CA2876864A1 - Methods for eliminating mannosylphosphorylation of glycans in the production of glycoproteins - Google Patents

Abstract

The present invention relates to the elimination of mannosylphosphorylation on the glycans of glycoproteins in the yeast genus Pichia. The elimination of mannosylphosphorylated glycoproteins results from the disruption of the PNO1 gene and the newly isolated P. pastoris MNN4B gene. The present invention further relates to methods for producing modified glycan structures in host cells that are free of glycan mannosylphosphorylation.

Description

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.

NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

NOTE: For additional volumes please contact the Canadian Patent Office.

Description METHODS FOR ELIMINATING MANNOSYLPHOS-PHORYLATION OF GLYCANS IN TkII PRODUCTION OF
GLYCOPROTEINS
[1] (Cancelled.) STATEMENT AS TO FEDERALLY SPONSORED RESEARCH

[2] This invention was funded, at least in part, under a grant from the Department of Commerce, N1ST-ATP Cooperative Agreement Number 70NANB2H3046. The United States government may therefore have certain rights in this invention.
FIELD OF THE INVENTION

[3] The present invention relates to the elimination of mannosylphosphate transfer on .
glycans of glycoproteins, and further relates to eliminating genes responsible for the addition of mannosylphosphate residues on glycans in yeast and filamentous fungal cells. In particular, the invention relates to engineering yeast and filamentous fungal host cells to produce glycans without naannosylphosphate residues.
Background of the Invention [4] The ability to produce recoinbinant human proteins has led to major advances in hi-man health care and remains an active area of drug discovery. Many therapeutic =
proteins require the cotranslational addition of glycans to specific asparagine residues ( N-glycosylation) of the protein to ensure proper structure-function activity and subsequent stability in human serum. For therapeutic use in humans, glycoproteins require human-like N-glycosylation. Mammalian cell lines (Chinese hamster ovary (CHO) cells as well as human retinal cells) which can mimic human-like glycoprotein processing have several drawbacks including low protein titers, long fermentation times, heterogeneous products, and ongoing viral containment issues. Thus, the use of yeast and filamentous fungal expression systems having more economical processing, fewer safety obstacles and producing more robust heterologous protein yields have been heavily researched as host cells for human therapeutics.

[5] In yeast and filamentous fungus, glycoproteins are produced having oligosaccharides which are different from those of mammalian-derived glycoproteins.
Specifically in yeast, outer chain oligosaccharides are hypermannosylated consisting of 30-150 mannose residues (Kukuruzinska et al., 1987, Anna. Rev. Biochem. 56:
915-944). Moreover, mannosylphosphate is often transferred to both the core and outer sugar chains of glycoproteins produced in yeast (Ballou, 1990, Methods Enzymol. 185:
440-470). Of most consequence, is that these mannosylphosphorylated glycans from glycoproteins produced in the yeast, Saccharomyces cerevisiae, have been shown to =
illicit an immune response in rabbits (Rosenfeld and Ballou, 1974, JBC, 249:
2319-2321). Thus, the elimination of mannosylphosphorylation in yeast and filamentous fungi is essential for the production of non-immunogenic therapeutic gly-coproteins.

[6] In .S cerevisiae there are at least two genes which participate in the transfer of man-nosylphosphate. The two genes, MNN4 and MNN6 have been cloned, and arinlyses of the gene product suggest they function in the transfer of mannosylphosphate (for review see Iipmi and Ofilni, 1999, Biochim. Biophys. Acta, 1426: 333-345).

encodes a type IL membrane protein homologous to the Kre2p/Mntlp family of proteins which has been characterized as Golgi aL1,2-mannosyl-transferases involved in 0-mannosylation and N-glycosylation (Lnssier et al., 1997,1BC, 272:
_ _ 15527-15531). The Amnn6 mutant does nOt show a defect in the mannosylphos-phorylation of the core glycans in vivo, but exhibits a decrease inmannosyiphosphate transferase activity in vitro (Wang at al, 1997, JBC, 272: 18117-18124). Mnn4p is also a putative type 11 membrane protein which is 33% identical to the S.
cerevisiae Yjr061p (Odani at al., 1996, Glycobiology,6: 805-810; Bunter and Plowman, 1997, Trends in Biochem; Sci., 22:18-22). Both the Amnn6 and Amnn4 mutants decrease the _ transfer of mannosylphosphate. However, the Amnn6 Amnn4 double mutant does not further reduce this activity. These observations suggest the presence of Pdrittional man-nosyltransferases that add mannosylphosphate to the core glycans.

