CA3060686A1 - Tgf-s receptor ii isoform, fusion peptide, methods of treatment and methods in vitro - Google Patents

Abstract

ABSTRACT An isoform of the TGF beta receptor II comprising a sequence of about of 80 amino acids and lacking a transmembrane domain;. The isoform comprises the amino acid sequence set forth in SEQ ID No. 12. The isoform may have the amino acid sequence set forth in SEQ ID No. 2 or sequences having at least 85 % sequence identity to the sequence set forth in SEQ ID No. 2. A fusion peptide is provided comprising an isoform of the TGF beta II receptor fused to a ligand, wherein a vector comprising the fusion peptide is used to treat cancer and/or hepatic fibrosis. An antibody binding the soluble isoform of the TGF beta II receptor is provided. The antibody binds the amino acid sequence shown in SEQ ID No. 12 and is used in in vitro methods. CA 3060686 2019-10-25

Description

TGF- 13 receptor II isoform, fusion peptide, methods of treatment and methods in vitro The present invention refers to an isoform of the TGF-13 receptor II, codifying polynucleotides, vectors, cells, transformed peptides, and fusion peptides, method and uses. More specifically, it refers to an isoform of the TGF-beta receptor ll comprising a sequence of about 80 amino acids and lacking a transmembrane domain;. The isoform comprises the amino acid sequence of SEQ ID No. 12. The isoform may have the amino acid sequence set forth in SEQ ID No. 2 or sequences having at least 85 %
sequence identity to the sequence set forth in SEQ ID No. 2.
BACKGROUND
Transforming growth factor-beta (TGF-(3) is abundant in bone matrix and has been shown to regulate the activity of osteoblasts and osteoclasts in vitro and in vivo.
Human Adipose derived Mesenchymal Stromal Cells (ASC) are precursors of osteoblasts, adipoblasts and chondroblasts. Thus, studies initially focused on the secretion of cytokines by ASC which have a profound effect in bone remodeling, such as Tgf-131, Osteoprotegerin (OPG) and Hepatocyte Growth Factor (HGF).
TGF-I31 concentrations are high in subchondral bone from humans with osteoarthritis. High concentrations of TGF-131 induced formation of nestin-positive mesenchymal stem cell (MSC) clusters, leading to formation of marrow osteoid islets accompanied by high levels of angiogenesis (Zhen G, et al. (Nat Med. 19: 704-12, 2013). It has been found that transgenic expression of active TGF-I31 in osteoblastic cells induced osteoarthritis, whereas inhibition of TGF-(3 activity, by means of a Tr3R11 dominant negative receptor, in subchondral bone, attenuated the degeneration of articular cartilage leading to less development of osteoarthritis. It has also been reported that mice expressing a dominant negative type ll TGF-13 receptor (TI3R1I-DN) in osteoblasts, show decreased TGF-13 responsiveness in osteoblasts and increased bone volume, demonstrating that endogenous TGF-beta acts directly on osteoblasts to regulate bone remodeling, structure and biomechanical properties (Filvaroff, E. et al.
Development, 126: 4267-4279, 1999). In addition, TGF-13 also regulates osteoclastogenesis and osteoclast survival, in part through the induction of osteoprotegerin (OPG), a protein known to inhibit osteoclast formation and function (Thirunavukkarasu K, et al. J. Biol. Chem. 276:36241-36250, 2001).
Transgenic mice that overexpress the dominant-negative type II TGF-13 receptor (dnTgfbr2) in skeletal tissue exhibit progressive skeletal degeneration (Buckwalter JA, et al. Clin Orthop Re/at Res 423: 7-16, 2004). The articular chondrocytes in the superficial zone of cartilage tissue become hypertrophic with increased type X

collagen expression. Loss of proteoglycan and progressive degradation of cartilage tissue have been observed in 6-month-old mice which strongly resemble human osteoarthritis (OA) (0A-like) (Serra R, et al. J Cell Biol 139: 541-552, 1997). TGF43 signaling plays a critical role not only in the regulation of chondrocyte homeostasis during cartilage destruction, but also in the manipulation of subchondral bone cell behavior during osteophyte formation, another feature of OA (van der Kraan PM, et al.
Osteoarthr Cartilage 15: 237-244, 2007).
The role of the TGF-13. signaling pathway in osteophyte formation was further explored by blocking studies using specific TGF-13 inhibitors. Several groups demonstrated that ablation of endogenous TGF-13 activity, by intra-articular overexpression of soluble TGF-13 type II receptor extracellular domain or Smad7, suppresses osteophyte formation in experimental murine OA models (Scharstuhl A, et al. J Immunol 169: 507-514, 2002). These observations clearly demonstrate that ICE-13 plays a dominant role in the induction of osteophytes, at least in murine OA models.
In vivo, TGF-131 also induces angiogenesis (Madri JA, et al. J Cell Biol. 106:

1375-1384, 1988; Roberts AB, Proc Nat! Acad Sci USA. 83: 4167-4171, 1986; Yang

2 EY, et al. J Cell Biol. 111: 731-741, 1990.). In OA, high TGF-131 levels are also accompanied by high levels of angiogenesis. Hepatocyte growth factor (HGF) is a potent mitogen, morphogen, and motogen for a variety of cells, mainly epithelial cells.
Increased expression of the HGF/HGF-receptor system in osteoarthritic cartilage, suggest a regulatory role in the homeostasis and pathogenesis of human joint cartilage (Pfander D, et al. Osteoarthritis Cartilage. 7: 548-59, 1999).
Previous studies have shown that TGF-f3 can promote angiogenesis and tumor invasion via stimulation of HGF expression (Chu SH, et al. J Neurooncol., 85:
33-38, 2007; Lewis MP, et al. Br J Cancer 90: 822-832, 2004)). Conversely, TGF-13 has also been shown to inhibit HGF transcription, potentially through binding of a TGF-inhibitory element located approximately 400 bp upstream of the HGF
transcription start site (Liu Y, et. al. J Biol Chem., 269: 4152-4160, 1994; Plaschke-Schlutter A, et al. J Biol Chem., 270: 830-836, 1995), and abrogation of this effect leads to cancer development (Cheng N, et al. Cancer Res. 67: 4869-4877, 2007).
Quinolones (QNs) antibiotics such as Ciprofloxacin (CPFX) were widely used in clinical practice owing to their wide spectrum antibacterial activity and high degree of bioavailability. They were not approved for use in children and adolescents due their toxic effects on joint cartilage of immature animals (Cuzzolin L, et at.
Expert Opin Drug Saf 1: 319-24, 2002). Quinolones, administered systemically, caused arthropathy and tendinopathy when given during the growth phase (Sendzik J, et al. Int J
Antimicrob Agents 33: 194-200, 2009.). It was reported that Ciprofloxacin decreased thickness of articular cartilage of the femoral condyle, inhibit proliferation of cultivated chondrocytes and secretion of soluble proteoglycans in a concentration- and time-dependant manner in juvenile rats (Li, P. et al. Arch. PharmacoL Sin. 25: 1262-1266, 2004).
Chondrocyte cluster formation is a feature of all mechanical and chemical OA
models (Moriizumi T, et al. Virchows Arch B Cell Pathol Incl Mol Pathol., 51:
461-474,

3 1986; van der Kraan PM, et al. Am J Pathol., 135:1001-1014, 1989). Animals with quinolone arthropathy showed cavities in the middle zone of the articular cartilage containing necrotic chondrocytes. After 14 days, many of the lacunae in defective areas contained chondrocyte clusters. When treated for 14 days, and after a 14-day recovery period, territorial matrix had been deposited around individual chondrocytes within the clusters, indicating that in immature joints there is a certain degree of spontaneous repair by cluster cells (Sharpnack DD, et al. Lab Anim Sc., 44:
436-442, 1994). It has been shown that TGF431 is activated in the subchondral bone in response to altered mechanical loading in an anterior cruciate ligament transection (ACLT) osteoarthritis mouse model (Zhen G, et al. Nat Med. 19: 704-12, 2013).
Additionally, CPFX was found to up-regulate TGF-131 production by HT-29 cells and its anti-proliferative effect was abolished when TGF-f31 was blocked (Bourikas LA, et al.
Br J Pharmacol. 157: 362-70, 2009).
Adipose derived stem cells (hASCs) express cytokines such as IL-6, GM-CSF
and Flt3-ligand (Tholpady SS, et al. Clin Plast Surg 33: 55-62, 2006; Katz AJ, et al.
Stem Cells. 23: 412-23, 2005; Schafer A, et al. Stem Cells 25: 818-827, 2007).
These cytokines are regulated by TGF-131 either negatively (GM-CSF, SCF and Flt3-ligand) (Jacobsen SE, et al. J Immunol., 151: 4534-4544, 1993; Jacobsen SE, et al.
Blood 87:
5016-5026, 1996) or positively (IL-6, TPO) (Ramsfjell V, et al. J lmmunol.
158: 5169-5177, 1997.). Recently, overexpression of a dominant negative mutant of the human T13R11 receptor (Ti3R11-DN) in mammalian cells has been shown to be very effective in blocking TGF-131 action. This mutant, based on the isoform A of the receptor, is capable to bind TGF-131 but signaling is disrupted due to the absence of a serine/threonine kinase domain. Ti3RIIA-DN has been shown to disrupt TGF-131 mediated signaling allowing the study of the behavior of different cell types in the absence of either a paracrine or an autocrine effect of the cytokine (Fan X, et al. The

