CA3126580A1

CA3126580A1 - Piscine orthoreovirus virulence markers

Info

Publication number: CA3126580A1
Application number: CA3126580A
Authority: CA
Inventors: Magnus Andreas DEVOLD; Morten Lund; Havard Aanes; Linda Ramsevik Teigene; Vidar Teis ASPEHAUG; Gordon RICHIE
Original assignee: Patogen As
Current assignee: Patogen As
Priority date: 2019-01-30
Filing date: 2020-01-28
Publication date: 2020-08-06
Also published as: CL2021001992A1; EP3918095A1; WO2020159379A1; NO344967B1; WO2020159379A8

Abstract

The invention relates to methods for determining virulence of PRV in a biological sample from a fish, comprising detection of SNPs. The invention further relates to primers and probes to be used in such a method.

Description

Piscine Orthoreovirus Virulence Markers The present invention relates to methods for determining virulence of Piscine orthoreovirus (PRV), and primers and probes to be used in such a method, according to the preamble of the independent patent claims.
Background The aquaculture industry is an important food source and income, and Salmonids in particular are very popular farmed species in many regions of the world. Viral diseases pose a significant threat to the productivity in aquaculture, and thus impact the future global aquaculture production. Heart and Skeletal Muscle Inflammation (HSMI) has become a serious disease in farmed salmonids in several geographical areas. It was discovered in salmon in the sea in Norway in 1999, and is now reported from fresh and seawater sites in for instance UK, Scotland, Canada and Chile.
The causal relationship between the PRV and HSMI was described by (Wessel 0, et al.
(2017) Infection with purified Piscine orthoreovirus demonstrates a causal relationship with heart and skeletal muscle inflammation in Atlantic salmon.
PLoS
ONE 12(8):e0183781). The mortality during HSMI outbreaks varies from negligible to 20%.
According to The National Veterinary Institute the virus has spread over the years and in 2014 the virus was delisted from notifiable diseases. The delisting was done because the PRV is ubiquitous in Atlantic salmon, and thus present also in healthy individuals not associated with clinical disease. Still, HSMI is a significant health problem for the aquaculture industry in Norway, but it is not yet possible to differentiate between virulent and less virulent or non-virulent strains of PRV.
Reoviruses are non-enveloped icosahedral viruses with double-stranded RNA
genomes comprising 10-12 segments and consistent with the genome organization characteristic for members of the family Reoviridae, the genome of the PRV
comprises at least 10 RNA segments (GenBank Accession numbers GU994013-

2 GU994022). Palacios et al 2010, identified these 10 different segments as L1, L2, L3, M1, M2, M3, Si, S2, S3 and S4 (Palacios G, et al. (2010) Heart and Skeletal Muscle Inflammation of Farmed Salmon Is Associated with Infection with a Novel Reovirus. PLoS ONE 5(7): e11487).
Viruses closely related to PRV from farmed Atlantic salmon have been discovered in association with diseases in other salmonid species. A virus called PRV-2 was demonstrated to be the possible causative agent of erythrocytic inclusion body syndrome (El BS), a disease that can cause mass mortality in Coho salmon (Oncorhynchus kisutch). Another PRV-like virus was detected in association with a disease outbreak in rainbow trout (Oncorhynchus mykiss) in Norway; the fish displayed signs of circulatory disturbance and histopathological changes resembling HSMI. Furthermore, a PRV strain closely related to the PRV from rainbow trout was found in association with HSMI-like lesions in Coho salmon in Chile. The presence of several PRV variants associated with diseases in salmonids suggests that species adaptation is important for pathogenesis (Wessel 2017).
Siah et al 2015 conducted a phylogenetic study of PRV strains from Norway, Canada and Chile, and found that Norwegian strains differed in Si segment.
Wessel et al have shown the genetic relationship of strains from different regions and species, and shows that strains from Atlantic salmon all belong to the same group.
Parts of the genome of the Norwegian strain is sequenced, and known for instance from Genbank. However, also in Norway there are fish detected positive to PRV
without clinical symptoms, and fish detected positive to PRV developing HSMI.
Therefore it is important to have diagnostic tools to differentiate between the strains that can cause disease, and those that do not.
The current diagnostic methods are histology, immunohistochemistry, virus propagation, serology, neutralizing assay, sequencing and PCR, wherein PCR
gives the fastest result and is the preferred method. EP 2482825 describes a known method for determining the presence or absence of piscine reovirus, by using PCR.

3 The genomes of all organisms undergo spontaneous mutations during their continuing evolution, forming variant forms of progenitor genetic sequences. A

mutation may result in an evolutionary advantage or disadvantage relative to a progenitor form or may be neutral. A variant that result in an evolutionary advantage .. may eventually be incorporated in many members of the species and may thus effectively become the progenitor form. Furthermore, often various variant forms survive and coexist in a species population. The coexistence of multiple forms of a genetic sequence gives rise to genetic polymorphism, including single-nucleotide polymorphisms (SNPs).
A single-nucleotide polymorphism (SNP) is a DNA sequence variation occurring when a single nucleotide ¨ A, T, C or G ¨ in the genome (or other shared sequence such as RNA) differs between members of a biological species or paired chromosomes in an organism. For example, two DNA fragments from different .. individuals, AAGCCTA to AAGCTTA, contain a difference in a single nucleotide, commonly referred as two alleles. Almost all common SNPs have only two alleles.
The genomic distribution of SNPs is not homogenous; SNPs usually occur in non-coding regions more frequently than in coding regions or, in general, where natural selection is acting the allele of the SNP that constitutes the most favorable genetic .. adaptation is predominating.
The invention The issues set out above are solved by methods, primers and probes according to the characterizing part of the enclosed independent claims. Further advantageous .. features are stated in the corresponding dependent claims.
The present invention relates to a method for determining virulence of Piscine Orthoreovirus (PRV) in a biological sample from a fish, comprising a step for detecting whether any of the following single nucleotide polymorphisms (SNPs) are .. present in the genomic material S4-T3200 or S4-G754A in SEQ ID NO. 4,

