CA2938520A1 - Abhd6 antagonists for promoting browning of white adipose tissue and brown adipose tissue functionality - Google Patents

Abstract

The present disclosure relates to compounds of formula I : compositions containing same and methods for treating or preventing a condition associated with brown adipose tissue dysfunction in a subject and/or for converting white adipose tissue into beige/brite adipose tissue.

Description

BROWN ADIPOSE TISSUE FUNCTIONALITY
CROSS-REFERENCE TO RELATED APPLICATIONS
This application includes a sequence listing in electronic format which is being concurrently filed herewitn. This application also claims priority from U.S. provisional application Serial Number 61/946293 filed on February 28, 2014. The content of the sequence listing and of the priority application is herewith incorporated in its entirety.
FIELD OF THE DISCLOSURE
The present disclosure relates to compounds, compositions containing same and methods for treating or preventing a condition associated with brown adipose tissue dysfunction in a subject in need thereof.
BACKGROUND
Glycerolipid/free fatty acid cycle, which generates signaling molecules within its lipolysis and lipogenesis segments, plays a role in the regulation of fat storage and mobilization, insulin secretion and action, non-shivering thermogenesis and energy homeostasis.
Lipolysis of triglycerides to diacylglycerol, monoacylglycerol (MAG) and glycerol plus free fatty acids is catalyzed by the sequential action of adipose triglyceride lipase, hormone sensitive lipase and MAG lipase. Even though MAG lipase is the major MAG hydrolyzing enzyme in many tissues, intracellular breakdown of MAG can also be catalyzed by membrane bound u/p-hydrolase domain-6 (ABHD6). Whole-body deletion of MAGL in mice enhances insulin sensitivity and glucose tolerance but no effects on body weight gain or food intake were noted in the KO mice on high fat diet (HFD). It was recently reported that ABHD6 is the major MAG hydrolase in pancreatic p-cells and that suppression of ABHD6 results in elevated islet MAG levels with enhanced glucose stimulated insulin secretion. These results identified ABHD6 as a negative modulator of insulin secretion, as this enzyme hydrolyzes the signal molecule 1-MAG that activates the exocytosis facilitating protein, Munc13-1. A recent study showed that male mice fed a high fat diet treated with antisense oligonuleotides (ASO) against ABHD6 protects mice from high-fat-diet-induced obesity, hepatic steatosis and systemic insulin resistance (Thomas etal., 2013).
Although an imbalance between energy intake and expenditure and the resulting excessive body weight is a major contributor of type 2 diabetes (T2D), the current pharmacological approaches for treating obesity and diabetes target different pathways. Several studies showed altered expression of a given specific gene, either by knockout or overexpression, to offer protection against diet-induced obesity (D10), but none of these genes were shown to control both insulin secretion and sensitivity directly. However, it is desirable to identify a metabolic step/pathway that can influence both insulin secretion and action in conjunction with additional beneficial effects on energy homeostasis, such that a single target can be addressed for diabetes and obesity.
Increased energy expenditure via fat oxidation and non-shivering thermogenesis by classical brown adipose tissue (BAT) and also by the stimulation of beige adipocytes may provide a novel avenue to alleviate the effects of obesity and prevent T2D. Several recent reports in rodents indicated that augmented BAT function and browning of white adipose enhance glucose tolerance, insulin sensitivity and protect from diet-induced obesity and obesity-related diabetes. Signaling via peroxisomal proliferator activated receptors (PPAR) is important for the beige adipocyte formation and the stimulation of BAT. PPARa itself plays a role in maintaining brown adipocyte phenotype and in the browning process of white adipose. The endogenous activators involved are unknown and recent studies suggested that lipolytic products to be defined may activate PPARs.
It would be desirable to be provided with compounds capable of browning white adipose tissue to beige/brite adipose tissue and/or increase the functionality of the brown adipose to prevent, treat or alleviate symptoms associated thereto.
SUMMARY
In an aspect of the disclosure, there is provided a compound of formula I

eA

xR4X
HN

or a pharmaceutically acceptable salt or solvate thereof, wherein X is N or CH;
R1 is lower linear or branched alkyl, cycloalkyl, lower linear or branched alkenyl, cycloalkenyl or aryl;
each of R2, R3, R4 and R5 is H or one or more independently selected substituent;
R6 is H, lower linear or branched alkyl, or cycloalkyl;
each of R7 and R8 is independently selected from H, lower alkyl or fluoride.
In another aspect of the disclosure, there is provided a pharmaceutical composition comprising a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof, and an acceptable excipient.

2 In a further aspect of the disclosure, there is provided a method for treating, preventing or alleviating symptoms of a condition associated with a dysfunction of brown adipose tissue in a subject in need thereof, said method comprising administering to the subject a therapeutically effective amount of a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof. In the context of the present disclosure, the dysfunction of brown adipose tissue includes, but is not limited to as a reduction in brown adipose tissue function or insufficient/defective brown adipose function in an afflicted subject when compared to a healthy subject.
For example, dysfunctional brown adipose tissue is observed in subjects afflicted by diabetes (especially type II
diabetes), obesity, metabolic syndrome X and/or lipodystrophy.
In some embodiments, the prevention and/or treatment of a dysfunction of brown adipose tissue can be useful for decreasing body weight, decreasing body weight gain, decreasing fat and/or decreasing fat gain, for decreasing appetite, for enhancing voluntary exercise (locomotion), for preventing/limiting fat build-up (especially in the liver) and/or for promoting energy expenditure in the afflicted subjects.
In yet another aspect of the disclosure, there is provided a method for promoting the conversion of white adipose tissue to beige/brite adipose tissue in a subject in need thereof, said method comprising administering to the subject a therapeutically effective amount of a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof.
In the context of the present disclosure, "brown", "beige" or "brite" adipose tissue refers to a tissue containing adipocytes and preadipocytes capable of uncoupling respiration (e.g., oxidation and the generation of ATP) to produce energy (heat). In contrast, "white" adipose tissue refers to a tissue containing adipocytes and preadipocytes that are not capable of generating a substantive amount of energy/heat. In some embodiments, "beige/brite" adipose tissue (which refer to the same type of adipose tissue) contain cells that can be stimulated to express UCP1 and also express CD37/TMEM26 (Rosen et al., 2014). In other embodiments, "brown" adipose tissue contain cells that do express UCP1, but not CD37 not TMEM26 (Rosen etal., 2014). Further, "brown" adipose tissue can also be characterized as being derived from a muscle lineage (Myf5). In contrast, beige/brite adipose tissue is not derived from a muscle lineage.
In still another aspect of the disclosure, there is provided a method for increasing the functionality of brown adipose tissue (e.g., enhancing brown adipose tissue fonction) in a subject in need thereof, said method comprising administering to the subject a therapeutically effective amount of a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof. In some embodiments, such methods can be used to promote/enhance locomoter function in the subject, promote/induce thermogenesis (e.g., energy/heat production) in the subject, limiting/reducing hepatic steatosis (e.g., liver fat accumulation) in the subject, limiting/reducing food intake, especially high-fat food intake, in the subject and/or limiting/reducing body weight, especially the fat

3 mass, of the subject.
In another aspect of the disclosure, there is provided a method for decreasing the activity of ABHD6 and/or increasing a level of monoacylglyceride (MAG) in an adipocyte or a preadipocyte of a subject, said method comprising administering to the subject a therapeutically effective amount of a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof. In some embodiments, the compounds can be formulated to be administering more specifically to adipocytes and/or preadipocytes.
In another aspect of the disclosure, there is provided the use of a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof, in the manufacture of a medicament for the treatment, prevention or the alleviation of symptoms of a disease or condition described above or herein.
In another aspect of the disclosure, there is provided the use of a compound as defined herein or a pharmaceutically acceptable salt or solvate thereof, for use in the treatment, prevention or the alleviations of symptoms of a disease or condition described above or herein.
In another aspect of the disclosure, there is provided the pharmaceutical composition as defined herein or use in the treatment, prevention or the alleviation of symptoms of a disease or condition described above or herein.
In the context of the present disclosure, the expression "treatment, prevention or the alleviation of symptoms" refer to the ability of a method or an agent to limit the development, progression and/or symptomology of a disease or condition. Broadly, the prevention, treatment and/or alleviation of symptoms can encompass the conversion of white adipose tissue into beige/brite adipose tissue and/or the increase in functionality of brown adipose tissue.
In the context of the present disclosure, the "functionality of brown adipose tissue" refers to the total mass of brown adipose tissue, the percentage of brown adipose (when compared to the total adipose tissue) or the biological activity of the brown adipose tissue. The biological activity of the brown adipose tissue includes, but is not limited to, mitochondrial activity, oxidation of carbohydrates and/or oxidation of lipids, energy expenditure, etc. Adipocyte or pre-adipocytes from brown adipose tissue usually expression a higher levels, when compared to adipocytes or pre-adipocytes from white adipose tissue, of mRNAs encoding the following proteins expression:
UCP1, PRDM16, Trem26 and TBX1. It is known in the art that the beige/brite, brown and white adipose tissue differentially expresses some proteins and that it is possible to characterize the type of adipose tissue (refer to the Examples below). Such differentially expressed proteins include, but are not limited to, those encoded by at least one of the following gene or mRNA transcript: UCP1, PGC1a, PRDM16, PPARa, TBX1, CD37, TREM26, Cox8b, Cox7a1, PPAR8, PPARy, CPT1, CIDEA and AP2.

4 The functionality of brown adipose tissue or the presence of beige/brite adipose tissue can be measured in vivo or in vitro, for example, by determining the energy expenditure and/or the respiration exchange ratio (RER), cold-induced thermogenesis, fatty acid oxidation, the extent of uncoupled respiration, the expression of WAT- or BAT-specific mRNAs and associated proteins, etc.
BRIEF DESCRIPTION OF THE DRAWINGS
Figures 1 and 2 represent oral glucose tolerance test on mice.
Figure 3 illustrates basic characterization of male and female ABHD6 KO mice on chow diet.
Male and female ABHD6 KO, HZ and WT mice were fed chow diet over 24 weeks and food intake and body weight gain were measured each week. OGTT was performed on 6-week old mice following a 6h food withdrawal and ITT was performed on 12-week old mice.
(a) Glycemia of male mice during OGTT. Inset depicts area under the curve for glycemia. (b) Corresponding plasma insulin levels of male mice during OGTT. Inset depicts area under the curve for insulinemia. * P<0.05 vs WT. (c) Glycemia during ITT on male mice. Inset depicts area above the curve (AAC). (d) Glycemia during OGTT on female mice. Inset depicts area under the curve for glycemia. * P<0.05 vs WT. (e) Corresponding plasma levels for female mice.
* P<0.05 vs WT. (f) Blood glucose levels during ITT on female mice. Inset depicts area above the curve (AAC) for insulinemia. * P<0.05 vs WT. (g) Body weight gain of male mice over 24 weeks. (h) Cumulative weekly food intake of male mice over 16 weeks. (i) Body weight gain of female mice. (j) Cumulative weekly food intake of female mice. * P<0.05 vs WT. For all the studies on male and female mice, each group has 6-9 mice.
Figure 4 illustrates improved glucose tolerance, insulin sensitivity and reduced food intake and body weight gain in male and female ABHD6 KO mice on high fat diet (HFD). Male and female ABHD6 KO (homozygous), heterozygous (HZ) and wild-type (WT) mice were placed on HFD for 8 weeks, and food intake and body weight gain were monitored. Oral glucose tolerance test (OGTT) was performed after 8 weeks, after a 6h food withdrawal. Tail blood was collected at indicated times and analyzed for glucose and insulin by ELISA. Insulin tolerance test (ITT) and hyperinsulinemic euglycemic clamp (HIEC) were performed after 10 weeks on HFD.
(a) Glycemia during OGTT on male WT, HZ and KO mice (n=9, each group). Inset depicts area under the curve for glycemia. (b) Insulinemia during OGTT in male mice. Inset, area under the curve. (c) Glycemia during ITT on male WT, HZ and KO mice (n=6, each group).
Inset depicts area above the curve (AAC). (d) Glycemia during OGTT on female WT, HZ and KO
mice (n=8, each group). Inset depicts area under the curve. * P<0.05 vs WT. (e) Corresponding plasma insulin levels for female mice. (f) Blood glucose levels during ITT on female WT, HZ and KO
mice (n=8, each group). Inset depicts area above the curve (AAC) for insulinemia. (g) Blood glucose levels during HIEC on male WT (n=8), HZ (n=9) and KO (n=10) mice. (h) Glucose

5 infusion rate (GIR) during HIEC on male mice. (i) Body weight gain of male WT, HZ and KO
mice (n=9, each group). (j) Cumulative food intake of male mice over 7 weeks.
(k) Body weight gain in female mice. (I) Cumulative food intake in female mice over 7 weeks. *
P<0.05; **
P<0.01 vs WT.
Figure 5 illustrates increased glucose uptake in soleus muscle and visceral fat from HFD fed ABHD6 KO mice. ABHD6 KO and WT mice were fed HFD for 12 weeks. Then the mice were sacrificed, and soleus muscle and visceral fat were removed, and used for measuring glucose uptake with [31-1]-2-doexy-glucose, as detailed in Example 9. (a) Glucose uptake in visceral fat of male mice. (b) Glucose uptake in soleus muscle of male mice. (c) Glucose uptake in visceral fat of female mice. (d) Glucose uptake in soleus muscle of female mice. *P<0.05 vs WT.
Figure 6 illustrates body composition, tissue weight and liver histology of HFD-fed ABHD6 KO
mice. After 10 weeks of HFD, body composition of male and female ABHD6 KO, HZ
and WT
mice was analyzed by Echo-MRI, and then the mice were sacrificed and fat and liver tissues were removed for further analysis. (a) Lean mass of male mice. (b) Fat mass of male mice. (c) Liver weight of male mice. (d) Visceral fat weight of male mice. (e) Lean mass of female mice.
(f) Fat mass of female mice. (g) Liver weight of female mice. (h) Visceral fat weight of female mice. (i) H-E staining of female liver. Black arrows indicate lipid droplets.
(j) Female ABHD6 KO
and WT mice. *P<0.05 vs WT (n= 7-10 mice).
Figure 7 illustrates plasma adipokine profile in HFD-fed female ABHD6 KO and WT mice.
Female ABHD6 KO and WT (n=8, each) were fed HFD mice and sacrificed. Blood was collected by heart puncture and plasma was separated for adipokine analysis. Plasma adipokines were measured using Mouse Adipokine Antibody Array and adipokine levels were expressed as relative expression compared to the control provided by the supplier. (a) Adipokines with significant changes and (b) Adipokine levels with no significant difference. *
P<0.05, ** P<0.01 vs WT (n= 6 mice) Figure 8 illustrates increased energy expenditure and locomotor activity in HFD-fed ABHD6 KO
and WT mice during dark and light phases. Male and female ABHD6 KO, HZ and WT
(n=10, each group) mice were fed HFD for 6 weeks, and at the end of feeding period the mice were placed in metabolic cages at room temperature for 3 days. After acclimatization for the first two days, volume of 02, CO2 as well as locomotor activity measurements were made on the 3rd day and based on these parameters, respiration exchange ratio (RER) and energy expenditure (EE) were calculated. In parallel, metabolic cage measurements were also made with HFD fed male ABHD6 KO and WT mice under thermoneutral (30 C) conditions. Results shown were calculated for light and dark phases separately, during the 3rd day. (a) Volume 02 and (b) Volume CO2 (expressed as liters /kg body weight/ h); (c) RER, (d) Energy expenditure

6 (expressed as kcal/ kg metabolic mass/h) and (e) Locomotor activity. Metabolic mass was calculated as lean mass + 0.2 x fat mass for each mouse. *P<0.05 vs WT.
Figure 9 illustrates increased energy expenditure and locomotor activity in HFD-fed ABHD6 KO
and WT mice during a 24h period. Male and female ABHD6 KO, HZ and WT (n=10, each group) mice were fed HFD for 6 weeks, and at the end of feeding period the mice were placed in metabolic cages at room temperature for 3 days. After acclimatization for the first two days, volume of 02, CO2 as well as locomotor activity measurements were made on the 3rd day and based on these parameters, respiration exchange ratio (RER) and energy expenditure (EE) were calculated. In parallel, metabolic cage measurements were also made with HFD fed male ABHD6 KO and WT mice under thermoneutral (30 C) conditions. Results shown were calculated for 24h period on the 3rd day. (a) Volume 02 and (b) Volume CO2 (expressed as liters/kg body weight/ h); (c) RER, (d) Energy expenditure (expressed as kcal/
kg metabolic mass/h) and (e) Locomotor activity. Metabolic mass was calculated as lean mass + 0.2 x fat mass for each mouse. * P<0.05 vs WT.
Figure 10 illustrates the lack of difference between ABHD6 KO and WT mice in their response to anxiety and depression tests. Male and female ABHD6 KO and WT mice (8-10 wk old) on normal chow diet were subjected to anxiety (elevated plus maze and open field) and depression (forced swimming) tests, as described in Example 9. (a) Elevated plus maze.
(b) Open field. (c) Forced swimming.
Figure 11 illustrates increased expression of UCP1 and other adipose browning related genes and cold-induced thermogenesis in HFD-fed female ABHD6 KO mice. Female ABHD6 KO (n=7) and WT (n=7) mice fed HFD for 10 weeks, were sacrificed, and visceral, inguinal and brown fat tissues were quickly removed and frozen in liquid N2 for further analysis.
Total RNA was extracted and the expression of various browning marker genes was assessed by real-time PCR (a-e). All gene expressions are normalized to 18S RNA expression.
Histological (hematoxylin-eosin staining) and immunochemical (for UCP1 expression) examination was also done on the adipose tissues (f, g). Also, another batch of HFD fed ABHD6 KO
and WT mice were placed in cold room (4 C) for 3h, and rectal temperature was monitored every 30 min (h).
Gene expressions in visceral, inguinal and brown adipose tissues: (a) UCP1 expression, (b) PGC1a, (c) PRDM16, (d) PPARa, (e) CD36. Histochemistry of visceral, inguinal and brown adipose tissues: (f) H-E staining, (g) UCP1 immunohistochemical staining. (h) Cold¨induced thermogenesis. *P<0.05 vs WT.
Figure 12 illustrates the expression of different adipose browning related genes in visceral, inguinal and brown adipose tissues from HFD-fed ABHD6 KO mice. Female ABHD6 KO
and WT (n=7, each) mice fed HFD for 10 weeks, were sacrificed, and visceral, inguinal and brown fat tissues were removed and total RNA was extracted and the expression of various browning