4 Journal of Immunology 168: 755-762, 2002.).
Various documents disclosing different TGF-I31 receptors, chimerics, fusion proteins, domains, are known, for example, EP0975771, WO 2008/157367, US
2006/0247198, US 6001969, and WO 94/09815.
SUMMARY OF THE INVENTION
A soluble isolated isoform of the TGF beta II receptor is provided comprising a sequence of about 80 amino acids and lacking the transmembrane domain; wherein the isoform would be acting as a TG93-1 agonist. In a preferred embodiment, the amino acid sequence of the isoform has at least 85 %, 90 %, 95 %, or 99 %
identity with the amino acid sequence set forth in SEQ ID No. 2. The isoform comprises within its sequence the peptide disclosed in SEQ ID No. 12.
A polynucleotide encoding a soluble isoform of the TGF beta II receptor is provided, which in a preferred embodiment has at least 90 `1/0, 95 %, or 99 %
identity with the nucleotide sequence of SEQ ID No. 1. In another preferred embodiment, the polynucleotide further comprises a Kozak sequence.
A fusion peptide is provided comprising an isoform of the TGF beta II receptor fused to a ligand. In a preferred embodiment the isoform is an amino acid sequence having at least 85 % sequence identity to SEQ ID No. 2 and the ligand is the Fc of an immunoglobulin.
An antibody binding the soluble isoform of the TGF beta ll receptor is provided.
In a preferred embodiment, the antibody binds the amino acid sequence shown in SEQ ID No. 12.
A method of treating diseases associated to TGF-(3 dysregulation is provided, comprising administering to a mammal in need thereof the soluble isoform of the TGF
beta receptor.
A method of treating diseases associated to TGF-I3 dysregulation is provided, comprising administering to a mammal in need thereof an antibody binding the soluble isoform of the TGF beta II receptor. In a preferred embodiment the antibody recognizes and binds the amino acid sequence shown in SEQ ID No. 12. The associated diseases may be selected from any disorder related to dysregulation of TGF-P signals, such as cancer, fibrosis, and cardiovascular diseases;
metabolic and musculoskeletal defects, mutations in TPRII (TGFBR2 gene), for example, Loeys-Dietz syndrome (LDS), Marfan syndrome type 2 (MFS2), or different aneurisms (FTAAD).

DESCRIPTION OF THE DRAWINGS
Figure 1 shows a schematic diagram of the TI3RII receptor indicating the extracellular (ECD), transmembrane (TMD) and intracellular (ICD) domains. FP
and RP boxes indicate the forward and reverse primers used to amplify the TPRII
cDNA by RT-PCR.
Figure 2 shows a gel with the results of recombinant plasmid digestion containing the two already described human T13R11 (A and B) isoforms and the newly described by the present inventors, TpRII-SE, obtained by RT-PCR from human lymphocytes.
Figure 3 shows the alignment of partial cDNA sequences of the two known T13R11 (A and B) isoforms, and the one disclosed in the present application (TPRII-SE);
cDNA sequences include the start codon (ATG) and the last nucleotide encoding the transmembrane domain (TMD); the dark grey bar indicates an additional deletion found in exons II and III of TpRII-SE.
Figure 4 shows alignments of partial predicted protein sequences belonging to the human TpRII isoforms A and B, and the Tf3R1I-SE; light grey boxes show residues involved in disulfide bridges critical for receptor-ligand bonding (C54-C71, C61-C67);
dark grey boxes show residues which are fundamental for interaction with TGF-f3 (D55, 176, E142).

Figure 5 shows the results of detection by RT-PCR of the different T6RII
isoforms (A, B and SE) in different human cell types; HT1080 (fibrosarcoma), (pulmonary adenocarcinoma), CaCo-2 (colorectal adenocarcinoma), Hep3B (hepatic carcinoma), Jurkat (acute T-cell leukemia), 2931 (epithelial cells from embryonic kidney immortalized with the SV40 virus large 1-antigen), HEK-293 (epithelial cells from embryonic kidney immortalized with adenovirus), EBV-LCL (lymphoblastoid cell line immortalized with the Epstein-Barr virus), and hASC (stromal mesenchymal cells from human adipose tissue).
Figure 6 shows the results obtained by flow cytometry plots showing cell purity of monocytes (CD14+), B-cells (CD19+), and T-cells (CD3+) separated by immune purification.
Figure 7 shows Tf3RII splicing variant mRNA profiles in human leukocyte subsets, such as granulocytes, T-lymphocytes (CD3+), B lymphocytes (CD19+), and monocytes (CD14+).
Figure 8 shows lentiviral vectors encoding the newly described hT6R1I-SE
variant and a dominant negative (DN) mutant of the T6R1I-A receptor under the action of the CMV promoter; as a control, a lentiviral vector encoding eGFP under the CMV
promoter was used. The complete names of the vectors are indicated at the left side of the diagram. The abbreviated names are shown on top of each vector.
Figure 9 shows overexpression of T6R1I-SE in A549 cells. A): results of a flow cytometry analysis showing the percentage of eGFP expressing A549 cells transduced with a lentiviral vector encoding T6R1I-SE (Lt-T6R1I-SE) and control vectors;
B): results of a RT-PCR showing overexpression of T6R11-SE at the mRNA level; C): results of a demonstration of the presence of T6R1I-SE only in the supernatant of cells transduced with Lt-T6R1I-SE as detected by Western blot with a T6R11 specific antibody recognizing the extracellular domain.

