CA2994320C - Treatment of cellulosic material and enzymes useful therein - Google Patents

Abstract

The present invention relates to the production of sugar hydrolysates from cellulosic material. The method may be used e.g. for producing fermentable sugars for the production of bioethanol from lignocellulosic material. Cellulolytic enzymes and their production by recombinant technology is described, as well as uses of the enzymes and enzyme preparations.

Description

Treatment of cellulosic material and enzymes useful therein Field of the Invention The present invention relates to the production of sugar hydroly-sates from cellulosic material. More precisely the invention relates to produc-tion of fermentable sugars from lignocellulosic material by enzymatic conver-sion. The fermentable sugars are useful e.g. in the production of bioethanol, or for other purposes. In particular the invention is directed to a method for treat-ing cellulosic material with cellobiohydrolase, endoglucanase, beta-glucosidase, and optionally xylanase, and to enzyme preparations and the us-lo es thereof. The invention is further directed to novel cellulolytic polypeptides, polynucleotides encoding them, and to vectors and host cells containing the polynucleotides. Still further the invention is directed to uses of the polypep-tides and to a method of preparing them.
Background of the Invention Sugar hydrolysates can be used for microbial production of a variety of fine chemicals or biopolymers, such as organic acids e.g. lactic acid, or eth-anol or other alcohols e.g. n-butanol, 1,3-propanediol, or polyhydroxyalka-noates (PHAs). The sugar hydrolysates may also serve as raw material for other non-microbial processes, e.g., for enrichment, isolation and purification of high value sugars or various polymerization processes. One of the major uses of the sugar hydrolysates is in the production of biofuels. The production of bi-ethanol and/or other chemicals may take place in an integrated process in a biorefinery (Wyman 2001).
Limited resources of fossil fuels, and increasing amounts of CO2 re-leased from them and causing the greenhouse phenomenon have raised a need for using biomass as a renewable and clean source of energy. One promising, alternative technology is the production of biofuels i.e. ethanol from cellulosic materials. In the transportation sector biofuels are for the time being the only option, which could reduce the CO2 emissions by an order of magni-tude. The ethanol can be used in existing vehicles and distribution systems and thus it does not require expensive infrastructure investments. Sugars de-rived from lignocellulosic renewable raw materials can also be used as raw materials for a variety of chemical products that can replace oil-based chemi-cals.

2 Most of the carbohydrates in plants are in the form of lignocellulose, which essentially consists of cellulose, hemicellulose, pectin and lignin. In a lignocellulose-to-ethanol process the lignocellulosic material is first pretreated either chemically or physically to make the cellulose fraction more accessible to hydrolysis. The cellulose fraction is then hydrolysed to obtain sugars that can be fermented by yeast into ethanol. Lignin is obtained as a main co-product that may be used as a solid fuel.
Bioethanol production costs are high and the energy output is low, and there is continuous research for making the process more economical.
Enzymatic hydrolysis is considered the most promising technology for convert-ing cellulosic biomass into fermentable sugars. However, enzymatic hydrolysis is used only to a limited amount at industrial scale, and especially when using strongly lignified material such as wood or agricultural waste the technology is not satisfactory. The cost of the enzymatic step is one of the major economical factors of the process. Efforts have been made to improve the efficiency of the enzymatic hydrolysis of the cellulosic material (Badger 2002).
US 2002/019 2774 Al describes a continuous process for convert-ing solid lignocellulosic biomass into combustible fuel products. After pretreat-ment by wet oxidation or steam explosion the biomass is partially separated in-to cellulose, hemicellulose and lignin, and is then subjected to partial hydroly-sis using one or more carbohydrase enzymes (EC 3.2). CelluclastTM, a com-mercial product by Novo Nordisk A/S containing cellulase and xylanase activi-ties is given as an example.
US 2004/000 5674 Al describes novel enzyme mixtures that can be used directly on lignocellulose substrate, whereby toxic waste products formed during pretreatment processes may be avoided, and energy may be saved.
The synergistic enzyme mixture contains a cellulase and an auxiliary enzyme such as cellulase, xylanase, ligninase, amylase, protease, lipidase or glucuron-idase, or any combination thereof. Cellulase in considered to include endoglu-canase (EG), beta-glucosidase (BG) and cellobiohydrolase (CBH). The exam-ples illustrate the use of a mixture of Trichoderma xylanase and cellulase preparations.
Kurabi et al. (2005) have investigated enzymatic hydrolysis of steam-exploded and ethanol organosolv-pretreated Douglas-fir by novel and commercial fungal cellulases. They tested two commercial Trichodema reesei cellulase preparations, and two novel preparations produced by mutant strains

3 of Trichoderma sp. and Penicillium sp. The Trichoderma sp. preparation showed significantly better performance than the other preparations. The bet-ter performance was believed to be at least partly due to a significantly higher beta-glucosidase activity, which relieves product inhibition of cellobiohydrolase and endoglucanase.
US 2004/005 3373 Al pertains a method of converting cellulose to glucose by treating a pretreated lignocellulosic substrate with an enzyme mix-ture comprising cellulase and a modified cellobiohydrolase I (CBHI). The CBHI
has been modified by inactivating its cellulose binding domain (CBD). Ad-vantages of CBHI modification are e.g. better recovery and higher hydrolysis rate with high substrate concentration, The cellulase is selected from the group consisting of EG, CBH and BG. The GBH! is preferably obtained from Tricho-derma.
US 2005/016 4355 Al describes a method for degrading lignocellu-Iosic material with one or more cellulolytic enzymes in the presence of at least one surfactant. Additional enzymes such as hemicellulases, esterase, peroxi-dase, protease, laccase or mixture thereof may also be used. The presence of surfactant increases the degradation of lignocellulosic material compared to the absence of surfactant. The cellulolytic enzymes may be any enzyme in-volved in the degradation of lignocellulose including CBH, EG, and BC.
There is a huge number of publications disclosing various cellulases and hemicellulases.
Cellobiohydrolases (CBHs) are disclosed e.g. in WO 03/000 941, which relates to CBHI enzymes obtained from various fungi. No physiological properties of the enzymes are provided, nor any examples of their uses. Hong et a/. (2003b) characterizes CBHI of Thermoascus aurantiacus produced in yeast. Applications of the enzyme are not described. Tuohy et a/. (2002) de-scribe three forms of cellobiohydrolases from Talaromyces emersonii.
Endoglucanases of the ce15 family (EGs fam 5) are described e.g. in WO 03/062 409, which relates to compositions comprising at least two thermo-stable enzymes for use in feed applications. Hong et al. (2003a) describe pro-duction of thermostable endo-13-1,4-glucanase from T. aura ntiacus in yeast.
No applications are explained. WO 01/70998 relates to 13-glucanases from Tala-romyces. They also describe P-glucanases from Talaromyces emersonii.
Food, feed, beverage, brewing, and detergent applications are discussed. Lig-nocellulose hydrolysis is not mentioned. WO 98/06 858 describes beta-1,4-

4 endoglucanase from Aspergillus niger and discusses feed and food applica-tions of the enzyme. WO 97/13853 describes methods for screening DNA
fragments encoding enzymes in cDNA libraries. The cDNA library is of yeast or fungal origin, preferably from Aspergillus. The enzyme is preferably a cellulase.
Van Petegem et al. (2002) describe the 3D-structure of an endoglucanase of the ce15 family from Thermoascus aurantiacus. Parry et al. (2002) describe the mode of action of an endoglucanase of the ce15 family from Thermoascus au-rantiacus.
Endoglucanases of the ce17 family (EGs fam 7) are disclosed e.g. in lc US 5,912,157, which pertains Myceliphthora endoglucanase and its homo-logues and applications thereof in detergent, textile, and pulp. US 6,071,735 describes cellulases exhibiting high endoglucanase activity in alkaline condi-tions. Uses as detergent, in pulp and paper, and textile applications are dis-cussed. Bioethanol is not mentioned. US 5,763,254 discloses enzymes de-grading cellulose/hemicellulose and having conserved amino acid residues in CBD.
Endoglucanases of the ce145 family (EGs fam 45) are described e.g.
in US 6,001,639, which relates to enzymes having endoglucanase activity and having two conserved amino acid sequences. Uses in textile, detergent, and pulp and paper applications are generally discussed and treating of lignocellu-losic material is mentioned but no examples are given. WO 2004/053039 is di-rected to detergent applications of endoglucanases. US 5,958,082 discloses the use of endoglucanase, especially from Thiela via terrestris in textile applica-tion. EP 0495258 relates to detergent compositions containing Humicola cellu-lase. US 5,948,672 describes a cellulase preparation containing endoglu-canase, especially from Humicola and its use in textile and pulp applications.

Lignocellulose hydrolysis is not mentioned.
A small amount of beta-glucosidase (BG) enhances hydrolysis of biomass to glucose by hydrolyzing cellobiose produced by cellobiohydrolases.
Cellobiose conversion to glucose is usually the major rate-limiting step. Beta-glucosidases are disclosed e.g. in US 2005/021 4920, which relates to BG
from Aspergillus fumigatus. The enzyme has been produced in Aspergillus oryzae and Trichoderma reesei. Use of the enzyme in degradation of biomass or detergent applications is generally discussed but not exemplified.
W002/095 014 describes an Aspergillus oryzae enzyme having cellobiase ac-tivity. Use in the production of ethanol from biomass is generally discussed but =
not exemplified. W02005/074656 discloses polypeptides having cellulolytic enhancing activity derived e.g. from T. aurantiacus; A. fumigatus; T.
terrestris and T. aurantiacus. W002/26979 discloses enzymatic processing of plant ma-terial. US 6,022,725 describes cloning and amplification of the beta-gluco-

5 sidase gene of Trichoderma reesei, and US 6,103,464 describes a method for detecting DNA encoding a beta-glucosidase from a filamentous fungus. No application examples are given.
Xylanases are described e.g. in FR2786784, which relates to a heat-stable xylanase, useful e.g. in treating animal feed and in bread making.

The enzyme is derived from a thermophilic fungus, particularly of the genus The rmoascus.
US 6,197,564 describes enzymes having xylanase activity, and ob-tained from Aspergillus aculeatus. Their application in baking is exemplified.

6 relates to Talaromyces xylanases. Feed and baking examples are given. W001/42433 discloses thermostable xylanase from Talaromyces emersonii for use in food and feed applications.
The best-investigated and most widely applied cellulolytic enzymes of fungal origin have been derived from Trichoderma reesei (the anamorph of Hypocrea jecorina). Consequently also most of the commercially available fun-gal cellulases are derived from Trichoderma reesei. However, the majority of cellulases from less known fungi have not been applied in processes of practi-cal importance such as in degrading cellulosic material, including lignocellu-lose.
There is a continuous need for new methods of degrading cellulosic substrates, in particular lignocellulosic substrates and for new enzymes and enzyme mixtures, which enhance the efficiency of the degradation. There is al-so a need for processes and enzymes, which work at high temperatures, thus enabling the use of high biomass consistency and leading to high sugar and ethanol concentrations. This approach may lead to significant saving in energy and investments costs. The high temperature also decreases the risk of con-tamination during hydrolysis. The present invention aims to meet at least part of these needs.
Brief Description of the Invention It has now surprisingly been found that cellulolytic enzymes, and especially cellobiohydrolases obtainable from Thennoascus aurantiacus, Acremonium the rmophilum, or Chaetomium thermophilum are particularly use-ful in hydrolyzing cellulosic material. In addition to cellobiohydrolases these fungi also have endoglucanases, beta-glucosidases and xylanases that are very suitable for degrading cellulosic material. The enzymes are kinetically very effective over a broad range of temperatures, and although they have high activity at high temperatures, they are also very efficient at standard hy-drolysis temperatures. This makes them extremely well suited for varying cellu-losic substrate hydrolysis processes carried out both at conventional tempera-tures and at elevated temperatures.
The present invention provides a method for treating cellulosic ma-tenet with cellobiohydrolase, endoglucanase and beta-glucosidase, whereby said cellobiohydrolase comprises an amino acid sequence having at least 80%
identity to SEQ ID NO: 2, 4, 6 or 8, or to an enzymatically active fragment thereof.
The invention further provides an enzyme preparation comprising cellobiohydrolase, endoglucanase and beta-glucosidase, wherein said cellobi-ohydrolase comprises an amino acid sequence having at least 80% identity to SEQ ID NO: 2, 4, 6 or 8, or to an enzymatically active fragment thereof.
The use of said enzyme preparation for degrading cellulosic material is also provided, as well as the use of said method in a process for preparing ethanol from cellulosic material.
The invention is also directed to a polypeptide comprising a frag-ment having cellulolytic activity and being selected from the group consisting of:
a) a polypeptide comprising an amino acid sequence having at least 66% identity to SEQ ID NO:4, 79% identity to SEQ ID NO:6, 78% identity to SEQ ID NO:12, 68% identity to SEQ ID NO:14, 72% identity to SEQ ID NO:16, 68% identity to SEQ ID NO:20, 74% identity to SEQ ID NO:22 or 24, or 78%
identity to SEQ ID NO:26;
b) a variant of a) comprising a fragment having cellulolytic activity;
and C) a fragment of a) or b) having cellulolytic activity.
One further object of the invention is an isolated polynucleotide se-lected from the group consisting of:
a) a nucleotide sequence of SEQ ID NO: 3, 5, 11, 13, 15, 19, 21, 23 or 25, or a sequence encoding a polypeptide of claim 35;
b) a complementary strand of a)

7 c) a fragment of a) or b) comprising at least 20 nucleotides; and d) a sequence that is degenerate as a result of the genetic code to any one of the sequences as defined in a), b) or c).
The invention still further provides a vector, which comprises said polynucleotide as a heterologous sequence, and a host cell comprising said vector. Escherichia coli strains having accession number DSM 16728, DSM
16729, DSM 17324, DSM 17323, DSM 17729, DSM 16726, DSM 16725, DSM
17325 or DSM 17667 are also included in the invention.
Other objects of the invention are enzyme preparations comprising at least one of the novel polypeptides, and the use of said polypeptide or en-zyme preparation in fuel, textile, detergent, pulp and paper, food, feed or bev-erage industry.
Further provided is a method for preparing a polypeptide comprising a fragment having cellulolytic activity and being selected from the group con-sisting of:
a) a polypeptide comprising an amino acid sequence having at least 66% identity to SEQ ID NO:4, 79% identity to SEQ ID NO:6, 78% identity to SEQ ID NO:12, 68% identity to SEQ ID NO:14, 72% identity to SEQ ID NO:16, 68% identity to SEQ ID NO:20, 74% identity to SEQ ID NO:22 or 24, or 78%
identity to SEQ ID NO:26;
b) a variant of a) comprising a fragment having cellulolytic activity;
and C) a fragment of a) or b) having cellulolytic activity, said method comprising transforming a host cell with a vector en-coding said polypeptide, and culturing said host cell under conditions enabling expression of said polypeptide, and optionally recovering and purifying the pol-ypeptide produced.
Still further provided is a method of treating cellulosic material with a spent culture medium of at least one microorganism capable of producing a polypeptide as defined above, wherein the method comprises reacting the cel-lulosic material with the spent culture medium to obtain hydrolysed cellulosic material.
Specific embodiments of the invention are set forth in the dependent claims.

8 Other objects, details and advantages of the present invention will become apparent from the following drawings, detailed description and exam-ples.
Brief Description of the Drawings Figure 1. Temperature dependencies of the cellulase and beta-glucosidase activities in the supernatants of the tested six fungal strains.
The incubation time in the assay was 60 min at the given temperature, the assay pH was 5.0 (MUL-activity) or 4.8 (CMCase or BGU). Activity obtained at 60 C
is set as the relative activity of 100%. A) Thermoascus aurantiacus ALK04239, B) Thermoascus aurantiacus ALK04242, C) Acremonium thermophilum ALK04245, D) Talaromyces thermophilus ALK04246, E) Chaetomium ther-mophilum ALK04261, F) Chaetomium thermophilum ALK04265.
Figure 2. Schematic picture of the expression cassettes used in the transformation of Trichoderma reesei protoplasts for producing the recombi-nant fungal proteins. The recombinant genes were under the control of T.
reesei cbhl (ce/7A) promoter (cbhl prom) and the termination of the transcrip-tion was ensured by using T. reesei cbhl terminator sequence (cbhl term).
The amdS gene was included as a transformation marker.
Figure 3. A) pH optima of the recombinant CBH/Ce17 protein prepa-rations from Thermoascus aurantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acremonium thermophilum ALK04245 determined on 4-meth-ylumbelliferyl-p-D-lactoside (MUL) at 50 C, 10 min. The results are given as mean ( SD) of three separate measurements. B) Thermal stability of recombi-nant CBH/Ce17 protein preparations from Thermoascus aurantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acremonium ther-mophilum ALK04245 determined on 4-methylumbelliferyl-p-D-lactoside (MU L) at the optimum pH for 60 min. The results are given as mean ( SD) of three separate measurements. Both reactions contained BSA (100 pg/ml) as a stabi-lizer.
Figure 4. Crystalline cellulose (Avicel) hydrolysis by the purified re-combinant cellobiohydrolases at 45 C. Substrate concentration 1% (w/v), pH
5.0, enzyme concentration 1.4 pM. A) Cellobiohydrolases harboring a CBD, B) cellobiohydrolases (core) without a CBD.
Date Recue/Date Received 2022-03-03 8a Figure 5. Crystalline cellulose (Avicel) hydrolysis by the purified re-combinant cellobiohydrolases at 70 C. Substrate concentration 1% (w/v), pH
5.0, enzyme concentration 1.4 pM. A) Cellobiohydrolases harboring a CBD, B) cellobiohydrolases (core) without a CBD.
It is provided a polypeptide having cellulolytic activity and compris-ing an amino acid sequence having at least 80% identity over the full length to SEQ ID NO: 22.
It is further provided an isolated polynucleotide comprising a nucleo-tide sequence selected from the group consisting of: the nucleotide sequence of SEQ ID NO: 21; a sequence encoding the polypeptide as provided ; and the full length complement of the nucleotide sequence recited.
It is also provided method for preparing a polypeptide having cellulo-lytic activity and comprising an amino acid sequence having at least 80% iden-tity over the full length to SEQ ID NO: 22, the method comprising transforming a host cell with a vector encoding the polypeptide, and culturing the host cell under conditions enabling expression of the polypeptide, and recovering and purifying the polypeptide produced.
Date Recue/Date Received 2022-03-03

9 Figure 6. A) The pH dependency of the heterologously produced Acremonium EG _ 40/Ce145A, EG _ 40 _like/Ce145B and Thermoascus EG_28/Cel5A activity was determined with CMC substrate in a 10 min reaction at 50 C. B) Temperature optimum of the Acremonium EG_40/Ce145A, EG_40_like/Ce145B and Thermoascus EG_28/Cel5A was determined at pH
5.5, 4.8, and 6.0, respectively. The reaction containing CMC as substrate was performed for 60 min, except for EG_28/Cel5A for 10 min. BSA (100 pg/ml) was added as a stabilizer.
Figure 7. A) The pH dependency of the heterologously produced Acremonium BG_101/Cel3A, Chaetomium BG_76/Cel3A, and Thermoascus BG_81/Cel3A activity was determined with 4-nitrophenyl-p-D-glucopyranoside substrate in a 10 min reaction at 50 C. B) Temperature optimum of the Acre-monium pG_101/Cel3A, Chaetomium 13G_76/Cel3A, and Thermoascus pG_81/Cel3A was determined at pH 4.5, 5.5, and 4.5, respectively. The reac-tion containing 4-nitrophenyl-p-D-glucopyranosid as substrate was performed for 60 min, BSA (100 pg/ml) was added as a stabilizer.
Figure 8. A) The pH dependency of the heterologously produced Thermoascus XYN _ 30/Xyn10A xylanase activity was determined with birch xy-Ian substrate in a 10 min reaction at 50 C. B) Temperature optimum of XYN 30/Xyn10A was determined at pH 5.3 in a 60 min reaction, BSA (100 pg/ml) was added as a stabilizer.
Figure 9. Hydrolysis of washed steam exploded spruce fibre (10 mg/ml) with a mixture of thermophilic enzymes (MIXTURE 1) and T. reesei en-zymes at 55 and 60 C. Enzyme dosage is given by FPU/g dry matter of sub-strate, FPU assayed at 50 C, pH 5. Hydrolysis was carried out for 72 h at pH
5, with mixing. The results are given as mean ( SD) of three separate meas-urements.
Figure 10. Hydrolysis of steam exploded corn stover (10 mg/ml) with a mixture of thermophilic enzymes (MIXTURE 2) and T. reesei enzymes at 45, 55 and 57.5 C. Enzyme dosage was for "MIXTURE 2" 5 FPU/g dry mat-ter of substrate and for T. reesei enzymes 5 FPU/g dry matter Celluclast sup-plemented with 100 nkat/g dry matter Novozym 188 (filter paper activity was assayed at 50 C, pH 5). Hydrolysis was carried out for 72 h at pH 5, with mix-ing. The results are given as mean ( SD) of three separate measurements.
Date Recue/Date Received 2022-03-03

10 The substrate contained soluble reducing sugars (ca 0.7 mg/m1). This back-ground sugar content was subtracted from the reducing sugars formed during the hydrolysis.
Figure 11. Hydrolysis of steam exploded corn stover (10 mg/ml) with a mixture of thermophilic enzymes containing a new thermophilic xylanase from Thermoascus aurantiacus (MIXTURE 3) and T. reesei enzymes at 45, 55 and 60 C. Enzyme dosage was for "MIXTURE 3" 5 FPU/g dry matter of sub-strate and for T. reesei enzymes 5 FPU/g dry matter Celluclast supplemented with 100 nkat/g dry matter Novozym 188 (filter paper activity was assayed at 50 C, pH 5). Hydrolysis was carried out for 72 h at pH 5, with mixing. The re-sults are given as mean ( SD) of three separate measurements. The substrate contained soluble reducing sugars (ca 0.7 mg/m1). This background sugar con-tent was subtracted from the reducing sugars formed during the hydrolysis.
Figure 12. Hydrolysis of steam exploded spruce fibre (10 mg/ml) with a mixture of thermophilic enzymes containing a new thermophilic xylanase XYN_30/Xyn10A from Thermoascus aurantiacus (MIXTURE 3) and T. reesei enzymes at 45, 55 and 60 C. Enzyme dosage for "MIXTURE 3" was 5 FPU/g dry matter of substrate and for T. reesei enzymes 5 FPU/g dry matter Cellu-clast supplemented with 100 nkat/g dry matter Novozym 188 (filter paper ac-tivity was assayed at 50 C, pH 5). Hydrolysis was carried out for 72 h at pH
5, with mixing. The results are given as mean ( SD) of three separate measure-ments.
Figure 13. The effect of glucose on activity of different 6-gluco-sidase preparations. The standard assay using p-nitropheny1-6-D-gluco-pyranoside as substrate was carried out in the presence of glucose in the as-say mixture. The activity is presented as percentage of the activity obtained without glucose.
Figure 14. FPU activities of the enzyme mixtures at temperatures from 50 C to 70 C, presented as a percentage of the activity under the stand-ard conditions (50 C, 1 h).
Figure 15. The relative cellulase activity of two different T. reesei strains grown in media containing untreated Nutriose (NO) or BG_81/Cel3A
pretreated Nutriose (NBG81) as a carbon source.
Detailed Description of the Invention Cellulose is the major structural component of higher plants. It pro-vides plant cells with high tensile strength helping them to resist mechanical

11 stress and osmotic pressure. Cellulose is a 13-1,4-glucan composed of linear chains of glucose residues joined by 13-1,4-glycosidic linkages. Cellobiose is the smallest repeating unit of cellulose. In cell walls cellulose is packed in vari-ously oriented sheets, which are embedded in a matrix of hemicellulose and lignin. Hemicellulose is a heterogeneous group of carbohydrate polymers con-taining mainly different glucans, xylans and mannans. Hemicellulose consists of a linear backbone with 13-1,4-linked residues substituted with short side chains usually containing acetyl, glucuronyl, arabinosyl and galactosyl. Hemi-cellulose can be chemically cross-linked to lignin. Lignin is a complex cross-linked polymer of variously substituted p-hydroxyphenylpropane units that pro-vides strength to the cell wall to withstand mechanical stress, and it also pro-tects cellulose from enzymatic hydrolysis.
Lignocellulose is a combination of cellulose and hemicellulose and polymers of phenol propanol units and lignin. It is physically hard, dense, and inaccessible and the most abundant biochemical material in the biosphere.
Lignocellulose containing materials are for example: hardwood and softwood chips, wood pulp, sawdust and forestry and wood industrial waste; agricultural biomass as cereal straws, sugar beet pulp, corn stover and cobs, sugar cane bagasse, stems, leaves, hulls, husks, and the like; waste products as munici-pal solid waste, newspaper and waste office paper, milling waste of e.g.
grains;
dedicated energy crops (e.g., willow, poplar, swithcgrass or reed canarygrass, and the like). Preferred examples are corn stover, switchgrass, cereal straw, sugarcane bagasse and wood derived materials.
"Cellulosic material" as used herein, relates to any material compris-ing cellulose, hemicellulose and/or lignocellulose as a significant component.