7 related genes was assessed by real-time PCR. All gene expressions are normalized to 18S
mRNA. Gene expressions in visceral, inguinal and brown adipose tissues: (a) TBX1, (b) CD37, (c) TREM26, (d) Cox8b, (e) Cox7a1, (f) PPAR8, (g) PPARy, (h) CPT1, (i) CIDEA.
* P<0.05 vs \ATT.
Figure 13 illustrates the increased expression of UCP1 and other adipose browning related genes in HFD-fed male ABHD6 KO mice under thermoneutrality conditions. ABHD6 KO and WT
mice (5 weeks age) were fed HFD for 8 weeks, and then the mice were placed under thermoneutrality conditions (at 30 C) for 3 days, and sacrificed. Visceral, inguinal and brown fat were isolated and expression of various adipose browning related genes was measured by RT-PCR. All gene expressions are normalized to 18S mRNA. Gene expressions in visceral, inguinal and brown adipose tissues: (a) UCP1, (b) PGC1a, (c) PRDM16, (d) PPARa, (e) PPARy, (f) AP2. *P<0.05 vs \ATT.
Figure 14 illustrates the increased fatty acid oxidation in brown fat in HFD
fed ABHD6 KO
female mice. ABHD6 KO and \ATT mice were fed HFD for 12 weeks. Then the mice were sacrificed, and soleus muscle and visceral fat were removed, and used for measuring fatty acid oxidation using [1-14q-palmitate. Incubations were at 30 C in modified Krebs-Henseleit buffer containing 5% fatty acid-free BSA, 5 mM glucose, 1 mM [1-14q-palmitate for 1h (soleus muscle) or 2h (adipose tissues). After the incubation, complete oxidation was determined by acidifying the incubation medium and measuring the released 14CO2. PaImitate oxidation was expressed as nmol/ mg tissue. (a) Inguinal fat. (b) Visceral fat. (c) Brown fat. (d) Soleus muscle. * P<0.05 vs WT.
Figure 15 illustrates that the suppression of ABHD6 by V\M/L70 increased the expression of browning related genes in white adipose tissue in HFD fed mice. Wild-type C57616N mice were fed high fat diet (45% calories from fat) for 8 weeks and were treated with V\M/L-70 (10 mg/kg/
day, i.p.) during the feeding period. After the feeding period, mice were sacrificed and visceral fat was removed and processed for measuring the expression of various browning related genes and UCP1 immunohistochemical staining Gene expression results were normalized to corresponding 18S RNA expression (a) UCP1 immunochemical staining in visceral adipose from V\M/L70 treated mice. (b) Browning related gene (UCP1, PRDM16, Trem26 and TBX1) expression in visceral adipose from V\M/L70 treated and control mice. *P<0.05 vs control mice.
Figure 16 illustrates changes in the expression of additional browning related genes in visceral adipose from HFD-fed mice treated with V\ANL70. Treatment of mice with V\M/L70 was as described under Figure 15. Additional browning related gene expression was examined by RT-PCR in visceral adipose and the results were normalized to 18S RNA expression.
(a) Expression of UCP2, Cidea, Cox7a1, PPARa and PPARy in vehicle and V\ANL70 treated mice. *
P<0.05 vs \ATT.

8

9 PCT/CA2015/050147 Figure 17 illustrates the accumulation of 1-MAG in ABHD6 KO mouse adipose tissues and PPARa-dependence of elevated browning gene expression by 1-MAG or V\ANL70 in human adipocytes. (a) MAG hydrolase activity in visceral adipose from ABHD6 \ATT and KO mice.
Visceral adipose tissues were homogenized and employed for assaying MAG
hydrolysis activity using 1-S-arachidonoylglycerol, as described in Example 9. * P<0.05 vs WT
(n=7, each). (b, c) Visceral and brown adipose tissues were processed for lipid extraction and MAG
species were analyzed by a combination of TLC and HPLC, as described in Example 9. (b) Increased levels of long chain 1-MAG species in visceral adipose isolated from HFD fed female ABHD6 KO and WT mice. * P<0.05 vs WT (n=7, each). (c) Increased levels of long chain 1-MAG
species in brown adipose isolated from HFD fed female ABHD6 KO and \ATT mice (n=7, each).
*P<0.05 vs WT. (d) PPARa-dependence of elevated browning gene (UCP1, PGC1a, PRDM16 and PPARa) expression by 1-OG (1-oleoylglycerol) or V\ANL70 (VV) in human adipocytes. Fully differentiated human adipocytes were incubated with either DMSO vehicle, 10 pM
V\M/L70 or 100 pM 1-OG for overnight, in the presence and absence of PPARa antagonist 1 pM GW6471 (G), and the cells were collected for RNA analysis and RT-PCR. Results were normalized to 18S RNA expression (n = 5). *P<0.05 vs control (DMSO); # P<0.05 vs GW6471. (e) Stimulation of uncoupled oxygen consumption rate (OCR) in differentiated human adipocytes by 1-OG and V\M/L70 and this increase is curtailed by PPARa antagonist GW6471 (n = 5). *
P<0.05 vs DMSO control; # P<0.05 vs GW6471. (f) Transactivation of PPARa and PPARy by 1-MAG.
PPAR transactivation assay was done in 293T cells, transfected with plasmids expressing PPARa, PPAR8 or PPARy, using dual luciferase PPRE reporter assay. WY16427, and pioglitazone were used as positive controls for the activation of PPARa, PPAR8 and PPARy, respectively (n = 6). * P<0.05, ** P<0.01, ** P<0.001 vs DMSO. (g) PPARa antagonist, GW6471 suppresses the expression of browning related genes UCP1, PGC1a, PRDM16 and PPARa in adipocytes differentiated ex vivo from pre-adipocytes isolated from ABHD6 KO and WT mice (n = 5). *P<0.05; ***P<0.001 vs WT-DMSO; # P<0.05 vs KO-DMSO.
Figure 18 illustrates the 2-MAG levels in visceral and brown adipose tissues isolated from HFD-fed female ABHD6 KO and WT mice. Visceral and brown adipose tissues were processed for lipid extraction and MAG separation and quantification as in Figure 17. Levels of different species of 2-MAG were expressed per total tissue weight. (a) 2-MAG profile in visceral adipose.
(b) 2-MAG profile in brown adipose.
Figure 19 illustrates that V\M/L70 and 1-MAG induce browning related gene expression and OCR in 3T3-L1 adipocytes in a PPARa dependent manner. (a) Browning related gene expression in 3T3-L1 cells. Fully differentiated 3T3-L1 cells were incubated in the presence of

10 pM V\M/L70, 100 pM 1-OG (1-oleoylglycerol), 100 pM 1-PG (1-palmitoylglycerol) or DMSO
(control) for 24h and then the cells were collected and processed for gene expression analysis by RT-PCR. The results were normalized to 18S RNA expression * P<0.05 vs DMSO.
(b) Oxygen consumption rate (OCR) in 3T3-L1 cells. Fully differentiated 3T3-L1 cells were incubated for 24h with 10 pM V\ANL70 or 100 pM 1-OG in the absence or presence of 1 pM
PPARa antagonist GW6471, and then OCR in these cells was monitored with different respiratory inhibitors. From these traces (c) basal, (d) maximal and (e) uncoupled oxygen consumption was calculated.
Figure 20 illustrates that V\ANL70 and 1-OG increase OCR in human differentiated adipocytes in a PPARa dependent manner. (a) Original traces of OCR in differentiated human adipocytes, incubated overnight with 10 pM V\M/L70 or 100 1..iM 1-OG in the absence or presence of 1 pM
PPARa antagonist GW6471. (b) Basal respiration. (c) Maximal respiration.
Figure 21 illustrates that V\M/L70 and 1-OG induced browning-related gene expression in differentiated human adipocytes is inhibited by PPARy antagonist. Fully differentiated human adipocytes, were treated with 10 uM V\ANL70 and 100 uM 1-OG in the absence or presence of 1 pM PPARy antagonist T0070907, overnight. Then the adipocytes were harvested and gene expression was assessed by RT-PCR. Gene expressions were normalized to 18S RNA
expression. (a) UCP1; (b) PGC1a; (c) PRDM16; (d) PPARa and (e) PPARy. (n = 5).
* P<0.05 vs control; # P<0.05 vs corresponding V\ANL70 or 1-OG without T0070907 treatment.
Figure 22 illustrates that ABHD6 KO mediated protection from HFD-induced obesity, and reduced glucose tolerance and insulin sensitivity is not prevented by pair feeding. Male ABHD6 KO and \ATT mice (6-week old) were pair-fed HFD every day. Daily body weight gain was monitored and OGTT and ITT were performed at the end of feeding period. (a) Body weight gain. (b) Daily food intake in WT and KO mice. (c) Glycemia during OGTT. Inset depicts AUC.
(d) Insulinemia during OGTT. Inset depicts AUC (e) ITT. Results were calculated as percentage of basal (0 min) glycemia. *P<0.05 vs WT.
Figure 23 illustrates the reversal of ABHD6 KO mediated effects on obesity, glucose tolerance, insulin sensitivity, energy expenditure and adipose tissue UCP1 expression by PPARa antagonist. Female ABHD6 KO and WT mice were fed HFD for 8 weeks without or with PPARa antagonist GW6471 treatment (1 mg/ kg BW; once every two days, i.p.). Daily body weight gain and food intake were monitored and at the end of feeding period energy expenditure, lean and fat mass were assessed and OGTT and ITT were performed. Then the mice were sacrificed and adipose tissues were isolated for measuring browning related gene expression.
(a) Body weight gain; (b) Food intake; (c) Glycemia during OGTT. Inset depicts AUC. (d) Insulinemia during OGTT. Inset depicts AUC. (e) ITT. Glycemia with time was shown as percentage of basal 0 min value. (f) Energy expenditure under thermoneutrality (30 C) conditions (expressed as kcal/kg metabolic mass), during light and dark phases and complete 24h. (g) UCP1 expression in visceral, inguinal and brown adipose tissues. (n=6, each group). * P<0.05, **
P<0.01, ***
P<0.001 vs WT-Vehicle; # P<0.05 vs KO-Vehicle.

Figure 24 illustrates the reversal of ABHD6 KO mediated effects on metabolic parameters and locomotor activity by PPARa antagonist. Female ABHD6 KO and WT mice were fed HFD and treated with PPARa antagonist, GW6471 for 8 weeks, as described under Figure 23. After the feeding period, the mice were placed in metabolic cages under thermoneutrlity (30 C) conditions for 3 constitutive days. After the first two days of acclimatization, on the third day V02, VCO2, locomotor activity were monitored, and RER was calculated for light and dark phases and for complete 24h. (a) V02. (b) VCO2. (c) RER. (d) Locomotor activity. (n=6, each group)* P<0.05 vs WT-vehicle; # P<0.05 vs KO-vehicle.
Figure 25 illustrates the reversal of ABHD6 KO mediated effects on adipose tissue browning related gene expression by PPARa antagonist. Female ABHD6 KO and WT mice were fed HFD
and treated with PPARa antagonist, GW6471 for 8 weeks, as described under Figure 23. After the feeding period the mice were sacrificed and visceral, inguinal and brown adipose tissues were isolated to measure the browning related gene expression. Liver and soleus muscle were also isolated and palmitate oxidation was measured in liver, brown adipose, visceral adipose and muscle. Gene expressions were normalized to corresponding 18S RNA
expression. (a) PGC1a. (b) PRDM16. (c) PPARa. (d) PaImitate oxidation in visceral adipose, brown adipose, liver, and muscle. (n=6, each group)* P<0.05 vs WT-vehicle; # P<0.05 vs KO-vehicle.
DESCRIPTION OF THE EMBODIMENTS
Description of the compounds of the disclosure and their uses In accordance with one embodiment, there is provided a compound having the formula la N
r>( N% 0 <

HN¨R6 R5 la or a pharmaceutically acceptable salt or solvate thereof, wherein R1, R2, R3, R5, R6, R7 and R8 are as defined herein.
In accordance with one embodiment, there is provided a compound described herein wherein the compound has the formula ll

11 I I
or a pharmaceutically acceptable salt or solvate thereof, wherein X, R1, R2, R3, R4, R5 and R6 are as defined herein.
In accordance with one embodiment, the disclosure provides a compound of formula III:

I \/o HN

Ill wherein X, R1, and R6 are as defined herein In accordance with one embodiment, the disclosure provides a compound of formula IV

HN

wherein R1, R2, R3, R5 and R6 are as defined herein.
In accordance with one embodiment, the disclosure provides a compound of formula IVa

12 17i NO
HN

IVa wherein R1, and R6 are as defined herein.
In one embodiment, in compound of formula I and II, R2, R3, R4 and R5 are H.
In one embodiment, in compound of formula I and II, R2, R3, R4 and R5 are H or an independently selected substituent as defined herein.
In one embodiment, in compound of formula I, each of R7 and R8 is independently selected from H, C1-3 alkyl or fluoride.
In one embodiment, in compound of formula I, each of R7 and R8 is independently selected from H or C1-3 alkyl.
In one embodiment, in compound of formula I, each of R7 and R8 is independently selected from H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl.
In one embodiment, in compound of formula I, each of R7 and R8 is H.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, X is CH.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, X is N.
In one embodiment, in compound of formula I, II or III or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, C2-6 linear or branched alkenyl or aryl.
In one embodiment, in compound of formula I, II or III or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, or optionally substituted phenyl.
In one embodiment, in compound of formula I, II or III or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear alkyl, C3 branched alkyl, C3 cycloalkyl, or optionally substituted phenyl.
In one embodiment, in compound of formula I, II or III or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl.

13 In one embodiment, in compound of formula I, II or III or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear or C3 branched alkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R1 is an optionally substituted phenyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R1 is methyl, ethyl, n-propyl, i-propyl, cyclopropyl or optionally substituted phenyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R1 is methyl, ethyl, n-propyl, i-propyl or cyclopropyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is H.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is C1-3 linear alkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is C3 branched alkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is C3 cycloalkyl.
In one embodiment, in compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, R6 is H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is CH, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, or optionally substituted phenyl and R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is CH, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3

14 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is CH, R1 is C1-3 linear or C3 branched alkyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is CH, R1 is phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is CH, R1 is methyl, ethyl, n-propyl, i-propyl,cyclopropyl or optionally substituted phenyl and R6 is H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is N, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, or optionally substituted phenyl and R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is N, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl.
A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is N, R1 is R1 is C1-3 linear or C3 branched alkyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.

In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is N, R1 is phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, there is provided a compound of formula I, ll or III or a pharmaceutically acceptable salt or solvate thereof, wherein X is N, R1 is methyl, ethyl, n-propyl, i-propyl, cyclopropyl or optionally substituted phenyl I and R6 is H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl. A first sub-selection of the previous embodiment is, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, that each of these variable are H.
In one embodiment, in compound of formula I and II, R2, R3, R4 and R5 are H or an independently selected substituent as defined herein.
In any one of the above embodiment, when the compound (such as compound of formula I or II) comprises R2, R3, R4, R5, R7 and R8, each of these variable can be H.
In one embodiment, in compound of formula la R2, R3 and R5 are H or an halogen, preferably a F atom or preferably a H atom;
In one embodiment, in compound of formula la, each of R7 and R8 is independently selected from H, C1-3 alkyl or fluoride.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, C2-6 linear or branched alkenyl or aryl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, or optionally substituted phenyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear alkyl, C3 branched alkyl, C3 cycloalkyl, or optionally substituted phenyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear or C3 branched alkyl.