Figure 10 shows the results of a proliferative MIT assay. A): A549 cells untransduced (UT) and transduced with Lt-T6R1I-SE, Lt-TpRIIA-DN, and Lt-eGFP, treated with 0.4 nM TGF6-1 and untreated. B): TGF6-1 curve in A549 cells transduced with a lentiviral vector encoding T6R1I-SE and untransduced (UT). *p<0.05;
**p<0.01, ***p<0.001.
Figure 11 shows: A) results of a flow cytometry analysis of hASC transduced with lentiviral vectors encoding T6R1I-SE, T6RIIA-DN, and eGFP; and untransduced (UT), and B) representative histogram showing percentage of purity after cell sorting.
Figure 12 shows the results of a RT-PCR analysis of hASC cells showing overexpression of T6RIIA-DN and T6R1I-SE; GAPDH was used as reference gene.
Figure 13 shows relative mRNA levels of T6RII receptors (T6R1I-A, T6R1I-B and T6R1I-SE) in untransduced hASCs (UT) and transduced with Lt.T6R1I-SE.
Figure 14 shows mRNA levels of 16R11 receptors in hASCs cells incubated with and without exogenous TGF6-1.
Figure 15 shows mRNA levels of isoforms T6R1I-A and T6R1I-B in hASCs cells transduced with lentiviral vectors (Lt) encoding 16R11-SE and control vectors incubated with and without TGF6-1.
Figure 16 shows X-ray images of rats treated with ciprofloxacin (CPFX) and intra-articularly injected in the knees with Lt.coT6R1I-SE, Lt.eGFP, and culture medium (vehicle). White arrows indicate radiolucent images.
Figure 17 shows a graphic of serum level measurements for aspartate transaminase (AST), in the same animals.
Figure 18 shows a cDNA alignment to compare changes made to the recombinant T6R1I-SE. To obtain coT6R11-SE/Fc (underlined sequence), a Kozak sequence (light gray box) was included in the TpRII-SE cDNA, to make translation initiation more efficient. Additionally, some nucleotides have been changed (black boxes with white letters) for codon optimization, to make translation more efficient in human cells. To allow fusion in frame of cDNA with the human IgG-Fc domain cDNA, the stop codon of Tf3R1I-SE was removed (italics) and replaced by a Bg/II
recognition sequence in the new construct. Primers used for PCR-amplification of human IgG1 Fc coding sequences are shown in dark gray boxes.
Figure 19 shows protein alignment to compare changes made to the recombinant TpRII-SE. coTpRII-Se was fused "in frame" to the human IgG1 Fc domain. Asterisk: Stop Codon; Black Box: linker aminoacids; Grey box: Fc domain.
Figure 20 shows a schematic diagram of the self-inactivating (SIN) bicistronic lentiviral vector encoding the fusion cassette coTPRII-SE/Fc together with ires eGFP, under the control of an internal CMV promoter.
Figure 21 shows flow cytometry dot plots demonstrating the efficiency of vector transduction of Lt.coTpRII-SE/Fc.ires eGFP and the control vector Lt. eGFP.
Figure 22 shows the results of an agarose gel electrophoresis with RT-PCR
products, using primers for amplifying IgG1 Fc, from RNAm of Mock, Lt.eGFP, and Lt.
coTPRII-SE/Fc transduced A549 cells.
Figure 23 shows the results of a Western blot of cell lysates (CL) and supernatants (SN) from proteins of Mock, Lt.eGFP and Lt. coTpRII-SE/Fc transduced A549 cells.
Figure 24 shows the effect of TPRII-SE/Fc overexpression on gross appearance of livers in CCI4-induced liver fibrosis in rats. Representative images of livers corresponding to animals treated with vehicle (A), 0014 (B) or Lv.TpRII-SE/Fc + CCI4 (C).
Figure 25 shows the effect of TpRII-SE/Fc overexpression on body weight and in the liver to body weight ratio in C014-induced liver fibrosis in rats. A) Body weight gain (%) of animals in the different experimental groups. B) Liver to body weight ratio (`)/0) in the different experimental groups. *p<0.05: Vehicle vs CCI4;
#p<0.05: CCI4 vs Lv.Tr3R1I-SE/Fc + CCI4.
Figure 26 shows the effect of TPRII-SE/Fc overexpression on serum liver enzymes in CCI4-induced liver fibrosis in rats. Activity levels of serum liver enzymes in the different experimental groups: A) AST, B) ALT, C) ALP. Results are expressed as IU/L. *p<0.05: Vehicle vs CCI4; #p<0.05: CCI4 vs Lv.T8R1I-SE/Fc + CCI4. AST:
Aspartate aminotransferase. ALT: Alanine aminotransferase. ALP: Alkaline Phosphatase. IU: International units.
Figure 27 shows the effect of T8R1I-SE/Fc overexpression on liver histology.
H&E staining. Representative images of liver histological sections stained with H&E of animals treated with vehicle (A), CCI4 (B) or Lv.T8R1I-SE/Fc + CCI4 (C).
Magnification 100x (upper panel) y 400x (lower panel).
Figure 28 shows the effect of T8R1I-SE/Fc overexpression on liver histology by Sirius Red staining. A) Representative images of liver histological sections stained with Sirius Red of animals treated with vehicle (A), CCI4 (B) or Lv.T8R1I-SE/Fc +
CCI4 (C).
Magnification 40x. B) Quantification of liver fibrosis. Results are expressed as mean percentage (%) of Sirius Red-positive area. *p<0.05: Vehicle vs CCI4; #p<0.05:
CCI4vs Lv.T8R1I-SE/Fc + CCI4.
Figure 29 shows the effect of T8R1I-SE/Fc overexpression on HSC activation.
Representative images showing a-SMA-positive areas in liver histological sections from animals treated with vehicle (A), CCI4 (B) or Lv.T8R1I-SE/Fc + CCI4 (C).
Magnification 40x.
Figure 30 shows the effect of T8R1I-SE/Fc overexpression on tumor growth in vivo. Increased volumen of subcutaneous TN60 mammary carcinoma in syngenic CH3 mice after intratumoral injection with the lentiviral vector of the invention, (1,5 x 106 tranduction units/tumor) encoding the recombinant fusion protein T8R1I-SE/Fc (Lv.TpRII-SE/Fc) (N=7) (circles); the dominant negative mutant TpRII-DN
(Lv.TPRII-DN) (N= 6) (squares); and vehicle (cell culture medium) (N= 6) (triangels).
*p<0,05;
**p<0,01.
Figure 31 shows flow cytometry evaluation of intracellular TpRII-SE in neutrophils from Rheumatoid Arthritis (AR) patients. Flow cytometry plots of lymphocytes (Top Panel) and neutrophils (Bottom Panel) from patients with low (P07), moderate (P02) and high (P03) disease activity, where 113R11-SE was detected by using the anti-TORII-SE monoclonal antibody of the invention conjugated with ATT0647N. Left Panel shows lymphocytes from PBMC (Top) and neutrophils (bottom) taken to analyze the percentage of cells expressing TpRII-SE.
Figure 32 shows the correlation analysis between the percentage of neutrophils evaluated by flow cytometry from 19 AR patients expressing TpRII-SE, and AR
disease activity measured by DAS28-ESR (Disease Activity Score ¨
erythrosedimentation rate) of the same patients. rs= Spearman's rank correlation coefficient.
Figure 33 shows the correlation analysis between TpRII-SE protein levels in peripheral blood plastic adherent cells from 5 patients evaluated by In-cell ELISA, and DAS28-ESR of the same patients. rs= Spearman's rank correlation coefficient.
Figure 34 shows the experimental design and time schedule of CCI4 injection, administration of the lentiviral vector of the invention, and sample acquisition for analysis. Animals were euthanized by CO2 inhalation after 72 hours of the last injection.
DETAILED DESCRIPTION OF THE INVENTION
A variant or isoform of the TGF beta receptor II is disclosed, which is expressed in human cells referred to herein as endogenous soluble TPRII (TPRII-SE) and that contrarily to other isoforms acts like a TGF-131 agonist.
By using specific primers, a region of the human TI3RII mRNA from T-lymphocytes only encoding the extracellular (ECD) and the transmembrane (TMD) domains and excluding the intracellular domain (ICD) was initially amplified by RT-PCR, (Figure 1).
After the PCR reaction, DNA products were cloned into the pGEM-T Easy plasmid. Plasmids were digested with Agel and Sall and revealed in an agarose gel the presence of clones with inserts of three different sizes (Figure 2). Clone contained an insert of 650 bp. In clones 3, 7, 8, 11, and 12 the insert size was of 580 bp and in clone 10 the size reflected the presence of an insert of 430 bp.
DNA sequencing and BLAST alignment (NCBI) of all clones indicated that clones 3, 7, 8, 11, and 12 (582 bp) were identical to human TGF 13 receptor II
variant A
(T13R11-A). Additionally, clone 2 (657 bp) showed 100 % identity with the isoform TpRII-B. Clone 10 (433 bp) was similar to the T13R1I-A sequence but with an additional 149 bp deletion. In this clone, the last 62 bp encoded by exon II and the first 88 bp encoded by exon III were absent, TI3R1I-SE (SEQ ID No. 1) (Figure 3).
The alignment of the predicted amino acid sequence of all three isoforms (Figure 4) indicated that the deletion found in clone 10 generates a frameshift starting at amino acid 68, which adds a stop codon 13 amino acids after the deletion generating a prematurely terminated 80 amino acids long isoform lacking the transmembrane domain and this is the new isoform TI3R1I-SE (SEQ ID No. 2).
This isoform differs in 12 amino acids at the carboxyl end compared to the membrane bound variants of T13R11 (isoforms A and B). Due to this, and according to the predicted amino acid sequence, the TI3R1I-SE isoform of clone 10 lacks pivotal sites for the productive action of TGF-I3 such as amino acid 176 of SEQ ID No.
3 that contributes to the ligand-receptor binding through hydrophobic contact; amino acid E142 of SEQ ID No. 3 which forms hydrogen bonds with R25 of TGF-13 increased affinity and determined binding specificity and amino acid C71 of SEQ ID No. 3 which forms a disulfide bridge with C54 of the same receptor (see Figure 4) necessary both for binding to the ligand and for signaling (reference, Alain Guimond, et. al.
FEBS
Letters 515: 13-19, 2002). Thus, the TORII-SE isoform might not be able to bind TGF-131 with the same affinity than that of known isoforms. Additionally, due to the premature termination, the TORII-SE isoform lacks the amino acid sequence belonging to the transmembrane domain (TMD), showing the presence of a new endogenously secreted soluble TORII isoform in human T-lymphocytes.
As previously mentioned, the new isoform is referred to as TORII Soluble Endogenous (TORII-SE). The TORII-SE isoform is different from the secretable genetically engineered TORII isoform. The latter is an artificial TORII
receptor with a truncated TORII-A fused to the Fc region of human IgM and blocks the effects of TGF-13, thus acting as an antagonist (reference, R. J Akhurst. J. Clin. Invest.
109: 1533-3610, 2002).
To determine the theoretical molecular weight of the TORII-SE isoform, post-translational modifications (PTM) predicted from the amino acid sequence (SEQ
ID
No. 2) were established by using different computer programs (Table 1). In this analysis, three glycation sites at K46, K52 and K78 (NetGlycate program) (Johansen, M. B.; Glycobiology 16: 844-853, 2006); three phosphorylation sites at S31, 359 and Y73 (NetPhos program) (Blom, N.; Journal of Molecular Biology 294: 1351-1362, 1999) and one site for sumoylation in K46 (SUMOplotTm program, ABGENT, CA, USA) were identified. On the other hand, sites for sulfonation, C-mannosylation, 0-GaINAC
glycosilation, 0-glycosilation, N-glycosilation, myristoylation, and palmitoylation were not found in TORII-SE. In this study it was estimated that the molecular weight of the mature TORII-SE isoform was of about 18.4 kDa.

Table 1.
In silico analysis of the TORII-SE amino acid sequence showing predicted post-translational modifications and molecular weight with and without modifications.
Predicted p1/theoretical 9.64/9161.72 Mw p1/Mw without a signal 9.05/6532.51 6,532.51 kDa peptide Secretion probability of 0.960 (first 12 aa) SignalP Program the signal peptide Clivage site Between pos. 23 SignalP Program and 24 C-mannosylation No sites GaINAc 0-glycosylation No sites Glycations 3 sites (Lys 46, 52, NetGlycate 0.558 kDa and 78) Program (0.186 kDa each) N-glycosylations No sites NetNGlyc Program 0-Glycosylations No sites (OGPT Program) 0-(beta)-GIcNAc No sites Myristoylation No sites Palmitoylation No sites Phosphorylation 3 sites (Ser 31 and NetPhos 0.285 kDa 59, Tyr 79) Program (0.095 Da each) Sulfonations No sites Addition of SUMO 1 site (Lys 46) SUMOplot 11 kDa protein program Final Mw with 18.4 kDa modifications To confirm whether TORII-SE mRNA was also present in human cells other than lymphocytes, we amplified by RT-PCR using the same set of primers various human cell lines and primary cultures (Figure 5). It may be observed that human solid tumor derived cell lines, for example, HT1080 (fibrosarcoma), A549 (lung adenocarcinoma), CaCo-2 (colon cancer) and Hep 3B (hepatocellular carcinoma) only showed the presence of mRNA of variants A and B, but not TORII-SE. Additionally, in Jurkat cells (acute lymphoid leukemia), 2931 cells (embryonic kidney cells immortalized with the SV40 1-antigen), HEK-293 cells (embryonic kidney cells immortalized with the adenovirus El A protein, EBV-LCL (Lymphoblastoid Cell Line immortalized with the Epstein Barr Virus) and ASC (human adipose derived mesenchymal stem cells) passage 6 primary culture, mRNA encoding for TORII-SE was present in all cases (Figure 5). The presence of the TORII-SE isoform was further confirmed by DNA
sequencing.
To check whether TORII-SE is also present in leukocytes different from T-lymphocytes, granulocytes, monocytes, B-cells and 1-cells were purified from human peripheral blood by density gradient and subsequent magnetic immune-purification with specific monoclonal antibodies, to high purity (Figure 6). RT-PCR
analysis showed that TORII-SE is present in all leukocyte subsets but with different expression levels (Figure 7).
To determine whether TORII-SE may be secreted to the extra cellular medium, TI3R1I-SE cDNA was cloned downstream from the ubiquitous promoter CMV in a self-inactivating (SIN) bicistronic lentiviral vector also expressing eGFP, as described in the examples, to generate the Lt-TORII-SE vector. As a control, two lentiviral vectors were used: one bicistronic encoding a dominant negative TORII mutant together with eGFP
(Lt-TORIIA-DN) and another encoding eGFP alone (Lt-eGFP), also under the action of the CMV promoter (Figure 8).
With these lentiviral vectors, shown in Figure 8, A549 cells were transduced, at an MOI of 50. Seventytvvo hours after transduction, cell supernatants were frozen for further experiments and the percentage of eGFP expressing cells was measured by flow cytometry (Figure 9A). In cells transduced with Lt-TORII-SE and Lt-eGFP, 68.63 % and 65.27 % of the cells, respectively, showed integration of the lentiviral vector as demonstrated by eGFP expression. RT-PCR of Lt-TORII-SE transduced cells revealed the presence of a 433 bp band, indicating overexpression at the mRNA level of the TORII-SE isoform (Figure 9B). Cell supernatants were thawed, and Western blotted as described in the examples (Figure 9C). Only TpRII-SE was detected in the supernatant of Lt-TpRII-SE transduced A549 cells cultured in the presence of protease inhibitors.
The molecular weight of 113R11-SE detected by Western blot is in agreement with the predicted molecular weight, after the addition of post-translational modifications (18 kDa) (Table 1). This is the first evidence ever that there exists a new secretable TpRII receptor variant or isoform in human cells.
To show the function of the TpRII-SE isoform, functional assays were carried out wherein untransduced, expressing nearly undetectable levels of TpRII-SE, transduced with lentiviral vectors encoding eGFP alone, or bicistronics together with either TpRII-SE or the dominant negative (DN) mutant of the TPRIIA variant known to work as a TGF-P1 antagonist, A549 cells were used.
Initially, MTT ((344,5-dimethylthiazol-2-y1]-2,5-diphenyltetrazolium bromide;
thiazolyl blue) assays were performed to evaluate if overexpression of TpRII-SE
inhibits or not cell proliferation in the presence of 0.4 nM TGF13-1 (Figure 10A). As may be noted, in the presence of TG193-1, TpRII-SE-transduced cells proliferate significantly less than the same cells not treated with TGFP-1 and at levels found in control untransduced cells (UT) and Lt.eGFP-transduced cells.These results indicated that TPRII-SE is not a TGFP-1 antagonist.
Additionally, to check whether TPRII-SE acts as a TGF3-1 agonist, A459 cells either overexpressing TORII-SE or not (untransduced cells or UT) were incubated in the presence of increasing concentrations of TGFP-1 (Figure 10B). These results show that in UT cells, proliferation started to decrease in the presence of 0.2 nM