[7] Thus, despite the reduction of mannosylphosphorylation in S. cerevisiae with the disruption of MNN4,101N6 or both in combination, there is no evidence that complete *Ftlirninnfion of mannosylphosphate transferase activity is possible. Other genes which affect the mannosylphosphate levels have been identified in S. cerevisiae.
These genes include P212.1, VRG4, M7N2 and MNN.5. PMR1 encodes a Golgi-localized Ca2+/Mn2+
-AlTase required for the normal function of the Golgi apparatus (Antebi and Fink, 1992, Mol. Biol. Cell, 3: 633-654); Vrg4p is involved in nucleotide-sugar transport in the Golgi (Dean at al.,1997,113C, 272: 31908-31914), and Mmap and Mnn5n are .4,2-marmosy1transferases responsible for the initiation of branching in the outer chain of N.4 inlrf-d glyrans (Rayner and Munro, 1998, JBC, 273: 23836-23843). For all four proteins, the reduction in nazanosylphosphate groups attached to N-liniced glycans seems to be a consequence of Golgi malfunction or a reduction in size of the N-linked glycans rather than a specific defect in the transfer activity of the mannosylphosphate groups.

[8] Proteins expressed in the methylotrophic yeast, Pichia pastoris contPin mamm-sylphosphorylated glycans (Miele, etal., 1997, Biotech. Appl Biochem., 2: 79-83).
Miula at al. reported the identification of the PND1 (Phosphorylmannosylation of N -finked Oligosaccharides) gene which upon disruption confers an attenuation of manno-sylphosphorylation on glycoproteins (WO 01/88143; Miura et al., 2004, Gene, 324:
129-137). The PNO1 gene encodes for a protein involved in the transfer of manno-sylphosphate to glycans in P. pastoris. Its specific function, however, is unknown. As mentioned, the Apnol mutant decreases but does not abolish mannosylphosphorylation on N-glycans relative to a P. pastoris strain having wild-type Pnolp.

[9] Currently, no methods exist to eliminate mannosylphosphorylation on glycoproteins produced in fungal hosts. A residual amount of mannosylphosphorylation on glycoproteins may still be immunogenic and, thus, is undesirable for use as human therapeutics.

[10] What is needed, therefore, is an expression system based on yeast or filamentous fungi that produces glycoproteins which are essentially free of mannosylphosphorylated glycans.
SUMMARY OF THE INVENTION

[11] The present invention provides a method for eliminating mannosylphosphate residues on glycans of glycoproteins in a yeast or filamentous fungal host (e.g., P. pastoris).
The present invention also provides a fungal host which normally produces mannosylphosphorylated glycoproteins or a fraction thereof, in which the fungal host is modified to produce glycoproteins essentially free of mannosylphosphate residues. In one embodiment, the present invention provides a null mutant lacking one or more genes homologous to MNN4. In a preferred embodiment, the present invention provides a host of the genus Pichia comprising a disruption, deletion or mutation of rnnn4B and pno 1 . The resulting host strain is essentially free of mannosylphosphorylation on glycans of glycoproteins. According to another embodiment, there is provided a fungal host comprising a combined disruption, deletion or mutation of the MNN4B and PNOI genes wherein the fungal host is Pichia pastoris and is capable of producing less than 1%
mannosylphosphorylated glycoproteins of total N-glycans.

[12] The present invention further provides glycoprotein compositions that are essentially free of mannosylphosphorylated glycoproteins. Such glycoprotein 3a compositions comprise complex N-glycans that may be used for therapeutic applications.

[13] The present invention also provides isolated polynucleotides comprising or consisting of nucleic acid sequences selected from the group consisting of the coding sequences of the P. pastoris MNN4A, MNN4B and MNNC; nucleic acid sequences that are degenerate variants of these sequences; and related nucleic acid sequences and fragments.
The invention also provides isolated polypeptides comprising or consisting of polypeptide sequences selected from the group consisting of sequences encoded by the P.
pastoris MNN4A, MNN4B, MNN4C; related polypeptide sequences, fragments and fusions.
Antibodies that specifically bind to the isolated polypeptides of the invention are also provided.