"Lignocellulosic material" means any material comprising lignocellulose. Such materials are e.g. plant materials such as wood including softwood and hard-wood, herbaceous crops, agricultural residues, pulp and paper residues, waste paper, wastes of food and feed industry etc. Textile fibres such as cotton, fi-bres derived from cotton, linen, hemp, jute and man made cellulosic fibres as modal, viscose, lyocel are specific examples of cellulosic materials.
Cellulosic material is degraded in nature by a number of various or-ganisms including bacteria and fungi. Cellulose is typically degraded by differ-ent cellulases acting sequentially or simultaneously. The biological conversion of cellulose to glucose generally requires three types of hydrolytic enzymes:
(1) Endoglucanases which cut internal beta-1,4-glucosidic bonds; (2) Exocellobio-

12 hydrolases that cut the dissaccharide cellobiose from the end of the cellulose polymer chain; (3) Beta-1,4-glucosidases which hydrolyze the cellobiose and other short cello-oligosaccharides to glucose. In other words the three major groups of cellulases are cellobiohydrolases (CBH), endoglucanases (EG) and beta-glucosidases (BG).
Degradation of more complex cellulose containing substrates re-quires a broad range of various enzymes. For example lignocellulose is de-graded by hemicellulases, like xylanases and mannanases. Hemicellulase is an enzyme hydrolysing hemicellulose.
"Cellulolytic enzymes" are enzymes having "cellulolytic activity", which means that they are capable of hydrolysing cellulosic substrates or de-rivatives thereof into smaller saccharides. Cellulolytic enzymes thus include both cellulases and hemicellulases. Cellulases as used herein include cellobi-ohydrolase, endoglucanase and beta-glucosidase.
T. reesei has a well known and effective cellulase system containing two CBH's, two major and several minor EG's and BG's. T. reesei CBHI
(Cel7A) cuts sugar from the reducing end of the cellulose chain, has a C-terminal cellulose binding domain (CBD) and may constitute up to 60% of the total secreted protein. T. reesei CBHII (Cel6A) cuts sugar from the non-reducing end of the cellulose chain, has an N-terminal cellulose binding do-main and may constitute up to 20% of the total secreted protein. Endoglu-canases EGI (Cel7B), and EGV (Ce145A) have a CBD in their C-terminus, EGII
(Cel5A) has an N-terminal CBD and EGIII (Ce112A) does not have a cellulose binding domain at all. CBHI, CBHII, EGI and EGII are so called "major cellu-lases" of Trichoderma comprising together 80-90% of total secreted proteins.
It is known to a man skilled in the art that an enzyme may be active on several substrates and enzymatic activities can be measured using different sub-strates, methods and conditions. Identifying different cellulolytic activities is discussed for example in van Tilbeurgh etal. 1988.
In addition to a catalytic domain/core expressing cellulolytic activity cellulolytic enzymes may comprise one or more cellulose binding domains (CBDs), also named as carbohydrate binding domains/modules (CBD/CBM), which can be located either at the N- or C-terminus of the catalytic domain.
CBDs have carbohydrate-binding activity and they mediate the binding of the cellulase to crystalline cellulose but have little or no effect on cellulase hydro-

13 lytic activity of the enzyme on soluble substrates. These two domains are typi-cally connected via a flexible and highly glycosylated linker region.
"Cellobiohydrolase" or "CBH" as used herein refers to enzymes that cleave cellulose from the end of the glucose chain and produce mainly cellobi-ose. They are also called 1,4-beta-D-glucan cellobiohydrolases or cellulose 1,4-beta-cellobiosidases. They hydrolyze the 1,4-beta-D-glucosidic linkages from the reducing or non-reducing ends of a polymer containing said linkages, such as cellulose, whereby cellobiose is released. Two different CBHs have been isolated from Trichoderma reesei, GBH! and CBHII. They have a modular structure consisting of a catalytic domain linked to a cellulose-binding domain (CBD). There are also cellobiohydrolases in nature that lack CBD.
"Endoglucanase" or "EG" refers to enzymes that cut internal glyco-sidic bonds of the cellulose chain. They are classified as EC 3.2.1.4. They are 1,4-beta-D-glucan 4-glucanohydrolases and catalyze endohydrolysis of 1,4-beta-D-glycosidic linkages in polymers of glucose such as cellulose and de-rivatives thereof. Some naturally occurring endoglucanases have a cellulose binding domain, while others do not. Some endoglucanases have also xy-lanase activity (Bailey etal., 1993).
"Beta-glucosidase" or "BG" or "OG" refers to enzymes that degrade small soluble oligosaccharides including cellobiose to glucose. They are classi-fied as EC 3.2.1.21. They are beta-D-glucoside glucohydrolases, which typical-ly catalyze the hydrolysis of terminal non-reducing beta-D-glucose residues.
These enzymes recognize oligosaccharides of glucose. Typical substrates are cellobiose and cellotriose. Cellobiose is an inhibitor of cellobiohydrolases, wherefore the degradation of cellobiose is important to overcome end-product inhibition of cellobiohydrolases.
Xylanases are enzymes that are capable of recognizing and hydro-lyzing hemicellulose. They include both exohydrolytic and endohydrolytic en-zymes. Typically they have endo-1,4-beta-xylanase (EC 3.2.1.8) or beta-D-xylosidase (EC 3.2.1.37) activity that breaks down hemicellulose to xylose.
"Xylanase" or "Xyn" in connection with the present invention refers especially to an enzyme classified as EC 3.2.1.8 hydrolyzing xylose polymers of lignocel-lulosic substrate or purified xylan.
In addition to this cellulases can be classified to various glycosyl hy-drolase families according their primary sequence, supported by analysis of the three dimensional structure of some members of the family (Henrissat

14 1991, Henrissat and Bairoch 1993, 1996). Some glycosyl hydrolases are multi-functional enzymes that contain catalytic domains that belong to different gly-cosylhydrolase families. Family 3 consists of beta-glucosidases (EC 3.2.1.21) such as Ta BG_81, At BG_101 and Ct BG_76 described herein. Family 5 (for-merly known as celA) consists mainly of endoglucanases (EC 3.2.1.4) such as Ta EG_28 described herein. Family 7 (formerly cellulase family ceIC) contains endoglucanases (EC 3.2.1.4) and cellobiohydrolases (EC 3.2.1.91) such as Ct EG_54, Ta CBH, At CBH_A, At CBH_C and Ct CBH described herein. Family (formerly celF) consists mainly of xylanases (EC 3.2.1.8) such as Ta 10 XYN_30 and At XYN_60 described herein. Family 45 (formerly celK) contains endoglucanases (EC 3.2.1.4) such as At EG_40 and At EG_40_like described herein.
Cellulolytic enzymes useful for hydrolyzing cellulosic material are obtainable from Thermoascus aura ntiacus, Acremonium thermophilum, or Chaetomium thermophilum. "Obtainable from" means that they can be ob-tained from said species, but it does not exclude the possibility of obtaining them from other sources. In other words they may originate from any organism including plants. Preferably they originate from microorganisms e.g. bacteria or fungi. The bacteria may be for example from a genus selected from Bacillus, Azospirillum and Streptomyces. More preferably the enzyme originates from fungi (including filamentous fungi and yeasts), for example from a genus se-lected from the group consisting of Thermoascus, Acremonium, Chaetomium, Achaetomium, Thielavia, Aspergillus, Bottytis, Chtysosporium, Collybia, Fomes, Fusarium, Humicola, Hypocrea, Lentinus, Melanocarpus, Myceli-ophthora, Myriococcum, Neurospora, Penicillium, Phanerochaete, Phlebia, Pleurotus, Podospora, Polyporus, Rhizoctonia, Scytalidium, Pycnoporus, Trametes and Trichoderma.
According to a preferred embodiment of the invention the enzymes are obtainable from Thermoascus aurantiacus strain ALK04242 deposited as CBS 116239, strain ALK04245 deposited as CBS 116240 presently classified as Acremonium thermophilium, or Chaetomium thermophilum strain ALK04265 deposited as CBS 730.95.
The cellobiohydrolase preferably comprises an amino acid se-quence having at least 80% identity to SEQ ID NO: 2, 4, 6 or 8, or an enzymat-ically active fragment thereof.

15 Cellobio- Gene Obtainable CBD nucleic acid amino acid hydrolase from SEQ ID NO: SEQ ID NO:
Ta CBH Ta cef7A T. aura ntiacus 1 2 At CBH_A At cel7B A. thermophilum - 3 4 At CBH_C At cel7A A. thermophilum + 5 6 Ct CBH Ct ce/7A I C. thermophilum + 7 8 These CBHs have an advantageous cellulose inhibition constant compared to that of Trichoderma reesei CBH, and they show improved hydrol-ysis results when testing various cellulosic substrates. SEQ ID NO: 2 and 4 do not comprise a CBD. Particularly enhanced hydrolysis results may be obtained when a cellulose binding domain (CBD) is attached to a CBH that has no CBD
of its own. The CBD may be obtained e.g. from a Trichoderma or Chaetomium species, and it is preferably attached to the CBH via a linker. The resulting fu-sion protein containing a CBH core region attached to a CBD via a linker may comprise an amino acid sequence having at least 80 % identity to SEQ ID NO:
28 or 30. Polynucleotides comprising a sequence of SEQ ID NO: 27 or 29 en-code such fusion proteins.
The endoglucanase may comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 10, 12, 14 or 16, or an enzymatically ac-tive fragment thereof. These endoglucanases have good thermostability.
Endo- Gene Obtainable CBD nucl. acid amino acid glucanase from SEQ ID NO: SEQ ID NO:
Ta EG 28 Ta co/5A T. aurantiacus 9 10 At EG 40 At cel45A A. thermophilum + 11 12 At EG40 like At ce/45B A. thermophilum - 13 14 Ct EG_54 Ct cer7B C. thermophilum + 15 16 The beta-glucosidase may comprise an amino acid sequence hav-ing at least 80% identity to SEQ ID NO: 22, 24 or 26, or an enzymatically ac-tive fragment thereof. These beta-glucosidases have good resistance to glu-cose inhibition, which is advantageous to avoid end product inhibition during enzymatic hydrolysis of cellulosic material. The beta-glucosidases may also be used in preparing sophorose, a cellulase inducer used in cultivation of T.
reesei.

16 Beta- Gene Obtainable nucleic acid amino acid glucosidase from SEQ ID NO: SEQ ID NO:
Ta BG_81 Ta ce/3A T. aura ntiacus 21 22 At BG_101 At cel3A A. thermophilum 23 24 Ct BG_76 Ct ce/3A C. the rmophilum 25 26 The xylanase may comprise an amino acid sequence having at least 80% identity to SEQ ID NO: 18 or 20, or an enzymatically active fragment thereof.
Xylanase Gene Obtainable CBD nucleic acid amino acid from SEQ ID NO: SEQ ID NO:
Xyn_30 Ta xynl OA T aurantiacus + 17 18 Xyn_60 At xynl OA A. the rmophilum - 19 20 By the term "identity" is here meant the global identity between two amino acid sequences compared to each other from the first amino acid en-coded by the corresponding gene to the last amino acid. The identity of the full-length sequences is measured by using Needleman-Wunsch global alignment program at EMBOSS (European Molecular Biology Open Software Suite; Rice et a/., 2000) program package, version 3Ø0, with the following parameters:
EMBLOSUM62, Gap penalty 10.0, Extend penalty 0.5. The algorithm is de-scribed in Needleman and Wunsch (1970). The man skilled in the art is aware of the fact that results using Needleman-Wunsch algorithm are comparable on-ly when aligning corresponding domains of the sequence. Consequently com-parison of e.g. cellulase sequences including CBD or signal sequences with sequences lacking those elements cannot be done.
According to one embodiment of the invention, a cellulolytic poly-peptide is used that has at least 80, 85, 90, 95 or 99% identity to SEQ ID NO:

2,4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24 or 26 or at least to its enzymatically ac-tive fragment.
By the term "enzymatically active fragment" is meant any fragment of a defined sequence that has cellulolytic activity. In other words an enzymati-cally active fragment may be the mature protein part of the defined sequence,

17 or it may be only an fragment of the mature protein part, provided that it still has cellobiohydrolase, endoglucanase, beta-glucosidase or xylanase activity.
The cellulolytic enzymes are preferably recombinant enzymes, which may be produced in a generally known manner. A polynucleotide frag-ment comprising the enzyme gene is isolated, the gene is inserted under a strong promoter in an expression vector, the vector is transferred into suitable host cells and the host cells are cultivated under conditions provoking produc-tion of the enzyme. Methods for protein production by recombinant technology in different host systems are well known in the art (Sambrook etal., 1989; Co-en, 2001; Gellissen, 2005). Preferably the enzymes are produced as extracel-lular enzymes that are secreted into the culture medium, from which they can easily be recovered and isolated. The spent culture medium of the production host can be used as such, or the host cells may be removed therefrom, and/or it may be concentrated, filtrated or fractionated. It may also be dried.
Isolated polypeptide in the present context may simply mean that the cells and cell debris have been removed from the culture medium contain-ing the polypeptide. Conveniently the polypeptides are isolated e.g. by adding anionic and/or cationic polymers to the spent culture medium to enhance pre-cipitation of cells, cell debris and some enzymes that have unwanted side ac-tivities. The medium is then filtrated using an inorganic filtering agent and a fil-ter to remove the precipitants formed. After this the filtrate is further processed using a semi-permeable membrane to remove excess of salts, sugars and metabolic products.
According to one embodiment of the invention, the heterologous polynucleotide comprises a gene similar to that included in a microorganism having accession number DSM 16723, DSM 16728, DSM 16729, DSM 16727, DSM 17326, DSM 17324, DSM 17323, DSM 17729, DSM 16724, DSM 16726, DSM 16725, DSM 17325 or DSM 17667.
The production host can be any organism capable of expressing the cellulolytic enzyme. Preferably the host is a microbial cell, more preferably a fungus. Most preferably the host is a filamentous fungus. Preferably the re-combinant host is modified to express and secrete cellulolytic enzymes as its main activity or one of its main activities. This can be done by deleting major homologous secreted genes e.g. the four major cellulases of Trichoderma and by targeting heterologous genes to a locus that has been modified to ensure high expression and production levels. Preferred hosts for producing the cellu-

18 lolytic enzymes are in particular strains from the genus Trichoderma or Asper-gillus.
The enzymes needed for the hydrolysis of the cellulosic material ac-cording to the invention may be added in an enzymatically effective amount ei-ther simultaneously e.g. in the form of an enzyme mixture, or sequentially, or as a part of the simultaneous saccharification and fermentation (SSF). Any combination of the cellobiohydrolases comprising an amino acid sequence having at least 80% identity to SEQ ID NO: 2, 4, 6 or 8 or to an enzymatically active fragment thereof may be used together with any combination of en-doglucanases and beta-glucosidases. If the cellulosic material comprises hem-cellulose, hemicellulases, preferably xylanases are additionally used for the degradation. The endoglucanases, beta-glucosidases and xylanases may be selected from those described herein, but are not limited to them. They can for example also be commercially available enzyme preparations. In addition to cellulases and optional hemicellulases one or more other enzymes may be used, for example proteases, amylases, laccases, lipases, pectinases, ester-ases and/or peroxidases. Another enzyme treatment may be carried out be-fore, during or after the cellulase treatment.
The term "enzyme preparation" denotes to a composition compris-ing at least one of the desired enzymes. The preparation may contain the en-zymes in at least partially purified and isolated form. It may even essentially consist of the desired enzyme or enzymes. Alternatively the preparation may be a spent culture medium or filtrate containing one or more cellulolytic en-zymes. In addition to the cellulolytic activity, the preparation may contain addi-tives, such as mediators, stabilizers, buffers, preservatives, surfactants and/or culture medium components. Preferred additives are such, which are common-ly used in enzyme preparations intended for a particular application. The en-zyme preparation may be in the form of liquid, powder or granulate. Preferably the enzyme preparation is spent culture medium. "Spent culture medium" re-fers to the culture medium of the host comprising the produced enzymes. Pref-erably the host cells are separated from the said medium after the production.

According to one embodiment of the invention the enzyme prepara-tion comprises a mixture of CBH, EG and BG, optionally together with xy-lanase and/or other enzymes. The CBH comprises an amino acid sequence having at least 80% identity to SEQ ID NO: 2, 4, 6 or 8 or to an enzymatically active fragment thereof, and it may be obtained from Thermoascus aurantia-

19 cus, Acrernonium thermophilum, or Chaetomium thermophilum, whereas EG, BG and xylanase may be of any origin including from said organisms. Other enzymes that might be present in the preparation are e.g. proteases, amylas-es, laccases, lipases, pectinases, esterases and/or peroxidases.
Different enzyme mixtures and combinations may be used to suit different process conditions. For example if the degradation process is to be carried out at a high temperature, thermostable enzymes are chosen. A com-bination of a CBH of family 7 with an endoglucanase of family 45, optionally in combination with a BG of family 3 and/or a xylanase of family 10 had excellent hydrolysis performance both at 45 C, and at elevated temperatures.
Cellulolytic enzymes of Trichoderma reesei are conventionally used at temperatures in the range of about 40-50 C in the hydrolysis, and at 30-40 C in SSF. CBH, EG, BG and Xyn obtainable from Thermoascus aurantia-cus, Acremoniurn thermophilum, or Chaetomium thermophilum are efficient at these temperatures too, but in addition most of them also function extremely well at temperatures between 50 C and 75 C, or even up to 80 C and 85 C, such as between 55 C and 70 C, e.g. between 60 C and 65 C. For short incu-bation times enzyme mixtures are functional up to even 85 C, for complete hy-drolysis lower temperatures are normally used.
The method for treating cellulosic material with CBH, EG, BG and Xyn is especially suitable for producing fermentable sugars from lignocellulosic material. The fermentable sugars may then be fermented by yeast into ethanol, and used as fuel. They can also be used as intermediates or raw materials for the production of various chemicals or building blocks for the processes of chemical industry, e.g. in so called biorefinery. The lignocellulosic material may be pretreated before the enzymatic hydrolysis to disrupt the fiber structure of cellulosic substrates and make the cellulose fraction more accessible to the cellulolytic enzymes. Current pretreatments include mechanical, chemical or thermal processes and combinations thereof. The material may for example be pretreated by steam explosion or acid hydrolysis.
A number of novel cellulolytic polypeptides were found in Thermo-ascus aurantiacus, Acremonium thermophilum, and Chaetomium thermophi-lum. The novel polypeptides may comprise a fragment having cellulolytic activi-ty and be selected from the group consisting of a polypeptide comprising an amino acid sequence having at least 66%, preferably 70% or 75%, identity to SEQ ID NO: 4, 79% identity to SEQ ID NO: 6, 78% identity to SEQ ID NO: 12,

20 68%, preferably 70% or 75%, identity to SEQ ID NO: 14, 72%, preferably 75%, identity to SEQ ID NO: 16, 68%, preferably 70% or 75%, identity to SEQ ID
NO: 20, 74% identity to SEQ ID NO: 22 or 24, or 78% identity to SEQ ID NO:
26.
The novel polypeptides may also be variants of said polypeptides. A
"variant" may be a polypeptide that occurs naturally e.g. as an allelic variant within the same strain, species or genus, or it may have been generated by mutagenesis. It may comprise amino acid substitutions, deletions or insertions, but it still functions in a substantially similar manner to the enzymes defined above i.e. it comprises a fragment having cellulolytic activity.
The cellulolytic polypeptides are usually produced in the cell as im-mature polypeptides comprising a signal sequence that is cleaved off during secretion of the protein. They may also be further processed during secretion both at the N-terminal and/or C-terminal end to give a mature, enzymatically active protein. A polypeptide "comprising a fragment having cellulolytic activity"
thus means that the polypeptide may be either in immature or mature form, preferably it is in mature form, i.e. the processing has taken place.
The novel polypeptides may further be a "fragment of the polypep-tides or variants" mentioned above. The fragment may be the mature form of the proteins mentioned above, or it may be only an enzymatically active part of the mature protein. According to one embodiment of the invention, the poly-peptide has an amino acid sequence having at least 80, 85, 90, 95, or 99%
identity to SEQ ID NO: 4, 6, 12, 14, 16, 20, 22, 24 or 26, or to a cellulolytically active fragment thereof. It may also be a variant thereof, or a fragment thereof having cellobiohydrolase, endoglucanase, xylanase, or beta-glucosidase activi-ty. According to another embodiment of the invention, the polypeptide consists essentially of a cellulolytically active fragment of a sequence of SEQ ID NO:
4, 6,12, 14, 16, 20, 22, 24 or 26.
The novel polynucleotides may comprise a nucleotide sequence of SEQ ID NO: 3, 5, 11, 13, 15, 19, 21, 23 or 25, or a sequence encoding a novel polypeptide as defined above, including complementary strands thereof. Poly-nucleotide as used herein refers to both RNA and DNA, and it may be single stranded or double stranded. The polynucleotide may also be a fragment of said polynucleotides comprising at least 20 nucleotides, e.g. at least 25, 30 or 40 nucleotides. According to one embodiment of the invention it is at least 100, 200 or 300 nucleotides in length. Further the polynucleotide may be degener-

21 ate as a result of the genetic code to any one of the sequences as defined above. This means that different codons may code for the same amino acid.
According to one embodiment of the invention the polynucleotide is "comprised in" SEQ ID NO: 3, 5, 11, 13, 15, 19, 21, 23 or 25, which means that the sequence has at least part of the sequence mentioned. According to an-other embodiment of the invention, the polynucleotide comprises a gene simi-lar to that included in a microorganism having accession number DSM 16728, DSM 16729, DSM 17324, DSM 17323, DSM 17729, DSM 16726, DSM 16725, DSM 17325 or DSM 17667.
The novel proteins/polypeptides may be prepared as described above. The novel polynucleotides may be inserted into a vector, which is ca-pable of expressing the polypeptide encoded by the heterologous sequence, and the vector may be inserted into a host cell capable of expressing said pol-ypeptide. The host cell is preferably of the genus Trichoderma or Aspergillus.
A heterologous gene encoding the novel polypeptides has been in-troduced on a plasmid into an Escherichia coil strain having accession number DSM 16728, DSM 16729, DSM 17324, DSM 17323, DSM 17729, DSM 16726, DSM 16725, DSM 17325 or DSM 17667.
The novel enzymes may be components of an enzyme preparation.
The enzyme preparation may comprise one or more of the novel polypeptides, and it may be e.g. in the form of spent culture medium, powder, granules or liquid. According to one embodiment of the invention it comprises cellobiohy-drolase, endoglucanase, beta-glucosidase, and optionally xylanase activity and/or other enzyme activities. It may further comprise any conventional addi-tives.
The novel enzymes may be applied in any process involving cellulo-lytic enzymes, such as in fuel, textile, detergent, pulp and paper, food, feed or beverage industry, and especially in hydrolysing cellulosic material for the pro-duction of biofuel comprising ethanol. In the pulp and paper industry they may be used to modify cellulosic fibre for example in treating kraft pulp, mechanical pulp, or recycled paper.
The invention is illustrated by the following non-limiting examples. It should be understood, however, that the embodiments given in the description above and in the examples are for illustrative purposes only, and that various changes and modifications are possible within the scope of the invention.