compared to the values obtained in the absence of TGF131. However, in cells overexpressing TPRII-SE, proliferation started to decrease at a TGFp-1 concentration of 0.1 nM compared to the same cell line without the addition of TGF-I31.
These results indicate that in cells overexpressing TORII-SE, TGF3-1 achieved the same effect than in UT cells but at half concentration, which would suggest that the TORII-SE
isoform may act as an agonist.
To further assess the agonistic role of the 113R11-SE isoform, hASCs were transduced with Lt-TORII-SE, Lt-TORIIA-DN, and Lt.eGFP, at an MOI of 150 as described in the examples. Seventy two hours after transduction the percentage of eGFP expressing cells was measured by flow cytometry (Figure 11A). For further experiments with pure cell populations, transduced cells were expanded and cell sorted in a FACSAriall Cell Sorter (Becton Dickinson, San Jose, CA) to a purity of eGFP-expressing cells of more than 90 % (Figure 11B), indicating that most cells overexpress the new isoform.
RT-PCR performed on poly A+ mRNA from either transduced or untransduced hASC cells showed the pattern of TORII isoforms expression depicted in Figure 12.
Cells overexpressing TORII-SE showed a strong band of 433 bp and a weak band of 582 bp reflecting the fact that overexpression of TORII-SE downregulates TORII

isoform A expression. Similarly, when TORIIA-DN was overexpressed in hASC
cells, TORII-SE expression (433bp) could not be detected. Finally, in hASC cells transduced with the lentivector encoding only the eGFP marker gene, a weak band representing expression of TORII-A was detected, suggesting that viral transduction "per se"
downregulates TORII expression.
mRNA levels of all three isoforms of Type ll TGF-13 receptor were also quantified by qRT-PCR (Figure 13). It was found that in untransduced cells (UT), membrane bound TBRII-A and B variants were the main molecules to be expressed and TORII-SE expression was minimal, as expected. Contrarily, when the new isoform expression was increased in hASC cells, both TORII-A and B variants decreased dramatically, due to a compensation effect which shows the agonistic effect of the T6R1I-SE isoform.
This compensation effect was also verified by addition of exogenous TGF-61 and analysis of mRNA levels of the T6R11 variants in hASCs cells (Figure 14).
It was found that upon addition of TGF-131 , T6R11-A increased and TI3R1I-SE
decreased compared to untreated cells, suggesting once again that the TpRII-SE isoform acts as a TGF-61 agonist.
According to this, it was also found that mRNA of both T6R1I-A and Ti3R1I-B
are highly upregulated (40- and 50-fold increase, respectively) in cells overexpressing Lt-T6R11-SE in the presence of physiological concentrations of TGF-I31 compared to levels of mRNA produced in the absence of exogenous TGF-61, further confirming the role of Ti3R1I-SE acting as a TGF-131 agonist by increasing the expression of membrane-bound receptors Ti3R11 and TI3R1I-B (Figure 15).
Furthermore, the effect of TI3R1I-SE recombinant isoform was measured on a panel of 80 cytokines secreted by hASCs cells (Figure 16). Cells were transduced with either control Lt-GFP, the TGF461 inhibitor Lt. Ti3R1I-DN, or Lt-T6R1I-SE and incubated in the presence or absence of exogenous TGF-61. Collected supernatants were used to analyze the cytokines in a Cytokine Array G5 (Raybiotech, Inc. Norcross, USA).
Table 2.

Pub:Kona 7G7-111 Paramine TC4-1(1 ape/sal) III 711911-ON Ilt.763111-SE Imuutuced ;u.T3111I-SE
Hernatopmef feeetolones stenulobbeticaytokines , 1..CSI _i I 4, _ 6-C66 ar lab, 4 M C Y T I UC 38-CSE abs GIVI.tsf T ! -7 Guts, T RAI 4 11.6. UC , 1X 11.-6' IX UC
T (UM 1 4, 11.7 UC 1 _ 4 _ UF 1.1- 1 UC UF _ 73A1...g_a..- tic ar3 1 FL13-1. UC- UC__.
SCF abs ' alb WI LC UC ,.