4 M2-G5510, M2-T580A, M2-G784T, M2-A958G, or M2-A1108G in SEQ ID
NO. 5, M3-A280T, M3-0371T, M3-01064T, M3-A1351G, M3-T14210 or M3-T16870 in SEQ ID NO. 6, or the complementary oligonucleotides thereof, wherein the numbering of said positions are in accordance with sequences 4, 5, and 6, respectively, wherein presence of at least one SNP confirms that the virus is virulent and will cause morbidity and/or mortality of a fish upon infection.
The SNPs as mentioned above are to be understood as defined in table 1 below.
Table 1 SNPs related to the invention SNP Position in DNA Nucleotide in reference Nucleotide in non-virulent virus virulent virus S4-T320C 320 in S4 segment S4-G754A 754 in S4 segment G A
M2-G551C 551 in M2 segment M2-T580A 580 in M2 segment T A
M2-G784T 784 in M2 segment M2-A958G 958 in M2 segment A
M2-A1 108G 1108 in M2 segment A
M3-A280T 280 in M3 segment A
M3-C371T 371 in M3 segment M3-C1064T 1064 in M3 segment M3-A1351G 1351 in M3 segment A
M3-T1421C 1421 in M3 segment M3-T1687C 1687 in M3 segment The SNP 54-T3200 should thus be understood to mean a mutation from T to C in position 320 of the S4 segment. The reference segment of S4 is shown in SEQ ID

NO. 4.
Virulence is a measure of the pathogenicity of an organism. The degree of virulence is related directly to the ability of the organism to cause disease despite host resistance mechanisms.
In one embodiment, the method further comprises a step for isolating the genomic material from the biological sample, and possibly a step for sequencing the material before detecting the SNPs. The step for detection of the SNPs may be performed in many ways which will be obvious to a skilled person, and the necessity of isolating and sequencing depends on the detection method.

5 In a preferred embodiment, any sequencing, is performed by a polymerase chain reaction and use of at least one primer. The sequencing may also be performed by Next Generation Sequencing Methods, such as a method selected from the group consisting of IIlumina (Solexa) sequencing, Roche 454 sequencing, Ion Torrent and SOLiD sequencing.
The detection of SNPs may be performed by manual or automatic comparing the sequenced genomic material from the sample with the reference.
In a preferred embodiment of the invention, the step of detecting comprises use of a polymerase chain reaction and use of at least one primer and/or probe.
In a preferred embodiment, each primer or probe used for sequencing or detecting comprise a sequence of at least 10 consecutive nucleotides selected from one of the sequences of a group consisting of SEQ ID NO. 24-26, 28-30, 32-34, 36-38, 40-42, 44-46, 48-50, 52-54, 56-58 and 60-63.
In a preferred embodiment, the primers used for sequencing or detecting are used as primer pairs, selected from a group consisting of the following primer pairs:
primers according to SEQ ID NO. 24 and 25, primers according to SEQ ID NO. 28 and 29, primers according to SEQ ID NO. 32 and 33, primers according to SEQ ID NO. 36 and 37, primers according to SEQ ID NO. 40 and 41, primers according to SEQ ID NO. 44 and 45, primers according to SEQ ID NO. 48 and 49, primers according to SEQ ID NO. 52 and 53, primers according to SEQ ID NO. 56 and 57, and

6 primers according to SEQ ID NO. 60 and 61.
In a preferred embodiment, the step of detecting comprises use of probes, preferably in a PCR reaction, wherein binding of a probe comprising a sequence of at least 10 consecutive nucleotides from SEQ ID NO. 26, confirms the virus to have SNP 54-T3200 SEQ ID NO. 30, confirms the virus to have SNP 54-G754A
SEQ ID NO. 34, confirms the virus to have SNP M2-G5510 SEQ ID NO. 38, confirms the virus to have SNP M2-T580A
SEQ ID NO. 42, confirms the virus to have SNP M2-G784T
SEQ ID NO. 46, confirms the virus to have SNP M2-A1108G
SEQ ID NO. 50, confirms the virus to have SNP M3-A280T
SEQ ID NO. 54, confirms the virus to have SNP M3-0371T
SEQ ID NO. 58, confirms the virus to have SNP M3-A1351G
SEQ ID NO. 62 or 63, confirms the virus to have SNP M3-T16870 The invention further relates to a method as described above, wherein the presence of mutation M3-A280T and/or M3-A1351G in SEQ ID NO. 6 confirms the virus to cause high mortality.
The invention further relates to a method as described above, wherein the presence of mutations M3-A280T, M3-01064T, M3-A1351G, M3-T14210 and M3-T16870 in SEQ ID NO. 6 confirm the virus to cause high mortality.
.. The invention further relates to a method as described above, wherein the presence of mutations 54-G754A, M2-G5510, M2-T580A, M2-G784T, M2-A958G, M2-A1108G, M3-A280T, M3-01064T, M3-A1351G, M3-T14210, and M3-T16870 in SEQ ID NO. 6 confirm the virus to cause high mortality.
The invention further relates to a method as described above, wherein the presence of mutation M3-0371T in SEQ ID NO. 6 confirms the virus to cause moderate to low mortality, and morbidity.