In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is an optionally substituted phenyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is methyl, ethyl, n-propyl, i-propyl, cyclopropyl or optionally substituted phenyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R1 is methyl, ethyl, n-propyl, i-propyl or cyclopropyl.
In one embodiment, in compound of formula la, IV or Iva or a pharmaceutically acceptable salt or solvate thereof, R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R6 is H.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R6 is C1-3 linear alkyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R6 is C3 branched alkyl .
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R6 is C3 cycloalkyl.
In one embodiment, in compound of formula la, IV or IVa or a pharmaceutically acceptable salt or solvate thereof, R6 is H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl.
In one embodiment, in compound of formula la, each of R7 and R8 is independently selected from H or C1-3 alkyl.
In one embodiment, in compound of formula la, each of R7 and R8 is independently selected from H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl.
In one embodiment, in compound of formula la, each of R7 and R8 is H.
In one embodiment, in compound of formula la or IV, a pharmaceutically acceptable salt or solvate thereof, R1 is C1-6 linear or C3-6 branched alkyl, C3-6 cycloalkyl, or optionally substituted phenyl and R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound formula la or IV comprises R2, R3, R5, R7 and R8, that each of these variable are H.
In one embodiment, in compound of formula la la or IV, or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound formula la or IV comprises R2, R3, R5, R7 and R8 that each of these variable are H.
In one embodiment, in compound of formula la or IV, or a pharmaceutically acceptable salt or solvate thereof, R1 is C1-3 linear or C3 branched alkyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl. A first sub-selection of the previous embodiment is, when the compound formula la or IV comprises R2, R3, R5, R7 and R8, that each of these variable are H.
In one embodiment, in compound of formula la or IV, or a pharmaceutically acceptable salt or solvate thereof, R1 is phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl.
A first sub-selection of the previous embodiment is, when the compound formula la or IV
comprises R2, R3, R5, R7 and R8, that each of these variable are H.
In one embodiment, in compound of formula la or IV, or a pharmaceutically acceptable salt or solvate thereof, R1 is methyl, ethyl, n-propyl, i-propyl,cyclopropyl or optionally substituted phenyl and R6 is H, methyl, ethyl, n-propyl, i-propyl or cyclopropyl. A first sub-selection of the previous embodiment is, when the compound formula la or IV comprises R2, R3, R5, R7 and R8, that each of these variable are H.
In one embodiment, in any compound, use or method defined herein, the compound is other than Me NO

The term "alkyl" represents an optionally substituted linear or branched hydrocarbon moiety having 1 to 10 carbon atoms. Examples of "alkyl" groups include but are not limited to methyl, ethyl, propyl, isopropyl, butyl, isobutyl, sec-butyl, tert-butyl, pentyl, isopentyl, neopentyl, tert-pentyl, hexyl, isohexyl or neohexyl. Lower alkyls represent a linear or branched moiety having 1 to 6 or preferably 1 to 3 carbon atoms.
The term "cycloalkyl" represents optionally substituted cyclic hydrocarbon moiety having 3 to 10 carbon atoms. Examples of "cycloalkyl" groups include but are not limited to cyclopropyl, cyclobutyl, cyclopentyl, and cyclohexyl. Lower cycloalkyls comprise 3 to 6 or preferably 3 carbon atoms.

The terms "alkenyl" and "alkynyl" represent optionally substituted linear or branched hydrocarbon moiety which has one or more double bonds or triple bonds in the chain. The number of carbon atoms can be the same as those in "alkyl" provided that there is at least 2 carbon atoms. Examples of alkenyl, and alkynyl groups include but are not limited to, ally!, vinyl, acetylenyl, ethylenyl, propenyl, isopropenyl, butenyl, isobutenyl, hexenyl, butadienyl, pentenyl, pentadienyl, hexenyl, hexadienyl, hexatrienyl, heptenyl, heptadienyl, heptatrienyl, octenyl, octadienyl, octatrienyl, octatetraenyl, propynyl, butynyl, pentynyl and hexynyl.
The terms "alkoxy," "alkenyloxy," and "alkynyloxy" represent an alkyl, alkenyl or alkynyl moiety, respectively, which is covalently bonded to the adjacent atom through an oxygen atom.
Examples include but are not limited to methoxy, ethoxy, propoxy, isopropoxy, butoxy, isobutoxy, sec-butoxy, tert-butoxy, pentyloxy, isopentyloxy, neopentyloxy, tert-pentyloxy, hexyloxy, isohexyloxy, trifluoromethoxy and neohexyloxy.
As used herein, amino include amino which are unsubstituted such as ¨NH2, or substituted with one or two C1-6alkyl or aryl such as ¨NH(C1_6a1ky1), ¨N(C1_6a1ky1)2, ¨N(C1_6a1ky1)(aryl) and ¨N
(aryl)2.
The term "aryl" represents an optionally substituted carbocyclic moiety containing at least one benzenoid-type ring (i.e., may be monocyclic or polycyclic). Examples include but are not limited to phenyl, tolyl, dimethylphenyl, aminophenyl, anilinyl, naphthyl, anthryl, phenanthryl or biphenyl. Preferably, the aryl comprises 6 to 10 or more preferably 6 carbon atoms.
The term "aryloxy" represents an aryl moiety, which is covalently bonded to the adjacent atom through an oxygen atom. Examples include but are not limited to phenoxy, dimethylphenoxy, aminophenoxy, anilinoxy, naphthoxy, anthroxy, phenanthroxy or biphenoxy.
The term "arylalkyl" represents an aryl group attached to the adjacent atom by an alkyl, alkenyl or alkynyl. Examples include but are not limited to benzyl, benzhydryl, trityl, phenethyl, 3-phenylpropyl, 2-phenylpropyl, 4-phenylbutyl and naphthylmethyl.
The term " arylalkyloxy" represents an arylalkyl moiety, which is covalently bonded to the adjacent atom through an oxygen atom. Examples include but are not limited to benzyloxy, benzhydroxy, trityloxy, phenethyloxy, 3-phenylpropoxy, 2-phenylpropoxy, 4-phenylbutoxy and naphthylmethoxy.
The term "heterocycle" represents a 3 to 11 membered optionally substituted saturated, unsaturated, partially saturated or aromatic cyclic moiety wherein said cyclic moiety is interrupted by at least one heteroatom selected from oxygen (0), sulfur (S) or nitrogen (N). Heterocycles may be monocyclic or polycyclic rings. Heterocycles may be 3 to 6 membered monocyclic ring or 5 to 6 membered monocyclic ring. Heterocycles may be 7 to 12 membered bicyclic ring or 9 to 10 membered bicyclic ring. Examples of heterocycles include but are not limited to azepinyl, aziridinyl, azetyl, azetidinyl, diazepinyl, dithiadiazinyl, dioxazepinyl, dioxolanyl, dithiazolyl, furanyl, isooxazolyl, isothiazolyl, imidazolyl, morpholinyl, morpholino, oxetanyl, oxadiazolyl, oxiranyl, oxazinyl oxazolyl, piperazinyl, pyrazinyl, pyridazinyl, pyrimidinyl, piperidyl, piperidino, pyridyl, pyranyl , pyrazolyl, pyrrolyl, pyrrolidinyl, thiatriazolyl, tetrazolyl, thiadiazolyl, triazolyl, thiazolyl, thienyl, tetrazinyl, thiadiazinyl, triazinyl, thiazinyl and thiopyranyl, furoisoxazolyl, imidazothiazolyl, thienoisothiazolyl, thienothiazolyl, imidazopyrazolyl, cyclopentapyrazolyl, pyrrolopyrrolyl, thienothienyl, thiadiazolopyrimidinyl, thiazolothiazinyl, thiazolopyrimidinyl, thiazolopyridinyl, oxazolopyrimidinyl, oxazolopyridyl, benzoxazolyl, benzisothiazolyl, benzothiazolyl, imidazopyrazinyl, purinyl, pyrazolopyrimidinyl, imidazopyridinyl, benzimidazolyl, indazolyl, benzoxathiolyl, benzodioxolyl, benzodithiolyl, indolizinyl, indolinyl, isoindolinyl, furopyrimidinyl, furopyridyl, benzofuranyl, isobenzofuranyl, thienopyrimidinyl, thienopyridyl, benzothienyl, cyclopentaoxazinyl, cyclopentafuranyl, benzoxazinyl, benzothiazinyl, quinazolinyl, naphthyridinyl, quinolinyl, isoquinolinyl, benzopyranyl, pyridopyridazinyl and pyridopyrimidinyl.
When heterocycle is a polycyclic ring, the rings comprise at least one ring comprising the heteroatom and the other rings may be cycloalkyl, aryl or heterocycle and the point of attachment may be on any available atom.
"Halogen atom" is specifically a fluorine atom, chlorine atom, bromine atom or iodine atom;
preferably the halogen is a fluoride.
The term "optionally substituted", "optionally substituent" or "substituent"
(such as for the definition of R2, R3, R4 and R5 herein above) represents at each occurance and independently, one or more halogen, amino, amidino, amido, azido, cyano, guanido, hydroxyl, nitro, nitroso, urea, OS(0)2Rm (wherein Rm is selected from C1-6alkyl, C6-10aryl or 3-10 membered heterocycle), OS(0)20Rn (wherein Rn is selected from H, C1-6alkyl, C6-10aryl or 3-10 membered heterocycle), S(0)20Rp (wherein Rp is selected from H, C1-6alkyl, C6-10aryl and 3-10 membered heterocycle), S(0)0_2Rq (wherein Rq is selected from H, C1-6alkyl, C6-10aryl or 3-10 membered heterocycle), OP(0)0RsORt, P(0)0RsORt (wherein Rs and Rt are each independently selected from H or C1-6alkyl), C1-6alkyl, C6-10aryl-C1-6alkyl, C6-10aryl, C1-6alkoxy, C6-10aryl-C1-6alkyloxy, C6-10aryloxy, 3-10 membered heterocycle, C(0)Ru (wherein Ru is selected from H, C1-6alkyl, C6-10aryl, C6-10aryl-C1-6alkyl or 3-10 membered heterocycle), C(0)0Rv (wherein Rv is selected from H, C1-6alkyl, C6-10aryl, C6-10aryl-C1-6alkyl or 3-10 membered heterocycle), NRxC(0)Rw (wherein Rx is H or C1-6alkyl and Rw is selected from H, C1-6alkyl, C6-10aryl, C6-10aryl-C1-6alkyl or 3-10 membered heterocycle, or Rx and Rw are taken together with the atoms to which they are attached to form a 3 to 10 membered heterocycle) or SO2NRyRz (wherein Ry and Rz are each independently selected from H, C1-6alkyl, C6-10aryl, C3-10heterocycle or C6-10aryl-C1-6alkyl).

In another embodiment, the term "optionally substituted", "optionally substituent" or "substituent"
preferably represents halogen, C1-6alkyl, C2-6alkenyl, C2-6alkynyl, C1-6 alkoxy, C2-6alkenyloxy, C2-6alkynyloxy, ¨NR4OR41, ¨C(0)NR4OR41, -NR4OCOR41, carboxy, azido, cyano, hydroxyl, nitro, nitroso, ¨0R40, ¨SR40, ¨S(0)0_2R40, ¨C(0)R40, ¨C(0)0R40 and ¨
SO2NR4OR41; wherein R40 and R41 are each independently H, C1-6alkyl, C2-6alkenyl or C2-6a1kynyl.
In still another embodiment, the term "optionally substituted", "optionally substituent" or "substituent" preferably represents halogen, C1-6alkyl, C2-6alkenyl, C1-6 alkoxy, ¨NR4OR41, ¨
C(0)NR4OR41, -NR4OCOR41, carboxy, hydroxyl, nitro, ¨SR40, ¨S(0)0_2R40, ¨C(0)R40, ¨
C(0)0R40 and ¨SO2NR4OR41; wherein R40 and R41 are each independently H, or C1-6alkyl.
The term "independently" means that a substituent can be the same or a different definition for each item.
As defined herein "subject" refers to both human and non-human subjects.
Preferably the subject is human. In some embodiments, the subject is a female (such as a human female).
The compounds as defined herein may include a chiral center which gives rise to enantiomers. The compounds may thus exist in the form of two different optical isomers, that is (+) or (-) enantiomers.
All such enantiomers and mixtures thereof, including racemic or other ratio mixtures of individual enantiomers, are included within the scope of the invention. The single enantiomer can be obtained by methods well known to those of ordinary skill in the art, such as chiral HPLC, enzymatic resolution and chiral auxiliary derivatization.
It will also be appreciated that the compounds in accordance with the present disclosure can contain more than one chiral centre. The compounds of the present invention may thus exist in the form of different diastereomers. All such diastereomers and mixtures thereof are included within the scope of the invention. The single diastereomer can be obtained by methods well known in the art, such as HPLC, crystalisation and chromatography.
There is also provided pharmaceutically acceptable salts of the compounds of the present disclosure. What is meant by the term pharmaceutically acceptable salts of the compounds is that they are derived from pharmaceutically acceptable inorganic and organic acids and bases.
For example, conventional non-toxic salts include those derived from inorganic acids such as hydrochloric, hydrobromic, sulfuric, sulfamic, phosphoric, nitric, perchloric and the like, as well as salts prepared from organic acids such as formic, acetic, propionic, succinic, glycolic, stearic, lactic, malic, tartaric, citric, ascorbic, pamoic, maleic, hydroxymaleic, phenylacetic, glutamic, benzoic, salicylic, sulfanilic, 2-acetoxy-benzoic, fumaric, toluenesulfonic, methanesulfonic, benzenesulphonic, naphthalene-2-sulphonic, ethane disulfonic, oxalic, isethionic, trifluoroacetic and the like.

Other acids, while not in themselves pharmaceutically acceptable, may be useful as intermediates in obtaining the compounds of the disclosure and their pharmaceutically acceptable acid addition salts. Salts derived from appropriate bases include alkali metal, alkaline earth metal or ammonium salts. The salt(s) must be "acceptable" in the sense of not being deleterious to the recipient thereof.
The pharmaceutically acceptable salts of the compounds of this disclosure can be synthesized from the compounds of this disclosure which contain a basic or acidic moiety by conventional chemical methods. Generally, the salts of the basic compounds are prepared either by ion exchange chromatography or by reacting the free base with stoichiometric amounts or with an excess of the desired salt-forming inorganic or organic acid in a suitable solvent or various combinations of solvents. Similarly, the salts of the acidic compounds are formed by reactions with the appropriate inorganic or organic base.
The term "solvate" means that a compound as defined herein incorporates one or more pharmaceutically acceptable solvents including water to give rise to hydrates.
The solvate may contain one or more molecules of solvent per molecule of compound or may contain one or more molecules of compound per molecule of solvent. Illustrative non-limiting examples of hydrates include monohydrate, dihydrate, trihydrate and tetrahydrate or semi-hydrate.
In one embodiment, the solvent may be held in the crystal in various ways and thus, the solvent molecule may occupy lattice positions in the crystal, or they may form bonds with salts of the compounds as described herein. The solvate(s) must be "acceptable" in the sense of not being deleterious to the recipient thereof. The solvation may be assessed by methods known in the art such as Loss on Drying techniques (LOD).
It will be appreciated by those skilled in the art that the compounds in accordance with the present disclosure can exist in several different crystalline forms due to a different arrangement of molecules in the crystal lattice. This may include solvate or hydrate (also known as pseudopolymorphs) and amorphous forms. All such crystalline forms and polymorphs are included within the scope of the disclosure. The polymorphs may be characterized by methods well known in the art. Examples of analytical procedures that may be used to determine whether polymorphism occurs include: melting point (including hot-stage microscopy), infrared (not in solution), X-ray powder diffraction, thermal analysis methods (e.g. differential scanning calorimetry (DSC) differential thermal analysis (DTA), thermogravimetric analysis (TGA)), Raman spectroscopy, comparative intrinsic dissolution rate, scanning electron microscopy (SEM).
When there is a sulfur atom present, the sulfur atom can be at different oxidation levels, ie. S, SO, or SO2. All such oxidation levels are within the scope of the present disclosure.
When there is a nitrogen atom present, the nitrogen atom can be at different oxidation levels, ie. N
or NO. All such oxidation levels are within the scope of the present disclosure.