22 Examples Example 1. Screening for strains expressing cellulolytic activity and their cultivation for purification About 25 fungal strains from the Roal Oy culture collection were tested for cellulolytic activity including beta-glucosidases. After preliminary screening six strains were chosen for further studies. These were Thermo-ascus aurantiacus ALK04239 and ALK04242, Acremonium thermophilum ALK04245, Talaromyces thermophilus ALK04246 and Chaetomium ther-mophilum ALK04261 and ALK04265.
The strains ALK04239, ALK04242 and ALK04246 were cultivated in shake flasks at 42 C for 7 d in the medium 3 x B, which contains g/litre:
Sol-ka Floc cellulose 18, distiller's spent grain 18, oats spelt xylan 9, CaCO3 2, soybean meal 4.5, (NH4)HPO4 4.5, wheat bran 3.0, KH2PO4 1.5, MgSO4.1-120 1.5, NaCI 0.5, KNO3 0.9, locust bean gum 9.0, trace element solution #1 0.5, trace element solution #2 0.5 and Struktol (Stow, OH, USA) antifoam 0.5 ml;
the pH was adjusted to 6.5. Trace element solution #1 has g/litre: MnSO4 1.6, ZnSO4.7H20 3.45 and CoC12=6H20 2.0; trace element solution #2 has g/litre:
FeSO4=7H20 5.0 with two drops of concentrated H2SO4.
The strain ALK04261 was cultivated in shake flasks in the medium 1xB, which has one third of each of the constituents of the 3 x B medium (above) except it has same concentrations for CaCO3, NaCI and the trace el-ements. The strain was cultivated at 45 C for 7 d.
The strain ALK04265 was cultivated in shake flasks in the following medium, g/I: Solka Floc cellulose 40, PharmamediaTM (Traders Protein, Mem-phis, TN, USA) 10, corn steep powder 5, (NH4)2504 5 and KH2PO4 15; the pH
was adjusted to 6.5. The strain was cultivated at 45 C for 7 d.
After the cultivation the cells and other solids were collected by cen-trifugation down and the supernatant was recovered. For the shake flask cultivations, protease inhibitors PMSF (phenylmethyl-sulphonylfluoride) and pepstatin A were added to 1 mM and 10 pg/ml, respectively. If not used imme-diately, the preparations were stored in aliquots at ¨20 C.
For the estimation of the thermoactivity of the enzymes, assays were performed of the shake flask cultivation preparations at 50 C, 60 C, 65 C, 70 C and 75 C for 1 h, in the presence of 100 pg bovine serum albumin (BSA) /ml as a stabilizer. Preliminary assays were performed at 50 C and

23 65 C at two different pH values (4.8/5.0 or 6.0) in order to clarify, which pH

was more appropriate for the thermoactivity assay.
All shake flask supernatants were assayed for the following activi-ties:
Cellobiohydrolase I ¨like activity ('CBHI') and the endoglucanase I ¨
like activity (EGI'):
These were measured in 50 mM Na-acetate buffer with 0.5 mM
MUL (4-methylumbelliferyl-beta-D-lactoside) as the substrate. Glucose (100 mM) was added to inhibit any interfering beta-glucosidase activity. The liberated 4-methylumbelliferyl was measured at 370 nm. The 'CBHI' and the 'EGI' activities were distinguished by measuring the activity in the presence and absence of cellobiose (5 mM). The activity that is not inhibited by cellobiose represents the 'EGI' activity and the remaining MUL activity represents the `CBHI' activity (van Tilbeurgh eta!, 1988). The assay was per-formed at pH 5.0 or 6.0 (see below).
The endoglucanase (CMCase) activity:
This was assayed with 2% (w/v) carboxymethylcellulose (CMC) as the substrate in 50 mM citrate buffer essentially as described by Bailey and Nevalainen 1981: Haakana et a/. 2004. Reducing sugars were measured with the DNS reagent. The assay was performed at pH 4.8 or 6.0 (see below).
Beta-glucosidase (BGU) activity:
This was assayed with 4-nitropheny1-13-D-glucopyranoside (1 mM) in 50 mM citrate buffer as described by Bailey and Nevalainen 1981. The liberated 4-nitrophenol was measured at 400 nm. The assay was performed at pH 4.8 or 6.0 (see below).
The relative activities of the enzymes are presented in Figure 1. The relative activities were presented by setting the activity at 60 C as 100%
(Fig-ure 1). All strains produced enzymes, which had high activity at high tempera-tures (65 C-75 C).
For protein purifications. ALK04242 was also grown in a 2 litre bio-reactor (Braun BiostatO B, Braun, Melsungen, Germany) in the following me-dium, g/litre: Solka Floc cellulose 40, soybean meal 10, NH4NO3 5, KH2F04 5, MgSO4.7H20 0.5, CaCl2.2H20 0.05, trace element solution #1 0.5, trace ele-ment solution #2 0.5. The aeration was 1 vvm, antifoam control with Struktol, stirring 200-800 rpm and temperature at 47 C. Two batches were run, one at pH 4.7 - 0.2 (NH3 / H2SO4) and the other with initial pH of pH 4.5. The

24 cultivation time was 7 d. After the cultivation the cells and other solids were removed by centrifugation.
The strain ALK04245 was grown in 2 litre bioreactor (Braun Bio-statO B, Braun, Melsungen, Germany) in the following medium, g/litre: Solka Floc cellulose 40, corn steep powder 15, distiller's spent grain 5, oats spelt xy-Ian 3, locust bean gum 3, (NH4)2SO4 5 and KH2PO4 5. The pH range was 5.2 0.2 (NH3 / H2SO4), aeration 1 vvm, stirring 300-600 rpm, antifoam control with Struktol and the temperature 42 C. The cultivation time was 4 d. After the cul-tivation the cells and other solids were removed by centrifugation.
For enzyme purification, ALK04261 was grown in a 10 litre bioreac-tor (Braun Biostat ED, Braun, Melsungen, Germany) in the following medium, g/litre: Solka Floc cellulose 30, distiller's spent grain 10, oats spelt xylan 5, CaCO3 2, soybean meal 10, wheat bran 3.0, (NH4)2SO4 5, KH2PO4 5, MgSO4.7H20 0.5, NaCI 0.5, KNO3 0.3, trace element solution #1 0.5 and trace element solution #2 0.5. The pH range was 5.2 0.2 (NH3 / H2SO4), aeration 1 vvm, stirring 200-600 rpm, antifoam control with Struktol and the temperature 42 C. The cultivation time was 5 d. A second batch was grown under similar conditions except that Solka Floc was added to 40 g/I and spent grain to 15 g/I.
The supernatants were recovered by centrifugation and filtering through Seitz-K 150 and EK filters (Pall SeitzSchenk Filtersystems GmbH, Bad Kreuznach, Germany). The latter supernatant was concentrated about ten fold using the PeMoon mini ultrafiltration system (filter NMVVL 10 kDa; Millipore, Billerica, MA, USA).
For enzyme purification, ALK04265 was also grown in a 10 litre bio-reactor (Braun BiostatO ED, Braun, Melsungen, Germany) in the same medi-um as above, except KH2PO4 was added to 2.5 g/I. The pH range was 5.3 0.3 (NH3 / H3PO4), aeration 0.6 vvm, stirring 500 rpm, antifoam control with Struktol and the temperature 43 C. The cultivation time was 7 d. The superna-tants were recovered by centrifugation and filtering through Seitz-K 150 and EK filters (Pall SeitzSchenk Filtersystems GmbH, Bad Kreuznach, Germany).
The latter supernatant was concentrated about 20 fold using the Pellicon mini ultrafiltration system (filter NMVVL 10 kDa; Millipore, Billerica, MA, USA).

25 Example 2. Purification and characterization of cellobiohydrolases from Acremonium thermophilum ALK04245 and Chaetomium thermophilum Acremonium thermophilum ALK04245 and Chaetomium thermophi-luM ALK04285 were grown as described in Example 1. The main cellobiohydrolases were purified using p-aminobenzyl 1-thio-13-cellobioside-based affinity column, prepared as described by Tomme et al., 1988.
The culture supernatants were first buffered into 50 mM sodium acetate buffer pH 5.0, containing 1 mM 6-gluconolactone and 0.1 M glucose in order to retard ligand hydrolysis in the presence of 3-glucosidases.
Cellobiohydrolases were eluted with 0.1 M lactose and finally purified by gel filtration chromatography using Superdex 200 HR 10/30 columns in the AKTA
system (Amersham Pharmacia Biotech). The buffer used in gel filtration was 50 mM sodium phosphate pH 7.0, containing 0.15 M sodium chloride.
Purified cellobiohydrolases were analysed by SDS-polyacrylamide gel electrophoresis and the molecular mass of both proteins was determined to be approximately 70 kDa evaluated on the basis of the molecular mass stand-ards (Low molecular weight calibration kit, Amersham Biosciences). Purified Acremonium and Chaetomium cellobiohydrolases were designated as At Cel7A and Ct Cel7A, respectively, following the scheme in Henrissat et al.
(1998) (Henrissat, 1991; Henrissat and Bairoch, 1993).
The specific activity of the preparations was determined using 4-methylumbellifery1-3-D-lactoside (MUL), 4-methylumbellifery1-3-D-cellobioside (MUG2) or 4-methylumbellifery1-3-D-cellotrioside (MUG3) as substrate (van Tilbeurgh et al., 1988) in 0.05 M sodium citrate buffer pH 5 at 50 C for 10 min.
Endoglucanase and xylanase activities were determined by standard procedures (according to IUPAC, 1987) using carboxymethyl cellulose (CMC) and birch glucuronoxylan (Bailey et al., 1992) as substrates. Specific activity against Avicel was calculated on the basis of reducing sugars formed in a 24 h reaction at 50 C, pH 5.0, with 1% substrate and 0.25 pM enzyme dosage. The protein content of the purified enzyme preparations was measured according to Lowry etal., 1951. To characterize the end products of hydrolysis, soluble sugars liberated in 24 h hydrolysis experiment, as described above, were analysed by HPLC (Dionex). Purified cellobiohydrolase I (CBHI/Cel7A) of Trichoderma reesei was used as a reference.

26 The specific activities of the purified enzymes and that of T. reesei CBHI/Cel7A are presented in Table 1. The purified At Cel7A and Ct Cel7A
cellobiohydrolases possess higher specific activities against small synthetic substrates as compared to T. reesei CBHI/Cel7A. The specific activity against Avicel was clearly higher with the herein disclosed enzymes. Low activities of the purified enzyme preparations against xylan and CMC may either be due to the properties of the proteins themselves, or at least partially to the remaining minor amounts of contaminating enzymes. The major end product of cellulose hydrolysis by all purified enzymes was cellobiose which is typical to cellobiohydrolases.

27 Table 1. Specific activities (nkat/mg) of the purified cellobiohydrolases and the reference enzyme of T. reesei (50 C, pH 5.0, 24 h).
Substrate A. thermophilum C. thermophilum T. reesei ALK04245 Cel7A ALK04265 Cel7A
Cel7A
Xylan 11.3 6.7 1.3 CMC 26.2 5.5 1.0 MUG2 9.2 18.9 4.3 MUG3 1.3 1.5 0.9 MUL 21.5 54.0 21.9 Avicel 1.8 1.4 0.6 Thermal stability of the purified cellobiohydrolases was determined at different temperatures. The reaction was performed in the presence of 0.1%
BSA at pH 5.0 for 60 min using 4-methylumbellifery1-13-D-lactoside as sub-strate. C. thermophilum ALK04265 CBH/Cel7A and A. thermophilum ALK04245 CBH/Cel7A were stable up to 65 and 60 C, respectively. The T.
reesei reference enzyme (CBHI/Cel7A) retained 100% of activity up to 55 C.
Example 3. Purification and characterization of an endoglucanase from Acremonium thermophilum ALK04245 Acremonium thermophilum ALK04245 was grown as described in Example 1. The culture supernatant was incubated at 70 C for 24 hours after which it was concentrated by ultrafiltration. The pure endoglucanase was obtained by sequential purification with hydrophobic interaction and cation exchange chromatography followed by gel filtration. The endoglucanase activity of the fractions collected during purification was determined using carboxymethyl cellulose (CMC) as substrate (procedure of IUPAC 1987).
Protein content was measured by BioRad Assay Kit (Bio-Rad Laboratories) using bovine serum albumine as standard.
The concentrated culture supernatant was applied to a HiPrep 16/10 Butyl FF hydrophobic interaction column equilibrated with 20 mM potassium phosphate buffer pH 6.0, containing 1 M (NH4)2SO4. Bound proteins were eluted with the linear gradient from the above buffer to 5 mM potassium phosphate, pH 6Ø Fractions were collected and the endoglucanase activity

28 was determined as described above. The endoglucanase activity was eluted in a broad conductivity area of 120 to 15 mS/cm, Combined fractions were applied to a HiTrap SP XL cation ex-change column equilibrated with 8 mM sodium acetate, pH 4.5. Bound proteins were eluted with a linear gradient from 0 to 0.25 M NaCI in the equilibration buffer. The protein containing endoglucanase activity was eluted at the con-ductivity area of 3-7 mS/cm. Cation exchange chromatography was repeated and the protein eluate was concentrated by freeze drying.
The dissolved sample was loaded onto a Superdex 75 HR10/30 gel filtration column equilibrated with 20 mM sodium phosphate buffer pH 7.0, con-taining 0.15 M NaCI. The main protein fraction was eluted from the column with the retention volume of 13.3 ml. The protein eluate was judged to be pure by SDS-polyacryl amide gel electrophoresis and the molecular weight was evaluated to be 40 kDa. The specific activity of the purified protein, designated as At EG_40, at 50 C was determined to be 450 nkat/mg (procedure of IUPAC
1987, using CMC as substrate).
Thermal stability of the purified endoglucanase was determined at different temperatures. The reaction was performed in the presence of 0.1 mg/m1 BSA at pH 5.0 for 60 min using carboxymethyl cellulose as substrate. A.
thermophilum EG_40/Ce145A was stable up to 80 C. The T. reesei reference enzymes EGI (Cel7B) and EGII (Cel5A) retained 100% of activity up to 60 C
and 65 C, respectively.
Example 4. Purification of an endoglucanase from Chaetomium thermophilum ALK04261 Chaetomium thermophilum ALK04261 was grown as described in Example 1. The pure endoglucanase was obtained by sequential purification with hydrophobic interaction and cation exchange chromatography followed by gel filtration. The endoglucanase activity of the fractions collected during purification was determined using carboxymethyl cellulose (CMC) as substrate (procedure of IUPAC 1987).
Ammonium sulfate was added to the culture supernatant to reach the same conductivity as 20 mM potassium phosphate pH 6.0, containing 1 M
(NH4)2SO4. The sample was applied to a HiPrep 16/10 Phenyl FF hydrophobic interaction column equilibrated with 20 mM potassium phosphate pH 6.0, containing 1 M (NH4)2SO4. Elution was carried out with a linear gradient of 20 to 0 mM potassium phosphate, pH 6.0, followed by 5 mM potassium

29 phosphate, pH 6.0 and water. Bound proteins were eluted with a linear gradient of 0 to 6 M Urea. Fractions were collected and the endoglucanase activity was analysed as described above. The protein containing endoglucanase activity was eluted in the beginning of the urea gradient.
The fractions were combined, equilibriated to 16 mM Tris-HCI pH
7.5 (I = 1.4 mS/cm) by 10DG column (Bio-Rad) and applied to a HiTrap DEAE
FF anion exchange column equilibrated with 20 mM Tris-HCI, pH 7.5. Bound proteins were eluted with a linear gradient from 0 to 1 M NaCI in the equilibration buffer. Fractions were collected and analyzed for endoglucanase activity as described above. The protein was eluted in the range of 10-20 mS/cm.
The sample was equilibrated to 15 mM sodium acetate, pH 4.5 by 100G column (Bio-Rad) and applied to a HiTrap SP XL cation exchange col-umn equilibrated with 20 mM sodium acetate pH 4.5. Proteins were eluted with a linear gradient from 0 to 0.4 M sodium acetate, pH 4.5. Endoglucanase activ-ity was eluted in the range of 1-10 mS/cm. The collected sample was lyophi-lized.
The sample was dissolved in water and applied to a Superdex 75 HR 10/30 gel filtration column equilibrated with 20 mM sodium phosphate pH
6,0, containing 0.15 M NaCI. Fractions were collected and those containing endoglucanase activity were combined. The protein eluate was judged to be pure by SDS-polyacrylamide gel electrophoresis and the molecular mass was evaluated on the basis of molecular mass standards (prestained SDS-PAGE
standards, Broad Range, Bio-Rad) to be 54 kDa. The pl of the purified protein, designated as Ct EG_54 was determined with PhastSystem (Pharmacia) to be ca 5.5.
Example 5. Purification of an endoglucanase from Thermoascus aurantiacus ALK04242 Thermoascus aurantiacus ALK04242 was grown as described in Example 1. The pure endoglucanase was obtained by sequential purification with hydrophobic interaction and anion exchange chromatography followed by gel filtration. The endoglucanase activity of the fractions collected during purification was determined using carboxymethyl cellulose (CMC) as substrate (procedure of IUPAC 1987). Protein content was measured by BioRad Assay Kit (Bio-Rad Laboratories) using bovine serum albumine as standard.

30 The culture supernatant was applied to a HiPrep 16/10 Butyl hydro-phobic interaction column equilibrated with 20 mM potassium phosphate buffer pH 6.0, containing 0.7 m (NH4)2504. Bound proteins were eluted with 0.2 M
(NH4)2SO4 (I = 39 mS/cm). Fractions containing endoglucanase activity were combined and concentrated by ultrafiltration.
The sample was desalted in 10DG columns (Bio-Rad) and applied to a HiTrap DEAE FF anion exchange column equilibrated with 15 mM Tris-HCL, pH 7Ø Bound proteins were eluted with a linear gradient from 0 to 0.4 M

NaCl in the equilibration buffer. The protein containing endoglucanase activity was eluted at the conductivity area of 15-21 mS/cm. Collected fractions were combined and concentrated as above.
The sample was applied to a Sephacryl S-100 HR 26/60 gel filtra-tion column equilibrated with 50 mM sodium acetate buffer pH 5.0, containing 0.05 M NaCI. The protein fraction containing endoglucanase activity was elut-ed from the column with a retention volume corresponding to a molecular weight of 16 kDa. Collected fractions were combined, concentrated and gel filtration was repeated. The protein eluate was judged to be pure by SDS-polyacryl amide gel electrophoresis and the molecular weight was evaluated to be 28 kDa. The pl of the purified protein, designated as Ta EG_28, was determined in an IEF gel (PhastSystem, Pharmacia) to be about 3.5. The spe-cific activity of Ta EG_28 at 50 C was determined to be 4290 nkat/mg (proce-dure of IUPAC 1987, using CMC as substrate).
Example 6. Purification and characterization of a 6-glucosidase from Acremonium thermophilum ALK04245 Acremonium thermophilum ALK04245 was grown as described in Example 1. The pure p-glucosidase was obtained by sequential purification with hydrophobic interaction and anion exchange chromatography followed by gel filtration. The p-glucosidase activity of the fractions collected during purifi-cation was determined using 4-nitrophenyl-3-D-glucopyranoside as substrate (Bailey and Linko, 1990). Protein content was measured by BioRad Assay Kit (Bio-Rad Laboratories) using bovine serum albumine as standard.
The culture supernatant was applied to a HiPrep 16/10 Phenyl Se-pharose FF hydrophobic interaction column equilibrated with 20 mM potassium phosphate pH 6.0, containing 1 M (NH4)2SO4. Bound proteins were eluted with a linear gradient from the equilibration buffer to 5 mM potassium phosphate in

31 the conductivity area 137-16 mS/cm. Collected fractions were combined and concentrated by ultrafiltration.
The sample was desalted in 10DG columns (Bio-Rad) and applied to a HiTrap DEAE FF anion exchange column equilibrated with 10 mM potas-slum phosphate pH 7Ø Bound proteins were eluted with a linear gradient from the equilibration buffer to the same buffer containing 0.25 M NaCI in the con-ductivity area 1.5-12 mS/cm. Anion exchange chromatography was repeated as above, except that 4 mM potassium phosphate buffer pH 7.2 was used.
Proteins were eluted at the conductivity area of 6-9 mS/cm. Fractions contain-ing P-glucosidase activity were collected, combined, and concentrated.
The active material from the anion exchange chromatography was applied to a Sephacryl S-300 HR 26/60 column equilibrated with 20 mM sodi-um phosphate pH 6.5, containing 0.15 M NaCI. The protein with P-glucosidase activity was eluted with a retention volume corresponding to a molecular weight of 243 kDa. The protein was judged to be pure by SDS-polyacrylamide gel electrophoresis and the molecular weight was evaluated to be 101kDa. The pl of the purified protein, designated as At pG_101, was determined in an IEF
gel (PhastSystem, Pharmacia) to be in the area of 5.6-4.9. The specific activity of At 3G 101 at 50 C was determined to be 1100 nkat/mg (using 4-nitrophenyl-p-D-glucopyranoside as substrate, Bailey and Link , 1990).
Thermal stability of the purified P-glucosidase was determined at dif-ferent temperatures. The reaction was performed in the presence of 0.1 mg/ml BSA at pH 5.0 for 60 min using 4-nitrophenyl-3-D-glucopyranoside as sub-strate. A. thermophilum 3G_.101 was stable up to 70 C. The Aspergillus refer-ence enzyme (Novozym 188) retained 100% of activity up to 60 .
Example 7. Purification of a 13-glucosidase from Chaetomium thermophi-tam ALK04261 Chaetomium thermophilum ALK04261 was grown as described in Example 1. The pure p-glucosidase was obtained by sequential purification with hydrophobic interaction, anion and cation exchange chromatography fol-lowed by gel filtration. The p-glucosidase activity of the fractions collected dur-ing purification was determined using 4-nitrophenyl-3-D-glucopyranoside as substrate (Bailey and Linko, 1990).
The culture supernatant was applied to a HiPrep 16/10 Phenyl Se-pharose FF hydrophobic interaction column equilibrated with 20 mM potassium phosphate pH 6.0, containing 0.8 M (NI-14)2SO4. The elution was carried out

32 with a linear gradient from the equilibration buffer to 3 mM potassium phosphate, pH 6.0, followed by elution with water and 6 M urea. The first frac-tions with p-glucosidase activity were eluted in the conductivity area of 80-mS/cm. The second P-glucosidase activity was eluted with 6 M urea. The active fractions eluted by urea were pooled and desalted in 10DG columns (Bio-Rad) equilibrated with 10 mM Tris-HCl pH 7Ø
After desalting, the sample was applied to a HiTrap DEAF FF anion exchange column equilibrated with 15 mM Tris-HCI pH 7Ø The protein did not bind to the column but was eluted during the sample feed. This flow-through fraction was desalted in 10DG columns (Bio-Rad) equilibrated with 7 mM Na acetate, pH 4.5.
The sample from the anion exchange chromatography was applied to a HiTrap SP FF cation exchange column equilibrated with 10 mM sodium acetate pH 4.5. Bound proteins were eluted with a linear gradient from 10 mM
to 400 mM sodium acetate, pH 4.5. The fractions with ji-glucosidase activity eluting in conductivity area of 6.5-12 mS/cm were collected, desalted in 10DG
columns (Bio-Rad) equilibrated with 7 mM sodium acetate, pH 4.5 and lyophi-lized.
The lyophilized sample was diluted to 100 pl of water and applied to a Superdex 75 HF10/30 gel filtration column equilibrated with 20 mM sodium phosphate pH 4.5, containing 0.15 M NaCI. The p-glucosidase activity was eluted at a retention volume of 13.64 ml. Collected fractions were combined, lyophilized and dissolved in water. The protein was judged to be pure by SDS-polyacryl amide gel electrophoresis and the molecular weight was evaluated to be 76 kDa. The protein was designated as Ctl3G_76.
Example 8. Purification and characterization of a 8-glucosidase from Thermoascus aurantiacus ALK04242 Thermoascus aurantiacus ALK04242 was grown as described in Example 1. The pure p-glucosidase was obtained by sequential purification with hydrophobic interaction, anion and cation exchange chromatography fol-lowed by gel filtration. The p-glucosidase activity of the fractions collected dur-ing purification was determined using 4-nitrophenyl-3-D-glucopyranoside as substrate (Bailey and Linko, 1990). Protein content was measured by BioRad Assay Kit (Bio-Rad Laboratories) using bovine serum albumine as standard.
The culture supernatant was applied to a HiPrep 16/10 Phenyl Se-pharose FF hydrophobic interaction column equilibrated with 20 mM potassium

33 phosphate pH 6.0, containing 0.7 M (NH4)2SO4. Bound proteins were eluted with a linear gradient from 0.2 M (N1-14)2SO4 to 5 mM potassium phosphate, pH
6Ø The p-glucosidase activity was eluted during the gradient in the conductivi-ty area of 28.0-1.1 mS/cm. Fractions were combined and concentrated by ultrafiltration.
The sample was desalted in 10DG columns (Bio-Rad) and applied to a HiTrap DEAE FE anion exchange column equilibrated with 20 mM Tris-HCI pH 7Ø The enzyme was eluted with a linear gradient from 0 to 0.2 M
NaCI in the equilibration buffer and with delayed elution by 20 mM Tris-HCl, containing 0.4 M NaCI. The sample eluting in the conductivity area of ca. 10-30 mS/cm was concentrated by ultrafiltration and desalted by 10DG column (Bio-Rad).
The sample was applied to a HiTrap SP XL cation exchange column equilibrated with 9 mM sodium acetate pH 4.5. The enzyme was eluted with a linear gradient from 10 mM to 400 mM NaAc and by delayed elution using 400 mM NaAc pH 4.5 Proteins with p-glucosidase activity were eluted broadly dur-ing the linear gradient in the conductivity area of 5.0-11.3 mS/cm.
The active material from the cation exchange chromatography was applied to a Sephacryl S-300 HR 26/60 column equilibrated with 20 mM sodi-urn phosphate pH 7,0, containing 0.15 M NaCI. The protein with P-glucosidase activity was eluted with a retention volume corresponding to a molecular weight of 294 kDa. Collected fractions were combined, lyophilized and dissolved in water. The protein was judged to be pure by SDS-polyacrylamide gel electrophoresis and the molecular weight was evaluated to be 81 kDa, representing most likely the monomeric form of the protein. lsoelectric focusing (IEF) was carried out using a 3-9 pl gel. After silver staining, a broad area above pl 5.85 was stained in addition to a narrow band corresponding to pl 4.55. The specific activity of the purified protein, designated as Ta 3G_81, at 50 C was determined to be 600 nkat/mg using 4-nitrophenyl-3-D-glucopyranoside as substrate (Bailey and Linko, 1990).
Thermal stability of the purified 13-glucosidase was determined at dif-ferent temperatures. The reaction was performed in the presence of 0.1 mg/ml BSA at pH 5.0 for 60 min using 4-nitrophenyl-3-D-glucopyranoside as sub-strate. T. aurantiacusPG_81 was stable up to 75 C. The Aspergillus reference enzyme (Novozym 188) retained 100% of activity up to 60 C.