[14] The present invention also provides host cells comprising a disruption, deletion or mutation of a nucleic acid sequence selected from the group consisting of the coding sequence of the P. pastoris MN1\T4A, MNN4B and MA/NC gene, a nucleic acid sequence that is a degenerate variant of the coding sequence of the P. pastoris MNN4A, MNN4B
and MNNC
gene and related nucleic acid sequences and fragments, in which the host cells have a reduced activity of the polypeptide encoded by the nucleic acid sequence compared to a host cell without the disruption, deletion or mutation.
[14a] In one aspect, the invention provides a fungal host cell comprising a disruption, deletion or mutation of the MNN4B (mannosyltransferase 4B) and PNO1 (phosphomarmosylation of N-linked oligosaccharides 1) genes, wherein said disruption, deletion or mutation reduces the activity of said MNN4B and PN01, wherein the fungal host cell is Pichia pastoris and is capable of producing less than 1%
mannosylphosphorylated glycoproteins of total N-glycans, and wherein the MNN4B gene to be disrupted, deleted or mutated encodes a messenger RNA that corresponds to a cDNA comprising or consisting of a nucleic acid sequence selected from the group consisting of (a) SEQ ID NO:3;
(b) a nucleic acid sequence that is a degenerate variant of SEQ. ID NO:3; (c) a nucleic acid sequence at least 90% identical to SEQ ID NO:3; (d) a nucleic acid sequence that encodes a polypeptide comprising the amino acid sequence of SEQ ID NO:4; and, (e) a nucleic acid sequence that encodes a polypeptide at least 90% identical to SEQ ID NO:4.

3b [14b] In another aspect, the invention provides a method for producing glycoprotein compositions in the host cell as described herein comprising propagating said host cell and isolating the glycoprotein products.
[14c] In another aspect, the invention provides a glycoprotein produced by the method as described herein, wherein the glycoprotein is selected from the group consisting of kringle domains of human plasminogen, erythropoietin, cytokines, soluble IgE
receptor alpha-chain, IgG, IgG fragments, IgM, urokinase, chymase, urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, annexin V
fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, osteoprotegerin, alpha-1 antitrypsin, DNase II, alpha-fetoproteins, FSH and peptide hormones, wherein the glycoprotein comprises less than 1% mannosylphosphorylated glycoproteins of total N-glycans.
[14d] In another aspect, the invention provides a modified Pichia host cell characterized in that the host cell does not produce the gene products comprising the amino acid sequence of SEQ ID NO:2, SEQ ID NO:4 and of PN01, as a result of disruption, deletion, or mutation of nucleic acid sequences encoding the gene products, and thus lacks the mannosylphosphate transferase activity of the gene products.

BRIEF DESCRIPTION OF THE DRAWINGS

[15] Figure 1. depicts the nucleic acid and amino add sequence of?.
pastoris IONN4A.

[16] Figure 2. depicts the nucleic acid and amino acid sequence of?.
pastoris Aill11N4B.

[17] Figure 3. depicts the nucleic acid and amino acid sequence of?.
pastoris M2TN4C.

[18] Figure 4. illustrates the fusion PCR knock-out strategy of?. pastoris 2&N4B
using a drug resistance marker.

[19] Figure 5A. shows a high performance liquid chrom,gtogram for the negative ex-perimental control using 1120 as the sample. B. shows a high performance liquid chromatogram for the sample containing N-linked glycans from 1C3 purified from P.
pastoris YSH-44 supernatant Glycans with mannosylphosphate elute between 20 --mins. C. shows a high performance liquid chromatogram for a sample containing N -hinkfml glycans from 1(3 purified from P. pastoris YSH-49 (Apno 1) supernatant.
Glycans with maimosylphosphate elute between 20 - 30 rains. D. shows a high performance liquid chromatogram for a sample,contRining N-linked glycans from 1(3 , purified from P. pastoris YAS-130 (Apno Amnn4B) supernatant. Note the absence of mannosylphosphorylaind glycans between 20 and 30 mins.