In accordance with one embodiment, there is provided the uses, methods and compositions described herein wherein the compound is any compound as defined herein including any of compounds defined in formula I, ll and III.
The compounds provided herein may be useful in the treatment of a condition associated with a lowered functionality of the brown adipose tissue (also referred to as a dysfunction of the brown adipose tissue). As used herein, these conditions are commonly linked by the fact that the afflicted subjects has, proportionally, less brown adipose tissue or less activity associted with brown adipose tissue than a healthy subject. This condition can result from a reduction in function of the subject's brown adipose tissue or an insufficient/defective function of the subject brown adipose tissue. The compounds can be used to favor the conversion of white adipose tissue into beige/brite adipose tissue and/or increase the biological activity of the brown adipose tissue.
One of the conditions associated with a brown adipose tissue dysfunction is diabetes (e.g., type I
and type II diabetes). Other conditions associated with brown adipose tissue dysfunction is obesity and metabolic syndrome X. Metabolic syndrome is generally used to define a constellation of abnormalities that is associated with increased risk for the development of type ll diabetes and atherosclerotic vascular disease. Related conditions and symptoms include, but are not limited to, fasting hyperglycemia (diabetes mellitus type ll or impaired fasting glucose, impaired glucose tolerance, or insulin resistance), high blood pressure; central obesity (also known as visceral, male-pattern or apple-shaped adiposity), overweight with fat deposits mainly around the waist;
decreased HDL cholesterol; elevated triglycerides. Associated diseases can also include hyperuricemia, fatty liver (especially in concurrent obesity) progressing to non-alcoholic fatty liver disease, polycystic ovarian syndrome (in women), and acanthosis nigricans.
Other conditions that can benefit from a conversion of white adipose tissue to beige/brite adipose tissue or an increase in functionality of brown adipose tissue include, but are not limited to, metabolic syndrome and lipodystrophy.
The compounds provided herein can also be used as an additive to cell cultures, especially adipocyte and/or preadipocyte cell cultures, to promote the conversion of white adipose tissue to beige/brite adipose tissue and/or to maintain or increase the brown adipose tissue phenotype. The additive can be added to in vitro or ex vivo cell cultures, either punctually or for a pre-determined period of the cell culture. The additive can be added to primary cell culture or immortalized cell cultures.
In one embodiment, in a method or use as defined herein, the compound can be any compound as defined herein with the possible exception of any one of compounds i) to iv) as provided herein.
The proviso can be any of i) to iv) or a combination of said compounds thereof. For example, the method or use of a compounds defined herein for inhibiting ABHD6 in a subject in need thereof, is comprising a therapeutically effective amount of a compound I, ll or III or a pharmaceutically acceptable salt or solvate thereof, provided that it is other than compound i) and iv).
The excipient(s) for use in pharmaceutical compositions in accordance with the disclosure must be "pharmaceutically acceptable" in the sense of being compatible with the other ingredients of the formulation and not being deleterious to the recipient thereof.
In another embodiment, the present disclosure provides a combination comprising a therapeutically effective amount of a compound, as defined herein, and a therapeutically effective amount of at least one or more therapeutic agents useful in the method of the present disclosure.
It will be clear to a person of ordinary skill that if a further additional therapeutic agent is required or desired, ratios will be readily adjusted. It will be understood that the scope of combinations described herein is not particularly limited, but includes in principle any therapeutic agent useful for the prevention and treatment of deseases and conditions described herein. Also included as additional therapeutic agents are insulin or insulin conjugate or derivative or agents, other than those of the present disclosure, that increase or stimulates brown adipose tissue functionality and/or favor the conversion of white adipose tissue into beige, brite or brown adipose tissue.
Besides insulin and insulin conjugate, exemplary additional therapeutic agents include, but are not limited to metformin, TZD compounds (such as, for example rosiglitazone and pioglitazone), DPP4 inhibitors, and/or GLP1 analogues.
It will be appreciated that the amount of a compound of the description required for use in treatment will vary not only with the particular compound selected but also with the route of administration, the nature of the condition for which treatment is required and the age and condition of the patient and will be ultimately at the discretion of the attendant physician.
The desired dose may conveniently be presented in a single dose or as divided dose administered at appropriate intervals, for example as two, three, four or more doses per day.
The compounds can, for example, be administered orally, mucosally (including sublingual, buccal, rectal, nasal or vaginal administrations), parenterally (including subcutaneous injection, bolus injection, intrearterial, intravenous, intramuscular, intrasternal injection or infusion administrations techniques), by inhalation spray, transdermal, such as passive or iontophoretic delivery, or topical administration, in the form of a unit dosage of a pharmaceutical composition containing aneffective amount of the compound and conventional non-toxic pharmaceutically-acceptable carriers.
The formulations may, where appropriate, be conveniently presented in discrete dosage units and may be prepared by any of the methods well known in the art of pharmacy.
The methods for preparing a pharmaceutical composition can include the steps of bringing into association the compound as defined herein and pharmaceutically acceptable carriers and then, if necessary, shaping the product into the desired formulation, including applying a coating when desired.
Pharmaceutical compositions suitable for oral administration may conveniently be presented as discrete units such as capsules, cachets or tablets each containing a predetermined amount of the active ingredient; as a powder or granules; as a solution, a suspension or as an emulsion.
Tablets and capsules for oral administration may contain conventional excipients such as binding agents, fillers, lubricants, disintegrants, or wetting agents. The tablets may be coated according to methods well known in the art. Oral liquid preparations may be in the form of, for example, aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or may be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, emulsifying agents, non-aqueous vehicles (which may include edible oils), or preservatives.
The compounds may also be formulated for parenteral administration (e.g. by injection, for example bolus injection or continuous infusion) and may be presented in unit dose form in ampoules, pre-filled syringes, small volume infusion or in multi-dose containers with an added preservative. The compositions may take such forms as suspensions, solutions, or emulsions in oily or aqueous vehicles, and may contain formulatory agents such as suspending, stabilizing and/or dispersing agents. Alternatively, the active ingredient may be in powder form, obtained by aseptic isolation of sterile solid or by lyophilisation from solution, for constitution with a suitable vehicle, e.g. sterile water or saline, before use.
Compositions suitable for topical administration in the mouth include lozenges comprising the active ingredient in a flavoured base, usually sucrose and acacia or tragacanth; pastilles comprising the active ingredient in an inert base such as gelatin and glycerin or sucrose and acacia; and mouthwashes comprising the active ingredient in a suitable liquid carrier.
For administration by inhalation, the compounds and combinations as defined herein may take the form of a dry powder composition, for example a powder mix of the compound and a suitable powder base such as lactose or starch. The powder composition may be presented in unit dosage form in, for example, capsules or cartridges or e.g. gelatin or blister packs from which the powder may be administered with the aid of an inhalator or insufflator.
Further description of methods suitable for use in preparing pharmaceutical compositions for use in the present disclosure and of ingredients suitable for use in said compositions is provided in Remington's Pharmaceutical Sciences, 18(th) edition, edited by A. R.
Gennaro, Mack Publishing Co., 1990.
Table 1. Examples of compounds suitable for use in accordance with the present disclosure Compound # Structure Me I
N ..--- 0 go Me I
N..0 NI

ill 0 HN
Me -..,...... 4111 Ph I

_7., ill N 0o 0 4 41111 re iso 0 HN
Me Me I

N ,, =0 HN
'.........7 Compound # Structure NO

N

HN \Me Preparation of the Compounds of the Disclosure The compounds of the present disclosure can be prepared according to the procedures denoted in the following reaction Scheme. Examples or modifications thereof using readily available starting materials, reagents, and conventional procedures or variations thereof well-known to a practitioner of ordinary skill in the art of synthetic organic chemistry.
Specific definitions of variables in the Schemes are given for illustrative purposes only and are not intended to limit the procedures described.
The starting materials and reagents used in preparing these compounds generally are either available from commercial sources or are prepared by synthetic chemistry in accordance with methods described for example in as R. C. LaRock, Comprehensive Organic Transformations, 2nd edition Wiley- VCH, New York 1999; and Organic Reactions, Wiley & Sons:
New York, 1991, Volumes 1-40.
The compounds and or intermediates can be isolated and purified if necessary using known methods such as distillation, crystallization and chromatography.
The compounds of formula (1) and (2) depicted in scheme 1 below can be obtained from a commercial source or prepared in accordance with known synthetic chemistry methods. As illustrated in Scheme 1, a compound of formula (1) can be reacted with a proper "activating"
reagent to form compound of formula (1-1) in which L is a leaving group suitable for the following step such as a halogen (e.g. chloride) or hydroxysuccinimide. R10 can be ¨
(CO)NHR6' or a precursor thereof, wherein R6' is H, a protecting group or R6 as defined herein and R4 and R5 are as defined herein. Compound (1-1), with or without a prior step of isolation and purification, is reacted with a compound of formula (2) to provide a compound of formula (3). In compound of formula (2), X, R2, R3, R7 and R8 are as defined herein;
R1' is H, a protecting group or R1 as defined herein. The compound of formula (3) can optionally be deprotected and/or modified as required on substituents R1' and R10 to provide the compound of formula (I) however when compound of formula (3) represents a compound in which R1' is R1 and R10 is ¨(CO)NHR6, then no further chemical modification may be required except for the optional preparation of a salt of compound (I). A similar process could be used based on the use of compounds (1) and (2-1).
Scheme 1 General synthesis HO.,)/4 ___________________________________ 0 R4 7-1 R 1 0 (7\ R10 0 \

(1) (1-1) ey, eõA
I -I -R
11' X NH X
N

(2) (2-1) (1) + (2-1) R1' (1-1) + (2) R2 R4 __ C)R10 (3) 1 R5 (I) A particular selection of the compounds of the present disclosure is illustrated by formula (III) defined hereinbefore. The compounds of formula (1a) and (2a) depicted in scheme 2 below can be obtained from a commercial source or prepared in accordance with known synthetic chemistry methods. In this particular example, a compound of formula (la) can be reacted with a reagent of formula (4) in a suitable solvent (such as CH3CN) and in the presence of a base (such as Et3N) to provide the intermediate compound (1-1a). Compound (1-1a) or suitable alternative such as carbamyl chloride, with or without a prior step of isolation and purification, is reacted with a compound of formula (2a) to provide a compound of formula (III). In scheme 2, X, R1 and R6 are as defined herein. A particular example of such substituents is when R1 is a phenyl, a methyl or isopropyl; when R6 is H, a methyl or a cyclopropyl and X
is CH or N.

Scheme 2 s OH

(4) 0 (la) N
X

(2a) N
(1-1a) R6 N

(III) HN \ R6 The following examples are provided to further illustrate details for the preparation and use of the compounds of the present disclosure. They are not intended to be limitations on the scope of the instant disclosure in any way, and they should not be so construed.
Furthermore, the compounds described in the following examples are not to be construed as forming the only genus that is considered as the disclosure, and any combination of the compounds or their moieties may itself form a genus. Those skilled in the art will readily understand that known variations of the conditions and processes of the following preparative procedures can be used to prepare these compounds. All temperatures are in degrees Celsius unless noted otherwise.
V\M/L70 (corresponding to compound #1 in table 1 above) was obtained from Cayman Chemical Company. Orlistat was purchased from Sigma.

Abbreviations used in the description of the preparation of the compounds of the present disclosure:
AcOH = acetic acid;
Ac = acetyl;
AAC = area above the curve;
BW = body weight;
BAT = brown adipose tissue;
DMF = N,N-Dimethylformamide;
DSC = N,N'-Disuccinimidyl carbonate;
DMSO = Dimethyl sulfoxide;
Et = Ethyl;
EDCI = 1-ethyl-3-(3-dimethylaminopropyl) carbodiimide;
EE = energy expenditure;
HZ = heterozygote;
HOBt = Hydrox0enzotriazole;
HIEC = hyperinsulinemic euglycemic clamp;
ITT = insulin tolerance test;
KO = knock-out;
Me0H = Methanol;
OGTT = oral glucose tolerance test;
Ph = phenyl;
RER = respiration exchange ratio;
RT = Room temperature;
THF = Tetrahydofuran;
TLC = Thin layer chromatography;
TFA = trifluoroacetic acid;
WAT = white adipose tissue;
WT = wild-type.

4'-(Methylcarbamoyl)bipheny1-4-yIN-methyl-N-(3-(pyridin-4-yl)benzyl)carbamate (compound 2) ISye NO

CONHMe Step 1 CHO CHO
/¨ Pd(OAc)2 N )¨B(OH)2 Br N/ *
i-PrOH/H20 (20/1) Na2CO3, 80 C
Into a 2 L 3-necked round-bottom flask, purged and maintained with an inert atmosphere of nitrogen, was placed a solution of pyridin-4-ylboronic acid (30 g, 244 mmol, 1 equiv) in 2-propanol/water (800/40 mL), Na2CO3(77.3 g, 729 mmol, 3 equiv), Pd(OAc)2 (5.46 g, 24.3 mmol, 0.1 equiv), PPh3 (12.75 g, 48.7 mmol, 0.2 equiv) and 3-bromobenzaldehyde (45 g, 243 mmol, 1 equiv). The mixture was stirred for 48 h at 80 C in an oil bath. Then the solids were filtered out and the filtrate was concentrated under vacuum. The residue was purified by column chromatography on silica gel (eluting with 1:1 ethyl acetate/petroleum ether) to give 30 g of 3-(pyridin-4-yl)benzaldehyde as orange oil.
Step 2 CHO NHMe N/ * + MeNH2 NaBH,CN N/
Me0H, 60 C
Into a 250 mL round-bottom flask was placed a solution of 3-(pyridin-4-yl)benzaldehyde (10 g, 54.6 mmol, 1 equiv) in Me0H (200 mL), NaBH3CN (10.33 g, 164 mmol, 3 equiv) and CH3NH2.HCI (18.44 g, 273 mmol, 5 equiv). The mixture was stirred overnight at 60 C. The solvents were removed under reduced pressure. The residue was added to 100 mL
of H20 and extracted with 5x200 mL of ethyl acetate. After removal of solvent, the crude product was purified by re-crystallization from ethyl acetate to give 5 g of N-methyl-(3-(pyridin-4-yl)phenyl)methylamine as a white solid.

Step 3 CH3NH2, HOBt, EDCI
HO * CO2H _______________ HO CONHMe Et,N, THF, RT
Into a 50-mL round-bottom flask was placed a solution of 4-(4-hydroxphenyhbenzoic acid (1 g, 4.7 mmol, 1 equiv) in tetrahydrofuran (20 mL), methylamine hydrochloride, (0.409g 6 mmol, 1.3 equiv), EDCI (1.18 g, 6.2 mmol, 1.3 equiv), HOBt (0.74 g, 5.5 mmol, 1.2 equiv), and triethylamine (2 mL). The resulting solution was stirred overnight at room temperature. The solids were filtered out. The resulting mixture was concentrated under vacuum.
The residue was purified by column chromatography on silica gel (eluting with 15:2 ethyl acetate/petroleum ether) to give 4-(4-hydroxyphenyI)-N-methylbenzamide as a white solid.
Step 4 DSC, Et3N 0 P-4C
HO * * CONHMe¨x- CHCN, RT * CONHMe , 0 Into a 50 mL round-bottom flask was placed a solution of 4-(4-hydroxpheny1)-N-methylbenzamide (682 mg, 3 mmol, 1 equiv) in CH3CN (35 mL), Et3N (610 mg, 6.04 mmol, 2 equiv) and DSC (4.65 g, 18.2 mmol, 6 equiv). The resulting solution was stirred for 10 minutes at room temperature and it was monitored by TLC. When the reaction was complete, the reaction mixture was diluted with 100 mL of ethyl acetate, washed with 3x30 mL
of 5% citric acid. The organic layer was washed with 20 mL of brine, dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The resulting crude product was used as such in the next step.
Step 5 NHMe 0 / ye t 0 94 1)1 0 * =
CONHMe N ______________________________________________ N(0 0 Et,N, CH2Cl2, RT Ni 8 110 CONHMe Into a 100 mL round-bottom flask was placed a solution of succinimidyl carbonate derivative from Step 4 (958 mg, 2.6 mmol, 1 equiv), Et3N (260 mg, 2.57 mmol, 1 equiv) and N-methyl(3-(pyridin-4-yl)phenyl)methanamine from step 2 (510 mg, 2.58 mmol, 1 equiv) in dichloromethane (35 mL). The reaction mixture was stirred overnight at room temperature. The solid were filtered out. The filtrate was concentrated under vacuum. The crude product was purified by Prep-HPLC
with the following conditions (1#-Pre-HPLC-006 (Waters)): Column, 1#-PrepC-015 (Atlantis T3 19*150 186003698 011639092113 01); mobile phase, WATER with 0.05%TFA and CH3CN

(10% up to 76% in 13 min); Detector, UV 254 nm. The title compound was obtained as a white solid.
1H-NMR (400MHz, CDCI3, ppm) 6: 3.09 (3H, d), 3.15 (3H, s, rotamer 1), 3.50 (3H, s, rotamer 2), 4.69 (2H, s, rotamer 2), 4.80 (2H, s, rotamer 1), 6.22 (1H, d), 7.21-7.26 (2H, m), 7.56-7.70 (8H, m), 7.79-7.86 (4H, m), 8.75 (2H, d).
MS (ES, m/z): [M +H] 452 4'-Carbamoylbipheny1-4-yIN-phenyl-N-(4-(pyridin-4-yl)benzyl)carbamate, trifluoroacetate salt (compound 3) y Step 1 CHO N H Ph = NH2 NaBH,CN
N\ 411 N
DMF/AcOH (10/1) Into a 50-mL round-bottom flask, was placed a solution of 3-(pyridin-4-yl)benzaldehyde from Example 1 Step 1(2 g, 10.9 mmol, 1 equiv) in DMF/AcOH (20/2 mL), aniline (1.02 g, 11.0 mmol, 1 equiv) and NaBH3CN (2.62 g, 41.6 mmol, 4 equiv). The resulting solution was stirred 2h at 110 C. The reaction was then quenched by the addition of 30 mL of water.
The resulting solution was extracted with 30 mL of ethyl acetate, dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. The residue was purified by column chromatography on silica gel (eluting with 1:1 ethyl acetate/petroleum ether) to give N-(3-(pyridin-4-yl)benzyl)benzenamine as light yellow oil.