34 Example 9. Purification of a xylanase from Acremonium thermophilum Acremonium thermophilum ALK04245 was grown as described in Example 1. The culture supernatant was incubated at 70 C for 24 hours after which, it was concentrated by ultrafiltration. The pure xylanase was obtained by sequential purification with hydrophobic interaction and cation exchange chromatography followed by gel filtration. The xylanase activity was determined using birch xylan as substrate (procedure of IUPAC 1987). Protein was assayed by BioRad Protein Assay Kit (Bio-Rad Laboratories) using bovine serum albumin as standard.
The concentrated culture supernatant was applied to a HiPrep 16/10 Butyl FF hydrophobic interaction column equilibrated with 20 mM potassium phosphate buffer pH 6.0, containing 1 M (NI-14)2SO4. Bound proteins were eluted with the linear gradient from the above buffer to 5 mM potassium phosphate, pH 6Ø The protein fraction was eluted in a broad conductivity area of 120 to 15 mS/cm.
The sample from the hydrophobic interaction column was applied to a HiTrap SP XL cation exchange column equilibrated with 8 mM sodium ace-tate, pH 4.5. The protein did not bind to this column but was eluted in the flow-through during sample feed. This eluate was concentrated by ultrafiltration.
The hydrophobic chromatography was repeated as described above. The un-bound proteins were collected and freeze dried.
The dissolved sample was loaded onto the Superdex 75 HR10/30 gel filtration column equilibrated with 20 mM sodium phosphate buffer pH 7.0, containing 0.15 M NaCl. The protein eluted from the column with the retention volume of 11.2 ml was judged to be pure by SDS-polyacryl amide gel electrophoresis. The molecular mass of the purified protein was evaluated on the basis of molecular mass standards (prestained SDS-PAGE standards, Broad Range, Bio-Rad) to be 60 kDa. The specific activity of the protein, des-ignated as At XYN_60, at 50 C was determined to be 1800 nkat/mg (proce-dure of IUPAC 1987, using birch xylan as substrate). The relative activity was increased about 1.2 fold at 60 C and 1.65 fold at 70 C (10 min, pH 5.0) as compared to 50 C. The specific activity against MUG2 (4-methylumbellifery1-8-0-cellobioside), MUL (4-methylumbelliferyl-beta-D-lactoside) and MUG3 (4-methylumbellifery1-8-D-cellotrioside) were 54, 33 and 78 nkat/mg (50 C pH 5.0 10 min), respectively. This is in agreement with the fact that the family 10

35 xylanases also show activity against the aryl glucopyranosides (Biely et al.
1997).
Example 10. Purification of a xylanase from Thermoascus aurantiacus Thermoascus aurantiacus ALK04242 was grown as described in Example 1. The pure xylanase was obtained by sequential purification with hy-drophobic interaction, anion, and cation exchange chromatography followed by gel filtration. The xylanase activity was determined using birch xylan as substrate (procedure of IUPAC 1987). Protein was assayed by BioRad Protein Assay Kit (Bio-Rad Laboratories) using bovine serum albumin as standard.
The culture supernatant was applied to a HiPrep 16/10 Phenyl Se-pharose FF hydrophobic interaction column equilibrated with 20 mM potassium phosphate buffer pH 6.0, containing 0.7 M (NH4)2S0.4. Bound proteins were eluted with a two-step elution protocol. The elution was carried out by dropping the salt concentration first to 0.2 M (NH4)2SO4 and after that a linear gradient from 20 mM potassium phosphate pH 6.0, containing 0.2 M (NH4)2SO4 to 5 mM potassium phosphate pH 6.0 was applied. The protein was eluted with 0.2 M (NH4)2SO4 (I = 39 mS/cm).
The sample was desalted in 10DG columns (Bio-Rad) and applied to a HiTrap DEAE FF anion exchange column equilibrated with 15 mM Tris-HCL, pH 7Ø The protein did not bind to the anion exchange column but was eluted in the flow-through. The conductivity of the sample was adjusted to correspond that of 20 mM sodium acetate, pH 4.5 by adding water and pH was adjusted to 4.5 during concentration by ultrafiltration.
The sample was applied to a HiTrap SP XL cation exchange column equilibrated with 20 mM sodium acetate, pH 4.5. Bound proteins were eluted with a linear gradient from the equilibration buffer to the same buffer containing 1 M NaCI. The enzyme was eluted at the conductivity area of 1-7 mS/cm. The sample was lyophilized and thereafter dissolved in water.
The lyophilised sample was dissolved in water and applied to a Su-perdex 75 HR 10/30 gel filtration column equilibrated with 20 mM sodium phosphate pH 7.0, containing 0.15 M NaCI. The protein was eluted from the column with a retention volume corresponding to a molecular weight of 26 kDa.
The protein was judged to be pure by SDS-polyacrylamide gel electrophoresis.
The molecular mass of the pure protein was 30 kDa as evaluated on the basis of molecular mass standards (prestained SDS-PAGE standards, Broad Range,

36 Bio-Rad). The pl of the purified protein, designated as Ta XYN_30 was determined with PhastSystem (Pharmacia) to be ca. 6.8. The specific activity of Ta XYN_30 at 50 C was determined to be 4800 nkat/mg (procedure of IU-PAC 1987, using birch xylan as substrate).
Example 11. Internal amino acid sequencing The internal peptides were sequenced by electrospray ionization combined to tandem mass spectrometry (ESI-MS/MS) using the Q-TOF1 (Mk cromass) instrument. The protein was first alkylated and digested into tryptic peptides. Generated peptides were desalted and partially separated by nano liquid chromatography (reverse-phase) before applying to the Q-TOF1 instrument. The internal peptide sequences for Chaetomium thermophilum and Acremonium thermophilum cellobiohydrolases are shown in Table 2. The pep-tides from Chaetomium CBH were obtained after the corresponding cbh gene had been cloned. The peptides determined from Acremonium CBH were not utilized in the cloning of the corresponding gene.
Table 2: Internal peptide sequences determined from Chaetomium ther-mophilum ALK04265 CBH (1_C ¨ 4_C) and Acremonium thermophilum ALK04245 CBH (IA ¨
Peptide Sequence Peptide 1_C TPSTNDANAGFGR
Peptide 2_C VAFSNTDDFNR
Peptide 3_C FSNTDDFNRK
Peptide 4_C PGNSL/ITQEYCDAQ/KK
Peptide 1_A VTQFI/LTG
Peptide 2_A MGDTSFYGPG
Peptide 3_A CDPDGCDFN
Peptide 4_A SGNSL/ITTDF
I/ = leucine and isoleucine have the same molecular mass and cannot be distinguished in ESI-MS/MS analysis C/K = the molecular mass of glutamine and lysine differs only 0.036 Da and cannot be distinguished in ESI-MS/MS analysis

37 The internal peptide sequences of purified endoglucanases, 6-glucosidases, and xylanases of Acremonium thermophilum ALK04245, Chaetomium thermophilum ALK04261 and The rmoascus aura ntiacus ALK04242 are listed in Table 3, Table 4 and Table 5.
Table 3. Internal peptide sequences determined from Acremonium ther-mophilum ALK04245 EG_40, Chaetomium thermophilum ALK04261 EG_54 and Thermoascus aurantiacus ALK04242 EG_28 endoglucanases.
Protein Peptide Sequence At EG_40 Peptide 1 QSCSSFPAPLKPGCQWR
Peptide 2 YALTFNSGPVAGK
Peptide 3 VQCPSELTSR
Peptide 4 NQPVFSCSADWQR
Peptide 5 YWDCCKPSCGWPGIC
Peptide 6 PTFT
Ct EG_54 Peptide 1 EPEPEVTYYV
Peptide 2 YYLLDQTEQY
Peptide 3 RYCACMDLWEANSR
Peptide 4 PGNTPEVHPQ/K
Peptide 5 SI/LAPHPCNQ/K
Peptide 6 QQYEMFR
Peptide 7 ALNDDFCR
Peptide 8 WGNPPPR
Ta EG_28 Peptide 1 I/LTSATQWLR
Peptide 2 GCAI/LSATCVS ST I/LGQER
Peptide 3 PFMMER
Peptide 4 QYAVVDPITNYGR
(a I/L. = leucine and isoleucine have the same molecular mass and cannot be distinguished in ESI-MS/MS analysis, Q/K = the molecular mass of glutamine and lysine differs only 0.036 Da and cannot be distinguished in ESI-MS/MS analysis.

38 Table 4. Internal peptide sequences determined from Acremonium ther-mophilum ALK04245 13G_101, Chaetomium thermophilum ALK04261 13G_76 and Thermoascus aurantiacus ALK04242 13G_81 beta-gluco-sidases.
Protein Peptide Sequence At f3G_101 Peptide 1 SPFTWGPTR
Peptide 2 VVVGDDAGNPC
Peptide 3 AFVSQLTLLEK
Peptide 4 GTDVL/IYTPNNK
Peptide 5 QPNPAGPNACVL/IR
Ct 3G_76 Peptide 1 EGLFIDYR
Peptide 2 PGQSGTATFR
Peptide 3 ETMSSNVDDR
Peptide 4 IALVGSAAVV
Peptide 5 MWLCENDR
Peptide 6 YPQLCLQDGPLGIR
Peptide7 ELNGQNsGYPs Ta 3G_81 Peptide 1 TPFTWGK
Peptide 2 LCLQDSLPGVR
Peptide 3 GVDVQLGPVAGVAPR
Peptide 4 VNLTLE
Peptide 5 FTGVFGEDVVG
Peptide 6 NDLPLTGYEK
(a I/ = leucine and isoleucine have the same molecular mass and cannot be distinguished in ESI-MS/MS analysis

39 Table 5. Internal peptide sequences determined from Acremonium ther-mophilum ALK04245 XYN_60 and Thermoascus aurantiacus ALK04242 XYN_30 xylanases.
Protein Peptide Sequence At XYN_60 Peptide 1 YNDYNLEYNQK
Peptide 2 FGQVT PEN
Peptide 3 VDGDATYMSYVNNK
Peptide 4 KPAWTSVSSVLAAK
Peptide 5 SQGDIVPRAK
TaXYN_30 Peptide 1 vYFGVATDQNR
Peptide 2 NAAIIQADFGQVTPENSMK
Peptide 3 GHTLVWHSQLPSWVSSITDK
Peptide 4 NHITTLMTR
Peptide 5 AWDVvNEAFNEDGSLR
Peptide 6 LYINDYNLDSASYPK
Peptide 7 AS TTPLLFDGNFNPKPAYNA
IVQDLQQ
Peptide 8 QTVFLNVIGEDYIP AFQTA
Example 12. Construction of genomic libraries for Thermoascus auranti-acus, Chaetomium thermophilum and Acremonium thermophilum The genomic library of Chaetomium thermophilum ALK04265 and Acremonium thermophilum ALK04245 were made to Lambda DASH011 vector (Stratagene, USA) according to the instructions from the supplier. The chro-mosomal DNAs, isolated by the method of Raeder and Broda (1985), were partially digested with Sau3A. The digested DNAs were size-fractionated and the fragments of the chosen size 5-23 kb) were dephosphorylated and li-gated to the BamHI digested lambda vector arms. The ligation mixtures were packaged using Gigapack Ill Gold packaging extracts according to the manu-facturer's instructions (Stratagene, USA). The titers of the Chaetomium thermophilum and Acremonium thermophilum genomic libraries were 3.6 x 106 pfu/ml and 3.7 x 105 pfu/ml and those of the amplified libraries were 6.5 x pfu/ml and 4.2 x 106 pfu/ml, respectively.

40 Lambda FIX II/Xho I Partial Fill-1n Vector Kit (Stratagene, USA) was used in the construction of the genomic libraries for Thermoascus auranti-acus ALK04242 and Chaetomium thermophilum ALK04261 according to the instructions from the supplier. The chromosomal DNAs, isolated by the method of Raeder and Broda (1985), were partially digested with Sau3A. The digested DNAs were size-fractionated and the fragments of the chosen size 6-23 kb) were filled-in and ligated to the Xhol digested Lambda FIX 11 vector arms. The ligation mixtures were packaged using Gigapack III Gold packaging extracts according to the manufacturer's instructions (Stratagene, USA). The titers of lo the Thermoascus aurantiacus ALK04242 and Chaetomium thermophilum ALK04261 genomic libraries were 0.2 x 106 and 0.3 x 106 pfu/ml and those of the amplified libraries were 1.8 x 109 and 3.8 x 109 pfu/ml, respectively.
Example 13. Cloning of the cellobiohydrolase (cbh/ceR) genes from Thermoascus aurantiacus, Chaetomium thermophilum and Acremonium thermophilum Standard molecular biology methods were used in the isolation and enzyme treatments of DNA (plasmids, DNA fragments), in E. coli transfor-mations, etc. The basic methods used are described in the standard molecular biology handbooks, e.g., Sambrook et a/. (1989) and Sambrook and Russell (2001).
The probes for screening the genomic libraries which were con-structed as described in Example 12 were amplified by FOR using the Ther-moascus aurantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acremonium thermophilum ALK04245 genomic DNAs as templates in the re-actions. Several primers tested in PCR reactions were designed according to the published nucleotide sequence (WO 03/000941, Hong etal., 2003b). The PCR reaction mixtures contained 50 mM Tris-HCI, pH 9.0, 15 mM (NH4)2504, 0.1% Triton X-100TM, 1.5 mM MgCl2, 0.2 mM dNTPs, 5 pM each primer and 1 units of Dynazyme EXT DNA polymerase (Finnzymes, Finland) and 0.5-1 pg of the genomic DNA. The conditions for the FOR reactions were the following:
5 min initial denaturation at 95 C, followed by 30 cycles of 1 min at 95 C, ei-ther 1 min annealing at 62 C ( 8 C gradient) for Thermoascus ALK04242 and Chaetomium ALK04265 templates or 1 min annealing at 58 C ( 6 C gradient) for Acremonium ALK04245 template, 2 min extension at 72 C and a final ex-tension at 72 C for 10 min.
CAN_DMS: \137921606\1 Date Recue/Date Received 2021-02-11

41 DNA products of the expected sizes (calculated from published cbh sequences) were obtained from all genomic templates used. The DNA
fragments of the expected sizes were isolated from the most specific PCR
reactions and they were cloned to pCR Blunt-TOPO vector (Invitrogen, USA). The inserts were characterized by sequencing and by performing Southern blot hybridizations to the genomic DNAs digested with several re-striction enzymes. The PCR fragments, which were chosen to be used as probes for screening of the Thermoascus aura ntiacus, Chaetomium thermophilum and Acremonium thermophilum genomic libraries are presented in Table 6.
Table 6. The primers used in the PCR reactions and probes chosen for screening of the cbhIcel7 genes from Thermoascus aurantiacus, Chae-tomium thermophilum and Acremonium thermophilum genomic libraries.
The genomic template DNA and the name of the plasmid containing the probe fragment are shown.
Gene Forward primer Reverse primer Template Frag- Plasmid DNA ment (kb) Ta cbh TCEL11 TCEL12 Thermoascus 0.8 pALK1633 atgcgaactggcgttgggtcc gaatttggagctagtgtcgacg ALK04242 kb Ct cbh TCEL7 TCEL8 Chaetomium 0.8 pALK1632 cgatgccaactggcgctggac ttcttggtg_gtgtcgacggtc ALK04265 kb At cbh TCEL13 TCEL4 Acremonium 0.7 pALK1634 agctcgaccaactgctacacg accgtgaacttcttgctggtg ALK04245 kb The deduced amino acid sequences from all these probes had ho-mology to several published CBH sequences (BLAST program, version 2.2.9 at NCBI, National Center for Biotechnology Information; Altschul et al., 1990) of glycoside hydrolase family 7 (Henrissat, 1991; Henrissat and Bairoch, 1993).
The inserts from the plasmids listed in Table 6 were labeled with di-goxigenin according to the supplier's instructions (Roche, Germany), and the amplified genomic libraries (2 x 105¨ 3 x 105 plaques) were screened with the labeled probe fragments. The hybridization temperature for the filters was 68 C and the filters were washed 2 x 5 min at RI using 2 x SSC ¨ 0.1% SDS

42 followed by 2 x 15 min at 68 C using 0.1 x SSC ¨ 0.1% SDS with the homolo-gous probes used. Several positive plaques were obtained from each of the hybridizations. In screening of the Acremonium ALK04245 genomic libraries, some of the positive plaques were strongly hybridizing to the probe in question but, in addition, there was an amount of plaques hybridizing more weakly to the probes. This suggested that other cellobiohydrolase gene(s) might be present in the genome, causing cross-reaction. From four to five strongly hy-bridizing plaques were purified from Thermoascus ALK04242 and Chaetomi-um ALK04265 genomic library screenings. In the case of the Acremonium thermophilum ALK04245, four out of six purified plaques hybridized weakly by the probe used. The phage DNAs were isolated and characterized by Southern blot hybridizations. The chosen restriction fragments hybridizing to the probe were subcloned to pBluescript II KS+ vector and the relevant regions of the clones were sequenced.
In total four obh/ce17 genes were cloned; one from Thermoascus au-rantiacus ALK04242, one from Chaetomium thermophilum ALK04265 and two from Acremonium thermophilum ALK04245 (at the early phase of the work, these had the codes At_cbh_C and At_cbh_A, and were then designated as At ce/7A and At cel7B, respectively). Table 7 summarizes the information on the probes used for screening the genes, the phage clones from which the genes were isolated, the chosen restriction fragments containing the full-length genes with their promoter and terminator regions, the plasmid names, and the DSM
deposit numbers for the E. coli strains carrying these plasm ids.
Table 7. The probes used for cloning of cbhIcel7 genes, the phage clone and the subclones chosen, the plasmid number and the number of the deposit of the corresponding E. coil strain, Gene Probe used Phage The fragment Plasmid E. coil in screen- clone subcloned no deposit no ing to pBluescript II
Ta cef7A pALK1633 F12 3.2 kb Xbal pALK1635 DSM 16723 Ct ce/7A pALK1632 F36 2.3 kb Pvul - HindlIl pALK1642 DSM 16727 At cef7B pALK1634 F6 3.1 kb EcoRI pALK1646 DSM 16728 At cel7A pALK1634 F2 3.4 kb Xhol pALK1861 DSM 16729

43 The relevant information on the genes and the deduced protein se-quences (SEQ ID NO: 1-8) are summarized in Table 8 and Table 9, respec-tively.
The peptide sequences of the purified CBH proteins from Chaeto-mium thermophilum ALK04265 and Acremonium thermophilum ALK04245 (Table 2) were found from the deduced amino acid sequences of the clones containing the Ct ce/7A and At ce/7A genes. Thus, it could be concluded that the genes encoding the purified CBH/Ce17 proteins from Chaetomium thermophilum and Acremonium thermophilum were cloned.
Table 8. Summary on the cbhIcel7 genes isolated from Thermoascus au-rantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acre-monium thermophilum ALK04245.
Cbh gene Length with Coding No of Lengths of SEQ ID NO:
introns (bp) (a region introns introns (bp) (bp) (b Ta cef7A 1439 1371 1 65 1 Ct cef7A 1663 1596 1 64 7 At ce/7B 1722 1377 3 134, 122, 87 3 At ce/7A 1853 1569 4 88, 53, 54, 86 5 (a The STOP codon is included.
(b The STOP codon is not included.

44 Table 9. Summary of amino acid sequences deduced from the cbh/ce17 gene sequences from Thermoascus aurantiacus ALK04242, Chaetomium thermophilum ALK4265 and Acremonium thermophilum ALK04245. ss, signal sequence.
CBH No Length of C-ter- Predicted Predicted Putative SEQ
protein of ss mina! MW pl N-glyco- ID
aas NN/HMM(a CBD(b (Da, ss (ss not sylation NO:
not incl)(` incl) sites Ta Cel7A 457 17/17 NO 46 873 4.44 2 2 Ct Cel7A 532 18/18 YES, 54 564 5.05 3 8 to L532 At Cel7B 459 21/21 NO 47 073 4.83 2 4 At Cel7A 523 17/17 YES, 53 696 4.67 4 6 to L523 (a The prediction on the signal sequence was made using the program SignalP
V3.0 (Nielsen et a/., 1997; Bendtsen et al., 2004); the NN value was obtained using neural networks and HMM value using hidden Markov models.
(b The cellulose-binding domain (CBD), the amino acids of the C-terminal CBD
region are indicated (M1 (Met #1) included in numbering) (c The predicted signal sequence was not included. The prediction was made using the Com-pute p1/MW tool at ExPASy server (Gasteiger et al., 2003).
(d The number of sequences N-X-S/T.
The deduced amino acid sequences of Thermoascus aurantiacus Cel7A and Acremonium thermophilum Cel7A (core, without the CBD) were most homologous to each other (analyzed by Needleman-Wunsch global alignment, EMBOSS 3Ø0 Needle, with Matrix EBLOSUM62, Gap Penalty 10.0 and Extend Penalty 0.5; Needleman and Wunsch, 1970). In addition, the deduced Acremonium thermophilum Cel7A had a lower identity to the deduced Chaetomium thermophilum Cel7A. The Acremonium thermophilum Cel7B was most distinct from the CBH/Ce17 sequences of the invention.

45 The deduced Chaetomium Cel7A sequence possessed the highest identities (analyzed by Needleman-Wunsch global alignment, EMBOSS Nee-dle, see above) to polypeptides of Chaetomium thermophilum, Scytalidium thermophilum and Thielavia australiensis CBHI described in WO 03/000941.
Similarly, the deduced Thermoascus aurantiacus Cel7A sequence was highly identical to the published CBHI of the Thermoascus aurantiacus (WO
03/000941, Hong et a/., 2003b). Acremonium thermophilum Cel7B had significantly lower identities to the previously published sequences, being more closely related to the CBHI polypeptide from Oryza sativa. The highest homologies of the deduced Acremonium thermophilum Cel7A sequence were to Exidia gladulosa and Acremonium thermophilum CBHI polynucleotides (WO
03/000941). The alignment indicates that the cloned Thermoascus aurantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acremonium thermophilum ALK04245 sequences encode the CBH proteins having high homology to the polypeptides of the glycoside hydrolase family 7, therefore these were designated as Cel7A or Cel7B (Henrissat etal. 1998).
The comparison of the deduced amino acid sequences of the cbh/ce17 genes from Thermoascus aurantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acremonium thermophilum ALK04245 Thiela via to each other, and further to the sequences found from the databases, are shown in Table 10.