[20] Figure 6A. shows a highperfonnance liquid chromatogram for the sample containing N-iinirefi glycans from 1(3 purified from P. pastoris YSH-1 (dochl) su-pernatant. Glycans with mannosylphospirte elite between 20 - 30 mink-B. shows a high performance liquid chromatogram for a sample containing N-linkfid glycans from.
1(3 purified from P. pastoris YAS-164 (dochl dmnn4A Apno 1) supernatant.
Glycans with mannosylphosphate elute between 20 - 30 rains. C. shows a high performance liquid chromatogram for g sample. co-ntRining N-linked glycans from 1(3 purified from P. pastoris YAS-174 (dochl Amnn4A Apno 1 Amnn4B) supernatant.
Note the absence of marmosyiphosphorylated glycans between 20 and 30 rains.

[21] Figure 7A. shows a high performance liquid chromatogram for the negative ex-perimental control sample containing H20 B. shows a high performance liquid chromatogram for the sample containing N-1inlred glycans from erythropoietin expressed from pBK291 (His-FPO) produced in P. pastoris strain BK248 C. shows a high performance liquid chromatogram for the sample containing N-iinked glycans from His-EPO produced in P. pastoris strain BK244 I). shows a high performance liquid chromatogram for the sample containing N-3in1red glycans from 0D40 expressed from 111-C33 (His-CD40) produced in?. pastoris strain YJC12 E. shows a high performance liquid chromatogram for the YAS252. Note: Glycans with manno-sylphosphate elute between 20 - 30 mins [22] Figure 8 A. shows a high performance liquid chromatogram for the sample containing N-linked glycan from invertase expressed from pPB147 produced in?.
pastoris strain YAS252.

[23] Figure 9 [24] shows an alignment of 16,7N4IPNO1 homologs in?. pastoris (Pp), S.
cerevisiae (Sc), Neurospora crassa (Nc), Aspergillus nidulans (An), Candida albi cans (Ca) and Pichia angusta (Hansenula polYmorpha) (Pa) using Clustal W from DNAStar.
DETAILED DESCRIPTION OF Ilik: INVENTION

[25] Unless otherwise defined herein, scientific and technical terms used in connection with the present invention shall have the meanings that are commonly understood by those of ordinary skill in the art. Further, unless otherwise required by context, singular terms shall include the plural and plural terms shall include the singular.
Generally, nomenclatures used in connection with, and techniques of biochemistry, enzymology, molecular and cellular biology, microbiology, genetics and protein and nucleic acid chemistry and hybridization described herein are those well known and commonly used in the art: The methods and techniques of the present invention are generally performed according to conventional methods well known in the art and as described in various general and more specific references that are cited and discussed throughout the present specification unless otherwise indicated. See, e.g., Sambrook et al.
. = ' Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989); Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002);
. Harlow and Lane, Antibodies: A Laboratory Manual, Cold Spring Harbor Laboratory = Press, Cold Spring Harbor, N.Y. (1990); Taylor and Drickamer, Introduction to Gly-=:!==
= cobiology, Oxford Univ. Press (2003); Worthington Enzyme Manual, Worthington Biochemical Corp., Freehold, NJ; Handbook ofBiochemistry: Section A Proteins, Vol =
= I, CRC Press (1976); Handbook of Biochemistry: Section A Proteins, Vol 11, CRC
Press (1976); Essentials of Glycobiology, Cold Spring Harbor Laboratory Press (199.9). .

[26] All publications, patents and other references mentioned herein are hereby in-corporated-by reference in their entireties.

[27] The following terms, unless otherwise indicated, shall be understood to have the = =
following meanings:

[28] The term tpolynucleotide or 'nucleic acid molecule' refers to a polymeric form of nucleotides of at least 10 bases in length. The term includes DNA molecules (e.g., cDNA or genomic or synthetic DNA) and RNA molecules (e.g., mRNA or synthetic RNA), as well as analogs of DNA or RNA containing non-natural nucleotide analogs, non-native intemucleoside bonds, or both. The nucleic acid can be in any topological conformation. For instance, the nucleic acid can be single-stranded, double-stranded, triple-stranded, quadruplexed, partially double-stranded, branched, hairpinned, circular, or in a padlocked conformation.

[29] Unless otherwise indicated, a 'nucleic acid comprising SEQ ID NO:X' refers to a nucleic acid, at least a portion of which has either (i) the sequence of SEQ
ID NO:X, or (ii) a sequence complementary to SEQ ID NO:X. The choice between the two is dictated by the context. For instance, if the nucleic acid is used as a probe, the choice between the two is dictated by the requirement that the probe be complementary to the desired target.