Step 2 NH3, HOBt, ECG!
CO ________________________________________ HO * 2H 3. THF RT HO * * CONH, , Into a 50-mL round-bottom flask was placed tetrahydrofuran saturated with NH3 (gas) (20 mL), 4'-hydroxybipheny1-4-carboxylic acid (1 g, 4.67 mmol, 1 equiv), HOBt (900 mg, 6.67 mmol, 1.4 equiv), EDCI (1.34 g, 7.0 mmol, 1.5 equiv). The resulting solution was stirred for 4 hrs at room temperature. The resulting mixture was concentrated under vacuum. The residue was dissolved in 50 mL of ethyl acetate, washed with 2x40 mL of H20, 1x50 mL of brine, dried over anhydrous sodium sulfate and concentrated under vacuum. The reside was purified by column chromatography on silica gel (eluting with 1:1 ethyl acetate/petroleum ether) to give 500 mg (50%) of 4'-hydroxybipheny1-4-carboxamide as a white solid.
Step 3 ,o4 HO =
CONH _________________________ CI4, 0=

* CONH, THF, RT
To a solution of triphosgene (1.8 g, 6.1 mmol, 2 equiv) in dichloromethane (15 mL) was added pyridine (2.5 mL) at - 30 C .The reaction mixture was stirred for 15 min and a solution of 4'-hydroxylbipheny1-4-carboxamide (658 mg, 3.08 mmol, 1 equiv) in dichloromethane (10 mL) was added. Then reaction mixture was warmed up to RT and stirred for 2 hours. The reaction was quenched by the addition of 10 mL of hydrogen chloride aqueous solution (1N).
The resulting solution was extracted with 100 mL of dichloromethane. The organic phase was dried over anhydrous sodium sulfate, filtered and concentrated under vacuum. 4'-(carbamoyl)bipheny1-4-hydroxycarbamic chloride was obtained as a brown oil.
Step 4 NHPh 0 ph CINO
0 CONH, N\
________________________________________ N 0 Into a 50 mL round-bottom flask, was placed a solution of the carbamic chloride from Step 3 (345 mg, 1.25 mmol, 1 equiv), N-(3-(pyridin-4-yl)benzyl)benzenamine from Step 1 (325 mg, 1.25 mmol, 1 equiv), potassium carbonate (344 mg, 2.49 mmol, 2.00 equiv) and DMF
(15 mL). The reaction mixture was stirred for 3 hours at 110 C. The reaction was then quenched by the addition of 10 mL of water. The resulting solution was extracted with 2x25 mL
of ethyl acetate.
The organic layers were combined, washed with 2x10 mL of brine, dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product (1.0 g) was purified by Prep-HPLC
with the following conditions (1#-Pre-HPLC-016 (Waters)): Column, SunFire Prep C18, 19*150mm Sum; mobile phase, WATER with 0.05%TFA and CH3CN (5% CH3CN up to 36%
in 27 min, up to 100% in 0.1 min, hold 100% in 1.9 min, down to 5% in 0.1 min, hold 5% in 1.9 min); Detector, UV 254 nm. The trifluoroacetate salt of the title compound was obtained as a white solid.
1H-NMR (300MHz, DMSO-d6, ppm) 6: 5.15 (2H, s), 7.29-7.39 (3H, m), 7.42-7.50 (4H, m), 7.59-7.61 (2H, m), 7.75-7.78 (4H, m), 7.84-8.12 (7H, m), 8.87 (2H, d).
MS (ES, m/z): 500[M +H]

4'-(Methylcarbamoyl)bipheny1-4-yIN-methyl-N-(3-phenylbenzyl)carbamate (compound 4) ,e = NO

CONHMe Step 1 CHO NHMe NaBH CN
41 = + MeNH2 3*
Me0H, 60 C
Into a 250-mL round-bottom flask was placed methanol (100 mL), acetic acid (42 mL), Biphenylcarboxaldehyde (7.96 g, 43.7 mmol, 1 equiv), methylamine in anhydrous ethanol (20 g, 193.2 mmol, 4.4 equiv), and NaBH3CN (8.3 g, 132.1 mmol, 3 equiv). The solution was stirred overnight at 60 C. The resulting solution was diluted with 200 mL of water and extracted with 3x200 mL of ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (1/10) to give N-methyl (3-biphenyl)methylamine as a colorless oil.
Step 2 NHMe b0 afr = ryo tn/L 0o = CONHMe Et,N, CH2C12, R-13".
CONHMe Into a 100-mL round-bottom flask was placed a solution of 4-[4-(methylcarbamoyl)phenyl]phenyl 2,5-dioxopyrrolidin-1-y1 carbonate from Example 1 Step 4 (560 mg, 1.5 mmol, 1 equiv) in dichloromethane (40 mL), N-methyl (3-biphenyl)methylamine (301 mg, 1.5 mmol, 1 equiv) and triethylamine (153 mg, 1.5 mmol, 1 equiv). The resulting solution was stirred overnight at room temperature. The reaction mixture was washed with 2 x 20 mL of water and dried over anhydrous sodium sulfate. The resulting mixture was concentrated under vacuum.
The crude product (650 mg) was purified by Prep-HPLC with the following conditions (1#-Pre-HPLC-002(Agilent)): Column, SunFire Prep C18, 19150mm Sum; mobile phase, water and acetonitrile (10.0% acetonitrile up to 80.0% in 10 min, up to 100.0% in 1 min, down to 10.0% in 2 min);
Detector, uv 220 & 254nm. The title compound was obtained as a white solid.
1H-NMR (400MHz, DMSO-d6, ppm) 6: 2.81 (3H, d), 2.98 (3H, s, rotamer 1), 3.08 (3H, s, rotamer 2), 4.60 (2H, s, rotamer 2), 4.74 (2H, s, rotamer 1), 7.22 (1H, d), 7.29 (1H, d), 7.33-7.41 (2H, m), 7.47-7.55 (3H, m), 7.61 (2H, broad s), 7.67 (2H, d), 7.76 (4H, broad d), 7.92 (2H, d), 8.49 (1H, d).
MS (ES, m/z): [M +1-1] 451 4'-(Cyclopropylcarbamoyl)biphenyl-4-yIN-methyl-N-(3-(pyridin-4-yl)benzyl)carbamate (compound 5) Me 1 Ny0 401 Step 1 1>-NH2, HOBt, EDC1 HO * CO2H ______________ HO * * CON1-H<
Et,N, THF, RT
Into a 25-mL round-bottom flask was placed tetrahydrofuran (10 mL), cyclopropylamine (0.45 mL, 6.5 mmol, 1.4 equiv), 4-(4-Hydroxyphenyl)benzoic acid (1 g, 4.67 mmol, 1 equiv), HOBt (900 mg, 6.66 mmol, 1.43 equiv), EDC1.1-1C1 (1.34 g, 6.99 mmol, 1.5 equiv) and the solution was stirred overnight at room temperature. The reaction mixture was diluted with 30 mL of brine and extracted with 4 x 30 mL of ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in N-cyclopropyl 4-(4-hydroxyphenyl)benzamide as a white solid.
Step 2 DE E t N 0 04 HO 411 * CONH¨<tl\/L 0 * = CONH¨<
CH,CN, RT 0 Into a 100-mL round-bottom flask was placed a solution of N-cyclopropyl 4-(4-hydroxyphenyl)benzamide (500 mg, 1.97 mmol, 1 equiv) in CH3CN (60 mL), DSC (3 g, 11.71 mmol, 5.9 equiv), and triethylamine (400 mg, 3.95 mmol, 2 equiv). The resulting solution was stirred for 10 min at room temperature and was then diluted with 200 mL of ethyl acetate. The organic phase was washed with 2 x 100 mL of citric acid (5 /0) , 1 x 50 mL of water, dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in 0.6 g (crude) of 4-[4-(cyclopropylcarbamoyl)phenyl]phenyl 2,5-dioxopyrrolidin-1-y1 carbonate as a white solid.
Step 3 NHMe /0 N"" Me Me 0 P4 r/L 0 * CONH¨< _______________ 1 N O
=
0 Et,N, CH2Cl2, RT N 0 10 CONH¨<
Into a 100-mL round-bottom flask was placed a solution of 4-[4-(cyclopropylcarbamoyl)phenyl]phenyl 2,5-dioxopyrrolidin-1-y1 carbonate (600 mg, 1.52 mmol, 1.00 equiv) in dichloromethane (40 mL), N-methyl ([[3-(pyridin-4-yhphenyl]methylpamine (301 mg, 1.52 mmol, 1.00 equiv) and triethylamine (153 mg, 1.51 mmol, 0.99 equiv).
The resulting solution was stirred overnight at room temperature. The reaction mixture was washed with 2 x 20 mL of water and dried over anhydrous sodium sulfate. The resulting mixture was concentrated under vacuum. The crude product (650 mg) was purified by Prep-HPLC with the following conditions (1#-Pre-HPLC-002(Agilent)): Column, SunFire Prep C18, 19150mm Sum;
mobile phase, water and acetonitrile (10.0% acetonitrile up to 80.0% in 10 min, up to 100.0% in 1 min, down to 10.0% in 2 min); Detector, uv 220 & 254nm. The title compound was obtained as a white solid.

1H-NMR (400MHz, DMSO-d6, ppm) 6: 0.59 (2H, broad s), 0.71 (2H, broad s), 2.87 (1H, broad s), 2.98 (3H, s, rotamer 1), 3.09 (3H, s, rotamer 2), 4.62 (2H, s, rotamer 2), 4.76 (2H, s, rotamer 1), 7.22 (2H, dd), 7.46 (1H, m), 7.57 (1H, broad s), 7.75 (8H, broad m), 7.92 (2H, broad d), 8.48 (1H, s), 8.66 (2H, s).
MS (ES, m/z): [M +H] 478, [M +Na] 500 4'-(Methylcarbamoyhbipheny1-4-yIN-i-propyl-N-(3-(pyridin-4-yl)benzyl)carbamate (compound 6) SI Ny0 40 CONHMe Step 1 CHO
NaBH,CN
N/ 411 __________________ 3". N/
H2N Me0H, 60 C
Into a 250-mL round-bottom flask was placed methanol (100 mL), acetic acid (42 mL), 3-(pyridin-4-yl)benzaldehyde from Example 1 Step 1 (8 g, 43.7 mmol, 1 equiv), isopropylamine (16.5 mL, 192 mmol, 4.4 equiv), and NaBH3CN (8.3 g, 132 mmol, 3 equiv). The solution was stirred overnight at 60 C. The resulting solution was diluted with 200 mL of water and extracted with 3x200 mL of ethyl acetate. The organic phase was dried over anhydrous sodium sulfate and concentrated under vacuum. The residue was applied onto a silica gel column with ethyl acetate/petroleum ether (1/10). N-isopropyl (3-(pyridin-4-yhphenylmethylpamine was obtained as a white solid.
Step 2 ,04 Pyridine, CH2Cl2, -30 C ¨

Into a 50-mL 3-necked round-bottom flask, purged and maintained with an inert atmosphere of nitrogen, was placed a solution of triphosgene (660 mg, 2.22 mmol, 2 equiv) in dichloromethane (10 mL). This was followed by the addition of pyridine (1.5 mL) at ¨ 30 C .
The mixture was stirred 15 min. To this was added a solution of N-isopropyl 3-(4-pyridinyl)phenylmethylamine (256 mg, 1.13 mmol, 1 equiv) in dichloromethane (5 mL) at -30 C. The resulting solution was stirred for 90 min at -30 C. The reaction was then quenched by the addition of 5 mL of hydrochloric acid (1 N). The resulting solution was extracted with 20 mL of dichloromethane.
The combined organic layers were dried over anhydrous sodium sulfate and concentrated under vacuum. This resulted in crude N-[3-(4-pyridinyl)phenylmethyI]-N-isopropylcarbamoyl chloride as light yellow oil.
Step 3 N HO 40 CONHMe YNr0 NI \ * 0 ______________ 1.- I
8 ir Et,N, DMAP, CH2Cl2 N
0 C to RT
CONHMe Into a 50-mL round-bottom flask was placed a solution of N-[3-(4-pyridinyhphenylmethyl] N-isopropylcarbamoyl chloride (310 mg, 1.07 mmol, 1 equiv) in dichloromethane (15 mL), 4-(4-hydroxypheny1)-N-methylbenzamide from Example 1 Step 3 (291 mg, 1.28 mmol, 1.2 equiv) and triethylamine (216 mg, 2.13 mmol, 2 equiv). The resulting solution was stirred overnight at room temperature. The reaction was then quenched by the addition of 10 mL of water.
The resulting solution was extracted with 20 mL of dichloromethane. The organic layer was dried over anhydrous sodium sulfate and concentrated under vacuum. The crude product was purified by Prep-HPLC with the following conditions (1#-Pre-HPLC-002(Agilent)): Column, Xbridge Prep C18, Sum, 19*150mm; mobile phase, water and CH3CN (45.0% CH3CN up to 75.0% in 10 min, hold 100.0% in 1 min, hold 45.0% in 2 min); Detector, uv 220 &254 nm. The title compound was obtained as a white solid.
1H-NMR (400MHz, DMSO-d6, ppm) 6: 1.21 (6H, broad s), 2.80 (3H, d), 3.33 (3H, d), 4.36 (1H, broad m), 4.65 (2H, broad d), 7.15 (1H, d), 7.31 (1H, broad s), 7.45-7.65 (2H, m), 7.65-7.85 (8H, m), 7.91 (2H, d), 8.49 (1H, broad s), 8.65 (2H, d).
MS (ES, m/z): [M +H] 480, [M +Na]' 502 EXAMPLE 6 ¨ INHIBITION OF ABHD6 AND DAGL

INS 832/13 8-cell extracts (whole cell) were prepared by sonication in Krebs-Ringer Buffer, pH7.4. Both ABHD6 and DAGL enzymes were assayed in a single incubation, with separate substrates. Cell extract, 10 1.1g was incubated in a final volume of 50111 with 50 uM 1,2-dioleoylglycerol (substrate for DAGL) and 50 M 1-palmitoylglycerol (substrate for ABHD6).
Incubations were for 60 min at 30 C and then the released fatty acids (oleate or palmitate) due to hydrolysis were extracted (Dole's extraction) and separated by HPLC (Mehta et al. Journal of Chromatography B, 719 (1998) pp9-23) after derivatization by phenacylbromide.
Quantification of oleate and palmitate released gave the activities of DAGL and ABHD6, respectively.
Incubations contained indicated compounds at 10 1.1M (or as shown) concentration. V\M/L70 was used as a positive control for ABHD6 inhibition and orlistat (ORL) was used as a control for total lipase inhibition. Under the incubation conditions used, less than 1-2% of the added substrate was used up by either of the enzymes. The results are summarized in Table 2 below (in Example 7).