It. 3 T = 1/C ii 3 4 4. .
Om M UC ! .1. Onc M abs abs , An logerec tram** An4O98n.r cytoteses 11C3F t(045) - . 4(1,854 VEGF _ J(235) ; 1...0 Anrcgen.n LC LK Angogenon .3. (159) I (K , Ha 3.4181) Is (465) SIGF 4. t(416) _ (OF abs abs CGS 4 1161 Ur 4 111,1 4. 4. .
thane-tines C he rno4ones GPO VC _ _ , LOC_ GPO tic 1 UC
eXCII)GRCR 1` (IC C XCL1 (C.90 abs - labs CMOS (EN13., VC t 11.63 C5C15 ((NA- / (1,64) , OC
_ 0106(6CP. tX (IC SeCt6 (GCP. / (2,41) 4. .
8 OICLAM.83 _ 1K. 41461 76 (xas vt. al) IX 441.57a cxcpitas,a (IC (IC . CXC19 (7-08G) 4 - -_. - 4.
CINI 10(11.1 tit-- - . (IC CX.C110OP 1, 4- - 4.
Ceal2(601 i" UC OK& 1/ iSOt tit - abs -ClfC113(13LC abs ran CXCL13 i 81C 4. 4 CC1.1 (I. 309) T UC (CLIP-309) in abs õ
(C1.2 (MCP-1 IX ix Ca/ (MCP. 1 IX ! UC
CCI4IMP1b 1- '. UC CCIAIMPIO abs labs CCL511413411 4(198) . 4(7,85) CC1.51PANTE 4(3.33) ', -5.(42q CCL7 (mu,- 1 IX , LK Cal (MCP-1 IX / TAM_ E CCL8 (MCP. a 4.13,60) .i. E cctsimcp.; t 1 uc CCM (Colas VC -, 4.42,31) CCL111Fo1a, IX IX
CCLITITARC UC / 1.1C CCU 7 1 TAIIC IX UC .
CCL1S (PARC 113.46) I 4. CCL181PARC 4 T 13,381 CCL2OEM.P3,abs abs ccul? (MT A_ UC vc .(1.1-2'.1([0% =& _ . k _ _ CC124 (FotaNabs abs CCL/61totatabs teb; Cale (Eota.abs _abs (61-fl family TWA F anal 701-81 T 1E57/ ' 1== 1494/ TGF-41 I tIC i VC
10 tC4- i= Ma , ) t 4. (LW TGF-42 IX i 4.12.271 IONA. like Growth Factor Supertanot Insulin tete Growth Facto, Supwfarmi) 101.1 4. 1 161.1 as *FP- 1 l= lIC I0111-1 its -1G7BIT 3 4(11,88) 4 I0181.3 4 1: 4 , 166111,11 at abs ttaFeR.4 VC , T .
Turner Necrosis ream Sumatra'', Yuma NOCTIAllof WO, SYDVI8Tily 9041,4 t ViTii 1 4' iNf.stplia ... UC__ 4.,___ 1141-it tie 4.114151 1141.4 . 4. 1 lIGHT abs in LIGHT 4 I- 4 .
f throated Growth Pato, Parole Ilboblast Growth Factor family FGF -7 VC 4. FC4-7 * ' -- = abs .
101.9 / . LC 101.9 I uc tic bleutotthobas Neurotrophins , WOO T l uc SOW abs abs NT 3 T 1 tX NT-3 Er .
4, _ 141-4 EK UC 661,1 in abs .
we Inhibitor of Metalloprotemases Fat ue inthhitar of Metal lop ot einases Fat NW- 1 (IC I UC TOO- 1 1(226) 1 IX
THAV 2 IX ! IX 111/P-2 .7 (7-071 I
('(1.12) Macrophage Actwatinp Factors Macro , Actvannii C a COM
Pail tIC i .4. 4811 y I y MN (IC 1 t_tk9a MI4, (1,78) ' VC
= ., R./ t 1 (IC ff.- 2 labs tabs t -I
Bone Remodeling C/toh ines Bone beinedeltheCiottoes Osteopaths abs abs Osteopootil 4. 4.
Osteoprotes t/C ! UC Oueoptote UC 4(8.32) Hormones H0f1110MS
100tin I 4(E79) / .1 16PI1P I 441.12) 1 4. (ILU) WU Farn.I 61:441 Farnrly GONF i ur I it 14*0 Wig lob, :
ftnts=inflammatonf lotetletabls Anti snflemmatote Intsrls.km, 11.-10 t 1 14 11.10 1 11-13 I_ t stAiLl 4.
4Ø471 4 11.13 4. I 4. _ Pio otammatory Interleulorn= Pro..nllamrrtwor e ,nterle.tins=
IL-la C(8.11) t 4, '11,. 4. , .4.
IL. Li in t ,abs It-18 UC UC -- IL-5 . (IC 1. 1E871 11. 5 _ t (541) .4, ..
It.12p211... 1 , Ix' _ 11.17pm õ.4, .. 4. .
11 15 in ,abs It-15 4, 4. _ The results obtained with cytokine arrays are shown in Table 2. Increase or decrease of cytokines levels are referred to the levels secreted by cells transduced with the control vector Lt.eGFP either in the presence (paracrine) or absence (autocrine) of exogenous TGF-131 . UC: unchanged levels with respect to cells transduced with the control vector Lt.eGFP. Abs: absent in mock transducer cells control. Dark grey boxes: decreased to undetected levels or absent in the supernatant of cells transduced with control vector Lt.eGFP.
Light gray boxes: cytokines present.
It is shown that in ASC cells overexpressing Tr3R1I-DN with a high TGF-131 concentration, OPG secretion remains unchanged with respect to the values obtained in Lt.eGFP-transduced control cells, making cells insensitive to TGF-I31.
On the other hand, high TGF-131 concentrations caused a dramatic drop of OPG
secretion in Tf3R1I-SE overexpressing cells compared to control cells (Lt.eGFP-transduced). The Tr3R1I-SE isoform acts oppositely to the TGF-131 inhibitor (TPRII-DN) and seems to favor osteoclastogenesis.
Table 3 summarizes the results obtained by other authors, and those compared to the results disclosed in the present application regarding the cytokine array and the relationship with osteoarthritis (OA).
Results of the MSC/Osteoblasts Disease Bone/cartilage remodeling Invention Bone loss/increase of osteoclastic Lower OPG
resorption TGF-131 agonist High TGF-131 OA Increased PTG content Higher HGF
High angiogenesis TGF-131 agonist Osteophyte outgrowth Higher OPG
Decreased osteoclastic resorption Decreased PTG
TGF-131 inhibition (TpRII-DN) antagonist No 0A-like content/increased cartilage loss HGF
Angiogenesis TGF-131 Decreased osteophyte formation antagonist It is shown that in cells overexpressing T13R11-SE HGF secretion is highly upregulated both in the presence (4.16 times) or absence (7.65 times) of exogenous TGF-131, whereas in cells overexpressing the dominant negative mutant TpRII-DN, HGF secretion decreases 1.81 times or is absent, in the absence and presence of exogenous TGF-P1 , respectively. These results show that the TpRII-SE isoform is involved in the positive regulation of HGF.
Increased TGF-131 acts differently in animals depending on whether injections were applied in normal or osteoarthritic models. In normal animals, either TGF-protein or adenovirus TGF-131 injection generates increased synthesis and content of proteoglycan and osteophyte formation. On the other hand, in osteoarthritis (OA)-induced models, increases in the TGF pathway help to decrease cartilage damage, proteoglycan and osteophyte formation. Thus, the effect of the 11311-SE
isoform was analyzed either in CPFX-treated juvenile rats (24 days old) or untreated rats, by intra-articular injections of lentiviral vectors encoding a recombinant protein of the codon-optimized (co) TPRII-SE fused to the constant fragment (Fc) of the human immunoglobulin 1 (IgG1) (Lt.coTpRII-SE/Fc) or the enhanced green fluorescent protein (Lt.eGFP).
Seven days after injecting the vector into rats treated with ciprofloxacin (CPFX), only articulations overexpressing the fusion peptide or a fused coTPRII-SE/Fc isoform showed radiolucent images with irregular borders in the femoral condyle, consistent with intraosteal geodes (Figure 16). It is shown that coTPRII.SE/Fc could cause osteolytic damage by bone resorption.
When compared to serum levels of urea, creatinine, total proteins, albumin, alkaline phosphatase, alanine transaminase (ALT), and aspartate transaminase (AST), a statistically significant difference was only found for the latter. An increase in aspartate transaminase (AST) was only observed in serum of rats treated with CPFX
and intra-articularly injected with Lt.coTpRII-SE (Figure 17). Mitochondrial and cytoplasmic forms of AST are found in all cells, so the increase of AST which was only observed in rats injected with Lt.coTpRII-SE/Fc in combination with CPFX show that coTi3R1I-SE enhance the effect of CPFX on tissue damage in muscle, tendons or other tissues.
In the present application, the generation of a new recombinant TPRII-SE
protein expressed in human cells is shown. It is known that in nature, the concentration of soluble receptors is very low, thus, to increase the levels of the recombinant Tf3R1I-SE protein, the original coding sequence was codon optimized, and a Kozak sequence was included (Epoch Biolabs Inc., Texas, USA) referred to herein as coTPRII-SE (SEQ ID No. 4) and encoded by SEQ ID No. 5 (Figure 18).
Additionally, to make the protein more stable in vivo, and for a more effective purification, the human IgG1 Fc region was cloned "in frame" downstream of the coding sequence of coTpRII-SE to obtain the fusion peptide coTpRII-Se/Fc, as previously mentioned (SEQ
ID No. 6), encoded by SEQ ID No. 7 (Figures 18 and 19).
As can be observed, Figure 18 shows a cDNA alignment to compare changes made to the recombinant TpRII-SE. To obtain the coTPRII-SE/Fc (underlined sequence), a Kozak sequence (light gray box) was included in the TPRII-SE
cDNA, to make the initiation of translation more efficient. Additionally, some nucleotides have been changed (black boxes and white letters) for codon optimization, in order to make translation more efficient. To allow fusion in frame of cDNA with the human IgG-Fc domain cDNA, the stop codon of TpRII-SE was removed (italics) and replaced by a Bg/II recognition sequence in the new construct. Primers used for PCR-amplification of human IgG1 Fc coding sequences are shown in dark gray boxes.
As can be observed, Figure 19 shows a protein alignment and allows for comparing changes made to the recombinant TpRII-SE. coTpRII-Se was fused "in frame" to the human IgG1 Fc domain. Asterisk: Stop Codon; Black Box: linker aminoacids; Grey box: Fc domain.

Subsequently, the recombinant coT8R1I-SE/Fc cDNA was inserted between the Agel and EcoRV sites of a SIN lentiviral vector (Figure 20).
To check recombinant protein production, A549 cells were transduced at an M01=300 either with the control vector Lt.eGFP (93 % of eGFP expressing cells) or Lt.coT8RII.SE/Fc (47.53 % of eGFP expressing cells) and Mock transduced (Figure 21).
To verify the presence of human IgG1 mRNA in Lt.coTPRII-SE/Fc transduced cells, total mRNA of Mock transduced (vehicle), Lt.eGFP transduced and Lt.coT8R1I-SE/Fc transduced cells was extracted and RT-PCR assays were performed using specific primers for human IgG1-Fc (Figure 22). As expected, human IgG1 Fc domain mRNA was only detected in Lt.coT8R1I-SE/Fc transduced A549 cells.
Additionally, to verify the presence of the TPRII-SE/Fc protein both in cell lysates and supernatants, total proteins from Mock, Lt.eGFP and Lt.coT8R1I-SE/Fc transduced cells lysates and supernatants were western blotted (Figure 23) using a monoclonal antibody, capable of specifically detecting T8R11-SE. In this way, a predicted protein of circa 50 kD could be detected, which included 18 kD of plus 35 kD of the human IgG1 Fc domain, both in cell supernatants and lysates of acoT8R11-SE/Fc-transduced cells only.
A method to treat liver fibrosis was developed employing the lentiviral vector encoding the fusion protein T8R1I-SE/Fc of the invention.
To study the effect of T8R1I-SE/Fc expression on liver fibrogenesis, a rat model of carbon tetrachloride (CCL4) induced liver fibrosis was used. After animal euthanasia, liver gross appearance was evaluated macroscopically. Figure 24 shows that livers from group I (vehicle), exhibited a reddish color, a smooth lustrous surface, and a regular shape. As it was expected, in CCI4-treated animals livers looked shrunken with irregular shape, an opaque color, and an unsmooth surface. Rat livers of the Lv.TORII-SE/Fc + CCI4 group had a more regular shape, were redder and their surfaces were smoother than liver surfaces of the CCI4-group. These results suggest a beneficial effect of TORII-SE/Fe expression at macroscopic level against 0CI4-induced fibrosis in rats.
Effect of TORII-SE/Fc expression on body weight and liver to body weight ratio:
body weight was controlled in all rats throughout the experiment. It was observed that CCI4 treatment during eight weeks caused a growth retardation of rats, evidenced by the decrease of final body weight gain compared to rats of the vehicle group.
Injection of Lv.TORII-SE/Fc partially reversed the BW loss induced by this hepatotoxic agent.
This beneficial effect was more evident after 4 weeks of CCI4 administration (Figure 25A). In addition, CCI4 administration induced an increase in the LW/BW ratio respect to the rats of the control group injected only with vehicle, suggesting liver injury and extracellular matrix protein accumulation. Injection of Lv.TORII-SE/Fc prior to the treatment with CCI4 led to a LW/BW ratio comparable to that found in the Vehicle group of rats, suggesting a beneficial effect of TORII-SE/FC expression against liver injury induced by CCI4 (Figure 25B).
Effect of TORII-SE/Fc expression on serum liver enzymes: to evaluate liver iniurv, AST and ALT serum levels were determined. As it is shown in Figures 26A and B, CCI4 administration significantly increased both transaminase levels respect to those found in the Vehicle group of rats. Conversely, injection of Lv.TORII-SE/Fc induced a significant decrease in AST and ALT levels. On the other hand, ALP
showed increased response to CCI4 administration, which was reversed as a result of the Lv.T13R1I-SE/Fc injection (Figure 26C). These data suggest that TORII-SE/Fc expression exerts a beneficial effect against liver injury induced by CCI4.