46 Table 10. The highest homology sequences to the deduced amino acid sequences of the cbhicel7 genes from Thermoascus aurantiacus ALK04242, Chaetomium thermophilum ALK04265 and Acremonium thermophilum ALK04245. The alignment was made using Needleman-Wunsch global alignment (EMBLOSUM62, Gap penalty 10.0, Extend penalty 0.5). *indicates an amino acid sequence derived from one of the cellobiohydrolase genes cloned in this work. 'Core' indicates alignment without the CBD.
Organism, enzyme and accession number Identity, (%
* Thermoascus aurantiacus Cel7A 100.0 Thermoascus aurantiacus, AY840982 99.6 Thermoascus aurantiacus, AX657575 99.1 Thermoascus aurantiacus, AF421954 97.8 Talaromyces emersonii, AY081766 79.5 Chaetomidium pingtungium, AX657623 76.4 Trichophaea saccata, AX657607 73.4 * Acremonium thermophilum Cel7A (core) 70.6 Emericalla nidulans, AF420020 (core) 70.4 * Chaetomium thermophilum Cel7A (core) 66.4 * Chaetomium thermophilum Cel7A 100.0 Chaetomium thermophilum, AY861347 91.9 Chaetomium thermophilum, AX657571 91.7 Scytalidium thermophilum, AX657627 74.7 Thielavia australiensis, AX657577 74.6 Acremonium thermophilum, AX657569 72.3 Exidia glandulosa, AX657613 68.0 * Acremonium thermophilum Cel7A 66.9 Thermoascus aurantiacus Cel7A (core) 66.4 Exidia glandulosa, AX657615 60.8 Chaetomium pingtungium, AX657623 60.7 Acremonium thermophilum Cel7B (core) 60.2 *Acremonium thermophilum Cel7B 100.0 Oryza sativa, AK108948 66.1 Exidia glandulosa, AX657615 65.0 Acremonium thermophilum, AX657569 (core) 64.8

47 Thermoascus aurantiacus, AX657575 64.8 *Acremonium thermophilum Cel7A 64.6 Thermoascus aurantiacus Cel7A 64.4 Trichophaea saccata, AX657607 63.6 * Chaetomium thermophilum Cel7A (core) 60.2 *Acremonium thermophilum Cel7A 100.0 Exidia glandulosa, AX657613 77.9 Exidia glandulosa, AX657615 77.9 Acremonium thermophilum, AX657569 77.5 Thielavia australiensis, AX657577 71.0 * Thermoascus aurantiacus Cel7A (core) 70.6 Scytalidium thermophilum, AX657627 67.5 Chaetomium thermophilum, AX657571 67.5 Chaetomium pingtungium, AX657623 67.3 * Chaetomium thermophilum Cel7A 66.9 Acremonium thermophilum Cel7B (core) 64.6 =
Example 14. Production of recombinant CBH/Ce17 proteins in Trichoder-ma reesei Expression plasmids were constructed for production of the recom-binant CBH /Ce17 proteins from Thermoascus aurantiacus (Ta Cel7A), Chae-tomium thermophilum (Ct Cel7A) and Acremonium thermophilum (At Cel7A, At Cel7B; at early phase of the work these proteins had the temporary codes At CBH_C and At CBH_A, respectively). The expression plasmids constructed are listed in Table 11. The recombinant cbh/cel7 genes, including their own signal sequences, were exactly fused to the T. reesei cbhl (cel7A) promoter by PCR. The transcription termination was ensured by the T. reesei ce/7A ter-minator and the A. nidulans amdS marker gene was used for selection of the transformants as described in Paloheimo et al. (2003). The linear expression cassettes (Fig. 2), were isolated from the vector backbones after EcoRI diges-tion and were transformed into T. reesei A96 and A98 protoplasts (both strains have the genes encoding the four major cellulases CBHI/Cel7A, CBHII/Cel6A, EGI/Cel7B and EGII/Cel5A deleted). The transformations were performed as in Penttila etal. (1987) with the modifications described in Karhunen etal.
(1993), selecting with acetamide as a sole nitrogen source. The transformants were

48 purified on selection plates through single conidia prior to sporulating them on PD.
Table 11. The expression cassettes constructed to produce CBH/Ce17 proteins of Thermoascus aurantiacus ALK04242 (Ta Cel7A), Chaetomi-urn thermophilum ALK04265 (Ct Cel7A), and Acremonium thermophilum ALK04245 (At Cel7A, At Cel7B) in Trichoderma reesei. The overall struc-ture of the expression cassettes was as described in Fig. 2. The cloned cbhIce17 genes were exactly fused to the T. reesei cbhlIcel7A promoter.
CBH/Ce17 Expression Size of the expr. cef7A terminator (b plasm id cassette Ta Cel7A pALK1851 9.0 kb 245 bp (Xbal) Ct Cel7A pALK1857 9.2 kb 240 bp (Hind111) At Cel7B pALK1860 9.4 kb , 361 bp (EcoRI) At Cel7A pALK1865 9.5 kb 427 bp (EcoRV) (a The expression cassette for T. reesei transformation was isolated from the vector backbone by using EcoRI digestion.
(b The number of the nucleotides from the genomic cbhlicel7A terminator region after the STOP codon. The restriction site at the 3'-end, used in excising the genomic gene fragment, is included in the parenthesis.
The CBH/Ce17 production of the transformants was analysed from the culture supernatants of the shake flask cultivations (50 ml). The trans-formants were grown for 7 days at 28 C in a complex lactose-based cellulase-inducing medium (Joutsjoki etal. 1993) buffered with 5% KH2PO4. The cellobi-ohydrolase activity was assayed using 4-methylumbellifery1-6-D-lactoside (MUL) substrate according to van Tilbeurgh etal., 1988. The genotypes of the chosen transformants were confirmed by using Southern blots in which several genomic digests were included and the respective expression cassette was used as a probe. Heterologous expression of the Ta Cel7A, Ct Cel7A, At Cel7A and At Cel7B proteins was analyzed by SDS-PAGE with subsequent Coomassive staining. The findings that no cellobiohydrolase activity or heterologous protein production in SOS-PAGE could be detected for the At Cel7B transformants containing integrated expression cassette, suggest that

49 At Cel7B is produced below detection levels in Trichoderma using the described experimental design.
The recombinant CBH/Ce17 enzyme preparations were character-ized in terms of pH optimum and thermal stability. The pH optimum of the re-combinant CBH/Ce17 proteins from Thermoascus aurantiacus, Chaetomium thermophilum, and Acremonium thermophilum were determined in the univer-sal Mcilvaine buffer within a pH range of 3.0-8.0 using 4-methylumbellifery1-8-D-Iactoside (MUL) as a substrate (Fig 3 A). The pH optimum for Ct Cel7A and At Cel7A enzymes is at 5.5, above which the activity starts to gradually drop.

The pH optimum of the recombinant crude Ta Cel7A is at 5.0 (Fig 3 A). Ther-mal stability of the recombinant Ce17 enzymes was determined by measuring the MUL activity in universal McIlvaine buffer at the optimum pH with reaction time of 1 h. As shown from the results Ta Cel7A and Ct Cel7A retained more than 60% of their activities at 70 C, whereas At Cel7A showed to be clearly less stable at the higher temperatures (65 C) (Fig 3 B).
The chosen CBH/Ce17 transformants were cultivated in lab bioreac-tors at 28 C in the medium indicated above for 3-4 days with pH control 4.4 0.2 (NH3/H3PO4) to obtain material for the application tests. The supernatants were recovered by centrifugation and filtering through Seitz-K 150 and EK
filters (Pall SeitzSchenk Filtersystems GmbH, Bad Kreuznach, Germany).
Example 15. Production of the recombinant Thermoascus aurantiacus Cel7A+CBD fusion proteins in T. reesei Thermoascus aurantiacus Cel7A (AF478686, Hong et al., 2003b;
SEQ ID. NO: 1) was fused to linker and CBD of Trichoderma reesei CBHI/Cel7A (AR088330, Srisodsuk et al. 1993) (= Tr CBD) followed by the production of the fusion protein (SEQ ID NO: 28 corresponding nucleic acid SEQ ID. NO: 27) in the T. reesel as was described in FI20055205/US
11/119,526; filed April 29, 2005. In addition, Thermoascus aurantiacus Cel7A
was fused to linker and CBD of Chaetomium thermophilum Cel7A (SEQ ID.
NO: 7) (Ct CBD). For that purpose, the coding sequence of the linker and the MD of Chaetomium thermophilum Cel7A were synthesized by PCR using fol-lowing primers:
5'-TTAAACATATGTTATCTACTCCAACATCAAGGTCGGACCCATCGGCTC-GACCGTCCCTGGCCTTGAC-3' (forward sequence) and

50 5'-TATATGCGGCCGCAAGCTTTACCATCAAGTTACTCCAGCAAATCAGGG-AACTG-3' (reverse sequence).
The PCR reaction mixture contained lx DyNAzymeTM EXT reaction buffer (Finnzymes, Finland), 15 mM Mg2+, 0.2 mM dNTPs, 2 pM of each pri-mer, 0.6 units of DyNAzymeTM EXT DNA polymerase (Finnzymes, Finland), and approximately 75 ng / 30 pl of template DNA, containing full-length cel7A
gene from the Chaetomium thermophilum. The conditions for the PCR reaction were the following: 2 min initial denaturation at 98 C, followed by 30 cycles of 30 sec at 98 C, 30 sec annealing at 68 C ( 4 C gradient), 30 sec extension at 72 C and a final extension at 72 C for 10 min. The specific DNA fragment in FOR reaction was obtained at annealing temperature range from 64 C to 68.5 C. The synthesized CBD fragment of the Chaetomium thermophilum was ligated after Thermoascus aurantiacus cel7A gene resulting in a junction point of GPIGST between the domains. The PCR amplified fragment in the plasmid was confirmed by sequencing (SEQ ID. NO: 29). The constructed fusion cel7A
gene was exactly fused to the T. reesei cbhl (cel7A) promoter. The transcrip-tion termination was ensured by the T. reesei co/7A terminator and the A. nidu-lans amdS marker gene was used for selection of the transformants as de-scribed in Paloheimo et a/. (2003).
The linear expression cassette was isolated from the vector back-bone after Notl digestion and was transformed to T. reesei A96 protoplasts.
The transformations were performed as in Penttila etal. (1987) with the modifi-cations described in Karhunen etal. (1993), selecting with acetamide as a sole nitrogen source. The transformants were purified on selection plates through single conidia prior to sporulating them on PD.
Thermoascus aurantiacus Cel7A+CBD (SEQ ID. NO: 28 and 30) production of the transformants was analyzed from the culture supernatants of the shake flask cultivations (50 m1). The transformants were grown for 7 days in a complex cellulase-inducing medium (Joutsjoki et al. 1993) buffered with 5% KH2PO4 at pH 5.5. The cellobiohydrolase activity was assayed using 4-methylumbelliferyl-3-D-Iactoside (MUL) substrate according to van Tilbeurgh et al., 1988. The genotypes of the chosen transformants were confirmed by using Southern blots in which several genomic digests were included and the ex-pression cassette was used as a probe. The SDS-PAGE analyses showed that

51 the recombinant Thermoascus aurantiacus Cel7A+CBD enzymes were pro-duced as stable fusion proteins in T. reesei.
The chosen transformant producing the Ta Cel7A+Tr CBD fusion protein (SEQ ID. NO: 28) was also cultivated in 2 litre bioreactor at 28 C in the medium indicated above for 3-4 days with pH control 4.4 0.2 (NH3/H3PO4) to obtain material for the application tests. The supernatants were recovered by centrifugation and filtering through Seitz-K 150 and EK filters (Pall SeitzSchenk Filtersystems GmbH, Bad Kreuznach, Germany).
Example 16. Comparison of the Michaelis-Menten and cellobiose inhibi-tion constants of purified recombinant cellobiohydrolases The Michaelis-Menten and cellobiose inhibition constants were de-termined from the cellobiohydrolases produced heterologously in T. reesei (Examples 14 and 15). The enzymes were purified as described in Example 2.
Protein concentrations of purified enzymes were measured by their absorption at 280 nm using a theoretical molar extinction co-efficient, which were calculated from the amino acid sequences (Gill and von Hippel, 1989).
Kinetic constants (Km and kcat values) and cellobiose inhibition constant (Ki) for Tr CBHI/Cel7A, Ta CBH/Cel7A, At CBH/Cel7A and Ct CBH/Cel7A, were measured using CNPLac (2-Chloro-4-nitrophenyl-3-D-lac-toside) as substrate at ambient temperature (22 C) in 50 mM sodium phos-phate buffer, pH 5.7. For the determination of the inhibition constant (Ki), eight different substrate concentrations (31-4000 pM) in the presence of a range of five inhibitor concentrations (0-100 pM or 0-400 pM), which bracket the Ki value, were used. All experiments were performed in microtiter plates and the total reaction volume was 200 pl. The initial rates were in each case measured by continuous monitoring the release of the chloro-nitrophenolate anion (CNP., 2-Chloro-4-nitrophenolate) through measurements at 405 nm using Varioscan (Thermolabsystems) microtiter plate reader. The results were calculated from CNP standard curve (from 0 to 100 pM). Enzyme concentrations used were: Tr CBHI/Cel7A 2.46 pM, Ta CBH/Cel7A 1.58 pM, Ct CBH/Cel7A 0.79 pM and At CBH/Cel7A 3 pM. The Km and kcat constants were calculated from the fitting of the Michaelis-Menten equation using the programme of Origin. Lineweaver-Burk plots, replots (LWB slope versus [G1c2; cellobiose]) and Hanes plots were used to distinguish between competitive and mixed type inhibition and to determine the inhibition constants (Ki).

52 The results from the kinetic measurements are shown in Table 12 and Table 13. As can be seen, Ct CBH/Cel7A has clearly the higher turnover number (kcat) on CNPLac and also the specificity constant (kcat/Km) is higher as compared to CBHI/Cel7A of T. reesei. Cellobiose (G1c2) is a competitive inhibitor for all the measured cellulases, and the Tr CBHI/Cel7A (used as a control) has the strongest inhibition (i.e. the lowest Ki value) by cellobiose. The At CBH/Cel7A had over 7-fold higher inhibition constant as compared to that of Tr CBHI/Cel7A. These results indicate that all three novel cellobiohydrolases could work better on cellulose hydrolysis due to decreased cellobiose inhibition as compared to Trichoderma reesei Cel7A cellobiohydrolase I.
Table 12. Comparison of the cellobiose inhibition constants of four GH
family 7 cellobiohydrolases, measured on CNPLac in 50 mM sodium phosphate buffer pH 5.7, at 22 C.
Enzyme Ki (pM) Type of inhibition Ct Cel7A 39 competitive Ta Cel7A 107 competitive At Cel7A 141 competitive Tr Cel7A 19 competitive Table 13. Comparison of the Michaelis-Menten kinetic constants of Chae-tomium thermophilum cellobiohydrolase Cel7A to CBHI/Cel7A of T.
reesei, measured on CNPLac in 50 mM sodium phosphate buffer pH 5.7, at 22 C.
Enzyme kcat Km kcat /Km (min-1) (pM) (m1n-1 M-I) Ct Cel7A 18.8 1960 9.5 103 Tr Cel7A 2.6 520 5.0 103 Example 17. Hydrolysis of crystalline cellulose (Avicel) by the recombi-nant cellobiohydrolases The purified recombinant cellobiohydrolases Ct Cel7A, Ta Cel7A, Ta Cel7A+Tr CBD, Ta Cel7A+ Ct CBD, At Cel7A as well as the core version of Ct Cel7A (see below) were tested in equimolar amounts in crystalline cellulose hydrolysis at two temperatures, 45 C and 70 C; the purified T. reesei Tr Cel7A

53 and its core version (see below) were used as comparison. The crystalline cel-lulose (Ph 101, Avicel; Fluke, Bucsh, Switzerland) hydrolysis assays were per-formed in 1.5 ml tube scale 50 mM sodium acetate, pH 5Ø Avicel was shaken at 45 C or at 70 C, with the enzyme solution (1.4 pM), and the final volume of the reaction mixture was 325 pl. The hydrolysis was followed up to 24 hours taking samples at six different time points and stopping the reaction by adding 163 pl of stop reagent containing 9 vol of 94% ethanol and 1 vol of 1 M
glycine (pH 11). The solution was filtered through a Millex GV13 0.22 pm filtration unit (Millipore, Billerica, MA, USA). The formation of soluble reducing sugars in the supernatant was determined by para-hydroxybenzoic-acidhydrazide (PAHBAH) method (Lever, 1972) using a cellobiose standard curve (50 to 1600 pM cellobiose). A freshly made 0.1 M PAHBAH (Sigma-Aldrich, St. Louis, MO, USA) in 0.5 M NaOH (100 pl) solution was added to 150 pl of the filtered sample and boiled for 10 minutes after which the solution was cooled on ice.
16 The absorbance of the samples at 405 nm was measured.
The core versions of the cellobiohydrolases harboring a CBD in their native form were obtained as follows: Ct Cel7A and Tr Cel7A were exposed to proteolytic digestion to remove the cellulose-binding domain. Papain (Papaya Latex, 14 U/mg, Sigma) digestion of the native cellobiohydrolases was per-formed at 37 C for 24 h in a reaction mixture composed of 10 mM L-cystein and 2 mM EDTA in 50 mM sodium acetate buffer (pH 5.0) with addition of pa-pain (two papain concentrations were tested: of one fifth or one tenth amount of papain of the total amount of the Cel7A in the reaction mixture). The result-ant core protein was purified with DEAE Sepharose FF (Pharmacia, Uppsala, Sweden) anion exchange column as described above. The product was ana-lysed in SDS-PAGE.
The hydrolysis results at 45 C and 70 C are shown in Figure 4 and Figure 5, respectively. The results show clearly that all the cellobiohydrolases show faster and more complete hydrolysis at both temperatures as compared to the state-of-art cellobiohydrolase T. reesei Cel7A. At 70 C the thermostable cellobiohydrolases from Thermoascus aurantiacus ALK04242 and Chaetorni-urn thermophilum ALK04265 are superior as compared to the T. reesei Cel7A, also in the case where the Thermoascus Cel7A core is linked to the CBD of T.
reesei Cel7A (Ta Cel7A + Tr CBD). It was surprising that the cellobiohydrolas-es isolated and cloned in this work are superior, when harboring a CBD, in the rate and product formation in crystalline cellulose hydrolysis also at the con-

54 ventional hydrolysis temperature of 45 C when compared to the state-of-art cellobiohydrolase T. reesei Cel7A (CBH1) at the same enzyme concentration.
The results are also in agreement with those enzyme preparations (At Cel7A
and Ct Cel7A), which were purified from the original hosts and tested in Avicel hydrolysis (50 C, 24 h) (Example 2, Table 1).
Example 18. Cloning of Acremonium thermophilum ALK04245, Chaeto-mium thermophilum ALK04261, and Thermoascus aurantiacus ALK04242 endoglucanase genes Standard molecular biology methods were used as described in Ex-ample 13. The construction of the Acremonium, Chaetomium, and Thermoascus genomic libraries has been described in Example 12.
The peptides derived from the purified Acremonium and Chaetomi-um endoglucanases shared homology with several endoglucanases of glycosyl hydrolase family 45 such as Melanocarpus albomyces Ce145A endoglucanase (AJ515703) and Humicola insolens endoglucanase (A35275), respectively.
Peptides derived from the Thermoascus endoglucanase shared almost 100%
identity with the published Thermoascus aurantiacus EG1 endoglucanase sequence (AF487830). To amplify a probe for screening of the Acremonium and Chaetomium genomic libraries, degenerate primers were designed on the basis of the peptide sequences. The order of the peptides in the protein se-quence and the corresponding sense or anti-sense nature of the primers was deduced from the comparison with the homologous published endoglu-canases. Primer sequences and the corresponding peptides are listed in Table 14. Due to almost 100% identity of the Thermoascus peptides with the published sequence, the endoglucanase gene was amplified by PCR directly from the genomic DNA.

55 Table 14. Oligonucleotides synthesized and used as PCR primers to amplify a probe for screening of Acremonium thermophilum ce145A
(EG_40) and Chaetomium thermophilum cel7B (EG_54) gene from the corresponding genomic libraries.
Protein Peptide Primer Primer sequence(b location(' At EG_40 Peptide 5 1-6 TAYTGGGAYTGYTGYAARCC
WFQNADN (c RTTRTCNGCRTTYTGRAACCA
Ct EG_54 Peptide 7 3-7 GCAAGCTTCGRCARAARTCRTCRTT (d Peptide 2 5-9 GGAATTCGAYCARACNGARCARTA (e (a Amino acids of the peptide used for designing the primer sequence N = A, C, G, or T; R =A or G; Y = C or T
(c Peptide not derived from the purified Acremonium EG_40 protein, but originates from the M.
albomyces Ce145A sequence (AJ515703) homologous to EG_40.
(d A Hind111 restriction site was added to the 5' end of the oligonucleotide (e An EcoRI restriction site was added to the 5 end of the oligonucleotide The Acremonium thermophilum ce/45A gene specific probe to screen the genomic library was amplified with the forward (TAYTGGGAY-TGYTGYAARCC) and reverse (RTTRTCNGCRTTYTGRAACCA) primers us-ing genomic DNA as a template. The PCR reaction mixtures contained 50 mM
Tris-HCI, pH 9,0, 15 mM (NH4)2SO4, 0.1% Triton X-100, 1.5 mM MgC12, 0.1 mM dNTPs, 0.5 pg each primer, 1 unit of Dynazyme EXT DNA polymerase (Finnzymes, Finland) and approximately 0.5 pg of Acremonium genomic DNA.
The conditions for FOR reactions were the following: 5 min initial denaturation at 95 C, followed by 30 cycles of 1 min at 95 C, 1 min annealing at 50-60 C, 2 min extension at 72 C and a final extension at 72 C for 10 min. For amplification of the Chaetomium thermophilum ce/7B gene (coding for Ct EG_54) specific probe, a forward primer (GGAATTCGAYCARACNGARCARTA) and a reverse primer (GCAAGCTTCGRCARAARTCRTCRTT) were used. The PCR reaction mixtures contained 10 mM Tris-HCI, pH 8.8, 50 mM KCI, 0.1% Triton X-100, 1.5 mM MgCl2, 0.2 mM dNTPs, 250 pmol each primer, 2 unit of Dynazyme II
DNA polymerase (Finnzymes, Finland) and approximately 2 g of Chaetomium

56 genomic DNA. The conditions for PCR reaction were as described above, ex-cept that annealing was performed at 45-50 C.
Two PCR products were obtained from the Acremonium PCR reac-tion. DNA fragments of about 0.6 kb and 0.8 kb were isolated from agarose gel and were cloned into the pCR4-TOPOO TA vector (Invitrogen, USA) resulting in plasmids pALK1710 and pALK1711, respectively. The DNA products were characterized by sequencing and by performing Southern blot hybridizations to the genomic Acremonium DNA digested with several restriction enzymes. The hybridization patterns obtained with the two fragments in stringent washing conditions suggest that two putative endoglucanase genes could be screened from the Acremonium genomic library. The deduced amino acid sequences of both PCR products have homology to several published endoglucanase sequences of glycosyl hydrolase family 45 (BLAST program, National Center for Biotechnology Information: Altschul etal., 1990).
One PCR product of expected size (estimated from the homologous Humicola insolens endoglucanase sequence, A35275) was obtained from the Chaetomium PCR reaction, This DNA fragment of about 0.7 kb was cloned into the pCR4-TOPO TA vector (Invitrogen, USA) resulting in plasmid pALK2005 and analyzed as described above. The deduced amino acid sequence of the PCR product has homology to several published cellulase sequences of glycosyl hydrolase family 7 (BLAST program, version 2.2.9 at NCBI, National Center for Biotechnology Information; Altschul etal., 1990).
The insert from plasmids pALK1710, pALK1711, and pALK2005 was isolated by restriction enzyme digestion and labeled with digoxigenin ac-cording to the supplier's instructions (Roche, Germany). About 1-2 x 105 plaques from the amplified Acremonium or Chaetomium genomic library were screened. The temperature for hybridisation was 68 C and the filters were washed 2 x 5 min at RT using 2 x SSC ¨ 0.1 % SDS followed by 2 x 15 min at 68 C using 0.1 x SSC ¨ 0.1% SOS. Several positive plaques were obtained, of which five to six strongly hybridizing plaques were purified from each screen-ing. Phage DNAs were isolated and analysed by Southern blot hybridization.
Restriction fragments hybridizing to the probe were subcloned into the pBluescript II KS+ vector (Stratagene, USA) and the relevant parts were sequenced. In all cases the subcloned phage fragment contains the full-length gene of interest. Table 15 summarises the information of the probes used for screening of the endoglucanase genes, phage clones from which the genes

57 were isolated, chosen restriction fragments containing the full-length genes with their promoter and terminator regions, names of plasmids containing the subcloned phage fragment, and the deposit numbers in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH culture collection (DSM) for E. coil strains carrying these plasmids.
Table 15. Probes used for cloning of endoglucanase gene, phage clone and the subclone chosen, plasmid name and the corresponding deposit number of the E. coil strain.
Gene Genomic library Probe Phage Subcloned Plasmid E. coli used in clone fragment deposit no.
screening At ce/45A A. thermophilum pALK1710 P24 5.5 kb Smal pALK1908 DSM

At cel45i3 A thermophilum pALK1711 P41 6.0 kb Xhol pALK1904 DSM

Ct ce/7B C. thermophilum pALK2005 P55 5.1 kb BamHI pALK2010 DSM

Thermoascus aurantiacus ce/5A gene (coding for EG_28) (SEQ ID
NO: 9) was amplified directly from the isolated genomic DNA by PCR reaction.
The forward (ATTAACCGCGGACTGCGCATCATGAAGCTCGGCTCTCTCGTGCTC) and reverse (AACTGAGGCATAGAAACTGACGTCATATT) primers that were used for amplification were designed on the basis of the published T. aurantiacus egi gene (AF487830). The PCR reaction mixtures contained 1 x Phusion HF
buffer, 0.3 mM dNTPs, 0.5 pM of each primer, 2 units of PhusionTM DNA pol-ymerase (Finnzymes, Finland) and approximately 0.25 pg of Thermoascus ge-nomic DNA. The conditions for PCR reactions were the following: 5 min initial denaturation at 95 C, followed by 25 cycles of 30 s at 95 C, 30 s annealing at 57-67 C, 2.5 min extension at 72 C and a final extension at 72 C for 5 min.
The amplified 1.3 kb product containing the exact gene (from START to STOP
codon) was cloned as a Sacll-Pstl fragment into the pBluescript II KS+ vector.