Materials. Cell culture supplies were from Corning (Corning, NY) and Fisherbrand (Canada).
V\M/L70 was dissolved in dimethylsulfoxide (DMSO) before their use in insulin secretion experiments. PaImitate sodium salt was from Nu-Check Prep (Elysian, MN) and bicinchoninic acid protein assay kit from Pierce (Rockford, IL) was used. Stock unlabelled palmitate was prepared at 4 mM in 5% defatted BSA as described elsewhere (Roduit et al.
Diabetes (2004) 53 pp1007-1019,).
Cell culture. IN5832/13 cells (Hohmeir et al. Diabetes (2000) 49 pp424-430,) were cultured at 37 C in a humidified atmosphere containing 5% CO2 in RPM! 1640 with sodium bicarbonate, supplemented with 10% (v/v) fetal calf serum (Wisent), 10 mM HEPES, pH 7.4, 2 mM L-glutamine, 1 mM sodium pyruvate and 50 pM p-m e rca ptoet h a n o I (complete RPM I). Cells were grown to 80% confluence. Media were changed to RPM! 1640 containing 3 mM
glucose supplemented as the complete RPM! 24 h prior to the experiments. Insulin secretion incubations were conducted in Krebs-Ringer bicarbonate buffer containing 10 mM HEPES, pH
7.4 (KRBH).
Insulin secretion measurement. IN5832/13 cells were washed in KRBH containing 1 mM
glucose and 0.5% defatted BSA (KRBH 1G/0.5%BSA) and pre-incubated for 45 min in KRBH
1G/0.5%BSA in presence of pharmacological agents (at indicated concentrations) or vehicle (DMSO). For examining the effect of V\ANL70 (an inhibitor of ABHD6), other compounds identified in table 1, and/or orlistat (lipase inhibitor), the compounds were added first in pre-incubation media and then during incubation at 1 to 20 pM concentration (see Table 2) at 2 mM
and 10 mM glucose. Insulin secretion from IN5832/13 cells was measured from 2-h static incubations in KRBH containing various glucose concentrations, 0.5% defatted BSA and pharmacological agents or vehicle (DMSO), with or without 35 mM KCI or 0.3 mM
palmitate, as specified (see Peyot et al., 2009). The experiments were done 3 times, with triplicates of each measurement.
Table 2 Compound Conc Insulin secretion ABHD6 DAGL
(PM) ( /0 content) Inhibition Inhibition % %
Control 0 1.95 0 0 1 2 3.22 nd nd 3.97 nd nd 6.03 95 0 2 2 2.25 nd nd 5 3.70 nd nd 10 6.08 98 0 3 2 2.00 nd nd 5 2.10 nd nd 10 3.05 90 0 4 2 3.05 nd nd 5 3.65 nd nd 10 3.82 70 0 5 2 2.01 nd nd 5 2.05 nd nd 10 3.56 60 10 6 2 3.10 nd nd 5 3.98 nd nd 10 5.88 95 0 nd = not determined 5 EXAMPLE 8 ¨ IN VIVO EXPERIMENT
In this experiment, CD1 strain mice were injected once with streptozotocin (100 mg/kg body wt) to induce mild diabetes. After 4 weeks, the mice were fasted overnight and oral glucose tolerance test (OGTT) was done. Half the animals (5) received ABHD6 inhibitor, V\M/L70 for the three days prior to OGTT, daily, intraperitoneally (at 5mg/kg body weight) and the other half received only vehicle. For OGTT, glucose was given by gavage (2g / kg body wt), followed by blood collection at indicated time points (on the graph) for the analysis of blood glucose (by glucometer) and plasma insulin (by ELISA).
The results (see Figures 1 and 2) show that mice that received compound 1 (V\M/L70) were able to control their blood glucose levels better than the mice which were given vehicle. This is related to the increase in plasma insulin levels in mice that received compound 1, indicating that the compound increases insulin secretion in the presence of glucose and thus able to control glycemia.
EXAMPLE 9¨ MODULATION OF ABHD6'S ACTIVITY ON INSULIN SENSITIVITY AND
BROWN ADIPOSE TISSUE FUNCTIONALITY
Generation and maintenance of whole body ABHD6-K0 mice. All procedures involving animal studies were approved by the Institutional Committee for the Protection of Animals. All mice used in this study were of C57616N genetic background. Generation of whole body ABHD6 KO
mice (pure C57616N background) was described before (Zhao et al., 2014). The mice were maintained individually caged on a standard chow diet (Teklad Global 18%
protein rodent diet;
Harlan Teklad, Madison, WI, 15% fat by energy) and 12-hour dark/light cycle at 21 C with free access to water.
Metabolic studies on high fat diet fed ABHD6-K0 mice. Male and female wild type (WT), homozygous ABHD6 KO (KO) and heterozygous (HZ) mice at 5 weeks age were placed on chow diet or high fat diet (HFD; Bio-Ser Diet #F3282, Frenchtown, NJ, 60% fat by energy) for 8 weeks (Peyot et al., 2010). Body weight and food intake were monitored each week. At the end of feeding regimen, mice were placed in metabolic cages (Comprehensive Laboratory Animal Monitoring System, Columbus Instruments, Columbus, OH, USA) individually, for three days and oxygen consumption (V02), carbon dioxide production (VCO2), respiratory exchange ratio (RER), locomotor activity and energy expenditure by indirect calorimetry were monitored.
Energy expenditure was expressed as a function of metabolic mass (lean mass +
0.2 x fat mass) as suggested before (Even et al., 2012). Results from the last 24 h (after 48 h acclimatization) were used for calculations. The mice were allowed to recover for 2 days following CLAMS studies and lean and fat mass were determined by Echo Magnetic Resonance Imaging (Ech0MRITm-700; EchoMRI LLC, Houston, TX). Then oral glucose tolerance test was performed on these mice as described below.
Hyperinsulinemic euglycemic clamp (HIEC), oral glucose tolerance test (OGTT) and insulin tolerance test (I7-7). Male and female wild type (WT), homozygous ABHD6 KO
(KO) and heterozygous (HZ) mice on chow diet (for 12 weeks) or HFD (for 10 weeks) were used for OGTT and ITT as described as before (Zhao et al., 2014). HIEC was done on male ABHD6-KO, HZ and WT mice after 10 weeks of HFD feeding (Zhao et al., 2014). During HIEC, mice were given a bolus insulin infusion (0.75U insulin/ kg body weight), followed by insulin infusion at 5 mU/ kg/ min and the glycemia was clamped at 8 mM. Glycemia were measured every 30 min for 2h and glucose infusion rate (GIR) was calculated as an index of insulin sensitivity during the last 30 min of the clamp. For OGTT, food was withdrawn in the morning from 7:00 to 13:00, and the mice were given 2 g glucose/ kg body weight orally and blood collected from tail was analyzed for glucose and insulin levels at indicated time points.
Intraperitoneal insulin tolerance test (IP-ITT) was performed in conscious mice in the afternoon under fed conditions. Insulin was administered intraperitoneally at a dose of 0.75U/ kg BW. Blood was collected from tail at 0, 15, 30, 45, 60 and 90 min and glycemia was monitored.
Cold-induced thermogenesis. Female ABHD6 KO and WT mice were maintained on HFD
for 12 weeks. Then the mice were placed in individual cages (temperature equilibrated) in the cold room (4 C). Rectal temperature was monitored with a probe prior to cold exposure and at indicated time points during cold exposure for 3h.
Pair-feeding of ABHD6 KO and WT mice on high fat diet. Male ABHD6 KO and WT
mice were kept in individual cages and were fed HFD for 2 weeks. In order to examine the influence of food intake on glucose homeostasis, WT mice were pair-fed with the ABHD6 KO
mice. Daily food intake was measured and the WT mice were given each day the same amount (average) of food consumed by the ABHD6 KO mice on the previous day. Body weights were monitored each day and after two weeks, OGTT and ITT were performed on these mice and sacrificed.
Metabolic measurements in CLAMS could not be done as the system does not provide for pair-feeding during the period the mice are in metabolic cages.
PPARa antagonist treatment of ABHD6 KO mice on HFD. Female ABHD6 KO and WT
mice (5 wk old) were kept on HFD ad libitum, for 8 weeks. The mice were given PPARa antagonist GW6471 once every two days (1 mg/ kg BW; dissolved in ethanol: Tween 80:
saline = 1:1:8) or vehicle, intraperitoneally. The drug or vehicle treatments were done on alternate days during the HFD feeding period. After 8 weeks the mice were placed in the metabolic cages at 30 C
(CLAMS). Two days after acclimatization, respiratory exchange ratio, energy expenditure and locomotor activity were recorded at thermoneutral conditions. Then the mice were removed from metabolic cages and their len and fat mass were measured by EchoMRI and after acclimatization to normal room temperature conditions, their glucose tolerance and insulin sensitivity were assessed by OGTT and ITT, respectively, as described above.
Then the mice were sacrificed and visceral, inguinal and brown fat tissues were isolated and analyzed for browning gene expression.
Behavioral testing. Behavior tests for assessing anxiety (elevated plus maze and open field tests) and depression (forced swimming test) were conducted on both male and female ABHD6 KO and \ATT mice (8-10 weeks old), on normal chow diet, as described before (Sharma et al., 2013). These tests were conducted in three consecutive days on the same group of mice. First, elevated plus maze test was done followed by open field test on the second day, and forced swimming test on the third day.
Treatment of 45% fat diet fed mice with ABHD6 inhibitor, WWL70. Male mice (6-8 wk old) were fed 45% fat diet (-45% of energy as lard (contains fatty acids, 16:0 = 23.3%, 18:0 = 15.9%, 18:1 = 34.8%, 18:2 = 18.7%), for 8 weeks. One group of mice received V\M/L70 at 10 mg/kg BW/day, intraperitoneally and the control mice were given vehicle. At the end of feeding period, mice were sacrificed and visceral fat was removed and processed for UCP1 immunohistochemistry.
Visceral fat tissue was also processed for measuring the expression of adipose browning related genes by RT-PCR, as described below.
Blood/ plasma analyses. Glycerol, non-esterified fatty acids (NEFA), triglycerides (TG) and cholesterol ester (CE) were measured using commercially available kits in plasma from chow diet or HFD- fed mice in fed state. Plasma adipokines were measured using Mouse Adipokine Antibody Array (Catalog# ARY013; R & D Systems, Minneapolis, MN).
RNA extraction and real-time RT-PCR. Total RNA was extracted using kit from Invitrogen and after quantification, 2 pg RNA was used for cDNA synthesis. Primers for different genes are described in Table 3.
Table 3. Description of the primers used in this example for the RT-PCR
assays.
Target Nucleotide sequence SEQ ID NO:
Beta actin CAT GGA TGA CGA TAT CGA TCG

GTA CGA CCA GAG GCA TAC AGG

h ABHD6 TGT GGT CAA GTT CCT TCC AAA

-TTG TTC AGC TTC AGG CAT TCT

GAA CCA TGA AGC CAA CGA CT

mC0X8b GCG AAG TTC ACA GTG GTT CC

CAG CGT CAT GGT CAG TCT GT

mC0X7a1 AGA AAA CCG TGT GGC AGA GA

CAG CAC GGT GAA GCC ATT C

mPRDM16 GCG TGC ATC CGC TTG TG

CGT GCA GAA CTC CTG TGA TAA C

mCD37 GTC CAC CTA TGC TGG AGA AGG

TGC TCT TCT GTA TCG CCC AGT

mCidea GCC GTG TTA AGG AAT CTG CTG

CAG CGT CAT GGT CAG TCT GT

15 mC0X7b1 AGA AAA CCG TGT GGC AGA GA

16 GGC AGG CAG ACG AAT GTT C

17 mTBX1 TTG TCA TCT ACG GGC ACA AAG

18 ACC CTG TCA TCC CAC AGA G

19 mTmem26 TGT TTG GTG GAG TCC TAA GGT C

20 Target Nucleotide sequence SEQ ID NO:
CTG AGA AAC GGC TAG CAC ATC

21 18s GGC CTC GAA AGA GTC CTG TAT

22 hTBX1 CCT CGG CAT ATT TCT CGC TAT CT

23 ACG ACA ACG GCC ACA TTA TTC

24 hPRDM16 CCT TCA TGG CTG CAA AGC TC

25 CAG CAG GGT AGA AAA GCA GA

26 AAG GGA GAA TTT CGG TGC GT

27 hPGC1a AAG GAT GCG CTC TCG TTC AA

28 CCA TCT AGG GTT ATG ATG CTC TTC

29 mAP2 ACA CCG AGA TTT CCT TCA AAC TG

30 hUCP1 GCG GTG ATT GTT CCC AGG A

31 AGG TCC AAG GTG AAT GCC C

32 GGT CAG CTC TTG TGA ATG GAA

33 mPPARy ATC AGC TCT GTG GAC CTC TCC

34 GGC CAT ACA CAA GGT CTC CAT

35 mPPARa AGA GAA TCC ACG AAG CCT ACC

36 ACT GCC ACA CCT CCA GTC ATT

37 mUCP1 CTT TGC CTC ACT CAG GAT TGG

38 CGGCAGCCTCAACATG

39 mPPARp AGATCCGATCGCACTTCTCATA

40 hPPAR CACATCTACAATGCCTACCT

41 p CTTCTCTGCCTGCCACAATGTCT

42 hPPARy AGCCTGCATCTCCACCTTATT

43 TCCTTCACAAGCATGAACTCC

44 hPPARa AGTGGAGCATTGAACATCGAA

45 GTCGCACTTGTCATACACCAG

46 ACTTGGTCTGTGTGGACATGC

47 mABHD6 GTGCCTATAAGGTGAAAGGGC

48 TAG AGT GTG CTG CTC TGG TTG

49 mPGC1a GAT TGG TCG CTA CAC CAC TTC

50 AGG TCT ATC TAC GCT GTG TTC G

51 mCD36 CAA TGG TTG TCT GGA TTC TGG

52 GGT TCA AGC TGT TCA AGA TAG C

53 mCPT1 ACC ACA TAG AGG CAG AAG AGG

54 Glucose uptake and fatty acid oxidation. Glucose uptake was measured in visceral fat and soleus muscle and palmitate oxidation was measured in inguinal fat, visceral fat, brown fat and soleus muscle, isolated from ABHD6 KO and \ATT mice on HFD for 14 weeks. The isolated tissues were rinsed and weighed (150 mg per condition) and pre-incubated at 37 C in Krebs¨
Henseleit (KH) buffer, pH 7.4, containing 3.5% FA-free BSA (w/v) in the presence or absence of 100 nM insulin for 45 minutes as described previously (Attane et al., 2012), for studying insulin dependent and independent glucose uptake. Following pre-incubation, 0.1 mM 2-deoxyglucose (2-DG) and 5pCi [3N-D-2-DG were added and incubations continued for 10 min. At the end of the incubation, explants were washed with PBS, lysed in 500 pl 1M NaOH at 50 C
for 30 min and neutralized by 1M 500 pl HCI. This lysate (100 pl) was used to quantify 2-DG uptake by liquid scintillation counter. For palmitate oxidation, the tissues were incubated at 30 C in modified Krebs-Henseleit buffer containing 5% fatty acid-free BSA, 5 mM
glucose, 1 mM
palmitate, and 1 Ci/mL [1-14q-palmitate (PerkinElmer) for 1h (soleus muscle) or 2h (adipose tissue). After the incubation, complete oxidation was determined by acidifying the incubation medium with 1 mL of 1 M sulfuric acid, and measuring the released 14CO2 (Attane etal., 2011).
PPAR transactivation assay. In a 24-well plate, 293T cells were transfected with plasmids expressing PPARa, PPAR8 or PPARy (400ng DNA/ well), PPRE-directed luciferase expression plasmid (PPRE X3-TK-luc, Addgene; 800ng DNA/ well) and Renilla luciferase internal control plasmid (25 ng DNA/ well) using lipofectamine 2000Tm. After 24h, the transfected cells were starved overnight in DMEM without FBS. Then, the cells were incubated in DMEM
without FBS
in the presence or absence of 10 pM V\ANL70, 100 pM 1-palmitoylglycerol (1-PG), 100 pM 1-oleoylglycerol (1-OG), 50 pM WY14643 (PPARa agonist), 100 nM GW501516 (PPARI3 agonist), or 50 pM pioglitazone (PPARy agonist) for another 24h. After washing twice with PBS, the cells were scraped and lysed and stored in -80 C for further analysis. Luciferase assay was done with 2 pl of cell lysate using a kit (Promega). PPRE-directed luciferase expression was normalized with Renilla luciferase activity (internal control) in the same sample.
Analysis of MAG species. Analysis of different species of MAG (both 1- and 2-MAG) was done as described before (Zhao et al., 2014). Briefly, total lipids were extracted by Folch extraction protocol from visceral and brown fat (20 mg each), isolated from ABHD6 \ATT
and KO mice. The extracted lipids were dried under nitrogen and dissolved in 50 l chloroform and spotted on thin layer chromatography plates, pre-coated with 2.3% boric acid. Lipids and 1-and 2-MAG5 were separated using solvent system, chloroform: acetone: acetic acid in a ratio of 60:40:1. The plates were exposed to iodine vapor and the spots corresponding 1-MAG and 2-MAG were scraped and were saponified, followed by analysis of the released FFA by HPLC.
Histology and UCP1 immunohistochemistry. Inguinal fat, visceral fat, brown fat and liver were isolated from female ABHD6 KO and WT mice on HFD. After washing twice in cold PBS, the tissues were fixed in 10% paraformaldehyde and the tissue sections were processed for hematoxylin-eosin staining for assessing tissue morphology and for UCP1 immunostaining using anti-UCP1 antibody (ab10983; Abcam). The stained sections were examined using a Nikon microscope.
MAG hydrolysis activity. ABHD6 \ATT and KO mice were fed HFD for 10 weeks, and then the mice were sacrificed, and visceral fat was quickly removed and washed in cold PBS and homogenized in KRBH. Adipose tissue total MAG hydrolysis activity was measured in the homogenates as described before (Zhao et al., 2014). The assay system, in a final volume of 100 I, contained 50 mM potassium phosphate, pH 7.2, 1 pg of tissue extract protein and 13 1..LM

ThioGlo-1. Reactions were started with the addition of 5 pM 1-S-arachidonoylthioglycerol substrate after a pre-incubation of 15 min at 30 C. 1-S-arachidonoylthioglycerol hydrolysis was followed by the reaction of released thioglycerol with ThioGlo-1 to form a fluorescent adduct, which is measured continuously for 30 min at 380 nm excitation and 510 nm emission.
Effect of PPARa and PPARy antagonists, in vitro, on the expression of genes related to adipose browning. Fully differentiated 3T3-L1 cells and human primary adipocytes were prepared as described before (Kohanski et al., 1986 and Ahfedlt et al., 2012).
Preadipocytes from ABHD6 KO and WT mice were prepared (Liu et al., 2010) by rapidly dissecting out the fat pads (visceral, subcutaneous or brown), washing away all the blood and then cutting the tissue in to small fragments followed by collagenase (1 mg/ml) treatment. After complete digestion for 1 h at 37 C, the homogenate was filtered and then centrifuged at 300xg for 5 min, and the sedimented preadipocytes were suspended in an erythrocyte lysis buffer (154 mM NH4CI, 10 mM KHCO3 and 0.1 mM EDTA, pH 7.4). After 10 min, the preadipocytes were collected by centrifugation at 300xg for 5 min. The differentiated adipocytes were treated with 10 pM
V\M/L70, 100 pM 1-OG
in the absence or presence of 1 pM PPARa antagonist GW6471 (Wang et al., 2013) or 1 pM
PPARy antagonist T0070907 (Lee et al., 2002) for 24h, and then the cells will be used for RNA
analysis.
Oxygen consumption rates (OCR) in adipocytes. Fully differentiated mouse 3T3-L1 cells and human adipocytes derived from subcutaneous fat were treated in DMEM medium with DMSO, 100 pM 1-OG, or 10 1..LM V\M/L70, without and with 1 M GW6471 (PPARa antagonist) for overnight. Next day, the incubation medium was replaced with the specially formulated, unbuffered DMEM-based medium provided by Seahorse Bioscience with 25 mM
glucose with or without various inhibitors. Cells were incubated for 1h, and then OCR was measured using XF
analyzer (Seahorse Bioscience) following supplier's procedures.
Statistical analysis. Statistical analysis was performed using one-way ANOVA
with Dunnett's post-test for multiple comparisons or two-way ANOVA with Bonferroni's post-test for multiple comparisons using GraphPad Prism. For browning gene expression results, comparisons were made by unpaired two-tailed Student's t test. Values are expressed as means SEM.
Improved glucose tolerance in female but not male ABHD6-K0 mice on chow-diet.

mice were on a pure C57616N genetic background (Zhao et al., 2014). When placed on chow diet, 6-week old male ABHD6-K0 and heterozygous mice showed no differences in their glucose tolerance in comparison to wild type (WT) mice (Figure 3a) during oral glucose tolerance test (OGTT), despite increased insulin secretion (Figure 3b).
Insulin sensitivity was unaltered in these male KO mice (Figure 3c) as revealed by insulin tolerance test (ITT). This confirms our earlier results in older (26 week old) male ABHD6-K0 mice that insulin sensitivity is unaltered using hyperinsulinemic euglycemic clamp5. Unlike the male KO mice, female ABHD6-KO mice displayed better glucose tolerance than the WT mice (Figure 3d) but with reduced insulin secretion (Figure 3e), during OGTT, indicating that female KO mice are more insulin sensitive in comparison to WT and this was confirmed by ITT (Figure 30. There were no major differences in weekly body weight gain up to 24 weeks and cumulative food intake in the male KO mice on chow diet (Figure 3g and h). However, female ABHD6-K0 mice showed slightly reduced body weight gain and cumulative food intake (Figure 3i and j).
Overall, female ABHD6-KO mice showed stronger phenotype than the males on chow diet.
ABHD6-K0 mice on high fat diet show reduced weight gain and insulin resistance and improved glucose tolerance. Both male and female ABHD6-K0 mice after 60% HFD for 8 weeks, showed improved glucose tolerance but much lower insulinemia during OGTT and also enhanced insulin sensitivity in ITT as compared to WT littermates (Figure 4 a to 0.
Heterozygous mice showed intermediate response, more notably for insulinemia. The low insulinemia response in KO mice during OGTT (Figure 4b and e) was suggestive of enhanced insulin sensitivity, which was confirmed by ITT (Figure 4c and 0 and also by hyperinsulinemic-euglycemic clamp (Figure 4 g and h). The glucose infusion rate (index of insulin sensitivity) in HFD fed male KO mice was higher as compared to \ATT mice, with heterozygous mice showing intermediate effect (Figure 4h). During HFD feeding, both male and female ABHD6-K0 mice showed less body weight gain (Figures 4i and k) and reduced daily and cumulative (over 8 weeks) food intake (Figures 4 j and I). The decrease in body weight gain was more pronounced in female KO mice (-30% at week 8) as compared to male KO mice (-12 % at week 8), whereas the reduction in cumulative food intake in both sexes was modest and similar -8%, as compared to \ATT mice.
Ex-vivo analysis of 2-deoxyglucose uptake in visceral fat and soleus muscle indicated that these tissues from ABHD6 KO mice (male and female) show enhanced glucose uptake under basal condition and that insulin action per se is not enhanced (Figure 5). The observed effects were more pronounced in female than male mice. Thus, ABHD6 deficiency is associated with enhanced insulin independent glucose uptake by muscle and adipose tissues that likely contributes to the better glucose disposal or the KO mice vs WT.
Reduced fat mass and liver steatosis in ABHD6-K0 mice. ABHD6-K0 mice, particularly females, showed reduced fat in their visceral cavity (Figure 6a). Echo-MRI of both male and female mice revealed no difference in lean mass (Figures 6a and e). The fat mass (Figures 6 b and 0 was markedly decreased in female KO mice only, whereas a modest not significant reduction was noticed in males. Liver weight showed significant reduction in the KO mice as compared to \ATT mice in both males (Figure 6c) and females (Figure 6g) and this may be related to their decreased fat content, as noticed in liver histology, showing more fat accumulation in the WT than KO mice (Figure 6i). There was no change in visceral fat weight in male KO mice (Figure 6d) while in female KO mice this was reduced by nearly 40% (Figure 6h) and this was also evident physically (Figure 6j).