7 The invention further relates to a method as described above, wherein the presence of mutations M3-0371T, M3-01064T and M3-T14210 in SEQ ID NO. 6 confirm the virus to cause moderate to low mortality, and morbidity.
The invention further relates to a method as described above, wherein the presence of mutations 54-G754A, M2-G5510, M2-G784T, M2-A958G, M2-A1108G, M3-0371T, M3-01064T, and M3-T14210 in SEQ ID NO. 6 confirm the virus to cause moderate to low mortality, and morbidity.
The invention further relates to a method as described above, wherein the presence of mutation 54-T3200 in SEQ ID NO. 4 confirms the virus to cause high morbidity.
The invention further relates to a method as described above, wherein the presence of mutations 54-T3200, M2-G5510, M2-T580A, M2-G784T, M2-A958G, M2-A1108G, M3-01064T, M3-T14210 and M3-T16870 in SEQ ID NO. 6 confirms the virus to cause high morbidity.
The invention further relates to a method as described above, wherein the presence of mutation 54-G754A in SEQ ID NO. 4 confirms the virus to cause high to moderate mortality, and morbidity.
The invention further relates to a method as described above, wherein the absence of all SNPs mentioned in table 1 above, confirms the virus to be nonvirulent, and not cause mortality or morbidity. In order to prove the absence of all SNPs, a method according to the above may be carried out, comprising use of a primer and probe comprising a sequence of at least 10 consecutive nucleotides according to the following primers acc. to SEQ ID NO. 24 and 25, and probe acc. to SEQ ID NO. 27, confirm the absence of SNP 54-T3200, primers acc. to SEQ ID NO. 28 and 29, and probe acc. to SEQ ID NO. 31, confirm the absence of SNP 54-G754A,

8 primers acc. to SEQ ID NO. 32 and 33, and probe acc. to SEQ ID NO. 35, confirm the absence of SNP M2-G5510, primers acc. to SEQ ID NO. 36 and 37, and probe acc. to SEQ ID NO. 39, confirm the absence of SNP M2-T580A, primers acc. to SEQ ID NO. 40 and 41, and probe acc. to SEQ ID NO. 43, confirm the absence of SNP M2-G784T, primers acc. to SEQ ID NO. 44 and 45, and probe acc. to SEQ ID NO. 47, confirm the absence of SNP M2-A1108G, primers acc. to SEQ ID NO. 48 and 49, and probe acc. to SEQ ID NO. 51, confirm the absence of SNP M3-A280T, primers acc. to SEQ ID NO. 52 and 53, and probe acc. to SEQ ID NO. 55, confirm the absence of SNP M3-0371T, primers acc. to SEQ ID NO. 56 and 57, and probe acc. to SEQ ID NO. 59, confirm the absence of SNP M3-A1351G, primers acc. to SEQ ID NO. 60 and 61, and probe acc. to SEQ ID NO. 64, confirm the absence of SNP M3-T16870 The invention also relates to a primer or probe comprising a sequence of at least 10 consecutive nucleotides selected from the group comprising SEQ ID NO. 24-26, 30, 32-34, 36-38, 40-42, 44-46, 48-50, 52-54, 56-58 and 60-63. The primer or probe may comprise any 10 consecutive nucleotides from SEQ ID NO. 24, or from SEQ ID

NO. 25, or from SEQ ID NO. 26 etc. The primer or probe may also comprise, or be identical to, the mentioned sequences.
The invention further relates to a method for determining virulence of Piscine Orthoreovirus (PRV) in a biological sample from a fish, comprising the following steps, a) isolating amino acid sequences of the sample, b) sequencing the amino acid sequence, c) detecting whether any of the following amino acids are present in the amino acid sequences - A in position 107 or N in position 252 of SEQ ID NO. 1

9 - T in position 184, I in position 194, S in position 262, A in position 320 or D in position 370 of SEQ ID NO. 2, or - L in position 94, V in position 124, L in position 355, V in position 451, Tin position 474 or P in position 563 of SEQ ID NO. 3 wherein the numbering of said positions are in accordance with the sequences SEQ ID NO. 1,2 and 3, respectively, wherein presence of at least one of the amino acids confirms that the virus is virulent and will cause morbidity and/or mortality of the fish upon infection.
If none of the following amino acids are present, A in position 107 or N in position 252 of SEQ ID NO. 1, Tin position 184, I in position 194, S in position 262, A
in position 320 or D in position 370 of SEQ ID NO. 2, or L in position 94, V in position 124, L in position 355, V in position 451, Tin position 474 or Pin position 563 of SEQ ID NO. 3, then the virus is non-virulent.
The invention further relates to a method as described above, wherein the presence of amino acid L in position 94, and/or V in position 451 in SEQ ID NO. 3 confirms the virus to cause high mortality.
The invention further relates to a method as described above, wherein the presence of L in position 94, L in position 355, V in position 451, T in position 474 and P in position 563 of SEQ ID NO. 3 confirms the virus to cause high mortality.
The invention further relates to a method as described above, wherein the presence of N in position 252 of SEQ ID NO. 1, Tin position 184, I in position 194, S
in position 262, A in position 320 and D in position 370 of SEQ ID NO. 2, and L
in position 94, L in position 355, V in position 451, T in position 474 and P in position 563 of SEQ ID NO. 3 confirms the virus to cause high mortality.
The invention further relates to a method as described above, wherein the presence of V in position 124 of SEQ ID NO. 3 confirms the virus to cause moderate mortality, high morbidity.

The invention further relates to a method as described above, wherein the presence of V in position 124, L in position 355, and T in position 474 of SEQ ID NO. 3 confirms the virus to cause moderate mortality, high morbidity.