[30] An 'isolated' or 'substantially pure' nucleic acid or polynucleotide (e.g., an RNA, DNA or a mixed polymer) is one which is substantially separated from other celhilar components that naturally accompany the native polynucleotide in its natural host cell, e.g., ribosomes, polymerases and genomic sequences with which it is naturally associated. The term embraces a nucleic acid or polynucleotide that (1) has been removed from its naturally occurring environment, (2) is not associated with all or a portion of a polynucleotide in which the 'isolated polynucleotide' is found in nature, (3) is operatively linked to a polynucleotide which it is not linked to in nature, or (4) does not occur in nature. The term 'isolated' or 'substantially pure' also can be used in reference to recombinant or cloned DNA isolates, chemically synthesized polynucleotide analogs, or polynucleotide analogs that are biologically synthesized by.
heterologous systems.

[31] However, 'isolated' does not necessarily require that the nucleic acid or =
polynucleotide so described has itself been physically removed from its native en-vironment For instance, an endogenous nucleic acid sequence in the genome of an organism is deemed 'isolated' herein if a heterologous sequence is placed adjacent to = . the endogenous nucleic acid sequence, such that the expression of this endogenous = nucleic acid sequence is altered. In this context, a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not =
the heterologous sequence is itself endogenous (originating from the same host cell or = progeny thereof) or exogenous (originating from a different host cell or progeny = thereof). By way of example, a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of a host .
cell, such that this gene has an altered expression pattern. This gene would now become 'isolated' because it is separated from at least some of the sequences that naturally flank it.

[32] A nucleic acid is also considered 'isolated' if it contains any modifications that do not naturally occur to the corresponding nucleic acid in a genome. For instance, an endogenous coding sequence is considered 'isolated' if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention. An 'isolated nucleic acid' also includes a nucleic acid integrated into a host cell chromosome at a .
heterologous site and a nucleic acid construct present as an episome.
Moreover, an , 'isolated nucleic acid' can be substantially free of other cellular material, or sub-stantially free of culture medium when produced by recombinant techniques, or sub-stantially free of chemical precursors or other chemicals when chemically synthesized.

[33] As used herein, the phrase 'degenerate variant' of a reference nucleic acid sequence encompasses nucleic acid sequences that can be translated, according to the standard genetic code, to provide an amino acid sequence identical to that translated from the reference nucleic acid sequence. The term 'degenerate oligonucleotide' or 'degenerate =

primer' is used to signify an oligonucleotide capable of hybridizing with target nucleic acid sequences that are not necessarily identical in sequence but that are homologous to one another within one or more particular segments.

[34] The term 'percent sequence identity' or 'identical' in the context of nucleic acid sequences refers to the residues in the two sequences which are the same when aligned for maximum correspondence. The length of sequence identity comparison may be over a stretch of at least about nine nucleotides, usually at least about 20 nucleotides, more usually at least about 24 nucleotides, typically at least about 28 nucleotides, more typically at least about 32 nucleotides, and preferably at least about 36 or more nu-cleotides. There are a number of different algorithms known in the art which can be used to measure nucleotide sequence identity. For instance, polynucleotide sequences can be compared using FASTA, Gap or Bestfit, which are programs in Wisconsin Package Version 10.0, Genetics Computer Group (GCG), Madison, Wisconsin.
FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. Pearson, Methods Enzyn2oL
= 183:63-98 (1990) . For instance, percent sequence identity between nucleic acid sequences can be determined using = FASTA with its defaultparameters (a word size of 6 and the NOPAM factor for the = scoring matrix) or using Gap with its default parameters as provided in GCG Version = = 6.1. Alternatively, sequences can be compared using .
the computer program, BLAST (Altschul et at., MoL Biol. 215:403-410 (1990);
Gish . and States, Nature Genet. 3:266-272 (1993); Madden et aL, Meth. EnzymoL
=
266:131-141 (1996); Altschul et aL, Nucleic Acids Res. 25:3389-3402 (1997);
Zhang . and Madden, Genome Res. 7:649-656 (1997)), especially blastp or tblastn (Altschul et aL, Nucleic Acids Res. 25:3389-3402 (1997)).