Effect of TORII-SE/Fc expression on liver architecture: histological sections were stained with H&E to evaluate the general architecture of the liver. This analysis revealed that animals that received vehicle instead of CCI4, presented livers with a conserved architecture with cords of hepatocytes radiating from central veins (Figure 27A). Conversely, CCI4 administration during 8 weeks led to a disrupted liver architecture, extensive liver injury and prominent fibrosis (Figure 27B).
These detrimental effects were clearly attenuated when animals were injected with Lv.T13R11-SE/Fc before the treatment with CCI4 (Figure 27C).
Effect of T13R1I-SE expression on liver fibrosis: collagen deposition was evaluated by Sirius Red staining in liver sections from different experimental group rats. CCI4 administration induced extensive deposition of collagen fibers evidenced by the observation of bridging fibrosis. Figure 28A shows that Injection of Lv.Tr3R11-SE/Fc reduced liver fibrosis induced by CCI4 (Figure 28A). Quantification of Sirius Red-positive areas (SR+) demonstrated a significant increase in collagen deposition in the CCI4 group compared to the Vehicle group. However, Lv.113R11-SE/Fc administration significantly reduced SR+ areas, with reference to the CCI4 group (Figure 28B).
Moreover, a-SMA expression, a known marker of hepatic stellate cell (HSC) activation, was evaluated by immunohistochernistry. In comparison to rats only injected with vehicle, CCI4 treated animals showed a prominent increase of a-SMA-positive areas.
However, HSC activation was markedly reduced in CCI4 rats treated with Lv.T13R1I-SE/Fc (Figure 29). These data demonstrates that TpRII-SE/Fc expression reduces HSC activation, decreases pathological collagen fiber deposition, and limits liver injury induced by CCI4.

Use of the Lv.TpRII-SE/Fc vector to treat cancer: it was observed that intratumoral TpRII-SE/Fc overexpression inhibits tumor growth (Figure 30), compare to controls.
Assays were conducted to determine rheumatoid arthritis (RA) disease activity by means of measuring TpRII-SE by flow cytometry, with the TpRII-SE monoclonal antibody of the invention, conjugated with ATT0647N. The percentage of neutrophils expressing TpRII-SE (Figure 31, bottom panel) was quantified taking as basal reference the highest 113R11-SE A110647N fluorescence value in the lymphocyte population of each patient. (Figure 31, top panel).
When the percentage of neutrophils expressing TpRII-SE of each patient was correlated with its matching disease activity score (DAS28-ESR) value, it could be observed a negative correlation (Spearman's rank correlation coefficient rs. -0,69), statistically significant (p= 0,0009), (Figure 32). These data suggested variation in the levels of this isoform in RA patients. In this sense, TpRII-SE might be used as a therapeutic target. Also, the results give evidence that the evaluation of TpRII-SE in neutrophils might represent an alternative assay to determine RA disease activity in patients.
Also, experiments were carry out to detect intracellular TpRII-SE
concentration by In-cell ELISA in neutrophils from patients (N=5) with diferent RA activity levels. (Table 4).
Table 4 Patient ID Number Relative TORII-SE levels 9 16,48 15,98 11 20,69 12 10,26 Relative intracellular TpRII-SE protein levels in neutrophils from RA patients were correlated with their matching DAS28-ESR score (Table 5).
Table 5 Patient ID Number Relative TORII-SE levels 9 2,76 10 3,09 11 4,22 12 4,31 13 6,24 When both sets of data were analyzed by the Spearman's Rank correlation test, a negative correlation was observed between Ti3R1I-SE levels and DAS28-ESR
(Figure 33), where 113R11-SE levels decreases while DAS28-ESR score increases (Disease activity: (Low = 2.4 < DAS28 3.6, moderate = 3.6 < DAS28 5 5.5, High = DAS28>

5.5 (2).
This invention is better illustrated in the following examples, which should not be construed as limiting the scope thereof. On the contrary, it should be clearly understood that other embodiments, modifications and equivalents thereof may be possible after reading the present description, which may be suggested to a person of skill without departing from the spirit of the present invention and/or the scope of the appended claims.
Examples:
Example 1: isolation, cloning and sequencing of the TPRII-SE isoform Human adipose derived mesenchymal stromal cells (hASC) were obtained from 20 g subcutaneous fat following the protocol described by Zuk et al. (Zuk PA, et al. Mol Rio' Cell 13: 4279-95, 2002) and cultured in the presence of DMEM supplemented with % human serum and 1 % L-glutamine. Epstein Barr Virus immortalized lymphoblastoid cells were generated from peripheral blood mononuclear cells as described (Protocols in Immunology) and cultured with RPMI medium. Human A459 (lung adenocarcinoma), HT1080 (fibrosarcoma), Caco-2 (colorectal carcinoma), Hep 3B (hepatocellular carcinoma), Jurkat (acute lymphoblastoid leukemia), HEK293 (human embryonic kydney), and 293T cell lines were cultured in DMEM
supplemented with 10 % FCS and 1 % penicillin/streptomycin. The cells were cultured in a humidified 5 % CO2 incubator at 37 C.
Purification of different leukocyte subpopulations Granulocytes, lymphocytes and monocytes were isolated from heparinized peripheral blood by Ficoll-PaqueTM PLUS (GE Healthcare Bio-Sciences AB) gradient centrifugation. After centrifugation two fractions were obtained, one containing granulocytes/erythrocytes and another with peripheral blood mononuclear cells (PBMC). To obtain granulocytes, erythrocytes were lysed with KCI 0,6 M. PBMCs were labelled with anti CD3+, CD14+, and CD19+ monoclonal antibodies conjugated with magnetic microbeads (Miltenyi Biotech) and separated using MS columns (Miltenyi Biotech) in a MiniMACS magnet (Miltenyi Biotech). Viable cells were determined by Trypan blue dye exclusion and counted in an hemocytometer. The purity of B- and T-lymphocyte and monocyte sub-populations was determined by flow cytometric analysis using a FACSCalibur flow cytometer (BD Biosciences). Cell sub-populations homogenized in RNA Lysis Buffer (SV Total RNA Isolation System, Promega) were stored at -80 C until RNA extraction.
Cloning and sequencing of PCR fragments Tr3R11 PCR fragments were cloned by insertion into the pGEM-T Easy plasmid (Promega Corporation WI, USA) under the conditions established by the , manufacturers and E. coli transformation.TORII PCR fragments were sequenced by using M13 forward and direct primers in a DNA sequencer ABI 3130 (Applied Biosystems Inc, CA, USA).
Example 2: Cloning of the codon optimized (co) TPRII-SE/Fc isoform fusion construct The TI3R1I-SE coding sequence containing an Agel site was codon optimized, the stop codon was deleted and a Kozak sequence included (Epoch Biolabs Inc.
Texas, USA). The human IgG1 Fc coding sequence was obtained by RT-PCR from total blood mRNA using specific oligonucleotides as primers (forward: 5'AGA
TCT
GAC AAA ACT CAC ACA TGC 3' (SEQ ID No. 8) and reverse: 5' GAT ATC TTT ACC
CGG AGA CAG G 3' (SEQ ID No. 9)), containing a Bg/II site (forward primer) and EcoRV (reverse primer), to allow in frame fusion to Ti3R1I-SE and to the lentiviral vector, respectively. The fusion construct (coTI3R1I-SE/Fc) of 951 bp Agel/EcoRV
comprises 258 bp of the coTi3R1I-SE fused in frame with 693 bp of the human IgG1-Fc.
Example 3: Lentiviral vectors The cDNA encoding the three human TI3RII isoforms were cloned into the pRRLsin18.cPPT.WPRE lentiviral vector, generating the transfer vectors pRRLsin18.cPPT.CMV-Tr3R1I-SE.ireseGFP.WPRE, pRRLsin18.cPPT.CMV-Ti3R11-DN.ireseGFP.WPRE, and pRRLsin18.cPPT.CMV-coT3RII-SE/Fc.ireseGFP.WPRE.
Vesicular Stomatitis Virus G protein-pseudotyped lentiviruses (VSV-G) were generated by transient transfection of the transfer vectors together with the envelope plasmid (pCMV-VSVG), the packaging plasmid (pMDLg/pRRE) and Rev plasmid (pRSV-REV), into the 293T cell line, as previously described (R. A. Dewey, et al.
Experimental Hematology 34: 1163-1171, 2006). The supernatant was harvested once every 12 hours for 48 hours and frozen in aliquots. Viral titers were determined by transducing A549 cells (yielding 107 infectious particles per milliliter). The pRRLsin18.cPPT.CMV-eGFP.WPRE lentiviral vector was used as control.
Example 4: RT-PCR and RT-qPCR
Total RNA from different primary cultures and cell lines was isolated using the Absolutely RNA kit (Stratagene, La Jolla, CA, USA). First-strand cDNA was synthesized by mixing 1 pg of DNA free total RNA, 50 pmol primer p(DT)15 (Roche Diagnostics GmbH, Mannheim, Germany), 0.5 mM deoxyribonucleotide triphosphate, mM dithiothreitol, and 1 U Expand Reverse Transcriptase (Roche Diagnostics GmbH). cDNA corresponding to different isoforms of T6RII receptor was detected by PCR amplification in the presence of Expand High Fidelity polymerase (Roche Diagnostics GmbH), 0,2 mM dNTPS, and 0,5 pM of each primer (forward:
5'ACCGGTATGGGTCGGGGGCTGCTC3" (SEQ ID No. 10) and reverse:
5"GTCGACTCAGTAG CAGTAGAAGATG3" (SEQ ID No. 11) for 35 cycles using the following PCR conditions: 1 min. at 95 C, 1 min. at 55 C, and 1 min. at 95 C.
Quantitative RT-PCR was performed on diluted cDNA samples with FastStart Universal SYBR Green Master (Rox) (Roche Applied Science) using the Mx3005PTM
Real-Time PCR Systems (Stratagene) under universal cycling conditions (95 C
for 10 min; 40 cycles of 95 C for 15 s; then 60 C for 1 min). All results were normalized to GAPDH mRNA levels and further the results were analyzed using the MxProTM QPCR