The invention further relates to a method as described above, wherein the presence of - N in position 252 of SEQ ID NO. 1, and T in position 184, S in position 262, A in position 320 and D in position 370 of SEQ ID NO. 2, and V in position 124, L
in position 355, and T in position 474 of SEQ ID NO. 3 confirms the virus to cause

10 moderate mortality, high morbidity.
The invention further relates to a method as described above, wherein the presence of A in position 107 of SEQ ID NO. 1, and Tin position 184, I in position 194, Sin position 262, A in position 320 and D in position 370 of SEQ ID NO. 2, and L
in position 355, T in position 474 and P in position 563 of SEQ ID NO. 3 confirms the virus to cause high morbidity.
The invention further relates to a method as described above, wherein the presence of N in position 252 of SEQ ID NO. 1 confirms the virus to cause moderate mortality, high morbidity.
Figures The invention will now be described in detail with reference to the enclosed Figures and sequences where Fig. 1 shows an alignment of PRV protein S4, from GenBank AGR27923 (SEQ ID
NO. 1) and from a virulent virus strain (SEQ ID NO. 7-8), AGR27923 is cut 17 amino acids at the end, Fig. 2 shows an alignment of PRV Protein M2 (SEQ ID NO. 2), from GenBank AGR27919 and from a virulent virus strain (SEQ ID NO. 9-10), Fig. 3 shows an alignment of PRV Protein M3 (SEQ ID NO. 3), from GenBank AGR27920 and from a virulent virus strain (SEQ ID NO. 11-13)

11 Fig. 4 shows an alignment of the nucleotide encoding S4, from GenBank K0715687 (SEQ ID NO. 4) and from a virulent virus strain (SEQ ID NO. 14-16) K0715687 is cut 38 nucleotides at 5 end and 105 at 3 end, Fig. 5 shows an alignment of the nucleotide encoding M2, from GenBank K0715683 (SEQ ID NO. 5) and from a virulent virus strain (SEQ ID NO. 17-20) K0715683 is cut with 26 nucleotides at 5 end and 87 at 3 end, Fig. 6 shows an alignment of the nucleotide encoding M3, from GenBank K0715684 (SEQ ID NO. 6) and from a virulent virus strain (SEQ ID NO. 21-23) K0715684 is cut with 83 nucleotides at 5 end and 60 at 3 end, Fig. 7 shows a phylogenetic tree of S4, Fig. 8. shows accumulated mortality associated with the PRV genotypes of virulent virus, wherein Fig 8.A shows HSMI mortality and Fig 8.B. shows mortality of looser fish also called morbidity.
.. The enclosed nucleotide sequences are SEQ ID NO. 1 Amino acid of PRV segment S4 from fish (Modification of GenBank acc. AGR27923, with cut of 17 amino acids at 3 end) SEQ ID NO. 2 Amino acid of PRV segment M2 from fish (GenBank acc. AGR27919 ) SEQ ID NO. 3 Amino acid of PRV segment M3 from fish (GenBank acc. AGR27920) SEQ ID NO. 4 DNA of PRV segment S4 from fish (Modification of GenBank 10 acc.KC15687, with cut of 38 nucleotides at 5 end and 105 at 3 end) SEQ ID NO. 5 DNA of PRV segment M2 from fish (Modification of GenBank 10 acc.KC15683, with cut of 26 nucleotides at 5 end and 87 at 3 end) SEQ ID NO. 6 DNA of PRV segment M3 from fish (Modification of GenBank 10 acc.KC15684, with cut of 83 nucleotides at 5 end and 60 at 3 end) SEQ ID NO. 7 Amino acid of virulent PRV segment S4 from Genogroup A and C
SEQ ID NO. 8 Amino acid of virulent PRV segment S4 from Genogroup B
SEQ ID NO. 9 Amino acid of PRV segment M2 from Genogroup A-2 and B
SEQ ID NO. 10 Amino acid of PRV segment M2 from Genogroup A and C
SEQ ID NO. 11 Amino acid of PRV segment M3 from Genogroup A
SEQ ID NO. 12 Amino acid of PRV segment M3 from Genogroup B
SEQ ID NO. 13 Amino acid of PRV segment M3 from Genogroup C
SEQ ID NO. 14 DNA of PRV segment S4, genotype A
SEQ ID NO. 15 DNA of PRV segment S4, genotype B
SEQ ID NO. 16 DNA of PRV segment S4, genotype C
SEQ ID NO. 17 DNA of PRV segment M2, genotype A
SEQ ID NO. 18 DNA of PRV segment M2, genotype A-2