Two independent clones were sequenced and one clone was selected and designated as pALK1926. The deposit number of the E. coil strain containing

58 pALK1926 in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH culture collection is DSM 17326.
Relevant information of the genes and the deduced protein se-quences (SEQ ID NO: 9-16) are summarized in Table 16 and Table 17, re-spectively. Peptide sequences of the purified Acremonium EG_40 (gene At ce/45A), Chaetomium EG_54 (gene Ct ce/7B), and Thermoascus EG_28 (gene Ta ce/5A) endoglucanases were found in the corresponding deduced amino acid sequences of the cloned genes confirming that appropriate genes were cloned.
Table 16. Summary of the endoglucanase genes isolated from Acremoni-urn Chaetomium thermophilum, and Thermoascus au-rantiacus.
Endoglucanase Length Coding re- No of in- Lengths of SEQ ID
gene with gion trons introns (bp) NO:
introns (bp) (b (bp) (a At ce/45A 1076 891 2 59, 123 11 At ce/45B 1013 753 2 155, 102 13 Ct cei7B 1278 1275 15 Ta ce/5A 1317 1005 5 55, 60, 59, 74, 9 (a The STOP codon is included.
(b The STOP codon is not included.

59 Table 17. Summary of the deduced endoglucanase sequences of Acre-monium thermophilum, Chaetomium thermophilum, and Thermoascus aurantiacus. ss, signal sequence.
Endogluca- No Length CBDtb Predicted Predicted Putative SEQ ID
nase of of ss MW pl N- NO:
protein aas NN/HMM(a (Da, ss (ss not glyco-not incl)(` incl) sylation sites At EG_40 297 21/21 Yes, 28625 4.79 2 12 to L297 At 251 20/20 No 23972 6.11 2 14 EG_40_like Ct EG 54 425 17/17 No 45358 5.44 1 16 Ta EG 28 335 30(e No 33712 4.30 1 10 (a The prediction of the signal sequence was made using the program SignalP
V3.0 (Nielsen et al., 1997: Bendtsen et al., 2004); the NN value was obtained using neural networks and HMM value using hidden Markov models.
(b Presence of a cellulose binding domain in the protein, the amino acids of the C- terminal CBD are indicated (numbering according to the full length polypeptide) (c The predicted signal sequence is not included. Prediction was made using the Compute p1/MW tool at ExPASy server (Gasteiger et a/., 2003).
(d The putative N-glycosylation sites N-X-S/T were predicted using the program NetNGlyc 1.0 (Gupta et al., 2004).
(e According to Hong et al. 2003a The deduced protein sequences of Acremonium EG_40 (At Ce145A) and EG_40_like (At Ce145B), Chaetomium EG_54 (Ct Cel7B), and Thermo-ascus EG_28 (Ta Cel5A) endoglucanases share homology with cellulases of glycosyl hydrolase family 45 (Acremonium), family 7 (Chaetomium), and family 5 (Thermoascus), thus identifying the isolated genes as members of these gene families. The closest homologies of the Acremonium endoglucanases EG_40/Ce145A and EG_40_like/Ce145B are endoglucanases of Thielavia terrestris (C0827970, 77.3% identity) and Myceliophthora the rmophila

60 (AR094305, 66.9% identity), respectively (Table 18). The two isolated Acremonium family 45 endoglucanases share only an identity of 53.7% with each other. Of these enzymes only EG_40/Ce145A contains a cellulose binding domain (CBD).
The closest homology for the predicted protein sequence of Chae-tomium EG_54/Cel7B endoglucanase is found in the Melanocarpus albomyces Cel7A cellulase sequence (AJ515704). The identity between these two protein sequences is 70.6%.
The protein sequence of the isolated Thermoascus aurantiacus en-doglucanase is completely identical with that of the published T. aurantiacus EGI (AF487830, Table 18). The closest homology was found in a 13-glucanase sequence of Talaromyces emersonii (AX254752, 71.1% identity).
Table 18. Comparison of the deduced Acremonium thermophilum EG_40, EG_40_like/Ce145B, Chaetomium thermophilum EG_54/Cel7B, and Thermoascus aurantiacus EG_28/Cel5A endoglucanases with their homologous counterparts. The alignment was performed using the Needle programme of the EMBOSS programme package. *indicates an endoglucanase encoded by a gene cloned in this work.
Organism, enzyme, and accession number Identity (%) Acremonium thermophilum EG_40 100.0 Thielavia terrestris EG45, C0827970 77.3 Melanocarpus albomyces Ce145A, AJ515703 75.3 Neurospora crassa, hypothetical XM_324477 68.9 Hum/cola grisea var thermoidea, EGL3, AB003107 67.5 Hum/cola insolens EG5, A23635 67.3 Myceliophthora thermophila fam 45, AR094305 57.9 * Acremonium thermophilum EG_40_like 53.7 Acremonium thermophilum EG_40_like 100.0 Myceliophthora thermophila fam 45, AR094305 66.9 Magnaporthe grisea 70-15 hypothetical, XM_363402 61.9 Thielavia terrestris EG45, CQ827970 *Acremonium thermophilum EG_40 56.8 Melanocarpus albomyces Ce145A, AJ515703 53.7 52.8 Chaetomium thermophilum EG_54 100.0

61 Melanocarpus albomyces CellA, AJ515704 70.6 Humicola grisea var thermoidea EGI, D63516 68.8 Humicola insolens EGI, AR012244 67.7 Myceliophthora thermophila EGI, AR071934 61.7 Fusarium oxysporum var lycopercisi EGI, AF29210 53.5 Fusarium oxysporum EGI, AR012243 52.6 Thermoascus aurantiacus EG_28 100.0 Thermoascus aurantiacus EG, AX812161 100.0 Thermoascus aurantiacus EGI, AY055121 99.4 Talaromyces emersonii p-glucanase, AX254752 71.1 Talaromyces emersonii EG, AF440003 70.4 Aspergillus niger EG, A69663 70.1 Aspergillus nigerEG, A62441 69.9 Aspergillus niger EG, AF331518 69.6 Aspergillus aculeatus EGV, AF054512 68.5 Example 19. Production of recombinant endoglucanases in Trichoderma reesei Expression plasmids were constructed for production of the recom-binant Acremonium EG_40/Ce145A, EG_40_like/Ce145B, and Thermoascus EG_28/Cel5A proteins as described in Example 14. Linear expression cas-settes (Table 19) were isolated from the vector backbone by restriction enzyme digestion, transformed into T. reesei A96 and transformants purified as de-scribed in Example 14.

62 Table 19. The expression cassettes constructed for production of Acremonium thermophilum EG_40/Ce145A, EG_40_like/Ce14513, and Thermoascus aurantiacus EG_28/Cel5A endoglucanases in Trichoderma reesei. The schematic structure of the expression cassettes is described in Figure 2.
Endoglucanase Expression Size of the Heterologous plasmid expression terminator cassette At EG_40 pALK1920 10.9 kb Notl 156 bp (Hind111) At EG_40 like pALK1921 8.6 kb EcoRI 282 bp (Sspl) Ta EG_28 pALK1930 8.6 kb Notl none (a The expression cassette for T. reesei transformation was isolated from the vector backbone by EcoRI or Nail digestion.
(b The number of nucleotides after the STOP codon of the cloned gene that are included in the expression cassette are indicated. The restriction site at the 3'-region of the gene that was used in construction of the expression cassette is indicated in parenthesis.
The endoglucanase production of the transformants was analyzed from the culture supernatants of shake flask cultivations (50 m1). Trans-formants were grown as in Example 14 and the enzyme activity of the recom-binant protein was measured from the culture supernatant as the release of reducing sugars from carboxymethylcellulose (2% (w/v) CMC) at 50 C in 50 mM citrate buffer pH 4.8 essentially as described by Bailey and Nevalainen 1981; Haakana et al. 2004. Production of the recombinant proteins was also detected from culture supernatants by SDS-polyacrylamide gel electrophore-sis. Acremonium EG_40-specific polyclonal antibodies were produced in rabbits (University of Helsinki, Finland). The expression of EG_40 was verified by Western blot analysis with anti-EG_40 antibodies using the ProtoBlot Western blot AP system (Promega). The genotypes of the chosen transformants were analysed by Southern blotting using the expression cassette as a probe.
The pH optimum of the heterologously produced endoglucanases was determined in the universal Mcilvaine's buffer within a pH range of 4.0-8.0 using carboxymethylcellulose as substrate. As shown in Figure 6 A the broad-

63 est pH range (4.5-6.0) is that of the Acremonium EG_40/Ce145A protein, the optimum being at pH 5.5. The pH optima for the other heterologously produced endoglucanases are pH 5.0-5.5 and 6.0 for Acremonium EG_40_like/Ce145B
and Thermoascus EG_28/Cel5A, respectively. The optimal temperature for enzymatic activity of these endoglucanases was determined at the tempera-ture range of 50-85 C as described above. The highest activity of the en-zymes was determined to be at 75 C, 60 C, and 75 C for the Acremonium EG_40/Ce145A, EG_40_like/Ce145B, and Thermoascus EG_28/Cel5A, respec-tively (Figure 6 B).
The chosen transformants were cultivated, as described in Example 14, in a 2 litre bioreactor for four days (28 C, pH 4.2) to obtain material for the application tests.
Example 20. Cloning of Acremonium thermophilum ALK04245, Chaeto-mium thermophilum ALK04261, and Thermoascus aurantiacus ALK04242 beta-glucosidase genes Standard molecular biology methods were used as described in Ex-ample 13. The construction of the Acremonium, Chaetomium, and Thermoascus genomic libraries has been described in Example 12.
The peptides derived from the purified Acremonium, Chaetomium, and Thermoascus p-glucosidases shared homology with several p-gluco-sidases of glycosyl hydrolase family 3 such as Acremonium cellulolyticus (BD168028), Trichoderma viride (AY368687), and Talaromyces emersonii (AY072918) P-glucosidases, respectively. To amplify a probe for screening of the Acremonium, Chaetomium, or Thermoascus genomic libraries, degenerate primers were designed on the basis of the peptide sequences. The order of the peptides in the protein sequence and the corresponding sense or anti-sense nature of the primers was deduced from the comparison with the homologous published p-glucosidases. Primer sequences and the corresponding peptides are listed in Table 20.

64 Table 20. Oligonucleotides synthesized and used as PCR primers to am-plify a probe for screening of Acremonium thermophilum cel3A (13G_101), Chaetomium thermophilum cel3A (PG_76), and Thermoascus aurantiacus ce/3A (13G_81) gene from the corresponding genomic libraries.
Protein Peptide Primer Primer Sequence(b location(' At EKVNLT(c GARAARGTNAAYCTNAC
13G_101 Peptide 4 6-11 YTTRCCRTTRTTSGGRGTRTA
Ct Peptide 6 4-9 TNTCYCTNCARGAYGG
13G_76 Peptide 1 3-8 TCRAARTGSCGRTARTCRATRAASAG
Ta Peptide 3 1-5 AARGGYGTS GAYGTS CAR
i3G_81 Peptide 1 2-7 YTTRCCCCASGTRAASGG
(a Amino acids of the peptide used for designing the primer sequence (h To reduce degeneracy, some codons were chosen according to fungal preference N = A, C, G, or T; R = A or G; S = C or G; Y = C or T
(c Peptide not derived from the purified Acremonium pG_ioi protein, but originates from the A. cellulolyticus p-glucosidase sequence (BD168028) homologous to pG_101.
The probes for screening genomic libraries constructed were ampli-fied with the listed primer combinations (Table 20) using Acremonium, Chae-tomium, or Thermoascus genomic DNA as template. The PCR reaction mix-tures contained 50 mM Tris-HCI, pH 9.0, 15 mM (NH4)2SO4, 0.1% Triton X-100, 1.5 mM MgCl2, 0.1-0.2 mM dNTPs, 0.25 vtg each primer, 1 unit of Dynazyme EXT DNA polynnerase (Finnzymes, Finland) and approximately 0.5 vig of genomic DNA. The conditions for FOR reactions were the following: 5 min initial denaturation at 95 C, followed by 30 cycles of 1 min at 95 C, 1 min annealing at 40 C (Acremonium DNA as a template), at 50 C (Chaetomium DNA as a template), or at 63 C (Thermoascus DNA as a template), 2-3 min extension at 72 C and a final extension at 72 C for 5-10 min.
Specific PCR products of expected size (estimated from the homol-ogous p-glucosidase sequences BD168028, AY072918, and AY368687) were

65 isolated from the agarose gel. DNA fragments of about 1.8 kb (Acremonium), 1.5 kb (Chaetomium), and 1.52 kb (Thermoascus) were cloned into the pCR4-TOPOe' TA vector (lnvitrogen, USA) resulting in plasmids pALK1924, pALK1935, and pALK1713, respectively. The DNA products were characterized by sequencing and by performing Southern blot hybridizations to the genomic DNA digested with several restriction enzymes. The hybridization patterns in stringent washing conditions suggest that one putative p-glucosidase gene could be isolated from the Acremonium, Chaetomium, and Thermoascus genomic library. The deduced amino acid sequences of all three FOR products have homology to several published p-glucosidase sequences of glycosyl hydrolase family 3 (BLAST program, National Center for Biotech-nology Information; Altschul etal., 1990).
The insert from plasmids pALK1713, pALK1924, and pALK1935 was isolated by restriction enzyme digestion and labeled with digoxigenin ac-cording to the supplier's instructions (Roche, Germany). About 1-2 x 105 plaques from the amplified Acremonium, Chaetomium, or Thermoascus ge-nomic library were screened as described in Example 18. Several positive plaques were obtained, of which five to six strongly hybridizing plaques were purified from each screening. Phage DNAs were isolated and analysed by Southern blot hybridization. Restriction fragments hybridizing to the probe were subcloned into the pEluescript ll KS+ vector (Stratagene, USA) and the relevant parts were sequenced. In all cases the subcloned phage fragment contains the full-length gene of interest. Table 21 summarises the information of the probes used for screening of the I3-glucosidase genes, phage clones from which the genes were isolated, chosen restriction fragments containing the full-length genes with their promoter and terminator regions, names of plasmids containing the subcloned phage fragment, and the deposit numbers in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH cul-ture collection (DSM) for E. coil strains carrying these plasmids.

66 Table 21. Probes used for cloning of 13-glucosidase gene, phage clone and the subclone chosen, plasmid name and the corresponding deposit number of the E. coil strain.
Gene Genomic Probe Phage Sub- Plasmid E. con library used in clone cloned deposit screening fragment no.
At ce/3A A. thermophilum pALK1924 P44 6.0 kb pALK1925 DSM
ALK04245 Hindi II 17325 Ct ce/3A C. thermophilum pALK1935 P51 7.0 kb pALK2001 DSM
ALK04261 Xba I 17667 Ta ce/3A T. aurantiacus pALK1713 P21 5.3 kb pALK1723 DSM
ALK04242 BamHI 16725 Relevant information of the genes and deduced protein sequences (SEQ ID NO: 21-26) are summarized in Table 22 and Table 23, respectively.
Peptide sequences of the purified Acremonium f3G_101 (At Cel3A), Chaetomi-urn pG76 (Ct Cel3A), and Thermoascus i3G_81 (Ta Cel3A) proteins were found in the corresponding deduced amino acid sequences of the cloned genes confirming that appropriate genes were cloned.
Table 22. Summary of the 13-glucosidase genes isolated from Acremoni-um thermophilum, Chaetomium thermophilum, and Thermoascus au-rantiacus.
f3-gluco- Length with Coding No of Lengths of SEQ ID
sidase introns (bp) (a region introns introns (bp) NO:
gene bp) (b At ce/3A 2821 2583 3 92, 74, 69 23 Ct ce/3A 2257 2202 1 52 25 Ta ce/3A 3084 2529 7 134,67,56,64,59,110,62 21 (a The STOP codon is included.
(b The STOP codon is not included.

67 Table 23. Summary of the deduced 13-glucosidase sequences of Acremo-nium thermophilum, Chaetomium thermophilum, and Thermoascus au-rantiacus. ss, signal sequence.
S-gluco- No Length CED(b Predicted MW Predicted Putative SEQ ID
sidase of of (Da, ss pl N-glyco- NO:
protein aas ss not incl)(c ss not Incl) sylation NN/HMM(a sites At 861 19/18 No 91434 5.46 8 24 )3G 101 Ct 734 20/20 No 76457 6.3 2 28 pG 76 Ta 843 19/19 No 89924 4.95 8 22 (a The prediction of the signal sequence was made using the program SignalP
V3.0 (Nielsen et at, 1997; Bendtsen et al, 2004); the NN value was obtained using neural networks and HMM value using hidden Markov models.
(b Presence of a cellulose binding domain in the protein.
(c The predicted signal sequence is not included. Prediction was made using the Compute p1/MW tool at ExPASy server (Gasteiger etal., 2003).
(d The putative N-glycosylation sites N-X-S/T were predicted using the program NetNGlyc 1.0 (Gupta etal. 2004).
The deduced protein sequences of Acremonium 13G_101/Cel3A, Chaetomium 6G_76/Cel3A, and Thermoascus 6G_81/Cel3A 6-glucosidases share homology with enzymes of glycosyl hydrolase family 3, thus identifying that the isolated genes belong to this gene family. The closest counterparts of the Acremonium, Chaetomium, and Thermoascus p-glucosidases are those of Magnaporthe grisea (f3-glucosidase, AY849670), Neurospora crassa (hypo-thetical, XM_324308), and Talaromyces emersonii ()3-glucosidase, AY072918), respectively (Table 24). The highest sequence identity (73.2%) found was that of C. thermophilum f3G_76/Cel3A to N. crassa hypothetical protein indicating that novel enzymes genes were cloned.

68 Table 24. Comparison of the deduced Acremonium thermophilum 13G_101/Cel3A, Chaetomium thermophilum 13G_76/Cel3A, and Thermo-ascus aurantiacus 13G_81/Cel3A P-glucosidases with their homologous counterparts. The alignment was performed using the Needle programme of the EMBOSS programme package. *indicates a (3-glucosidase encoded by a gene cloned in this work.
Organism, enzyme, and accession number Identity (%) * Acremonium thermophilum 13G_101 100.0 Magnaporthe grisea p-glucosidase, AY849670 73.1 Neurospora crassa hypothetical, XM_330871 71.1 Trichoderma reesei Cel3B, AY281374 65.2 * The rmoascus aurantiacus PG_81 62.2 Aspergillus aculeatus p-glucosidase, 064088 59.5 Talaromyces emersonii p-glucosidase, AY072918 58.9 Aspergillus oryzae, AX616738 58.2 Acremonium cellulolyticus P-glucosidase, B0168028 57.2 * Chaetomium thermophilum f3G 76 40.9 Chaetomium thermophilum 3G_76 100.0 Neurospora crassa, hypothetical XM_324308 76.9 Magnaporthe grisea, hypothetical XM_364573 70.2 Trichoderma viridae BGI, AY368687 65.8 Acremonium celtufolyticus P-glucosidase, BD168028 41.2 *Acremonium thermophilum 3G 101 40.9 Trichoderma reesei Cel3B, AY281374 40.0 * Thermoascus aurantiacus i3G 81 39,9 * Thermoascus aurantiacus 3G_81 100.0 Talaromyces emersonii p-glucosidase, AY072918 73.2 Aspergillus oryzae, AX616738 69.5 Aspergillus aculeatus P-glucosidase, D64088 68.0 Acremonium cellulolyticus P-glucosidase, BD168028 65.7 * Acremonium thermophilum pG_101 62.2 Trichoderma reesei Cel3B, AY281374 57.9 * Chaetomium thermophilum PG 76 39.9

69 Example 21. Production of recombinant beta-glucosidases in Trichoderma reesei Expression plasmids were constructed for production of the recom-binant Acremonium 6G_101/Cel3A, Chaetomium 13G_76/Cel3A, and Thermo-ascus f3G_81/Cel3A proteins as described in Example 14. Linear expression cassettes (Table 25) were isolated from the vector backbone by restriction enzyme digestion, transformed into T. reesei A96 or A33 (both strains have the genes encoding the four major cellulases CBHI/Cel7A, CBH11/Cel6A, EGI/Cel7B and EGII/Cel5A deleted) and transformants purified as described in Example 14.
Table 25. The expression cassettes constructed for production of Acre-monium thermophilum pG_101/Cel3A, Chaetomium thermophilum 13G_76/Cel3A, and Thermoascus aurantiacus 13G_81/Cel3A p-glucosidases in Trichoderma reesei. The schematic structure of the expression cassettes is described in Figure 2.
P-glucosidase Expression Size of the Heterologous plasmid expression term i nator(b cassette At f3G_101 pALK1933 10.5 kb Notl 300 bp (HindIII) Ct 6G_76 pALK2004 10.1 kb EcoRI 528 bp (Xbal) Ta pG_81 pALK1914 10.9 kB EcoRI 452 bp (Apol) (a The expression cassette for T. reesei transformation was isolated from the vector backbone by EcoRI or Neff digestion.
(b The number of nucleotides after the STOP codon of the cloned gene that are included in the expression cassette are indicated. The restriction site at the 3'-region of the gene that was used in construction of the expression cassette is indicated in parenthesis.
The beta-glucosidase production of the transformants was analyzed from the culture supernatants of shake flask cultivations (50 ml). Trans-formants were grown as in Example 14 and the enzyme activity of the recom-binant protein was measured from the culture supernatant using 4-nitrophenyI-6-D-glucopyranoside substrate as described by Bailey and Nevalainen 1981.
Production of the recombinant proteins was also detected from culture super-natants by SDS-polyacrylamide gel electrophoresis. In addition, the expression

70 of Thermoascus 30_81 was verified by Western blot analysis with anti-I3G_81 antibodies as described in Example 19. The genotypes of the chosen transformants were analysed by Southern blotting using the expression cassette as a probe.
The pH optimum of the heterologously produced 3-glucosidases was determined in the universal McIlvaine's buffer within a pH range of 3.0-8.0 using 4-nitropheny1-13-D-glucopyranoside as substrate. The pH optima for the Acremonium 13G_101, Chaetomium pG_76, and Thermoascus I3G_81 are pH
4.5, 5.5, and 4.5, respectively (Figure 7 A). The optimal temperature for enzy-matic activity of these 13-glucosidases was determined at the temperature range of 50-85 C as described above. The highest activity of the enzymes was determined to be at 70 C, 65 C, and 75 C for the Acremonium 3G_101/Cel3A, Chaetomium 3G_76/Cel3A, and Thermoascus 3G_81/Cel3A, respectively (Figure 7 B).
The chosen transformants were cultivated, as described in Example 14, in a 2 litre bioreactor for four days (28 C, pH 4.2) to obtain material for the application tests.
Example 22. Cloning of Acremonium thermophilum ALK04245 and Thermoascus aurantiacus ALK04242 xylanase genes Standard molecular biology methods were used as described in Ex-ample 13. The construction of the Acremonium genomic library has been described in Example 12.
The peptides derived from the purified Acremonium xylanase shared homology with xylanases of the glycosyl hydrolase family 10 such as Humicola grisea XYNI (AB001030). All peptides derived from the Thermoascus xylanase were completely identical with the published Thermoascus aurantiacus XYNA sequence (AJ132635) thus identifying the purified protein as the same enzyme. Due to this the Thermoascus xylanase gene was amplified by FOR from the genomic DNA.
To amplify a probe for screening of the Acremonium xylanase gene from the genomic library, degenerate primers were designed on the basis of the peptide sequences (Example 11, Table 5). The order of the peptides in the protein sequence and the corresponding sense or antisense nature of the primers was deduced from the comparison with the homologous Hum/cola insolens XYNI sequence (AB001030). The sense primer sequence (GAYGGYGAYGCSACYTAYATG) is based on Peptide 3 (amino acids 2-8)

71 and anti-sense primer (YTTYTGRTCRTAYTCSAGRTTRTA) on Peptide 1 (amino acids 4-11).
A PCR product of expected size (estimated from the homologous Hum/cola insolens XYNI sequence AB001030) was obtained from the reaction.
This DNA fragment of about 0.7 kb was cloned into the pCR4-TOP06 TA
vector (lnvitrogen, USA) resulting in plasmid pALK1714, and was characterized by sequencing. The deduced amino acid sequence of the PCR
product has homology to several published xylanase sequences of glycosyl hydrolase family 10 (BLAST program, National Center for Biotechnology Information; Altschul etal., 1990).
The insert from plasmid pALK1714 was isolated by restriction en-zyme digestion and labeled with digoxigenin according to the supplier's in-structions (Roche, Germany). About 1-2 x 105 plaques from the amplified Acremonium genomic library were screened as described in Example 18.
Several positive plaques were obtained, of which five strongly hybridizing plaques were purified. Phage DNAs were isolated and analysed by Southern blot hybridization. A 3.0 kb Xbal restriction fragment hybridizing to the probe was subcloned into the pBluescript II KS+ vector (Stratagene, USA) resulting in plasmid pALK1725. Relevant parts of pALK1725 were sequenced and found to contain the full-length Acremonium thermophilum xynlOA gene (SEQ ID
NO: 19). The deposit number of the E. coil strain containing pALK1725 in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH culture collection is DSM 16726.
Thermoascus aurantiacus xyn10A gene (SEQ ID NO: 17) was am-plified directly from the isolated genomic DNA by PCR reaction. The forward (TTATACCGCGGGAAGCCATGGTTCGACCAACGATCCTAC) and reverse (TTATAGGATCCACCGGTCTATACTCACTGCTGCAGGTCCTG) primers that were used in the amplification of the gene were designed on the basis of the published T. aurantiacus xynA gene (AJ132635). The PCR reaction mixtures contained 50 mM Tris-HCI, pH 9.0, 15 mM (NH4)2SO4, 0.1% Triton X-100, 1.5 mM MgCl2, 0.3 mM dNTPs, 1 pM each primer, 1 unit of Dynazyme EXT DNA
polymerase (Finnzymes, Finland) and approximately 0.5 pg of Thermoascus genomic DNA. The conditions for PCR reactions were the following: 5 min ini-tial denaturation at 95 C, followed by 30 cycles of 1 min at 95 C, 1 min anneal-ing at 60-66 C, 3 min extension at 72 C and a final extension at 72 C for 10 min. The amplified 1.9 kb product containing the exact gene (from START to

72 STOP codon) was cloned as a SacII-BamH1 fragment into the pBluescript II
KS+ vector. Three independent clones were sequenced and one clone was selected and designated as pALK1715. The deposit number of the E. coil strain containing pALK1715 in the Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH culture collection is DSM 16724.
Relevant information of the genes and deduced protein sequences (SEQ ID NO: 17-20) are summarized in Table 26 and Table 27, respectively.
Peptide sequences of the purified Acremonium XYN_60 and Thermoascus XYN_30 proteins were found in the corresponding deduced amino acid sequences of the cloned genes (At xynlOA and Ta xyn10A, respectively) confirming that appropriate genes were cloned.
Table 26. Summary of the xylanase genes isolated from Acremonium thermophilum and Thermoascus aurantiacus.
Xylanase Length with Coding region No of in- Lengths of SEQ ID
gene introns (bp) (bp) (b trons introns NO:
(a (bp) At xyn10A 1471 1248 2 135. 85 19 Ta xyn10A 1913 987 10 73, 74, 68, 17 103, 69, 65, 93, 66, 100, (a The STOP codon is included.
(b The STOP codon is not included.