computer program and Infostat statistical computer program (Di Rienzo J.A., et al.
InfoStet version 2010. Grupo InfoStet, FCA, National University of Cordoba, Argentina.
URL, http://www.infostat.com.ar) Example 5: In vitro bioassay for the TpRII-SE isoform and other isoforms using the MTT proliferation assay A549 cells were transduced with lentiviral vectors at a multiplicity of infection (M01) of 50 in the presence of 8 pg/ml polybrene. Percentage of eGFP positive cells was measured in a FACscalibur (Becton Dikinson) cytometer.
Cells were harvested, counted, and inoculated at the appropriate concentrations into 96-well plates using a multichannel pipette. After 24 hr, TGF-61 (10 ng/rnl and 20 ng/ml; Sigma) was added to the culture wells, and cultures were incubated for 24 hr and 48 hr at 37 C, under an atmosphere of 5 c1/0 CO2. MIT (3-(4,5-dimethylthiazol-2-yI)-2,5-diphenyltetrazolium bromide) (Sigma) solution at a concentration of 5 mg/ml was added to the media and the cells were further incubated for 4 hr. After replacing 100 pl of supernatant with 100 pl of DMSO, the absorbance of each well was determined at 540 nm with a SEAC (Sirio S) photometer (Italy). The percentage of cell survival was defined as the relative absorbance of treated versus untreated cells.
Example 6: Transduction and flow cytometry A549 and hASC cells were transduced at an MOI of 50 and 200 respectively, with the different lentiviral constructs, in the presence of 8 pg/ml polybrene (Sigma).
Forty-eight hours after transduction, cells were harvested, washed in phosphate-buffered saline (PBS) supplemented with 10 % fetal calf serum and the percentage of eGFP positive cells was analyzed by flow cytometry (FACscalibur, BD) Example 7: Protein immunoblot (Western-blot) For Western blot analysis, both 20 pl and 100 pl of cell supernatant were loaded on 10 % SDS-polyacrylamide gels, separated by electrophoresis and blotted onto lmmovilon PVDF membranes (Millipore Corporation, Bedford, MA, USA). The membrane was exposed to anti-T6RII monoclonal primary antibody (clone C-4) (Santa Cruz, Biotechnology) diluted 1/200, or the monoclonal antibody IM 0577 (unprotected)], capable of specifically detecting T6R11-SE, diluted 1/500.
Horseradish peroxidase (HRP)-conjugated goat anti-mouse antibody (Becton Dickinson GmbH) diluted 1/10000 was used as secondary antibody. Protein detection was performed with the Amersham ECL Plus Western blotting detection reagents (Amersham Buchler GmbH, Germany) in a Typhoon 9410, Variable Mode Imager (GE Healthcare Bio-Sciences AB, Uppsala, Sweden).
Example 8: DNA and protein sequence analysis cDNA sequences belonging to the different TORII isoforms were used and the predicted protein sequences and statistics were obtained using the EditSeq software (DNAstar, Inc. Madison, WI, USA). Both the DNA and the predicted protein sequences belonging to the T8R1I-SE cDNA were aligned to known isoforms of the human TPRII
receptor (A and B) using the MegAlign software (DNASTAR, Inc. Madison, WI, USA).
Example 9: Analysis of cytokines and chemokines secreted by hASC cells A cytokine/chemokine array kit G5 (Ray Biotech Inc., Norcross, GA) was used to detect a panel of 80 secreted cytokines as recommended by the manufacturer.

hASCs P7 untransduced or transduced with lentiviral vectors were grown for 72h in a medium supplemented with 0,1 % BSA. Supernatants were collected, filtered and frozen after collection. For densitometry analysis of the arrays, Typhoon 9410 Variable mode Imager (GE Healthcare Life Sciences) was used, and signal intensity values were measured using the Image analysis software ImageQuant TL 7.0 (GE
Healthcare Life Sciences). Microarray data were analyzed with RayBio Antibody Array Analysis Tool. Good data quality and adequate normalization were ensured using internal control normalization without background. Any ?1.5-fold increase or 50.65-fold decrease in signal intensity for a single analyte between samples or groups may be considered a measurable and significant difference in expression, provided that both sets of signals are well above background (Mean background + 3 standard deviations, accuracy 99%).
Example 10: Generation of monoclonal and polyclonal antibodies raised against human TPRII-SE

Antibodies were generated by Rheabiotech, Campinas, Brazil. Immunization of both rabbit (polyclonal antibody) or mice (monoclonal antibody), was performed using a Multiple Antigene Peptide System (MAPS) with 8 identical copies of a peptide containing the 13 amino acids (FSKVHYEGKKKAW) (SEQ ID No. 12), which are only found in Ti3R1I-SE and not in the other splicing variants of the receptor. The monoclonal antibody IM-0577 was developed in mice and purified by protein G
affinity chromatography.Antibodies specificity was assayed by indirect ELISA by sensitization with antigen at a concentration of 5 pg/ml in Carbonate Buffer 0,2 M, blocked by PBS/BSA and detected with serial dilutions (1:1000-1:64000) of the specific antibody.
The ELISA test was developed with a Horseradish peroxidase (HRP)-conjugated secondary antibody together with H202/0PD as chromogenic substrate, and detected by absorbance at 492 nM.
Example 11: In vivo study of articular cartilage damage by ciprofloxacin (CPFX) and the TORII-SE isoform Male 24-day-old Wistar rats were housed under controlled conditions at 21 1 C with 50 % 5 % relative humidity and a constant light-dark schedule (light, 8 a.m.
to 8 p.m.). Food and tap water was provided ad libitum. The rats received ciprofloxacin hydrochloride on day 24 by oral administration of 200 mg/kg of body weight during 10 days. The animals were examined for clinical abnormalities including motility alterations and weighted during the treatment period.
On day 14 after ciprofloxacin treatment, 50 pl viral vectors were injected intra-articularly with either Lt.coTBRII-SE/Fc (2.35 x 106 transducing Units, TU) or Lt.eGFP
(6 x 106 TU). Control animals without ciprofloxacin were treated in the same manner.
Example 12: Method to treat liver fibrosis using a lentiviral vector encoding TORII-SE/Fe fusion protein Male Wistar rats weighting 150-200 g were housed at Mar del Plata National University Laboratory Animal Unit at a mean constant temperature of 22 C with a 12 h light¨dark cycle, and free access to standard pellet chow and water. All experiments were performed according to the 'Guide for the Care and Use of Laboratory Animals' and approved by the Institutional Animal Care and Use Committee (CICUAL) of Mar del Plata National University. The experimental groups were designed as follows (n= 7 per group): (I) Control group received intraperitoneal (ip) injection of vehicle of CCI4;
(II) CCI4 group received ip injection of CCI4; (Ill) Lv.T8R1I-SE/Fc + CCI4 group received intrahepatic (ih) injection of Lv.T8R1I-SE/Fc (week 0) before treatment with CCI4.
In vivo liver transduction Animals were ih injected with Lv.T8R1I-SE/Fc (5-lox 107 transduction units/ml) a week before the induction of liver fibrosis (Figure 34). To employ this route of administration, a small incision was made in animals previously anesthetized with ketamine/xylazine (50 mg/5 mg/kg, ip injection). Livers were exposed and small volumes of the lentiviral vector were injected with a 30G needle into several liver sites.
Liver fibrosis induction Liver fibrosis was induced by ip injection of carbon tetrachloride (CCI4) 1 ml in oil (1:1), per kg of body weight (BVV), twice a week, for 8 weeks (Figure 34), according to a well-established model (experimental groups II and III). Seventy-two hours after the last CCI4 injection, animals were euthanized by CO2 inhalation. Then, livers were obtained and fixed in 10% neutral buffered formalin for histological analysis.
Serum was also collected from each animal to analyze biochemical parameters.