12 SEQ ID NO. 19 DNA of PRV segment M2, genotype B
SEQ ID NO. 20 DNA of PRV A segment M2, genotype C
SEQ ID NO. 21 DNA of PRV segment M3, genotype A
SEQ ID NO. 22 DNA of PRV segment M3, genotype B
SEQ ID NO. 23 DNA of PRV segment M3, genotype C
SEQ ID NO. 24 Oligonucleotide (forward 1) primer for detecting SNP 54-T320C
SEQ ID NO. 25 Oligonucleotide (forward 2) primer for detecting SNP 54-T320C
SEQ ID NO. 26 Oligonucleotide probe P1 for detecting SNP 54-T320C
SEQ ID NO. 27 Oligonucleotide probe P2 for detecting absence of SNP 54-T320C
SEQ ID NO. 28 Oligonucleotide (forward 1) primer for detecting SNP 54-754A
SEQ ID NO. 29 Oligonucleotide (forward 2) primer for detecting SNP 54-G754A
SEQ ID NO. 30 Oligonucleotide probe P1 for detecting SNP 54-G754A
SEQ ID NO. 31 Oligonucleotide probe P2 for detecting absence of SNP 54-G754A
SEQ ID NO. 32 Oligonucleotide (forward 1) primer for detecting SNP M2-G551C
SEQ ID NO. 33 Oligonucleotide (forward 2) primer for detecting SNP M2-G551C
SEQ ID NO. 34 Oligonucleotide probe P1 for detecting SNP M2-G551C
SEQ ID NO. 35 Oligonucleotide probe P2 for detecting absence of SNP M2-G551C
SEQ ID NO. 36 Oligonucleotide (forward 1) primer for detecting SNP M2-T580A
SEQ ID NO. 37 Oligonucleotide (forward 2) primer for detecting SNP M2-T580A
SEQ ID NO. 38 Oligonucleotide probe P1 for detecting SNP M2-T580A
SEQ ID NO. 39 Oligonucleotide probe P2 for detecting absence of SNP M2-T580A
SEQ ID NO. 40 Oligonucleotide (forward 1) primer for detecting SNP M2-G784T
SEQ ID NO. 41 Oligonucleotide (forward 2) primer for detecting SNP M2-G784T
SEQ ID NO. 42 Oligonucleotide probe P1 for detecting SNP M2-G784T
SEQ ID NO. 43 Oligonucleotide probe P2 for detecting absence of SNP M2-G784T
SEQ ID NO. 44 Oligonucleotide (forward 1) primer for detecting SNP M2-A1108G
SEQ ID NO. 45 Oligonucleotide (forward 2) primer for detecting SNP M2-A1 108G
SEQ ID NO. 46 Oligonucleotide probe P1 for detecting SNP M2-A1108G
SEQ ID NO. 47 Oligonucleotide probe P2 for detecting absence of SNP M2-A1 108G
SEQ ID NO. 48 Oligonucleotide (forward 1) primer for detecting SNP M3-A280T
SEQ ID NO. 49 Oligonucleotide (forward 2) primer for detecting SNP M3-A280T
SEQ ID NO. 50 Oligonucleotide probe P1 for detecting SNP M3-A280T
SEQ ID NO. 51 Oligonucleotide probe P2 for detecting absence of SNP M3-A280T
SEQ ID NO. 52 Oligonucleotide (forward 1) primer for detecting SNP M3-C371T
SEQ ID NO. 53 Oligonucleotide (forward 2) primer for detecting SNP M3-C371T
SEQ ID NO. 54 Oligonucleotide probe P1 for detecting SNP M3-C371T
SEQ ID NO. 55 Oligonucleotide probe P2 for detecting absence of SNP M3-C371T
SEQ ID NO. 56 Oligonucleotide (forward 1) primer for detecting SNP M3-A1351G
SEQ ID NO. 57 Oligonucleotide (forward 2) primer for detecting SNP M3-A1351G
SEQ ID NO. 58 Oligonucleotide probe P1 for detecting SNP M3-A1351G
SEQ ID NO. 59 Oligonucleotide probe P2 for detecting absence of SNP M3-A1351G

13 SEQ ID NO. 60 Oligonucleotide (forward 1) primer for detecting SNP M3-T1687C
SEQ ID NO. 61 Oligonucleotide (forward 2) primer for detecting SNP M3-T1687C
SEQ ID NO. 62 Oligonucleotide probe P1a for detecting SNP M3-T1687C
SEQ ID NO. 63 Oligonucleotide probe P1b for detecting SNP M3-T1687C
SEQ ID NO. 64 Oligonucleotide probe P2 for detecting absence of SNP M3-T1687C
Description of preferred embodiments of the invention Reference throughout the description to "an embodiment" signifies that a particular feature, structure or property specified in connection with an embodiment is included in the least in one embodiment. The expressions "in one embodiment", "in a preferred embodiment" or "in an alternative embodiment" different places in the description does not necessarily point to the same embodiment. Further, the different features, structures or properties may be combined in any suitable way in one or more of the embodiments.
Example 1:
This study describes different genotypes of PRV isolates collected from farmed Atlantic salmon in Norway.
Materials and methods Tissue samples of heart, head or kidney from HSMI diseased farmed Atlantic salmon were collected from aquaculture farms in Norway and tested for PRV by RT-qPCR.
The samples were collected from 11 freshwater sites and 29 seawater sites during the years 2014 to 2016. The samples were collected aseptically on tubes prefilled with RNAlater (Ambion, USA). After sampling, the tubes containing tissue samples were shipped chilled to PatoGen AS with 24-hour delivery service.
The RT-qPCR assay targeting PRV were performed, the method is validated according to IS017025 standards and is described elsewhere (Glover et al.
2013).
Amino acid changes can be detected by different methods, such as protein sequencing, DNA or RNA sequencing, or by Real Time qPCR SNP assay. The two

14 last methods are easier and more cost effective than protein sequencing. In this example DNA/RNA sequencing by Sanger and by Real Time PCR were used.
PRV isolates from 3 freshwater sites and 17 seawater sites where the fish had developed HSMI, were selected, the genomic material of the samples were isolated, and the genomic material was sequenced. Further, the amino acid sequences of the sample were isolated and sequenced.
A retrospective epidemiological study was performed to investigate whether specific PRV genotypes was associated with HSMI mortality and/or morbidity (including looser fish). The data was collected from salmon farms in Norway. Looser fish is fish not developing and acting normal, it is often smaller than normal fish, has a higher mortality rate and it cannot be sent to the marked once slaughtered. In the following, virus causing looser fish will be referred to as virus causing morbidity.
Results All samples confirmed positive to PRV in standard qPCR testing. The phylogenetic analyses generated 3 distinct groups shown as A, B and C in figure 7, in addition to the reference.
The genomic material and the amino acid sequences of the sample were compared to a Canadian from Genbank named VT06062012-358 (herein called reference or reference virus), defined as non-virulent, where SEQ ID NO. 1 shows a truncated version of the amino acid sequence of S4, being the outer fiber protein, and SEQ ID NO. 4 shows a truncated version the nucleotide sequence of the S4 segment, encoding the outer fiber protein, SEQ ID NO. 2 shows the amino acid sequence of M2 segment being the outer shell protein, and SEQ ID NO. 5 shows a truncated version of the nucleotide sequence of the M2 segment encoding the outer shell protein, and SEQ ID NO. 3 shows the amino acid sequence of M3 segment, encoding a non-structural factory protein, and SEQ ID NO. 6 shows a truncated version of the nucleotide sequence of the M3 segment encoding the non-structural factory protein, 5 of the reference virus.
Sequences for both the proteins and the nucleotide sequences encoding the proteins were aligned with the reference. The alignments are enclosed as Figure 1 and 4, regarding S4 segment, Figure 2 and 5 regarding M2 segment and Figure 3 and 6 10 regarding M3 segment. Genotype groups were established, named A, B and C. In the alignments both SNPs causing an amino acid change and silent mutations are shown.
Regarding the S4 segment, the genotype groups A and C of the protein are identical.