Blood chemistry and additional parameters of ABHD6-K0 mice. ABHD6-K0 mice on HFD
showed reduced glycemia and insulinemia. On normal diet, neither glycemia nor insulinemia of the KO mice were different from WT mice (Table 3). There were no differences in chow or HFD
fed WT and KO mice in their plasma glycerol, triglyceride, FFA, free and total cholesterol levels (Table 4). Rectal temperature of the female KO mice was slightly, although not significantly, higher than the WT mice, suggestive of elevated energy expenditure (see below). The growth characteristics of the ABHD6 KO mice were not altered as indicated by their body and tail length in comparison to the WT mice. Fur appearance was also not different (Figure 6j). We measured various adipokines, cytokines and hormones (28 altogether) in plasma by "protein array" in HFD
mice and only 6 of them showed significant changes (Figure 7). FGF21 and FGF, which are implicated in the protection from obesity mediated effects, are elevated in KO
mice, whereas plasma proteins related to insulin resistance, including ICAM-1, IGFBP-1 and resistin are decreased. RAGE that is indicative of inflammation was also reduced.
Table 4. Blood chemistry, body length and rectal temperature of male and female ABHD6 KO
mice fed normal and high fat diet.
Male Female ND HFD ND HFD
Glycemia WT 7.96 0.54 12.5 0.74 7.50 0.31 8.53 0.48 (mM) KO 7.43 0.24 10.2 0.63 7.86 0.45 7.50 0.37 Insulinemia WT 0.76 0.21 5.69 0.66 0.50 0.13 1.92 0.41 (ng/ml) KO 0.90 0.14 3.29 0.48 0.51 0.15 1.02 0.13 CE WT 34,5 12.7 44.2 5.54 40.6 10.7 38.2 8.20 (mM) KO 39.9 7.72 42.7 4.10 35.8 15.9 40.9 7.50 TG WT 0.21 0.14 0.25 0.14 0.25 0.20 0.13 0.10 (mM) KO 0.25 0.03 0.23 0.08 0.27 0.18 0.13 0.08 FFA WT 1.22 0.42 1.27 0.26 1.44 0.52 1.18 0.33 (mM) KO 1.32 0.34 1.29 0.33 1.46 0.28 0.99 0.40 Glycerol WT 0.31 0.03 0.25 0.04 0.34 0.19 0.26 0.05 (mM) KO 0.32 0.02 0.23 0.04 0.33 0.11 0.30 0.08 Body length WT 9.10 0.14 9.00 0.18 8.90 0.20 9.10 0.14 (cm) KO 9.00 0.24 9.10 0.21 9.20 0.24 9.00 0.16 Rectal WT ND ND ND
38.7 0.55 Male Female ND HFD ND HFD
temperature ( C) KO ND ND ND
39.1 0.64 Elevated respiration, energy expenditure and locomotor activity in ABHD6-K0 mice. The mice were monitored for 72h in metabolic cages at room temperature and at 30 C
(thermoneutral conditions). Respiratory measurements on the third day (after 48h acclimatization) indicated elevated V02 during light and dark phases (Figure 8a) and during the last 24 h period (Figure 9a), both in male and female ABHD6 KO mice at both room temperature and at 30 C. VCO2 and respiratory exchange ratio (RER) were not affected (Figures 9b and c, Figures 8b and c).
Energy expenditure as a function of metabolic mass (lean mass + 0.2x fat mass) was higher in both female and male ABHD6 KO mice, in both the dark and light phases, last 24 h and at both temperatures (Figure 9d and Figure 8d).
Both male and female ABHD6 KO mice show increased locomotor activity during dark phase and this increase was more marked in females (Figure 9e and Figure 8e). In order to examine whether the enhanced locomotor activity is related to depressive behavior, anxiety, or stress we performed the forced swimming, open field and elevated platform tests, which revealed no differences between WT and KO mice (Figures 10a to c), suggesting that the enhanced locomotor activity of KO mice is most likely due to voluntary exercise.
Enhanced BAT function and white adipose 'browning' in ABHD6-K0 mice. As ABHD6 KO mice on HFD show enhanced energy expenditure, we examined whether BAT function is elevated in these mice and if there is white adipose 'browning'. We measured by qPCR in female ABHD6-KO mice maintained at room temperature, BAT specific thermogenic gene expression and genes associated with white adipose browning, in WAT from the visceral and inguinal regions and in BAT from the dorsal region. UCP1, PGC1a, PRDM16, PPARa and CD36 mRNA
levels (Figures 11a toe) were elevated in visceral and inguinal white adipose and in BAT. Expression of other browning related genes (TBX1, CD37, TREM26, Cox8b, Cox7a1, CIDEA) (Figures 12a to i) showed moderate or no changes. Expression of PPARa, that controls UCP1 transcription25, was elevated in WAT and BAT (Figure 11e) but no significant changes were seen in PPAR8 or PPARy (Figures 12f and g). PPARa target genes CD36 and CPT-1 showed increased expression in the KO mice (Figures 11a and 12h). Histology revealed smaller adipocytes in the visceral and inguinal adipose tissues and smaller adipocytes with much less lipid deposits in the BAT of the ABHD6-K0 mice (Figure 110. Higher level of UCP1 protein staining was observed in the visceral and brown adipose tissues (Figure 11g), whereas it was only marginally elevated in the inguinal adipose. Cold (4 C) induced thermogenesis for 3 hours revealed higher ability of the KO mice to maintain their body temperature than the wild-type mice (Figure 11h). Similar gene expression (UCP1, PGC1a, PPARa) changes were noticed in WAT and BAT from Ko mice after 3-day acclimatization at 30 C (Figure 13). BAT from KO mice, but not WAT or soleus muscle, showed nearly 2-fold increase in palmitate 8-oxidation (Figures 14a to d). Thus, there is increased thermogenic program and function in BAT and induction of browning related genes in visceral and subcutaneous adipose tissues of the KO mice.
Pharmacological inhibition of ABHD6 triggers adipose browning. Daily administration of the ABHD6 inhibitor V\M/L70 was shown to protect mice from obesity induced by a HFD (Thomas et al., 2013). In order to examine whether pharmacological inhibition of ABHD6 induces adipose browning as seen in the gene-deleted mice, C57616N mice were fed a high fat diet (40%
calories from fat) for 8 weeks with daily treatment with V\M/L70.
Administration of the drug led to more UCP1 staining (Figure 15a) and induction of browning related genes (UCP1, PRDM16, TREM26, and TBX1) (Figure 15b) in the visceral adipose. Expression of Cidea and Cox7a1 showed marginal increases whereas no changes were seen in the expression of UCP2, PPARa and PPARy in V\ANL70 treated mice (Figure 16a).
Thus, in vivo pharmacological inhibition of ABHD6 causes visceral adipose browning as observed in the KO mice.
ABHD6 inhibition and 1-MAG cause adipose browning via PPARa in a cell autonomous manner.
To gain insight into the mechanism by which ABHD6 inhibition causes white adipose browning we first verified if 1-MAG hydrolase activity is lowered in the adipose tissue of ABHD6 deficient mice, which also contains the classical MAG lipase. Total 1-MAG hydrolase activity in extracts of visceral adipose from the KO mice was markedly decreased (-50%) (Figure 17a), indicating that ABHD6 contribution to MAG hydrolysis in adipose is significant. This decrease in 1-MAG
hydrolysis is reflected in elevated levels of various 1-MAG species in both visceral and brown adipose tissues (Figures 17b and c). Changes in 2-MAG levels were modest (Figures 18a and b), similar to what we noticed earlier in ABHD6 KO mouse islets (Zhao et al., 2014).
We examined if the effects of ABHD6 suppression are cell-autonomous and intrinsic to adipocyte and if 1-MAG itself may act as a signal for browning. Incubation of differentiated 3T3-L1 adipocytes with V\M/L70, 1-oleoylglycerol or 1-palmitoylglycerol increased expression of the browning marker UCP1 and PPARa (Figure 19a). PRDM16 and PGC1a mRNA levels were not affected. Similar changes were noticed with V\M/L70 and 1-oleoylglycerol in differentiated human primary preadipocytes (Figure 17d). Addition of the PPARa antagonist completely abrogated the V\ANL70 and 1-oleoylglycerol induced increases in UCP1 and PPARa expression (Figure 17d), suggesting that the browning changes seen in white adipose by ABHD6 deletion/ inhibition are mediated via 1-MAG activation of PPARa in a cell autonomous manner. Respiration measurements in 3T3-L1 adipocytes (Figure 19b) and the differentiated human preadipocytes (Figure 20) showed that overnight preincubation with either V\M/L70 or 1-oleoylglycerol enhance their respiration, likely because of elevated UCP1 expression because uncoupled 02 consumption was increased (Figure 17e, Figures 19b and 3, Figure 20a). Similar to UCP1 expression, this increased 02 consumption rate in both adipocytes models was curtailed by the PPARa antagonist GW6471 (Figure 17e, Figures 19b and e).
Transactivation experiments revealed that 1-oleoylglycerol and 1-palmitoylglycerol could activate luciferase gene expression driven by PPARa, even better than the PPARa agonist WY16427 (Figure 170. There was also significant transactivation of PPARy by 1-MAG, whereas PPARI3 was not responsive (Figure 170. Finally, preadipocytes isolated from ABHD6 KO mice expressed very high levels of UCP1 and PPARa after differentiation as compared to WT mouse preadipocytes and this increased expression in the KO adipocytes was completely abrogated by incubation with PPARa antagonist GW6471 (Figure 17g). We further examined the contribution of PPARy for 1-MAG mediated browning process. Incubation of the human differentiated preadipocytes with PPARy antagonist T0070907, along with V\M/L70 and 1-oleoylglycerol led to a strong suppression of V\M/L70 or 1-OG mediated elevation in the expression of UCP1 and other browning related genes (Figures 21a to e). Overall the data support the view that 1-MAG
activation of PPARa and PPARy mediates the enhanced UCP1 gene expression and adipocytes browning induced by ABHD6 suppression, in a cell autonomous manner.
Since ABHD6 KO mice exhibited reduced food intake, we verified if this were the reason for the observed effects on body weight gain, glucose tolerance and insulin sensitivity. Even after pair-feeding, the body weight gain was still lower in ABHD6 KO mice on HFD (Figure 22a) as compared to \ATT mice. Similarly, OGTT revealed improved glucose tolerance and ITT showed better insulin sensitivity (Figures 22c to e) in the ABHD6 KO mice compared to the pair-fed WT
mice.
Partial reversal of ABHD6 KO mediated effects on obesity, glucose homeostasis, energy expenditure and adipose browning by PPARa antagonist, in vivo. We examined whether the ex vivo and in vitro effects of PPARa antagonist can be seen in vivo as well.
Treatment of HFD fed ABHD6 KO male mice with GW6471, slightly elevated their body weight gain (Figure 23a), without altering cumulative food intake (Figure 23b). Even though glycemia during OGTT was not changed (Figure 23c), insulinemia showed a tendency to increase (Figure 23d), revealing lowering insulin sensitivity and this was confirmed in ITT (Figure 23e). PPARa antagonist treatment led to lowered oxygen consumption in the ABHD6 KO mice, without much change in VCO2 and RER (Figures 24a to c). The elevated energy expenditure, measured under thermoneutral conditions in the vehicle treated ABHD6 KO mice, was reduced in GW6471treated ABHD6 KO mice (Figure 230. This decreased energy expenditure was associated with curtailed expression of UCP1 (Figure 23g) and other browning related genes in adipose tissues (Figure 25), indicating that PPARa is able to mediate the adipose browning and thermogenic program at least partially in ABHD6 KO mice. Interestingly, the increased locomotor activity seen in vehicle treated ABHD6 KO mice was also curtailed by PPARa antagonist, GW6471 (Figure 24d).
The results indicate that ABHD6 KO mice show a unique phenotype of interest for obesity and cardiometabolic disorders. When fed a high fat diet these mice show: (1) reduced body weight gain; (2) protection from hepatic steatosis; (3) a modest lowering of food intake; (4) improved glucose tolerance; (5) increased insulin sensitivity and protection from hyperinsulinemia; (6) enhanced insulin-independent glucose uptake in adipose and muscle; (7) increased locomotor activity, females being more responsive; (8) elevated energy expenditure; (9) augmented fatty acid oxidation in BAT; (10) increased cold-induced thermogenesis; (11) browning of WAT; and (12) increased circulating levels of FGF21, a hormone that antagonizes metabolic syndrome related defects and activates BAT and beige adipocytes. Interestingly, heterozygous mice deficient in ABHD6 showed an intermediate phenotype between WT and KO mice for many parameters, revealing a gene dosage effect. Also several of these effects, in particular, adipose browning and cold induced thermogenesis, were replicated by the ABHD6 inhibitor V\M/L70.
Thus, the results demonstrate that ABHD6 is a new player in the control of energy homeostasis and in the regulation of BAT function and white adipose browning.
What is the mechanism whereby ABHD6 deficiency or inhibition exerts beneficiary metabolic effects? It is likely multifactorial. The slight reduction of food intake may contribute to the improved metabolic profile although it alone cannot quantitatively explain all metabolic improvements. Thus, food intake was similarly reduced by only 8% in male and female mice yet the phenotype in females for glucose tolerance, body weight gain, fat mass and insulin sensitivity was quantitatively more important. In addition the protective effects of ABHD6 KO are persistent even after pair-feeding, indicating the slightly lowered food intake is not responsible for the observed effects in ABHD6 KO mice. The underlying causes for the modestly lowered food intake in the KO mice are not clear. Central involvement is a possibility since ABHD6 controls endocannabinoids that regulate appetite. However, a decrease in ABHD6 activity is expected to increase endocannabinoids that in fact enhance appetite, which is not the case in the KO mice. Besides CNS effects do not fully explain the reduced appetite and metabolic effects. At least part of the beneficiary effects of ABHD6 KO on glycemia could be due to the enhanced insulin-independent glucose uptake both in skeletal muscle and adipose tissues and this in turn could contribute to decreased body demand for insulin and thus to reduce hyperinsulinemia that drives obesity. However, an important contributor to the beneficiary effect of ABHD6 deletion is likely enhanced BAT function and WAT browning. Thus, energy expenditure (expressed per metabolic mass) was increased in both male and female mice during the light phase when the animals did not show any difference in locomotor activity.
Besides, energy expenditure was elevated at 30 C thermoneutral conditions, indicating that these effects are not because of room temperature mediated stimulation of BAT
and also not due to any skin or fur defects as pointed out recently. In addition, cold induced thermogenesis was considerably enhanced in ABHD6 KO mice.
Little is known about the biochemical basis of WAT browning. Several transcriptional regulators including PPARs and co-activators PRDM16 and PGC1a are known to be involved in the conversion of WAT to brite adipose. However, whether metabolic pathways or signals play a role in this process is unknown. The results support the view that 1-MAG is a signal that can drive intrinsic and cell autonomous adipose browning via PPARa and PPARy activation and that ABHD6 regulates adipose browning by controlling the signal competent 1-MAG
levels. The evidence is as follows. a) Various 1-MAG species are increased in visceral adipose of ABHD6 KO mice with minor changes in 2-MAG; b) 1-MAG and V\M/L70 induce UCP1 and PPARa in differentiated 3T3L1 preadipocytes and human preadipocytes; c) PPARa and PPARy antagonists abrogate UCP1 induction by 1-MAG and ABHD6 inhibition in differentiated adipocytes; d) UCP1 expression is dramatically induced during differentiation of preadipocytes from ABHD6-deficient WAT and this is completely abolished by PPARa antagonist;
e) 1-MAG
can activate PPARa and PPARy directly; f) PPARa target genes are induced in deficient WAT; g) 1-MAG and V\M/L70 increase uncoupled respiration in 3T3L1 preadipocytes and human adipocytes and this is blocked by PPARa antagonist; h) in vivo PPARa antagonist treatment to ABHD6 KO mice prevents the browning phenomenon and associated metabolic changes; and i) in vivo treatment of mice with V\ANL70 induce white adipose browning similar to ABHD6 KO.
Interestingly, ABHD6 and 1-MAG also appear to play a role in BAT function, which is important considering that the thermogenic contribution of classical BAT is predominant, even under conditions of "WAT browning". Thus, ABHD6 deficient mice showed elevated levels of various 1-MAG species in BAT whereas 2-MAG did not rise significantly. BAT of the KO
mice showed higher fat oxidation and induction of many of the BAT marker genes including PRDM16, PPARa, CD36, PGCla and CIDEA. Also UCP1 level was markedly increased in BAT of the KO
mice in association with better cold tolerance despite they were leaner. As for WAT browning, the results are consistent with the view that 1-MAG regulates BAT function at least partially through PPARa activation. This inference is also supported by the curtailed V\ANL70 or 1-MAG
mediated increase in the uncoupled respiration both in differentiated human preadipocytes and 3T3L1 adipocytes by PPARa antagonist.
The phenotype of male and female ABHD6 KO mice was qualitatively similar even though it was quantitatively more marked in females. The reason for this is uncertain but estrogens are well known to be protective against metabolic syndrome and diabetes. Also BAT in female mice appears to be more efficient in terms of mitochondrial organization, which may contribute to their increased responsiveness to ABHD6 deletion.