Body weight determinations Body weight (BW) measurements were taken before each CCI4 ip injection, and after completion of the experiment. These data were used to calculate BW gain, which was expressed as the percentage (%) of increase respect to the initial BW.
After euthanasia, livers were harvested and weighted to calculate the liver to body weight ratio (LW/BW), also expressed as percentage.
Biochemical parameter determinations Liver enzyme levels of aspartate aminotransferase (AST), alanine aminotransferase (ALT), and alkaline phosphatase (ALP) were determine in serum with an automatic analyzer BT300 plus (Biotecnica), according to the manufacturer's recommendations.
Histological analysis Livers fixed in 10% neutral buffered formalin were embedded in paraffin. Liver sections (5 pm) were stained with Hematoxylin and Eosin (H&E), for liver architecture visualization. For liver fibrosis assessment, sections were stained with 0.1 /.3 Sirius Red. Quantification of Sirius Red-positive areas was performed in at least ten microscopy fields per histological section using the software ImageJ. Results were expressed as mean percentage of Sirius Red-positive area per field.

lmmuhistochemichal analysis For immunohistochemical analysis, 5 pm sections were dewaxed and rehydrated.
Endogenous peroxidase activity was blocked with 3 % H202 3% in methanol (10 min, at room temperature). Antigen retrieval was performed using the heat induced epitope retrieval (HIER) method with 0.1 M citrate buffer, pH 6. Tissue sections were then incubated for 12 ¨ 16 h at 4 C with rabbit anti-a-smooth muscle actin (anti-a-SMA, 1:500, Cell Signaling Technology, Danvers, MA). After two washes with PBS, slides were incubated with HiDef Detection amplifier Mouse and Rabbit (Cell Marque, Rocklin, CA) for 10 min, at room temperature. Sections were further washed with PBS
and incubated with HiDef Detection HRP Polymer Detector (Cell Marque, Rocklin, CA) for 10 min, at room temperature. Finally, sections were washed twice with PBS, and immunohistochennical staining was obtained using the DAB Chromogen kit (Cell Marque, Rocklin, CA) by 5 min. incubation at room temperature, and counterstained with Hematoxylin. Dehydrated sections were mounted and imaged on a Nikon Eclipse E200 microscope.
Statistical analysis Data were analyzed using two-way ANOVA followed by the Fisher's Least Significant Difference (LSD) test. Statistical significance was set at < 0.05.
Results are expressed as mean SD.
Example 13: Method to treat cancer with a lentiviral vector encoding TI3R1I-SE/Fc fusion protein TN60 murine mammary carcinoma cells were injected subcutaneously into syngenic C3H/S mice (N= 6 - 7 per group), as it is described by Garcia M.
etal., 2015 Biological Rhythm Research 46: 573-578. Ten days after, 1,5 x 106 transduction units of a lentiviral vectors encoding T13R1I-SE/Fc (Lv.TI3R11-SE/Fc) (N=7), or the control vector Lv. TI3R1I-DN (dominant negative) (N=6) were intratumorally injected.
As an additional control, mice were intratumorally injected with the same volume of culture medium (vehicle).
Tumor diameter was determine every 2-3 days by measuring the tumor perimeter with a digital caliper, Tumor mean volume was determine by the formula V=4/3 (p x r3). Two weeks after tumor implantation, mice were euthanized by cervical dislocation.
Example 14: Method to determine rheumatoid arthritis disease activity by TpRII-SE protein quantification in neutrophils by immune detection with the anti TpRII-SE monoclonal antibody.
Patients Volunteers and samples Peripheral blood was collected by venipuncture from 19 RA patients diagnosed according to the ACR/EULAR 2010 criteria. All procedures were approved by CER

Medical Institute Research Ethics Committee, and the ComisiOn Coniunta de Investiqacion en Salud, Department of Health, Buenos Aires Province, Argentina, registered under the number 2919/653/13. All procedures were performed after signing off a voluntary informed consent, by the donors. Exclusion criteria included severe anaemia, autoimmune diseases different from RA, any other disease/condition able to increase ESR, treatment with biological drugs, treatment with disease-modifying anti-rheumatic drugs (DMARDs) except methotrexate, and with drugs with known effect on the TGF-P signalling cascade (losartan).
Detection of TpRII-SE in neutrophils by Flow Cytometry: both neutrophils and peripheral blool mononuclear cells (PBMC) were isolated by FicollPaqueTM PLUS
density gradient. Red blood cells were eliminated from the neutrophil fraction by incubation with a hypertonic buffer (0,15 M NI-14C1, 10 mM KHCO3, 0,1 mM
EDTA). To determine the percentage of cells expressing TpRII-SE, 1 x 106 of both, neutrophils and PBMC were fixed and permeabilized with the Cytofix/Cytoperm Kit (BD
Biosciences, USA) Subsequently, cells were incubated with 0,5 tg of the anti-TpRII-SE monoclonal antibody of the invention conjugated with the fluorochrome ATTO
647N. Cells were resuspended in 100 pLI of PBS and were analyzed by Flow Cytometry in a FACSCalibur device (BD Biosciences, USA), using Flowjo software (BD
Biosciences, USA). The percentage of neutrophils expressing TpRII-SE was determined by taking as cut off the fluorescence value obtained with lymphocytes of each patient, as reference. TpRII-SE fluorescence values in neutrophils were correlated with DAS28-ESR disease activity scores by the Spearman's rank correlation test of the OriginPro 8.5.1 software (Origin Lab Corporation, Northampton, MA, USA).
Example 15: Detection of TORII-SE in neutrophils by In-cell ELISA
To develop a method to quantify intracellular TpRII-SE in leukocytes by 1n-cell ELISA in RA pacientes, 2,6 x 106 celulas/cm2 , in saline solution+2 (0,9 %
NaCI, 1 mM
MgC12, 1 mM CaCl2), were incubated in 96 well plates for 20 minutes at room temperature, to allow cell adherence to plastic. Subsequently, cells were washed twice with 1 X PBS, and fixed and permeabilized with 100 111_ of Fix/Perm solution (BD
Cytofix/Cytoperm TM, USA) for 20 min. at 4 C. After two washes with 250 iiL
of 1 X BD
Perm/Wash buffer (BD Perm/Wash Tm, USA), adhered cells were incubated with the anti-TI3R1I-SE antibody (10 1.19/mL in 50 tiL of BD Perm/Wash buffer) for 30 minutes to 16 hours at 4 C. As control, cells were also incubated without the above mentioned antibody. After two aditional washes with 250 1AL of 1 X BD Perm/Wash Buffer, cells were incuabated with 1 jAg/mL secondary antibody (Anti Mouse HRP conjugated -Promega, USA), in 50 pt de 1 X BD Perm/Wash Buffer, for 90 minutes.
Subsequently, cells were incubated with 100 tiL of quenching solution (10 % V/V H202 in 1 X
BD
Perm/Wash Buffer. After 3 washes with 250 IAL of 1 X BD Perm/Wash Buffer, cells were incubated with 100 pit of TMB substrate (Life Technologies, EEUU), in the dark, and 655 nm absorbance was determined every 5 minutes for 30 minutes, in a microplate reader (Biotek, SYNERGYTM H1, USA). In addition, the number of adhered cells was determined by cristal violet staining, to be used as In-cell ELISA
normalizer.
To this end, each well was washed four times with 200 IAL 1 X PBS and cells were incubated with 50 pi crystal violet solution containing 2 g de crystal violet (Sigma, USA), 20 ml 95 % ethanol, 0,8 g amonium oxalate, and 80 ml distiled water, for minutes at room temperature. After wahing the wells with abundant tap water, cells were incubated with 100 1.11._ of 1 % SDS for 60 minutes at room temperatura..
Finally, absorbance at 595 nm was determined in a microplate reader (Biotek, SYNERGYTM
H1, USA).
Intracellular T13R1I-SE relative concentration values were determined as follows:
AbsNn= Absn655/Absn595 AbsNT=AbsT655/AbsT595 Tf3RII-SE relative concentration= (AbsNT-AbsNn) *100 where:
AbsNT = normalized absorbance of the well containing Anti Ti3R1I-SE primary antibody..

AbsT655 = Absorbance at 655 nm of the well containing Anti TI3R11-SE primary antibody.
AbsT595 = Absorbance at 595 nm of the well containing Anti TI3R11-SE primary antibody.
AbsNn = normalized absorbance of the well without primary antibody (negative).

Absn655 = Absorbance at 655 nm of the well without primary antibody (negative).
Absn595: Absorbance at 595 nm of the well without primary antibody (negative).
Ti3R1I-SE relative concentration in plastic adhered leukocytes from RA
patients was correlated with their matching DAS28-ESR value using the Spearman rank correlation test of the OriginPro 8.5.1 software (Origin Lab Corporation, Northampton, MA, USA).

Claims (14)

What is claimed is:

1. A method of treating hepatic fibrosis or cancer diseases, comprising the step of administering to a mammal in need thereof a vector bearing a polynucleotide sequence set forth in SEQ ID No. 7.

2. The method according to claim 1, when de disease is hepatic fibrosis the administration is intra-hepatic.

3. The method according to claim 1, when the disease is cancer the administration is intra-tumoral.

4. The method according to claim 1, wherein de vector is a lentivirus.

5. A method to establish rheumatoid arthritis disease activity, wherein said method comprises at least one of the following: the determination of the percentage of neutrophils expressing the isoform TORII-SE or the intracellular concentration of the isoform TpRII-SE in neutrophils.

6. The method according to claim 5, wherein the percentage of neutrophils expressing the isoform TpRII-SE is inversely proportional to rheumatoid arthritis disease activity levels.

7. The method according to claim 5, wherein intracellular TI3R1I-SE
concentration is inversely proportional to rheumatoid arthritis disease activity levels.

8. A method to detect the isoform 1131RII-SE, comprising a) isolation of blood cells;
b) permeabilization of these cells;
c) binding of an antibody recognizing the aminoacid sequence shown in SEQ ID
N 12 in the permeabilized cells of the previous stage, and d) detection.

9. The method according to claim 8, wherein blood cells are neutrophils.

10. The method according to claim 8, wherein said method is selected from the group consisting of In-cell ELISA and flow cytometry.

11 The use of a vector bearing a polynucleotide sequence set forth in SEQ
ID No.
7 for preparing a medicament for hepatic fibrosis.

12 The use of a vector bearing a polynucleotide sequence set forth in SEQ
ID No.
7 for preparing a medicament for cancer diseases.

13 A method of treating hepatic fibrosis or cancer diseases, comprising the step of administering to a mammal in need thereof the polypeptide sequence set forth in SEQ
ID No. 6.

14 The use of the polypeptide sequence set forth in SEQ ID No. 6 for cancer disease o hepatic fibrosis.