15 The sequences of A/C and B are enclosed as SEQ ID NO. 7 and 8 respectively. The genotype groups A, B and C of the nucleotide sequence are unique, and enclosed as SEQ ID NO. 14-16.
Regarding the M2 segment, there were 4 genotype groups, A, A-2, B and C, where the proteins of A-2 and B, and A and C are identical, sequences of which are enclosed as SEQ ID NO. 9 and 10, respectively. The groups A, A-2, B and C of the nucleotide sequence are unique, and enclosed as SEQ ID NO. 17-20, respectively.
Regarding the M3 segment, the genotype groups of the proteins were unique, the sequences are enclosed as SEQ ID NO. 11-13, showing genotype group A, B and C
respectively. The genotype groups A, B and C of the nucleotide sequence are also unique, and enclosed as SEQ ID NO. 21-23, respectively.
The three different genogroups identified 13 different unique changes in amino acids that are associated to virulence (Table 2). It is the amino acids that are the basis for the genogrouping. There were slight variations in silent mutations in addition, that did not cause any change in amino acid.

16 Table 2. Amino acid differences identified in PRV strains.
Segment AA AA ref AA nt nt ref nt SNP Geno-position virulent position virulent group S4 252 D N 754 G A 54-G754A A,C

M2 184 S T 551 G C M2-G551C A,B,C
M2 194 F I 580 T A M2-1580A A,B
M2 262 A S 784 G T M2-G7841 A,B,C
M2 320 T A 958 A G M2-A958G A,B,C
M2 370 N D 1108 A G M2-A1108G A,B,C

M3 355 P L 1064 C T M3-C10641 A,B,C

M3 474 I T 1421 T C M3-11421C A,B,C
M3 563 S P 1687 T C M3-11687C A, B
In the epidemiological study the accumulated mortality and morbidity (e.g.
looser fish) were recorded. The mortality and morbidity observations correlated well with the 3 genogroups A, B and C. The reference was not detected in any of the sites.
Six PRV-isolates grouped into genogroup C, 9 PRV-isolates into the genogroup A and PRV-isolates into the genogroup B (Table 3). Although several amino acid changes can be seen in several genogroups, these may also be important to predict the strains' ability to induce mortality and or morbidity, relatively to the non-virulent reference.
Table 3. PRV isolates with data about HSMI mortality grouped into genotypes.
FW:
freshwater site. SW: seawater site.
Production type Site number Genotype HSMI

SW 5 A High HSMI
SW 5 A mortality SW 10 c Moderate to low SW 11 c HSMI mortality SW 12 c

17 SW 15 B No specific HSMI
SW 16 B mortality, but high SW 17 B morbitidy The result from the epidemiological study showed that the PRV genotype A was associated to higher level of HSMI mortality. The genogroup B was associated with high morbidity (looser fish) and less mortality. The genogroup C was associated with lower mortality and morbidity (looser fish). Accumulated mortality associated with the PRV genotypes is shown in Figure 8, where fig. 8A shows the HSMI mortality and Fig 8.B. shows % mortality that is of looser fish, also called morbidity.
The figure also show the the 25th and 75th percentiles. A correlation between the genogroups and the mortality from the epidemiological data were confirmed. Regarding figure 8B, the lower and upper border of boxes indicates the 25th and 75th percentiles, respectively and the centerline indicates the 50th percentile. The upper and lower whiskers correspond to the highest and lowest value of the 1.5*IQR (inter-quartile range). The differences between genogroups, are reflected in the 13 amino acid changes shown in Table 2.
Example 2:
In order to determine whether a fish is infected by a PRV virus causing mortality and/or morbidity, or a nonvirulent virus, primers and probes proving the presence or absence of the SNPs according to the present invention were developed. If one or more of the SNPs are present, then the virus is virulent and will cause morbidity and/or mortality of a fish upon infection. Based on this, 10 different Real Time SNP
assays were designed to detect amino acid changes (Table 4). The probe 1 detect the virulent mutation, and probe 2 detect the reference being nonvirulent.
All SNP's can also be detected by sequencing, for the virulence markers M2-320, M3-355 and M3-474 only sequencing are used.

