booster dose is between 1 μ g to 100 μ g.

32. the purposes of claim 31, wherein booster dose is 50 μ g.

33. the purposes of claim 31, wherein booster dose is 25 μ g.

34. the purposes of claim 24, wherein by being selected from IM, IV, ID, subcutaneous, mucosa, recombinant bacteria, recombinant virus, or the method for particle gun or its combination, use the initiation vaccine.

35. the purposes of claim 24, wherein by being selected from IM, IV, ID, subcutaneous, mucosa, recombinant bacteria, recombinant virus, or the method for particle gun or its combination, use the reinforcement vaccine.