73 Table 27. Summary of the deduced xylanase sequences of Acremonium thermophilum and Thermoascus aurantiacus. ss, signal sequence.
Xylanase No Length of CBD(b Predicted Predicted Putative N- SEQ
protein of ss MW pl glyco- ID
aas NN/HMM(a (Da, ss not (ss not sylation NO:
incl)(` incl) sitesid At 416 19/19 Yes, 42533 6.32 1-2 20 XYN_60 W385 to Ta 329 26(e No 32901 5.81 0 18 (a The prediction of the signal sequence was made using the program SignalP
V3.0 (Nielsen et al 1997; Bendtsen et al, 2004): the NN value was obtained using neural networks and HMM value using hidden Markov models.
(b Presence of a carbohydrate binding domain CBD, the amino acids of the C-terminal CBD
are indicated (numbering according to the full length polypeptide) (c The predicted signal sequence is not included. Prediction was made using the Compute p1/MW tool at ExPASy server (Gasteiger etal. 2003).
(d The putative N-glycosylation sites N-X-SIT were predicted using the program NetNGlyc 1.0 (Gupta etal., 2004).
(e According to Lo Leggio etal., 1999 The deduced protein sequences of Acremonium and Thermoascus xylanases share homology with several enzymes of glycosyl hydrolase family 10, identifying the corresponding genes as members of family 10 xylanases.
The closest counterpart for the Acremonium XYN_60/Xyn10A found is the Humicola grisea XYLI (AB001030) showing 67.1% identity with XYN_60 (Table 28). The predicted protein sequence of the isolated Thermoascus aurantiacus XYN_30/Xyn1 OA xylanase is completely identical with that of the published T.
aurantiacus XYNA (P23360, Table 28). The closest homology was found in a xylanase sequence of Aspergillus niger (A62445, 69.7% identity).

74 Table 28. Comparison of the deduced Acremonium thermophilum XYN_60/XynlOA and Thermoascus aurantiacus XYN_30/Xyn10A
xylanases with their homologous counterparts. The alignment was performed using the Needle programme of the EMBOSS programme package. *indicates a xylanase encoded by a gene cloned in this work.
Organism, enzyme, and accession number Identity (%) * Thermoascus aurantiacus XYN_30 100.0 Thermoascus aurantiacus XynA, P23360 100.0 Thermoascus aurantiacus XynA, AF127529 99.4 Aspergillus nigerxylanase, A62445 69.7 Aspergillus aculeatus xylanase, AR137844 69.9 Aspergillus terreus fam 10 xyn, DQ087436 65.0 Aspergillus sojae, XynXI AB040414 63.8 Penicillium chtysogenum xylanase, AY583585 62.5 * Acremonium thermophilum XY1\1_60 100.0 Hum/cola grisea XYL I, AB001030 67.1 Magnaporthe grisea 70-15, hypothetical XM_364947 63.8 Aspergillus aculeatus xylanase, AR149839 53.7 Talaromyces emersonii xylanase, AX403831 51.8 Gibberella zeae xylanase, AY575962 51.4 Magnaporthe grisea XYL5, AY144348 48.5 Talaromyces emersonii, AX172287 46.9 Example 23. Production of recombinant xylanases in Trichoderma reesei Expression plasmids were constructed for production of the recom-binant Acremonium XYN_60/Xyn 10A and Thermoascus XYN_30/Xyn10A pro-teins as described in Example 14. Linear expression cassettes (Table 29) were isolated from the vector backbone by restriction enzyme digestion, transformed into T. reesei A96, and transformants purified as described in Example 14.

75 Table 29. The expression cassettes constructed for production of Acremonium thermophilum XYN_60/Xyn1OA and Thermoascus aurantiacus XYN_30/Xyn1OA xylanases in Trichoderma reesei. The schematic structure of the expression cassettes is described in Figure 2.
Xylanase Expression Size of the Heterologous plasmid expression terminator(b cassette At XYN_60 pALK1912 9.0 kb 150 bp (BamHI) Ta XYN_30 pALK1913 9.3 kb none (a The expression cassette for T. reesei transformation was isolated from the vector backbone by EcoRI digestion.
(b The number of nucleotides after the STOP codon of the cloned gene that are included in the expression cassette are indicated. The restriction site at the 3'-region of the gene that was used in construction of the expression cassette is indicated in parenthesis.
The xylanase production of the transformants was analyzed from the culture supernatants of shake flask cultivations (50 m1). Transformants were grown as in Example 14 and the enzyme activity of the recombinant pro-tein was measured from the culture supernatant as the release of reducing sugars from birch xylan (1% w/v) at 50 C in 50 mM citrate buffer pH 5.3 as de-scribed by Bailey and Poutanen 1989. Production of the recombinant protein was also analyzed from culture supernatant by SDS-polyacrylamide gel elec-trophoresis. In addition, the expression of both xylanases was determined by Western blot analysis with anti-XYN_30 or anti-XYN_60 antibodies as described in Example 19. The genotypes of the chosen transformants were analysed by Southern blotting using the expression cassette as a probe.
Thermoascus XYN_30/Xyn10A was produced in T. reesei and the pH optimum of the heterologously produced protein was determined in the uni-versal Molivaine's buffer within a pH range of 3.0-8.0 using birch xylan as sub-strate (Figure 8 A). The optimal pH was determined to be 4.5. The temperature optimum for the enzymatic activity of XYN_30 was determined to be 75 C
(Figure 8 B).

76 The chosen transformants were cultivated, as described in Example 14, in a 2 litre bioreactor for four days (28 C, pH 4.2) to obtain material for the application tests.
Example 24. Performance of the recombinant cellobiohydrolases in the hydrolysis The performance of the purified recombinant cellobiohydrolases was evaluated in the hydrolysis studies with purified T. reesei enzymes.
Hydrolysis was carried out with controlled mixtures of purified enzymes on several pre-treated substrates. Culture filtrates of T. reesei, containing different lo cloned CBH/Ce17 enzymes were obtained as described in Examples 14 and 15, and the CBH enzymes were purified by affinity chromatography as de-scribed in Example 2. In addition, pure T reesei cellulases (purified as de-scribed by Suurnakki et al., 2000) were used in the enzyme mixtures. The cellobiohydrolases used in the experiment were:
Thermoascus aurantiacus ALK04242 CBH (Ta Cel7A) The rmoascus aurantiacus ALK04242 CBH (Ta Cel7A) with genetically attached CBD of Trichoderma reesei (Ta Cel7A +Tr CBD) The rmoascus aurantiacus ALK04242 CBH (Ta Cel7A) with genetically attached CBD of Chaetomium thermophilum (Ta Cel7A +Ct CBD) Acremonium thermophilum ALK04245 CBH (At Cel7A) Chaetomium thermophilum ALK04265 CBH (Ct Cel7A).
Each CBH/Ce17 to be tested (dosage 14.5 mg/g dry matter of substrate) was used either together with EGII/Cel5A of T. reesei (3.6 mg/g) or with a mixture containing T. reesei EGI/Cel7B (1.8 mg/g), EGII/Cel5A (1.8 mg/g), xylanase pl 9 (Tenkanen et a/. 1992) (5000 nkat/g) and acetyl xylan esterase (AXE) (Sundberg and Poutanen, 1991) (250 nkat/g). All mixtures were supplemented with additional 3-glucosidase from a commercial enzyme preparation Novozym 188 (176 nkat/g d.w.). Triplicate tubes containing the en-zyme mixture and 10 mg (dry matter)/m1 of the substrate suspended in 0.05 M
sodium acetate were incubated in mixing by magnetic stirring at 45 C for 48 h.

Reference samples with inactivated enzymes and corresponding substrates were also prepared. The release of hydrolysis products was measured as reducing sugars with DNS method using glucose as standard (Table 30).
The following substrates were used in the experiment:
Crystalline cellulose (Avicel)

77 Washed steam pre-treated spruce fibre (impregnation with 3% w/w SO2 for 20 min, followed by steam pre-treatment at 215 C for 5 min), dry mat-ter 25.9% (SPRUCE).
Washed wet oxidized corn stover fibre (WOGS).
Washed steam pre-treated willow fibre (pre-treatment for 14 min at 210 C), dry matter 23.0% (WILLOW).
Table 30. Hydrolysis products with CBH enzymes (45 C, pH 5.0). Reaction products after 48 h hydrolysis as reducing sugars (mg/ml), measured glucose as standard. Abbreviations: CBH = cellobiohydrolase; EGI = en-doglucanase I (Cel7B) of T. reesei, EGII = endoglucanase II (Cel5A) of T.
reesei; bG = 13-glucosidase (from Novozym 188); XYL= xylanase pl 9 (XYN
II) of T. reesei, AXE = acetyl xylan esterase of T. reesei; nd = not done.
Enzymes substrates CBH Additional enzymes Avicel SPRUCE WOCS WILLOW
Ta Cel7A EGII, bG 2.0 2.0 2.8 2.0 Ta Cel7A +Tr CBD EGII, bG 5.8 4.0 4.4 4.0 Ta Cel7A +Ct CBD EGII, bG 4.9 3.7 4.6 3.7 At Cel7A EGII, bG 5.3 3.3 4.5 3.3 Ct Cel7A EGII, bG 6.0 2.6 3.4 2.6 Cel7A of T. reesei ECU, bG 4.7 2.9 2.9 2.9 Ta Cel7A EGII, EGI, XYL, AXE, bG nd nd 4.3 2.8 Ta Cel7A +Tr CBD ECU, EGI, XYL, AXE, bG nd nd 7.2 5.9 Ta Cel7A +Ct CBD EGII, EGI, XYL, AXE, bG nd nd 7.2 5.6 At Cel7A EGII, EGI, XYL, AXE, bG nd nd 6.4 5.4 Ct Cel7A EGII, EGI, XYL, AXE, bG nd nd 5.6 4.0 Cel7A of T. reesei EGII, EGI, XYL, AXE, bG nd nd 6.0 4.1 In Table 30 the different cellobiohydrolases have been compared based on the same protein dosage in the hydrolysis. The results show that on cellulosic substrates (Avicel and spruce fibre) Cel7A of The rmoascus aurantiacus with genetically attached CBD showed clearly higher hydrolysis than T. reesei CBHI/Cel7A. Without CBD, T. aurantiacus Cel7A was less efficient on these substrates. The performance of Acremonium the rmophilum and Chaetomium thermophilum cellobiohydrolases was also better than that of

78 T. reesei CBHI/Cel7A on several substrates; in particular, C. thermophilum Cel7A showed high efficiency on pure cellulose (Avicel).
In the case of substrates containing notable amounts of hemicellu-lose (willow and corn stover) the CBH/Ce17 enzymes clearly needed additional-ly both hemicellulases and endoglucanases to perform efficiently. If no additional hemicellulases were present, Cel7A of T. aurantiacus with genetically attached CBD showed again clearly highest hydrolysis. With the most important hemicellulose-degrading enzymes (xylanase, acetyl xylan esterase and EGI) Cel7A of T. aurantiacus with genetically attached CBD
performed again with highest efficiency. A. thermophilum Cel7A was more efficient than T. reesei enzyme and C. thermophilum Cel7A produced hydrolysis products on the same level than T. reesei CBHI/Cel7A. The cellulose binding domain of T. reesei seemed to give slightly better efficiency than CBD of C. thermophilum in the hydrolytic performance of T. aurantiacus Cel7A, even though the difference was rather small.
It can be concluded that when CBHI/ Cel7A was replaced in the mixture of Trichoderma enzymes by the herein produced cellobiohydrolases, the hydrolysis efficiency as judged by this experimental arrangements was clearly improved in the case of T. aurantiacus Cel7A with genetically attached COD, and also improved in the case of A. thermophilum Cel7A and C. ther-mophilum Cel7A. Considering also the better temperature stability of the herein produced cellobiohydrolases, the results indicate that the performance of cellu-lase enzyme mixtures in higher temperatures than 45 C can be clearly im-proved by using the herein produced cellobiohydrolases.
Example 25. Performance of the recombinant endoglucanases in the hydrolysis The preparations containing the endoglucanases were compared in hydrolysis studies mixed with the purified CBH/Ce17 and CBH/Ce16 enzymes on several pre-treated substrates. Culture filtrates of T. reesei, containing dif-ferent cloned endoglucanase enzymes were obtained as described in Example 19. The enzymes were enriched by removing thermolabile proteins from the mixtures by a heat treatment (60 C, 2 h, pH 5) and the supernatant was used for the hydrolysis studies. In addition, pure T. reesei cellulases (purified as described by Suurnakki et al., 2000) were used in the enzyme mixtures. The endoglucanases used in the experiment were:

79 Acremonium the rmophilum ALK04245 endoglucanase At EG_40/Ce145A (ALK04245 EG_40) Acremonium thermophilum ALK04245 endoglucanase At EG_40_like/Ce145B (ALK04245 EG_40_like) Thermoascus aurantiacus ALK04242 endoglucanase Ta EG_28/Cel5A (ALK04242 EG_28).
The following substrates were used in the experiment:
Washed steam pre-treated spruce fibre (impregnation with 3% SO2 for 20 min, followed by steam pre-treatment at 215 C for 5 min), dry matter 25.9% (SPRUCE).
Steam exploded corn stover fibre (steam pre-treatment at 210 C for 5 min), dry matter 31.0% (SECS).
The endoglucanases to be studied (dosage 840 nkat/g dry matter, based on endoglucanase activity against HEC according to IUPAC, 1987) were used either with cellobiohydrolases of T. reesei (CBHI/Cel7A, 8.1 mg/g d.m, and CBH11/Ce16A, 2.0 mg/g d.m.) or with Thermoascus aurantiacus Cel7A
with genetically attached CBD of T. reesei (10.1 mg/g d.m.). Purified (Suurnakki et a/., 2000) EGI (Cel7B) and EGI1 (Cel5A) of T. reesei were also included in the experiments for comparison. All mixtures were supplemented with additional p-glucosidase from Novozym 188 (to make the total p-glucosidase dosage 560 nkat/g d.w., the relatively high dosage was used to compensate the differences in the background activities of the different EG
preparations). Triplicate tubes were incubated in mixing at 45 C for 48 h and reference samples with inactivated enzymes and corresponding substrates were prepared. The release of hydrolysis products was measured as reducing sugars with DNS method using glucose as standard (Table 31).

80 Table 31. Hydrolysis products with different endoglucanase preparations when used together with cellobiohydrolases from T. reesei or with T.
aurantiacus Cel7A harbouring CBD of T. reesei. Reaction products after 48 h hydrolysis (45 C, pH 5.0) as reducing sugars (mg/ml), measured glu-cose as standard. Abbreviations: CBHI = cellobiohydrolase I (Cel7A) of T.
reesei; CBHII = cellobiohydrolase II (Cel6A) of T. reesei; EGI = endoglu-canase I (Cel7B) of T. reesei, EGII = endoglucanase II (Cel5A) of T. reesei;
bG = p-glucosidase (from Novozym 188); nd. = not done.
Enzymes Substrate Endoglucanase CBH/Ce17 SPRUCE SECS
no added EG CBHI and CBHII of T. reesei 2.4 3.2 EGI CBHI and CBHII of T. reesei 3.5 4.6 EGII CBHI and CBHII of T. reesei 3.8 3.5 At EG_40 CBHI and CBHII of T. reesei 4.9 4.3 At EG_40like CBHI and CBHII of T. reesei 4.5 4.8 Ta EG_28 GBH! and CBHII of T. reesei 3.0 3.9 no added EG T. aurantiacus Cel7A + Tr CBD 1.8 2.1 EG I I aurantiacus Cel7A + Tr CBD nd. 4.2 EG II T. aurantiacus Cel7A + Tr CBD 3.2 nd.
At EG_40 T. aurantiacus Cel7A + Tr CBD 4.8 4.0 Ta EG_28 T. aurantiacus Cel7A + Tr CBD 1.5 nd.
In Table 31 the different endoglucanases have been compared based on the same activity dosage in the hydrolysis. This may favour enzymes with low specific activity against the substrate (hydroxyethyl cellulose) used in the assay and underestimate the efficiency of enzymes with high specific activity against hydroxyethyl cellulose. In any case, the results show that Acremonium thermophilum endoglucanases perform very well in the hydrolysis when affecting together with both cellobiohydrolases used in the mixture. A.
thermophilum endoglucanases have similar performance to T. reesei EGI/Cel7B which is a very efficient enzyme on hemicellulose-containing corn stover substrate due to its strong xylanase side activity. T. aurantiacus endoglucanase Cel5A (ALK04242 EG_28) showed lower hydrolysis than T.
reesei enzymes.

81 It can be concluded that the endoglucanases from A. the rmophilum perform with comparable or enhanced efficiency when compared to the corre-sponding Trichoderma enzymes in the hydrolysis as judged by this experi-mental arrangement. Considering also the temperature stability of the herein described endoglucanases, the results indicate that the performance of cellu-lase enzyme mixtures in higher temperatures than 45 C can be improved by using the herein described endoglucanases.
Example 26. Hydrolysis of steam pre-treated spruce at high temperatures Washed steam exploded spruce fibre (impregnation with 3% w/w SO2 for 20 min, followed by steam pre-treatment at 215 C for 5 min), with dry matter of 25.9% was suspended in 5 ml of 0.05 M sodium acetate buffer in the consistency of 10 mg/ml. This substrate was hydrolysed using different enzyme mixtures in test tubes with magnetic stirring in the water bath adjusted in different temperatures for 72 h. For each sample point, a triplicate of test tubes was withdrawn from hydrolysis, boiled for 10 min in order to terminate the enzyme hydrolysis, centrifuged, and the supernatant was analysed for reaction products from hydrolysis. The blanks containing the substrate alone (only buffer added instead of enzymes) were also incubated in the corresponding conditions.
A mixture of thermophilic cellulases was prepared using the follow-ing components:
Thermophilic CBH/0e17 preparation containing Thermoascus au-rantiacus ALK04242 Cel7A with genetically attached CBD of T. reesei CBHI/Cel7A. The protein preparation was produced as described in Example 15 and purified according to Example 2 resulting in the purified Ta Cel7A + Tr CBD preparation with protein content of 5.6 mg/ml.
Thermophilic endoglucanase preparation containing Acremonium thermophilum ALK04245 endoglucanase At EG_40/Ce145A. The protein was produced in T. reesei as described in Example 19. In order to enrich the ther-mophilic components, the spent culture medium was heat treated (60 C for 2 hours). The preparation obtained contained protein 4.9 mg/ml and endoglucanase activity (according to IUPAC, 1987) 422 nkat/ml.
Thermophilic P-glucosidase preparation prepared as described in Example 21 containing Thermoascus aurantiacus ALK04242 (3-glucosidase Ta 13G_81/Cel3A. In order to enrich the thermophilic components, the fermen-tor broth was heat treated (65 C for 2 hours). The preparation obtained con-

82 tamed 4.3 mg/ml protein and P-glucosidase activity of 6270 nkat/ml (according to Bailey and Linko, 1990).
These enzyme preparations were combined as follows (per 10 ml of mixture): CBH/Ce17-preparation 4.51 ml, endoglucanase preparation 5.19 ml and p-glucosidase preparation 0.29 ml. This mixture was used as "MIXTURE
1" of the thermophilic enzymes.
As a comparison and reference, a state-of art mixture of commercial Trichoderma reesei enzymes was constructed combining (per 10 ml): 8.05 ml Celluclast 1,5 L FG (from Novozymes A/S) and 1.95 ml Novozym 188 (from Novozymes A/S). This was designated as "T. REESE1ENZYMES".
Enzymes were dosed on the basis of the FPU activity of the mix-tures: "MIXTURE 1" using the dosage of 5.5 FPU per 1 gram of dry matter in the spruce substrate, and "T. REESEI ENZYMES" using 5.8 FPU per 1 gram of dry matter in the spruce substrate.
Samples were taken from the hydrolysis after 24, 48 and 72 h and treated as described above. The hydrolysis products were quantified using the assay for reducing sugars (Bernfeld, 1955), using glucose as standard. The amount of hydrolysis products as reducing sugars is presented in Figure 9.
The results clearly show better performance of the herein described enzymes as compared to the state-of-art Trichoderma enzymes in 55 C and 60 C on the spruce substrate. On the basis of HPLC analysis the maximum yield of sugars from the substrate would be 5.67 mg per 10 mg of dry spruce substrate. Because of the relatively low dosage of enzyme the final sugar yields were clearly lower. For thermostable enzymes the sugar yield based on reducing sugar assay was 66% and 57% of theoretical in 55 C and 60 C, re-spectively. For state-of art Trichoderma enzymes it was only 31% and 11% in 55 C and 60 C, respectively.
Example 27. Hydrolysis of steam pre-treated corn stover at high ternperatures Steam exploded corn stover fibre (treatment at 195 C for 5 min), with dry matter of 45.3% was suspended in 5 ml of 0.05 M sodium acetate buffer in the consistency of 10 mg/ml. The treatments and measurements were performed as described in Example 26.
A mixture of herein described thermophilic cellulases was con-structed using the following components:

83 Thermophilic CBH preparation containing Thermoascus aura ntiacus ALK04242 Cel7A with genetically attached CBD of T. reesei CBHI/Cel7A (Ta Cel7A + Tr CBD, Example 15). The protein content of the preparation was 31 mg/ml.
Thermophilic endoglucanase preparation containing Acremonium thermophilum ALK04245 endoglucanase At EG_40/Ce145A was obtained as described in Example 19. The concentrated enzyme preparation contained en-doglucanase activity (according to IUPAC, 1987) of 2057 nkat/ml.
Thermophilic p-glucosidase preparation containing Thermoascus aurantiacus ALKO 4242 p-glucosidase Ta pG_81/Cel3A was obtained as de-scribed in Example 21 containing f3-glucosidase activity (according to Bailey and Linko, 1990) of 11500 nkat/ml.
Thermophilic xylanase product containing an AM24 xylanase origi-nating from Nonomuraea flexuosa DSM43186. The product was prepared by using a recombinant Trichoderma reesei strain that had been transformed with the expression cassette pALK1502, as described in W02005/100557. The sol-id product was dissolved in water to make a 10% solution and an enzyme preparation with xylanase activity (assayed according to Bailey et al., 1992) of 208000 nkat/ml was obtained.
These enzyme preparations were combined as follows (per 10 ml of mixture): CBH/Ce17 preparation 7.79 ml, endoglucanase preparation 0.96 ml, p-glucosidase preparation 1.14 ml and xylanase preparation 0.31 ml. This mixture was used as "MIXTURE 2" of the thermophilic enzymes.
As a comparison and reference, a state-of art mixture of commercial Trichoderma reesei enzymes was constructed by combining (per 10 nil) 8.05 ml Celluclast 1,5 L FG (from Novozymes A/S) and 1.95 ml Novozym 188 (from Novozymes A/S). This was designated as "T. REESEI ENZYMES".
Samples were taken from the hydrolysis after 24, 48 and 72 h and treated as described above. The hydrolysis products were quantified using the assay for reducing sugars (Bernfeld, 1955), using glucose as standard. The results from the substrate blanks were subtracted from the samples with enzymes, and the concentration of hydrolysis products as reducing sugars is presented in Figure 10.
The results clearly show better performance of the herein described enzymes as compared to the state-of-art Trichoderma enzymes. In 45 C the mixture of thermophilic enzymes showed more efficient hydrolysis as com-

84 pared to T. reesei enzymes: The hydrolysis was faster and higher sugar yields were also obtained. On the basis of HPLC analysis the maximum yield of sugars (including free soluble sugars in the unwashed substrate that was used) from the substrate would be 5.73 mg per 10 mg of dry substrate. Thus, the hydrolysis by the MIXTURE 2 enzymes was nearly complete within 48 hours. In 55 C and 57.5 C the herein described thermophilic enzymes showed also clearly better performance in the hydrolysis as compared to the state-of art Trichoderma enzymes.
Example 28. Hydrolysis of pre-treated corn stover at high temperatures using mixture with a thermostable xylanase The procedure explained in Example 27 was repeated except that the xylanase product XT 02026A3 was replaced by thermophilic xylanase preparation containing The rmoascus aurantiacus ALK04242 xylanase Ta XYN_30/Xyn1 OA produced in T. reesei. The fermentor broth, produced as de-scribed in Example 23 contained xylanase activity of 132 000 nkat/ml (assayed according to Bailey etal., 1992).
These enzyme preparations were combined as follows (per 10 ml of mixture): CBH/Ce17-preparation 7.64 ml, endoglucanase preparation 0.96 ml, 3-glucosidase preparation 1.15 ml and xylanase preparation 0.25 ml. This mixture was used as "MIXTURE 3" of the thermophilic enzymes.
As a comparison and reference, a state-of-art mixture of commercial Trichoderma reesei enzymes was constructed by combining (per 10 ml) 8.05 ml Celluclast 1,5 L FG (from Novozymes A/S) and 1.95 ml Novozym 188 (from Novozymes A/S). This was designated as "T. REESEI ENZYMES".
Samples were taken from the hydrolysis after 24, 48 and 72 h and treated as described above. The hydrolysis products were quantified using the assay for reducing sugars (Bernfeld, 1955), using glucose as standard. The results from the substrate blanks were subtracted from the samples with enzymes, and the concentration of hydrolysis products as reducing sugars is presented in Figure 11.
The results clearly show better performance of the mixture of the herein described enzymes as compared to the state-of-art Trichoderma en-zymes. In 45 C the mixture of thermophilic enzymes showed more efficient hydrolysis as compared to T. reesei enzymes. In 55 C and 60 C the herein described thermophilic enzymes showed clearly better performance in the hy-drolysis as compared to the state-of art Trichoderma enzymes. The perfor-

85 mance of the new enzyme mixture at 60 C was at the same level than the per-formance of state-of-art enzymes at 45 C.
Example 29. Hydrolysis of pre-treated spruce at high temperatures using mixture with a thermostable xylanase Procedure as described in Example 28 was repeated with washed steam exploded spruce fibre (impregnation with 3% w/w SO2 for 20 min, fol-lowed by steam pre-treatment at 215 C for 5 min, with dry matter of 25,9%) as substrate using hydrolysis temperatures 45 C, 55 C and 60 C. Samples were taken from the hydrolysis after 24, 48 and 72 h and treated as described above. The hydrolysis products were quantified using the assay for reducing sugars (Bernfeld, 1955), using glucose as standard. The results from the substrate blanks were subtracted from the samples with enzymes, and the concentration of hydrolysis products as reducing sugars is presented in Figure 12.
The results clearly show better performance of the mixture of herein described enzymes as compared to the state-of-art Trichoderma enzymes in all the temperatures studied. At 45 C the mixture of thermophilic enzymes showed more efficient hydrolysis as compared to T. reesei enzymes, evidently due to the better stability in long term hydrolysis. At 55 C the efficiency of the mixture of herein described enzymes was still on the same level than at 45 C, whereas the state-of-art mixture was inefficient with the substrate used in this temperature. At 60 C the herein described thermophilic enzymes showed de-creased hydrolysis although the hydrolysis was nearly at the same level as the performance of the state-of-art enzymes at 45 C.
Example 30. Evaluation of glucose inhibition of 13-glucosidases from Acremonium thermophilium A LK04245, Chaetomium thermophilum ALK04261 and Thermoascus aurantiacus ALK04242 The culture filtrates produced by Acremonium thermophilium ALK04245, Chaetomium the rmophilum ALK04261 and Thermoascus auranti-acus ALK04242 strains are described in Example 1. The p-glucosidase activi-ties (measured according to Bailey and Linko, 1990) of these preparations were 21.4 nkat/ml, 5.6 nkat/ml and 18.6 nkat/ml, respectively. For comparison, commercial enzymes Celluclast 1,5L (p-glucosidase 534 nkat/ml) and Novo-zym 188 (p-glucosidase 5840 nkatiml) were also included in the experiment.

86 In order to evaluate the sensitivity of the different P-glucosidases towards glucose inhibition, the standard activity assay procedure was per-formed in the presence of different concentrations of glucose. The substrate (p-nitrophenyl-p-D-glucopyranoside) solutions for p-glucosidase activity assay were supplemented by glucose so that the glucose concentration in the assay mixture was adjusted to the values from 0 to 0.5 M. Except this glucose addi-tion the assay was performed using the standard procedure (Bailey and Linko, 1990). The activities in the presence of varying glucose concentrations as a percentage of the activity without glucose are presented in Figure 13.
The results show that p-glucosidases from C. thermophilum and T.
aurantiacus were affected less by glucose inhibition than the (3-glucosidases present in the commercial enzymes: Aspergillus-derived p-glucosidase in No-vozym 188 or Trichoderma-derived P-glucosidase in Celluclast 1,5L. A.
thermophilum enzyme showed behaviour comparable to T. reesei enzyme of Celluclast. Especially C. thermophilum enzyme was clearly less affected by high glucose concentration. Thus, these results indicate that considering glu-cose inhibition the use of the new p-glucosidases, especially from strains Acremonium the rmophilium ALK04242 and Chaetomium thermophilum ALK04261, would give clear advantages in hydrolysis in industrial conditions with high glucose concentration.
Example 31. Filter paper activity of enzyme mixtures in high tempera-tures Filter paper activity of enzyme preparations was measured accord-ing to the method of 1UPAC (1987) as described in the procedure except en-zyme reaction was performed at temperatures from 50 C to 70 C. The calcu-lated FPU activity is based on the amount of enzyme required to hydrolyse 4%
of filter paper substrate in 1 h under the experimental conditions. The FPU ac-tivity is considered to represent the total overall cellulase activity of an enzyme preparation.
The enzyme mixtures were MIXTURE 2 prepared as described in Example 27, MIXTURE 3 prepared as described in Example 28, and MIX-TURE 4. MIXTURE 4 was prepared by combining enzyme preparations de-scribed in Example 27 as follows (per 10 ml of mixture): CBH/Ce17-preparation 7.84 ml, endoglucanase preparation 0.99 ml and p-glucosidase preparation 1.17 ml.

87 The enzyme mixtures used as reference, representing the state-of art-mixtures, were:
"T. REESEI ENZYMES A" prepared as preparation "T. REESEI
ENZYMES" described in Example 26.
"T. REESEI ENZYMES B" was constructed combining (per 10 ml) 8.05 ml Econase CE (a commercial T. reesei cellulase preparation from AB
Enzymes Oy, Rejamaki, Finland) and 1.95 ml Novozym 188 (from Novozymes A/S).
The FPU activities measured for the enzyme preparations at differ--10 ent temperatures are presented in Figure 14 as percentages of the activity un-der standard (IUPAC, 1987) conditions (at 50 C).
Results clearly show that the mixtures of the invention show higher overall cellulase activity in elevated (60-70 ) temperatures as compared to the state-of art mixtures based on enzymes from Trichoderma and Aspergillus.
Example 32. Use of the novel beta-glucosidases in preparation of sophorose A high concentration starch hydrolysate mixture (Nutriose 74/968, Roquette) was treated with Thermoascus aurantiacus [3G_81/Cel3A enriched enzyme preparation produced as described in Example 21 to produce a sugar mixture containing appreciable amounts of cellulase inducer (sophorose) to overcome the glucose repression.
The Ta f3G_81/Cel3A enriched enzyme preparation was added to a 70% (w/w) Nutriose solution to a final concentration of 1 g total protein /litre.
The container of the mixture was incubated in a water bath at 65 C for 3 days with constant stirring and used as a carbon source in a shake flask medium for two different Trichoderma-st rains (A47 and Rut-C30). The effect of the enzyme treatment was measured as an endoglucanase activity formed during a 7 days shake flask cultivation. As a reference cultivations were performed under the same conditions with untreated Nutriose as a carbon source. More than two-fold increase in the activities was obtained in the shake flask cultivations per-formed on Ta pG_81 /Cel3A pretreated Nutriose media with the strains tested.
Results are shown in Figure 15.

88 List of deposited organisms Strain Plasm id Deposition Deposition Deposition contained authority date number Acremonium CBS(1) 20 Sep 2004 CBS 116240 the rmophilum Thermoascus - CBS()) 20 Sep 2004 CBS 116239 aura ntiacus Chaetomium CBS(2) Nov 8, 1995 CBS 730.95(4) thermophilum Escherichia colt pALK1635 DSMZ(3) 16 Sep 2004 DSM 16723 Escherichia coil pALK1642 DSMZ 16 Sep 2004 DSM 16727 Escherichia coil pALK1646 DSMZ 16 Sep 2004 DSM 16728 Escherichia coil pALK1861 DSMZ 16 Sep 2004 DSM 16729 Escherichia colt pALK1715 DSMZ 16 Sep 2004 DSM 16724 Escherichia coil pALK1723 DSMZ 16 Sep 2004 DSM 16725 Escherichia coil pALK1725 DSMZ 16 Sep2004 DSM 16726 Escherichia coil pALK1904 DSMZ 13 May 2005 DSM 17323 Escherichia colt pALK1908 DSMZ 13 May 2005 DSM 17324 Escherichia coil pALK1925 DSMZ 13 May 2005 DSM 17325 Escherichia coil pALK1926 DSMZ 13 May 2005 DSM 17326 Escherichia coil pALK2001 DSMZ 18 Oct 2005 DSM 17667 Escherichia coli pALK2010 DSMZ 18 Nov 2005 DSM 17729 (') the Centralbureau Voor Schimmelcultures at Uppsalalaan 8, 3584 CT, Utrecht, the Nether-lands (2) the Centralbureau Voor Schimmelcultures at Oosterstraat 1, 3742 SK BAARN, The Nether-lands (3)Deutsche Sammlung von Mikroorganismen und Zelikulturen GmbH (DSMZ), Mascheroder VVeg 1 b, 0-38124 Braunschweig, Germany (4)[After termination of the current deposit period, samples will be stored under agreements as to make the strain available beyond the enforceable time of the patent.]

89 References Altschul S., Gish W., Miller W., Myers E. W. and Lipman D. J.
(1990) Basic local alignment search tool. J. Mol. Biol. 215: 403-410.
Badger, P.C. (2002) Ethanol from cellulose: a general review. In Trends in new crops and new uses. J. Janick and A. VVhipkey (eds.). ASHS
Press, Alexandria, VA, USA, pp. 17-21.
Bailey M. J. and K. M. H. Nevalainen (1981) Induction, isolation and testing of stable Trichoderma reesei mutants with improved production of solu-bilizing cellulase. Enz Microbiol Technol. 3: 153-157.
Bailey, M.J., Biely, P. and Poutanen, K. (1992) Interlaboratory test-ing for assay of xylanase activity. J Biotechnol. 23:257-270.
Bailey, M. J. and Linko, M. (1990) Production of 13-galactosidase by Aspergillus oryzae in submerged bioreactor cultivation. J. Biotechnol. 16:57-66.
Bailey M. J. and Poutanen K. (1989) Production of xylanases by strains of Aspergffius. Appl. Microbiol. Biotechnol. 30:5-10.
Bailey M., Siika-aho M., Valkeajarvi A. and Penttila M. (1993) Hy-drolytic properties of two cellulases of Trichoderma reesei expressed in yeast.
Biotehnol. Appl. Biochem 17: 65-76.
Bendtsen J.D., Nielsen H., von Heijne G. and Brunak S. (2004) Im-proved prediction of signal peptides: SignalP 3Ø J. Mol. Biol. 340: 783-795.
Bernfeld, B. (1955) Amylases, a. and 11. In: Methods in Enzymology, vol. 1, Eds. Colowick, S.P. and Kaplan, N.O. Academic Press, New York, pp.
149-158.
Biely P., Vrsanska M., Tenkanen M., Kluepfel D. (1997) Endo-beta-1,4-xylanase families: differences in catalytic properties. Journal of Biotechnol-ogy 57: 151-166.
Coen, D.M. (2001) The polymerase chain reaction. In: Ausubel, F.M., Brent, R., Kingston, R.E., More, D.D., Seidman, J.G., Smith, K. and Struhl, K. (eds.) Current protocols in molecular biology. John Wiley & Sons.
Inc., Hoboken, USA.
Gasteiger, E., Gattiker A., Hoogland C., lvanyi I., Appel R. D. and Bairoch A. (2003) ExPASy: the protelomics server for in-depth protein knowledge and analysis. Nucleic Acids Res. 31: 3784-3788.

Gellissen, G. (ed.) (2005) Production of recombinant proteins. Novel microbial and eukaryotic expression systems. Wiley-VCH Verlag Gmbh&Co.
Weinheim, Germany.
Gill, SC, and von Hippel, P.H. (1989) Calculation of protein extinc-5 tion coefficients from amino acid sequence data. Anal. Biochem. 182: 319-326.
Gupta, R., E. Jung and S. Brunak. (2004) Prediction of N-glycosyl-ation sites in human proteins, In preparation..
Haakana H., Miettinen-Oinonen A., Joutsjoki V., Mantyla A., Suomi-nen P, and Vehmaanpera J. (2004) Cloning of cellulose genes from Melano-10 carpus albomyces and their efficient expression in Trichoderma reesei. Enz.

Microbiol. Technol. 34: 159-167.
Henrissat B. (1991) A classification of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J. 280: 309-316.
Henrissat B. and Bairoch A. (1993) New families in the classification 15 of glycosyl hydrolases based on amino acid sequence similarities. Biochem. J.
293: 781-788.
Henrissat B. and Bairoch A. (1996).Updating the sequence-based classification of glycosyl hydrolases. Biochem. J. 316: 695-696 Henrissat B., Teen T. T. and Warren R. A. J. (1998) A scheme for 20 designating enzymes that hydrolyse the polysaccharides in the cell wall of plants. FEBS Letters 425: 352-354.
Hong J., H. Tamaki, K. Yamamoto, and Kumagai H. (2003a) Clon-ing of a gene encoding a thermo-stabile endo-I3-1,4-gluc,anase from Ther-moascus aurantiacus and its expression in yeast. Biotech. Letters 25: 657-661.
25 Hong J., Tamaki H., Yamamoto K. and Kumagai H. (2003b) Clon-ing of a gene encoding thermostable cellobiohydrolase from Thermoascus au-ran tiacus and its expression in yeast. Appl. Microbiol. Biotechnol. 63: 42-50.
IUPAC (International Union of Pure and Applied Chemistry) (1987).
Measurement of cellulase activities. Pure and Appl. Chem. 59: 257-268.
30 Joutsjoki, V. V., Torkkeli T.K. and Nevalainen K. M. H. (1993) Trans-formation of Trichoderma reesei with the Hormoconis resinae glucoamylase P
(gamP) gene: production of a heterologous glucoamylase by Trichoderma reesei. Curr. Genet. 24: 223-228.
Karhunen T., Mantyla A., Nevalainen K. M. H. and Suominen P. L.
35 (1993) High frequency one-step gene replacement in Trichoderma reeseL I.
Endoglucanase I overproduction. Mol. Gen. Genet. 241: 515-522.

Kurabi A., Berlin A, Gilkes N., Kilburn D., Markov A., Skomarovsky A., Gusakov A., Okunev 0., Sinitsyn A., Gregg D. Xie D. and Saddler J. (2005) Enzymatic hydrolysis of steam-exploded and ethanol organosolv-pretreated Douglas-Fir by novel and commercial fungal cellulases. Appl. Biochem and Bi-otechn. Vol 121-124: 219-229.
Lever, M. (1972) A new reaction for colorimetric determination of carbohydrates. Anal. Biochem., 47: 276-279.
Lo Leggio, L., Kalogiannis S., Bhat M.K., and Pickersgill R.W.
(1999) High resolution structure and sequence of the T. aurantiacus xylanase I: implications for evolution of thermostability in family 10 xylanases and en-zymes with (beta) alpha-barrel architecture. Proteins 36(3): 295-306.
Lowry, 0., Rosenbrough, N., Farr, A. and Randall, R. (1951) Protein measuremen with the Folin phenol reagent. J. Biol. Chem. 193: 265-275.
Needleman S. and Wunsch C. (1970) A general method applicable to the search for similarities in the amino acid sequence of two proteins.
Jour-nal of Molecular Biology 48, 443-453.
Nielsen H., Engelbrecht J., Brunak S. and von Heijne G. (1997) Identification of prokaryotic and eykaryotic signal peptides and prediction of their cleavage sites. Protein Engineering 10: 1-6.
Paloheimo M., Mantyla A., Kallio J., and Suominen P. (2003) High-yield production of a bacterial xylanase in the filamentous fungus Trichoderma reesei requires a carrier polypeptide with an intact domain structure. Appl.
Env. Microbiol. 69: 7073-7082.
Parry N., Beever D., Owen E., Nerinckx W. Claeyssens M, Van Beeumen J. and Bhat M. (2002) Biochemical characterization and mode of ac-tion of a thermostable endoglucanase purified from Thermoascus aurantiacus, Arch. of Biochem. and Biophys. 404: 243-253.
Penttila M., Nevalainen H., RattO M., Salminen E. and Knowles J.
(1987) A versatile transformation system for the cellulolytic filamentous fungus Trichoderma reesei. Gene 61:155-164.
Raeder U. and Broda P. (1985) Rapid preparation of DNA from fila-mentous fungi. Lett. Appl. Microbiol. 1: 17-20.
Rice P, Longden I and Bleasby A. (2000). EMBOSS: The European Molecular Biology Open Software Suite. Trends in Genetics 16:276-277.
Sambrook J., Fritsch E. F. and Maniatis T. (1989) Molecular cloning, a laboratory manual. Cold Spring Harbor Laboratory, New York, US.

Sambrook J. and Russell D. W. (2001) Molecular cloning, a labora-tory manual. Cold Spring Harbor Laboratory, New York, US.
Srisodsuk M, Reinikainen T, Penttila M and Teen T. (1993) Role of the interdomain linker peptide of Trichoderma reesei cellobiohydrolase I in its interaction with crystalline cellulose. J. Biol. Chem. Oct 5;268(28): 20756-61.
Sundberg, M., and Poutanen, K. (1991) Purification and properties of two acetylxylan esterases of Trichoderma reesei. Biotechnol. Appl. Bio-chem. 13: 1-11.
Suurnakki, A., Tenkanen M., Siika-aho, M., Niku-Paavola, M.-L., Viikari, L. and Buchert, J. (2000) Trichoderma reesei cellulases and their core domains in the hydrolysis and modification of chemical pulp. Cellulose 7: 189-209.
Tenkanen, M., Puls, J. and Poutanen, K (1992) Two major xy-lanases of Trichoderma reesei. Enzyme Microbiol. Technol. 14: 566-574.
Tomme, P. McRae, S., Wood, T. and Claeyssens, M. (1988) Chro-matographic separation of cellulolytic enzymes. Methods in Enzymol. 160:
187-192.
Tuohy M., Walsh J., Murray P., Claeyssens M., Cuffe M., Savage A.
and Coughan M. (2002) Kinetic parameters and mode of action of cellobiohy-drolases produced by Talaromyces emersonii. Biochem. Biophys. Acta 1596:
366-380 (abstract).
Van Petegem et al (2002) Atomic resolution structure of major en-doglucanase from Thermoascus aurantiacus, Biochem. and Biophys. Res.
Comm. 296, pp. 161-166.
Van Tilbeurgh, H., Loonties, F., de Bruyne, C. and Claeyssens, M.
(1988) Fluorogenic and chromogenic glycosides as substrates and ligands of carbohydrases. Methods Enzymol. 160:45-59.
Wyman, C.E. (2001) Twenty years of trials, tribulations, and re-search progress in bioethanol technology. Applied Biochemistry and Biotech-nology 91-93: 5-21.

Claims (17)

Claims

1. A polypeptide having cellulolytic activity and comprising an amino acid sequence having at least 80% identity over the full length to SEQ ID NO: 22.

2. The polypeptide of claim 1 comprising an amino acid sequence having at least 85% identity over the full length to SEQ ID NO: 22.

3. An isolated polynucleotide comprising a nucleotide sequence selected from the group consisting of:
a) the nucleotide sequence of SEQ ID NO: 21;
b) a sequence encoding the polypeptide of claim 1; and c) the full length complement of the nucleotide sequence of a).

4. A vector, which comprises as a heterologous sequence the polynucleotide of claim 3.

5. The vector of claim 4, which expresses the polypeptide of claim 1.

6. A host cell comprising the vector of claim 4.

7. The host cell of claim 6, which expresses the polypeptide encoded by the heterologous polynucleotide sequence.

8. The host cell of claim 7, which is a strain from the genus Trichoderma or Aspergillus.

9. An Escherichia co/istrain having accession number DSM 16725.

10. An enzyme preparation comprising the polypeptide of claim 1 in an admixture with a biologically compatible carrier, in a form of spent culture medium, powder, granules, or liquid.
Date Recue/Date Received 2022-03-03

11. The enzyme preparation of claim 10, which comprises cellobiohydrolase, endoglucanase, and beta-glucosidase.

12. The enzyme preparation of claim 10 or 11, further comprising at least one of xylanase activity and other enzyme activities selected from the group consisting of proteases, amylases, laccases, lipases, pectinases, esterases and peroxidases.

13. The enzyme preparation of any one of claims 10-12, which further comprises conventional additives.

14. Use of the polypeptide according to claim 1 or 2, or the enzyme preparation according to any one of claims 10-13 in the fuel, textile, detergent, pulp and paper, food, feed or beverage industry.

15. The use according to claim 14, wherein the enzyme preparation is used in treatment of kraft pulp, mechanical pulp, or recycled paper.

16. The use according to claim 14, wherein the enzyme preparation is spent culture medium.

17. A method for preparing a polypeptide having cellulolytic activity and comprising an amino acid sequence having at least 80% identity over the full length to SEQ ID NO: 22, said method comprising transforming a host cell with a vector encoding said polypeptide, and culturing said host cell under conditions enabling expression of said polypeptide, and recovering and purifying the polypeptide produced.
Date Recue/Date Received 2022-03-03