18 Table 4 Primer pairs and probes (assays) for detection of the SNPs related to the invention. Probe 1 (P1) detect virulent strains of the virus, P2 detect the reference virus.
SEQ Primer/
Primer/probe Sequence 5'-3' Detects ID NO. Probe GGTCCTGAGATTGACGACAAACT:::. ' ..............................iii iii-----Primer::
25 S4-107-R AGTTCATGATTGTGAGCTGGTCAT aaS4-V107A
Primer ii 26 S4-107-P1 CAGCTTAAGGCGCTG ntS4-T320C Probe ............................................................ 7 27 S4-107-P2 ACAGCTTAAGGTGCTG Probe .
28 S4-252-F GGAAGAAGCTGCCTCAAATGGTGAAAGG ' Primer 29 54-252-R TCACCACCACAGGAACTACATTG aa54-D252N
Primer 30 54-252-P1 ATGAGTCTGGTGAATTA nt54-G754A Probe 31 54-252-P2 AGTCTGGTGGATTATGA Probe ====
32 M2-184-F TCCCTCATTCAACTCCAATC d:. ............... Primer:, .t't!... .
33 M2-184-R AACATCCTCAGAATGGAATGCA aaM2-S184T
Primer !,!,!i!i!i== ..
ii 34 M2-184-P1 TAGTCTGACCGCTGAC ..........................
ntM2-G551C Probe =

.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:n.:.:.:.:.:.:.:.:.:.:
.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:., Probe . 36 M2-194-F GACCGCTGACATGCATTCC Primer 37 M2-194-R GCACACATTGGTTGGCTTGA aaM2-F1941 Primer 38 M2-194-P1 TTCTGAGGATGATTTCC ntM2-T580AProbe 39 M2-194-P2 TTCTGAGGATGTTTTCC Probe ========
.:.= By sequenzing ...:::::::::::.=
40 M2-262-F TCAACCTCCACTGACTGATCAGA :........... Primer ..
41 M2-262-R AGCCAGAGATGCATCAGACCTT M2 A262S Primer 4: ..
42 M2-262-P1 CGAAGTCCGTTCAAT ntM2-G784T Probe ................................................................
.................................................................. .
ii.... 43 M2-262-P2 CGAAGTTCGCGCAAT Probe 44 M2-370-F GCATCTGGATGACATCACCAGTA Primer 45 M2-370-R AAACTGTTGATCCTGAATCTGCC aaM2-N370D
Primer ntM2-46 M2-370-P1 TAGCGAACGACGC Probe Al 108G
47 M2-370-P2 TCGCGAACAACGC Probe 7.= .
4. 48 M3-94-F TGCTATACGTAGTATGATTTCTCCTCTTG ' Primer 49 M3-94-R CACTGCTTCTCAACAACATCAACA aaM3-M94L
Primer:
50 M3-94-P1 ATTTGGAGTGTTGCGC ntM3-A2801 Probe ::::. = .=
a... 51 M3-94-P2 ATTTGGAGTGATGCGC Probe ..
===
52 M3-1 24-F CTCTTGAAAGACGTGGGATGTTG Primer 53 M3-124-R TCAGTGACATCCAATTGAAGAGGTA aaM3-A124V
Primer 54 M3-124-P1 AGGATGCGGCTGTTGA ntM3-C371T Probe 55 M3-124-P2 GATGCGGCTGCTGAAT Probe ....
:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:
:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.:.==
By sequenzing .....
.=:n:n:.=
56 M3-451-F TGCGAGATCGTCAAGTAACGA aaM3-I451V
Primer t== .
W.,.: .. M3-451 -13:::.:.:.:.:.:.:.:
.TCCTTCATGTTGGCGACATP.........................................................*
:::.................p0A..................,..Primek.

19 SEQ Primer/
Primer/probe Sequence 5'-3 Detects ID NO. Probe 58 M3-451-P1 TCCACCGTTCAC-T¨C.. '' A1351 Probe 59 nA3-451-P2 TTCCACCATTCACTC Probe,d By sequenzing 60 M3-563-F CTCAGCTCTGACTTCCTGATGGT Primer 61 M3-563-R CAGCGGCACAGGACATTG Primer aaM3-S563P
62 M3-563-P1a ACCACTTCCTGAGCACA Probe ntM3-T1687C
63 M3-563-P1b ACCACTTCCTGAACACA Probe 64 M3-563-P2 AAACCACTTTCTGAGCACAA Probe Example 3:
Test of assays. To validate that the Real Time PCR SNP assays (Example 2) can differentiate between the different groups, 3 assays was tested on field samples from Example 1. The assays SNP S4-T3200, M3-0371T and M3-A1351G, detecting B, C
and A respectively, were used.
The assays give a differentiation in Ct values and the probe giving the lowest Ct values indicates which SNP mutation that is most frequent in the biologic sample.
The detected SNPs are marked in Bold in table 5 below.
Table 5: Three assays tested on biological samples, and Ct values from PCR.
Assay S4-T320C M3-C371T M3-A1351G
aa detection Probe 2 Probe 1 Probe 2 Probe 1 Probe 2 Probe 1 27 25,3 18,5 21,8 22,5 23,8 15,8 19,1 19,4 16,4 23,6 24,8 A 14,7 17,4 16,8 19,8 ND* 15,5 *ND = Not Detected.
This shows that if the P1 probe has the lowest Ct value, when using the SNP
assay S4-T3200, the virus is of genotype B. The same is shown for the SNP assays M3-0371T and M3-A1351G; if P1 has the lowest Ct value, the sample is of genotypes C
and A respectively.

Claims

Patent claims

1. Method for determining virulence of Piscine Orthoreovirus (PRV) in a biological sample from a fish, comprising a step for detecting whether any of the following 5 single nucleotide polymorphisms (SNPs) are present in the genomic material 54-T3200 or 54-G754A in SEQ ID NO. 4, M2-G551C, M2-T580A, M2-G784T, M2-A958G, or M2-A1108G in SEQ ID
NO. 5, M3-A280T, M3-C371T, M3-C1064T, M3-A1351G, M3-T1421C or M3-T1687C
10 in SEQ ID NO. 6, or the complementary oligonucleotides thereof, wherein the numbering of said positions are in accordance with sequences SEQ ID NO. 4, 5 or 6, respectively, wherein presence of at least one SNP confirms that the virus is virulent and will 15 cause morbidity and/or mortality of a fish upon infection.