[35] The term 'substantial homology' or 'substantial similarity; when referring to a nucleic acid or fragment thereof, indicates that, when optimally aligned with ap-propriate nucleotide insertions or deletions with another nucleic acid (or its com-plementary strand), there is nucleotide sequence identity in at least about 50%, more preferably 60% of the nucleotide bases, usually at least about 70%, more usually at least about 80%, preferably at least about 90%, and more preferably at least about 95%, 96%, 97%, 98% or 99% of the nucleotide bases, as measured by any well-known algorithm of sequence identity, such as FASTA, BLAST or Gap, as discussed above.

[36] Alternatively, substantial homology or similarity exists when a nucleic acid or fragment thereof hybridizes to another nucleic acid, to a strand of another nucleic acid, or to the complementary strand thereof, under stringent hybricii7ation conditions.
'Stringent hybridization conditions' and 'stringent wash conditions' in the context of nucleic acid hybridization experiments depend upon a number of different physical parameters. Nucleic acid hybridization will be affected by such conditions as salt con-centration, temperature, solvents, the base composition of the hybridizing species, length of the complementRry regions, and the number of nucleotide base mismatches between the hybridizing nucleic acids, as will be readily appreciated by those skilled in the ark One having ordinary skill in the art knows how to vary these parameters to achieve a particular stringency of hybridization.

[37] In general, 'stringent hybridization' is performed at about 25 C
below the thermal melting point (T.) for the specific DNA hybrid under a particular set of conditions.
'Stringent washing' is performed at temperatures about 5 C lower than the T.
for the =.
specific DNA hybrid under a particular set of conditions. The T. is the temperature at =
which 50% of the target sequence hybridizes to a perfectly matched probe. See Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed., Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y. (1989), page 9.51, hereby in-corporated by reference. For purposes herein, 'stringent conditions' are defined for solution phase hybridivition as aqueous hybridization (i.e., free of forraamide) in 6X =
SSC (where 20X SSC contRins 3.0 M NaC1 and 0.3 M sodium citrate), 1% SDS at 65 C for 8-12 hours, followed by two washes in 0.2X SSC, 0.1% SDS at 65 C for 20 minutes. It will be appreciated by the skilled worker that hybridization at 65 C will =
= = occur at different rates depending on a number of factors including the length and percent identity of the sequences which are hybridizing. . .
.
=

[38] The nucleic acids (also referred to as polynucleotides) of this invention may include both sense and antisense strands of RNA, cDNA, genomic DNA, and synthetic forms and mixed polymers of the above. They may be modified chemically or biochemically or may contain non#natural or derivatized nucleotide bases, as will be readily ap-preciated by those of skill in the art. Such modifications include, for example, labels, .
methylation, substitution of one or more of the naturally occurring nucleotides with an analog, intemucleotide modifications such as uncharged linkages (e.g., methyl phosphonates, phosphotriesters, phosphoramidates, carbamates, etc.), charged linkages = .=
(e.g., phosphorothioates, phosphorodithioates, etc.), pendent moieties (e.g., polypeptides), intercalators (e.g., acridine, psoralen, etc.), chelators, alkylators, and modified linkages (e.g., alpha anomeric nucleic acids, etc.) Also included are synthetic molecules that mimic polynucleotides in their ability to bind to a designated sequence via hydrogen bonding and other chemical interactions. Such molecules are known in =
the art and include, for example, those in which peptide linkages substitute for phosphate linkages in the backbone of the molecule. Other modifications can include, for example, analogs in which the ribose ring contains a bridging moiety or other structure such as the modifications found in 'locked' nucleic acids.

[39] The term 'mutated' when applied to nucleic acid sequences means that nucleotides in a nucleic acid sequence may be inserted, deleted or changed compared to a reference nucleic acid sequence. A single alteration may be made at a locus (a point mutation) or multiple nucleotides may be inserted, deleted or changed at a single locus. In addition, one or more alterations may be made at any number of loci within a nucleic acid sequence. A nucleic acid sequence may be mutated by any method known in the art including but not limited to mutagenesis techniques such as 'error-prone PCR' (a =
process for performing PCR under conditions where the copying fidelity of the DNA
polymerase is low, such that a high rate of point mutations is obtained along the entire length of the PCR product; see, e.g., Leung et aL, Technique, 1:11-15 (1989) and Caldwell and Joyce, PCR Methods Applic. 2:28-33 (1992)); and 'oligonucleotide-directed mutagenesis' (a process which enables the generation of site-specific =
mutations in any cloned DNA segment of interest see, e.g., Reidhaar-Olson and Sauer, Science 241:53-57 (1988)).