Mechanism underlying the elevated locomotor function seen here in the ABHD6 KO
mice and in the ABHD6 inhibited mice earlier is not clear. Since there is no associated stress or anxiety in the ABHD6 KO mice, and as the elevated locomotor activity is seen mostly during dark phase, when the rodents are more active, it can be inferred that ABHD6 suppression promotes voluntary exercise. The effects on locomotor function may also be dependent on PPARa activation, as these effects could be abrogated by PPARa antagonist.
Involvement of altered centrally mediated effects cannot be ruled out.
Lipolytic products are important physiological activators of both PPARa and also PPARy.
Several reports indicate the role of PPARy in WAT browning and also BAT
function. Indeed, we noticed that 1-MAG can also activate PPARy in addition to PPARa, but not PPAR8/5. Inasmuch as PPARy antagonist could lower the effectiveness of V\ANL70 and 1-oleoylglycerol in inducing browning related gene expression in differentiated human preadipocytes, it appears that PPARy also plays an important role in controlling ABHD6/1-MAG mediated adipose browning.
Collectively, our results demonstrate that ABHD6 regulates fuel homeostasis, WAT browning and BAT function. The mechanism of adipose browning appears to involve 1-monoacylglycerol acting as an intrinsic cell autonomous signal that causes PPARa and PPARy activation in adipose tissues. ABHD6 inhibition may provide a unique approach for both lean and obese type 2 diabetes. Thus, we observed before that ABHD6 inhibition in the low dose streptozotocin lean model of type 2 diabetes restores normal glucose tolerance via enhanced insulin secretion.
Here we show in obese mice with hyperglycemia and marked glucose intolerance that ABHD6 deficiency reduces body weight gain, improves glucose homeostasis and insulin action together with mild reduction in appetite and enhanced locomotor activity. Targeting ABHD6 offers a novel route to develop both anti-obesity and type-2 diabetes drugs.
EXAMPLE 10¨ COMPOUND 7 4'-carbamoy1-3,5-difluoro-[1,1'-biphenyl]-4-ylmethyl(3-(pyridin-3-yl)benzyl)carbamate (Compound 7) Step 1 1-(3-bromophenyI)-N-methylmethanamine 1) MeNH2, H20, Me0H
H
Br Br o 2) NaBH4 To a solution of 3-bromobenzaldehyde (20.0 g, 108 mmol) in methanol (120 mL) at rt was added a 40% aqueous solution of methylamine (21.9 mL, 130 mmol) and the solution was stirred for 0.5 h. The reaction flask was subsequently cooled to 0 C and sodium borohydride (6.12 g, 162 mmol) was added portion-wise to the solution following by slow warming to rt and stirring at this temperature 0/N. The reaction mixture was concentrated in vacuo and the residue was partitioned between DCM and H20. The layers were separated and the aqueous layer was extracted twice with DCM followed by washing of the organic phase with a saturated solution of NaHCO3, drying over MgSO4 and concentration in vacuo to afford Intermediate A as a faint-orange oil.
Step 2 N-methyl-1-(3-(pyridin-3-yl)phenyl)methanamine yhi ; I B, Pd(PPh3)4, K2CO3 \ IF1L- OH
Br THF, H20 reflux Intermediate A (1.50 g, 7.5 mmol), pyridine-3-boronic acid (0.97 g, 7.9 mmol), Pd(PPh3)4 (0.44 g, 0.38 mmol) and K2CO3 (2.68 g, 18.8 mmol) were placed in a 20 mL microwave reaction vial.
The vessel was sealed with a crimp-cap septum and then was twice evacuated under hi-vacuum and flushed with nitrogen. THF (11.5 mL) and H20 (5.5 mL) were added by syringe, the evacuation/nitrogen flush procedure was repeated and the vessel contents were then heated at reflux 0/N. After cooling to rt, the reaction mixture was partitioned between Et0Ac and H20 and the layers were separated. The aqueous layer was extracted twice with Et0Ac and the organic phases were combined, dried over MgSO4 and concentrated in vacuo. Flash chromatography of the residue on silica gel eluting with an increasing proportion of Me0H (0.5 to 10%) in DCM and evaporation of solvents in vacuo afforded Intermediate B as a faint-orange oil.
Step 3 3',5-difluoro-4'-hydroxy-[1,1'-biphenyl]-4-carboxamide OH OH HO di F abh F
,B
HO Pd(PPh3)4, K2CO3 +
NH2 THF, H20 F 41111kill s Br 0 reflux NH2 4-Bromo-2,6-difluorophenol (1.0 g, 4.8 mmol), 4-aminocarbonylphenylboronic acid (0.83 g, 5.0 mmol), Pd(PPh3)4 (0.28 g, 0.24 mmol) and K2CO3 (1.65 g, 11.9 mmol) were placed in a 20 mL
microwave reaction vial and the vessel was sealed with a crimp-cap septum. The reaction vessel was evacuated under hi-vacuum and placed under a nitrogen atmosphere and this process was repeated. THF (11 mL) and H20 (5.0 mL) were added and the vacuum/nitrogen-flush procedure was repeated twice more followed by heating of the reaction mixture at reflux 0/N. After cooling to rt, the reaction vessel contents were partitioned between Et0Ac/MeTHF
(3/1) and H20 and the layers were separated. The aqueous layer was extracted twice with Et0Ac/MeTHF (3/1) and the organics were combined, dried over MgSO4 and concentrated in vacuo. The residue was triturated with Et20, followed by trituration with DCM
0/N prior to collection of the solid by suction filtration and drying under hi-vacuum to afford Intermediate C
as a tan powder.
Step 4 HO 1) triphosgene, THF. DIPEA, 0 C
NO
F 2) SI IW
NH2 Fr1,-Triphosgene (0.036 g, 0.12 mmol) was added to a stirred suspension of Intermediate C (0.050 g, 0.20 mmol) and DIPEA (0.070 mL, 0.40 mmol) in THF (4.0 mL) at 0 C with continued stirring at this temperature for 0.5 h. A solution of Intermediate B (0.059 g, 0.3 mmol) in THF (0.5 mL) was then introduced in a single portion and the reaction was warmed slowly to rt 0/N. Following completion of the reaction, the vessel contents were concentrated in vacuo and the residue was dissolved in DCM/Me0H, adsorbed on silica and dried in vacuo. Flash chromatography of the pre-adsorbed sample on silica gel eluting with an increasing proportion of Me0H (0.5 to10%) in DCM and evaporation of solvents in vacuo afforded the title compound as a tan powder. 1H
NMR (400 MHz, d6-DMS0): 1:1 mixture of carbamate rotamers; 1H NMR (400 MHz, d6-DMS0):
6 8.91-8.92 (m, 1 H); 8.61-8.62 (m, 1 H); 8.08-8.10 (m, 2 H); 7.98-8.00 (m, 2 H); 7.86-7.88 (m, 2 H); 7.72-7.67 (m, 4 H); 7.51-7.58 (m, 2 H); 7.44-7.45 (m, 1.5 H); 7.37-7.39 (m, 0.5 H); 4.81 (s, 1 H); 4.65 (s, 1 H); 3.15 (s, 1.5 H); 3.01 (s, 1.5 H). MS ESI: 474.2 [M+H]
Compound 7 was then assayed to determine its ability to inhibit ABHD6 and to favor the conversion of white adipose tissue into beige/brite adipose tissue. The IC50 of Compound 7 against ABHD6 was determined to be about 8.3 nM. Also, it was determined that the UCP1 relative expression (e.g., Ct value of UCP1 mRNA/Ct value of [3-actin mRNA) of adipocytes having been in contact with Compound 7 was 0.0195 +/- 0.003 whereas the UCP1 relative expression of adipocytes having been contacted with DMSO (negative control) was 0.017 +/-0.001.
While the disclosure has been described in connection with specific embodiments thereof, it is understood that it is capable of further modifications and that this application is intended to cover any variation, use, or adaptation of the disclosure following, in general, the principles of the disclosure and including such departures from the present disclosure that come within known, or customary practice within the art to which the disclosure pertains and as may be applied to the essential features hereinbefore set forth, and as follows in the scope of the appended claims.
References Thomas, G., et al. The serine hydrolase ABHD6 Is a critical regulator of the metabolic syndrome. Cell reports 5, 508-520 (2013).
Peyot et al., 2009-Adipose Triglyceride Lipase Is Implicated in Fuel- and Non-fuel-stimulated Insulin Secretion¨J Biol Chem, 284: pp. 16848-16859 Zhao, S., et al. alpha/beta-Hydrolase domain-6-accessible monoacylglycerol controls glucose-stimulated insulin secretion. Cell metabolism 19, 993-1007 (2014).
Peyot, M.L., et al. Beta-cell failure in diet-induced obese mice stratified according to body weight gain: secretory dysfunction and altered islet lipid metabolism without steatosis or reduced beta-cell mass. Diabetes 59, 2178-2187 (2010).
Even, P.C. & Nadkarni, N.A. Indirect calorimetry in laboratory mice and rats:
principles, practical considerations, interpretation and perspectives. American journal of physiology. Regulatory, integrative and comparative physiology 303, R459-476 (2012).
Sharma, S. & Fulton, S. Diet-induced obesity promotes depressive-like behaviour that is associated with neural adaptations in brain reward circuitry. Int J Obes (Lond) 37, 382-389 (2013).
Attane, C., et al. Apelin treatment increases complete Fatty Acid oxidation, mitochondria!
oxidative capacity, and biogenesis in muscle of insulin-resistant mice.
Diabetes 61, 310-320 (2012).
Attane, C., et al. Apelin stimulates glucose uptake but not lipolysis in human adipose tissue ex vivo. Journal of molecular endocrinology 46, 21-28 (2011).
Kohanski, R.A., Frost, S.C. & Lane, M.D. Insulin-dependent phosphorylation of the insulin receptor-protein kinase and activation of glucose transport in 3T3-L1 adipocytes. The Journal of biological chemistry 261, 12272-12281 (1986).
Ahfeldt, T., et al. Programming human pluripotent stem cells into white and brown adipocytes.
Nature cell biology 14, 209-219 (2012).
Liu, Q., Gauthier, M.S., Sun, L., Ruderman, N. & Lodish, H. Activation of AMP-activated protein kinase signaling pathway by adiponectin and insulin in mouse adipocytes:
requirement of acyl-CoA synthetases FATP1 and AcsI1 and association with an elevation in AMP/ATP
ratio. FASEB
journal : official publication of the Federation of American Societies for Experimental Biology 24, 4229-4239 (2010).

Wang, W., et al. PPARalpha agonist fenofibrate attenuates TNF-alpha-induced expression in 3T3-L1 adipocytes via the SIRT1-dependent signaling pathway.
Experimental cell research 319, 1523-1533 (2013).
Lee, G., et al. T0070907, a selective ligand for peroxisome proliferator-activated receptor gamma, functions as an antagonist of biochemical and cellular activities. The Journal of biological chemistry 277, 19649-19657 (2002).
Rosen ED, Spiegelman BM. What we talk about when we talk about fat. Cell. 2014 Jan 16;156(1-2):20-44.

Claims (37)

What is claimed is:

1. A compound for the treatment, prevention or alleviation of symptoms associated with a dysfunction of a brown adipose tissue in a subject, wherein said compound is of formula or a pharmaceutically acceptable salt or solvate thereof, wherein X is N or CH;
R1 is lower linear or branched alkyl, cycloalkyl, lower linear or branched alkenyl, cycloalkenyl or aryl;
each of R2, R3, R4 and R5 is H or one or more independently selected substituent;
R6 is H, lower linear or branched alkyl, or cycloalkyl;
each of R7 and R8 is independently selected from H, lower alkyl or fluoride.

2. The compound of claim 1, wherein R1 is C1-6 linear or C3-6 branched alkyl, cycloalkyl, or optionally substituted phenyl.

3. The compound of claim 1 or 2, wherein R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl.

4. The compound of any one of claims 1 to 3, wherein R2, R3, R4 and R5 are H
or an independently selected substituent.

5. The compound of any one of claims 1 to 4, wherein each of R7 and R8 is independently selected from H or C1-3 alkyl.

6. The compound of any one of claims 1 to 5, wherein R2, R3, R4, R5, R7 and R8, are each H.

7. The compound of any one of claims 1 to 6, wherein said compound is other than compounds i).

8. The compound of any one of claims 1 to 7, wherein said compound is a compound of formula II

wherein X is N, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl; or X is CH, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl.

9. The compound of any one of claims 1 to 4, wherein said compound is a compound of formula IV

10. The compound of any one of claims 1 to 9 for promoting the conversion of white adipose tissue into beige/brite adipose tissue in the subject.

11. The compound of any one of claims 1 to 9 for promoting the biological activity of the brown adipose tissue in the subject.

12. The compound of claim 11, wherein the biological activity of the brown adipose tissue is at least one of a mitochondrial activity, an oxidative capacity or energy expenditure.

13. The compound of any one of claims 1 to 9 for reducing body weight in the subject.

14. The compound of any one of claims 1 to 9 for reducing hepatic steatosis in the subject.

15. The compound of any one of claims 1 to 9 for promoting exercise in the subject.

16. The compound of any one of claims 1 to 15, wherein the subject is human.

17. The compound of any one of claims 1 to 16, wherein the subject is female.

18. The compound of any one of claims 1 to 17, wherein the subject is obese and/or hyperglycemic.

19. A method for treating, preventing or alleviating the symptoms associated with a dysfunction in a brown adipose tissue of a subject in need thereof, said method comprising administering to the subject a therapeutically effective amount of the compound of formula I
or a pharmaceutically acceptable salt or solvate thereof, wherein X is N or CH;
R1 is lower linear or branched alkyl, cycloalkyl, lower linear or branched alkenyl, cycloalkenyl or aryl;
each of R2, R3, R4 and R5 is H or one or more independently selected substituent;
R6 is H, lower linear or branched alkyl, or cycloalkyl;
each of R7 and R8 is independently selected from H, lower alkyl or fluoride.

20. The method of claim 19, wherein R1 is C1-6 linear or C3-6 branched alkyl, cycloalkyl, or optionally substituted phenyl.

21. The method of claim 19, wherein R6 is H, C1-6 linear alkyl or C3-6 branched alkyl, C3-6 cycloalkyl.

22. The method of claim 19, wherein R2, R3, R4 and R5 are H or an independently selected substituent.

23. The method of claim 19, wherein each of R7 and R8 is independently selected from H or C1-3 alkyl.

24. The method of claim 19, wherein R2, R3, R4, R5, R7 and R8, are each H.

25. The method of claim 19, wherein said compound is other than compounds i).

26. The method of claim 19, wherein said compound is a compound of formula II

wherein X is N, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl; or X is CH, R1 is C1-3 linear alkyl, C3 branched alkyl, or optionally substituted phenyl and R6 is H, C1-3 linear alkyl, C3 branched alkyl or C3 cycloalkyl.

27. The method of claim 19, wherein said compound is a compound of formula IV
wherein R1, R2, R3, R5 and R6 are as defined in claim 19.

28. The method of claim 19 for promoting the conversion of white adipose tissue into beige, brite or brown adipose tissue in the subject.

29. The method of claim 19 for promoting the biological activity of the brown adipose tissue in the subject.

30. The method of claim 29, wherein the biological activity of the brown adipose tissue is at least one of a mitochondrial activity, an oxidative capacity or energy expenditure.

31. The method of claim 19 for reducing body weight in the subject.

32. The method of claim 19 for reducing hepatic steatosis in the subject.

33. The methof of claim 19 for promoting exercise in the subject.

34. The method of claim 19, wherein the subject is human.

35. The method of claim 19, wherein the subject is female.

36. The method of claim 19, wherein the subject is obese and/or hyperglycemic.

37. A compound having the formula la or a pharmaceutically acceptable salt or solvate thereof, wherein R1 is lower linear or branched alkyl, cycloalkyl, lower linear or branched alkenyl, cycloalkenyl or aryl;
each of R2, R3, and R5 is H or one or more independently selected substituent;
R6 is H, lower linear or branched alkyl, or cycloalkyl; and each of R7 and R8 is independently selected from H, lower alkyl or fluoride.