2. Method according to claim 1, comprising a step for isolating the genomic material from the sample, before detecting the SNPs.

20 3. Method according to claim 1 or 2, comprising a further step between isolating and detecting, for sequencing the genomic material.

4. Method according to claim 3, wherein the sequencing is performed by a method selected from the group consisting in IIlumina (Solexa) sequencing, Roche 454 sequencing, lon Torrent and SOLiD sequencing.

5. Method according to claim 3, wherein the sequencing is performed by a polymerase chain reaction and use of at least one primer.

6. Method according to any one of claim 1-5, wherein the step of detecting comprises a polymerase chain reaction and use of at least one primer and/or probe.

7. Method according to claims 5 or 6, wherein each primer comprises a sequence of at least 10 consecutive nucleotides selected from one of the sequences of a group consisting of SEQ ID NO. 24-25, 28-29, 32-33, 36-37, 40-41, 44-45, 48-49, 52-53, 56-57 and 60-61.

8. Method according to any one of claims 5-7, wherein primers are used as primer pairs, selected from a group consisting of the following primer pairs:
primers according to SEQ ID NO. 24 and 25, primers according to SEQ ID NO. 28 and 29, primers according to SEQ ID NO. 32 and 33, primers according to SEQ ID NO. 36 and 37, primers according to SEQ ID NO. 40 and 41, primers according to SEQ ID NO. 44 and 45, primers according to SEQ ID NO. 48 and 49, primers according to SEQ ID NO. 52 and 53, primers according to SEQ ID NO. 56 and 57, and primers according to SEQ ID NO. 60 and 61.

9. Method according to any one of the preceding claims 6-8, wherein the step of detecting comprises use of probes, wherein binding of a probe comprising a sequence of at least 10 consecutive nucleotides from SEQ ID NO. 26, confirms the virus to have SNP 54-T3200 SEQ ID NO. 30, confirms the virus to have SNP 54-G754A
SEQ ID NO. 34, confirms the virus to have SNP M2-G551C
SEQ ID NO. 38, confirms the virus to have SNP M2-T580A
SEQ ID NO. 42, confirms the virus to have SNP M2-G784T
SEQ ID NO. 46, confirms the virus to have SNP M2-A1108G
SEQ ID NO. 50, confirms the virus to have SNP M3-A280T
SEQ ID NO. 54, confirms the virus to have SNP M3-C371T
SEQ ID NO. 58, confirms the virus to have SNP M3-A1351G
SEQ ID NO. 62 or 63, confirms the virus to have SNP M3-T1687C

10. Method according to any one of the preceding claims, wherein the presence of mutation M3-A280T and/or M3-A1351G in SEQ ID NO. 6 confirms the virus to cause high mortality.

11. Method according to any one of the preceding claims, wherein the presence of mutation M3-A280T, M3-01064T, M3-A1351G, M3-T1421C and M3-T1687C in SEQ
ID NO. 6 confirms the virus to cause high mortality.

12. Method according to any one of claims 1-9, wherein the presence of mutation M3-C371T in SEQ ID NO. 6 confirms the virus to cause moderate to low mortality, and morbidity.

13. Method according to any one of claims 1-9, wherein the presence of mutation M3-C371T, M3-C1064T and M3-T1421C in SEQ ID NO. 6 confirms the virus to cause moderate to low mortality, and morbidity.

14. Method according to any one of claims 1-9, wherein the presence of mutation 54-T320C in SEQ ID NO. 4 confirms the virus to cause high morbidity.

15. Method according to any one of claims 1-9, wherein the presence of mutation 54-G754A in SEQ ID NO. 4 confirms the virus to cause high to moderate mortality, and morbidity.

16. A primer or probe comprising a sequence of at least 10 consecutive nucleotides selected from the group comprising SEQ ID NO. 24-26, 28-30, 32-34, 36-38, 40-42, 44-46, 48-50, 52-54, 56-58 and 60-63.

17. Method for determining virulence of Piscine Orthoreovirus (PRV) in a biological sample from a fish, comprising the following steps, a) isolating amino acid sequences of the sample, b) sequencing the amino acid sequence, c) detecting whether any of the following amino acids are present in the amino acid sequences from the sample:
- A in position 107 or N in position 252 of SEQ ID NO. 1, - T in position 184, I in position 194, S in position 262, A in position 320 or D in position 370 of SEQ ID NO. 2, or - L in position 94, V in position 124, L in position 355, V in position 451, T in position 474 or P in position 563 of SEQ ID NO. 3, wherein the numbering of said positions are in accordance with the sequences 1, 2 and 3, respectively, wherein presence of at least one the amino acids confirms that the virus is virulent and will cause morbidity and/or mortality of the fish upon infection.

18. Method according to claim 17, wherein the presence of amino acid L in position 94, and/or V in position 451 in SEQ ID NO. 3 confirms the virus to cause high mortality.

19. Method according to claim 17, wherein the presence of L in position 94, L
in position 355, V in position 451, T in position 474 or P in position 563 of SEQ
ID NO.
3 confirms the virus to cause high mortality.

20. Method according to claim 17, wherein the presence of V in position 124 of SEQ
ID NO. 3 confirms the virus to cause moderate mortality, high morbidity.

21. Method according to claim 17, wherein the presence of V in position 124, L
in position 355, or T in position 474 of SEQ ID NO. 3 confirms the virus to cause moderate mortality, high morbidity.

22. Method according to claim 17, wherein the presence of A in position 107 of SEQ
ID NO. 1 confirms the virus to cause high morbidity.

23. Method according to claims 17, wherein the presence of N in position 252 of SEQ ID NO. 1 confirms the virus to cause moderate mortality, high morbidity.