[40] The tem]. 'vector' as used herein is intended to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. One type of vector is a 'plasmid', which refers to a circular double stranded DNA loop into which additional DNA segments may be ligated. Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC). Another type 4 of vector is a viral vector, wherein artditional DNA segments may be ligated into the =
=
= = viral genome (discussed in more detail below). Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., vectors having an origin of replication which functions in the host cell). Other vectors can be -integrated into the genome of a host cell upon introduction into the host cell, and are =
.
thereby replicated along with the host genome. Moreover, certain preferred vectors are .
= =capable of directing the expression of genes to which they are operatively linked. Such.
= vectors are referred to herein as 'recombinant expression vectors' (or simply, = =
'expression vectors). =
= [41] The term 'marker sequence' or 'marker gene' refers to a nucleic acid sequence =
capable of expressing an activity that allows either positive or negative selection for .
the presence or absence of the sequence within a host cell. For example, the P. pastoris LIRAS gene is a marker gene becanse its presence can be selected for by the ability of cells containing the gene to grow in the absence of uracil. Its presence can also be selected against by the inability of cells containing the gene to grow in the presence of "
5-F0A. Marker sequences or genes do not necessarily need to display both positive and negative selectability. Non-limiting examples of marker sequences or genes from P. pastoris include ADE1, ARG4, H1.54 and URA. 3 .
[42] 'Operatively linked' expression control sequences refers to a linkage in which the expression control sequence is contiguous with the gene of interest to control the gene of interest, as well as expression control sequences that act in trans or at a distance to control the gene of interest.
[43] The term 'expression control sequence' as used herein refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which =
they are operatively linked. Expression control sequences are sequences which control the transciiption, post-transcriptional events and translation of nucleic acid sequences.

Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing sianals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA;
sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion.
The nature of such control sequences differs depending upon the host organism;
in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence. Tho term 'control sequences' is intended to include, at a minimum, all components whose presence is essential for expression, and can also include additional components whose presence is advantageous, for example, leader sequences and fusion partner sequences.
[44] The term 'recombinant host cell' (or simply 'host cell), as used herein, is intended to refer to a cell into which a recombinant vector has been introduced. It should be understood that such terms are intended to refer not only to the particular subject, cell but to the progeny of such a cell. Because certain modifications may occur in = = . =
succeeding generations due to either mutation or environmental influences, such = = , .
progeny may not, in fact, be identical to the parent cell, but are still included within the scope of the term 'host cell' as used herein. A recombinant host cell may be an isolated = cell or cell line grown in culture or may be a cell which resides in a living tissue or = organism.
[45] = The term 'peptide' as used herein refers to a short polypeptide, e.g., one that is typirtally less than about 50 amino acids Jong and more typically less than about 30 µ=
amino acids long. The term as used herein encompasses analogs and mimetics that =, mimic structural and thus biological function.
[46] The term polypeptide' encompasses both naturally-occurring and non-naturally-occurring proteins, and fragments, mutants, derivatives and analogs thereof.
A polypeptide may be monomeric or polymeric. Further, a polypeptide may comprise a number of different domains each of which has one or more distinct activities.
[47] The term 'isolated protein' or 'isolated polypeptide' is a protein or polypeptide that by virtue of its origin or source of derivation (1) is not associated with naturally ' associated components that accompany it in its native state, (2) exists in a purity not found in nature, where purity can be adjudged with respect to the presence of other cellular material (e.g., is free of other proteins from the same species) (3) is expressed by a cell from a different species, or (4) does not occur in nature (e.g., it is a fragment of a polypeptide found in nature or it includes amino acid analogs or derivatives not found in nature or linkages other than standard peptide bonds). Thus, a polypeptide that is chemically synthesized or synthesized in a cellular system different from the cell from which it naturally originates will be 'isolated' from its naturally associated components. A polypeptide or protein may also be rendered substantially free of naturally associated components by isolation, using protein purification techniques well known in the art. As thus defined, 'isolated' does not necessarily require that the protein, polypeptide, peptide or oligopeptide so described has been physically removed from its native environment.
[48] The term 'polypeptide fragment' as used herein refers to a polypeptide that has a deletion, e.g., an amino-terminal and/or carboxy-terminal deletion compared to a full-length polypeptide. In a preferred embodiment, the polypeptide fragment is a contiguous sequence in which the amino acid sequence of the fragment is identical to the corresponding positions in the naturally-occurring sequence. Fragments typically are at least 5, 6,7, 8, 9 or 10 amino acids long, preferably at least 12, 14, 16 or 18 amino acids long, more preferably at least 20 amino acids long, more preferably at = least 25, 30, 35, 40 or 45, amino acids, even morepreferably at least 50 or 60 amino acids long, and even more preferably at least 70 amino acids long.
[49] A 'modified derivative' refers to polypeptides or fragments thereof that 'are sub-stantially homologous in primary structural sequence but which include, e.g., in vivo or in vitro chemical and biochemical modifications or which incorporate amino acids that are not found in the native polypeptide. Such modifications include, for example, acetylation, carboxylation, phosphorylation, glycosylation, ubiquitination, labeling;
e.g., with radionuclides, and various enzymatic modifications, as will be readily ap-preciated by those skilled in the art. A variety of methods for labeling polypeptides and of substituents or labels useful for such purposes are well known in the art, and include radioactive isotopes such as 1251, 3113,35S, and ligands which bind to labeled an-tiligands (e.g., antibodies), finorophores, chemilumniescent agents, enzymes, and an-tiligands which can serve as specific binding pair members for a labeled ligand. The choice of label depends on the sensitivity required, ease of conjugation with the primer, stability requirements, and available instrumentation. Methods for labeling polypeptides are well known in the art. See, e.g., Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates (1992, and Supplements to 2002) .
[50] The term 'fusion protein' refers to a polypeptide comprising a polyp eptide or fragment coupled to heterologous amino acid sequences. Fusion proteins are useful because they can be constructed to contain two or more desired functional elements from two or more different proteins. A fusion protein comprises at least 10 contiguous amino acids from a polypeptide of interest, more preferably at least 20 or 30 amino acids, even more preferably at least 40, 50 or 60 amino acids, yet more preferably at least 75, 100 or 125 amino acids. Fusions that include the entirety of the proteins of the present invention have particular utility. The heterologous polypeptide included within the fusion protein of the present invention is at least 6 amino acids in length, often at least 8 amino acids in length, and usefully at least 15, 20, and 25 amino acids in length.
Fusions that include larger polypeptides, such as an IgG Fc region, and even entire proteins, such as the green fluorescent protein ('GFP') chromophore-containing proteins, have particular utility. Fusion proteins can be produced recombinantly by constructing a nucleic acid sequence which encodes the polypeptide or a fragment thereof in frame with a nucleic acid sequence encoding a different protein or peptide and then expressing the fusion protein. Alternatively, a fusion protein can be produced chemically by crosslinking the polypeptide or .a fragment thereof to another protein.
[51] The term 'non-peptide analog' refers to a compound with properties that are analogous to those of a reference polypeptide. A non-peptide compound may also be termed a 'peptide mimetic' or alpeptidomimetic'. See, e.g., Jones, Amino Acid and Peptide Synthesis, Oxford University Press (1992); Jung, Combinatorial Peptide and Non_peptide Libraries: A Handbook, John Wiley (1997); Bodanszky et al., Peptide Chemistry¨A Practical Textbook, Springer Verlag (1993); Synthetic Peptides: A
Users-Guide, (Grant, ed., W. H. Freeman and Co., 1992); Evans at al., J. Med. Chem.
30:1229 (1987); Fauchere, J. Adv. Drug Res. 15:29 (1986); Veber and Freidinger, Trends Neurosci., 8:392-396 (1985); and references sited in each of the above..
Such compounds are often developed with the aid of computerized molecular modeling. Peptide raimetics that are structurally similar to-useful peptides of the invention may be used to produce an equivalent effect and are therefore envisioned to be part of the invention.
[52] A 'polypeptide mutant or 'mutein' refers to a polypeptide whose sequence contains an insertion, duplication, deletion, rearrangement or substitution of one or more =amino acids compared to the amino acid sequence of a native or wild-type protein. A
mutein may have one or more amino acid point substitutions, in which a single amino acid.at a position has been changed to another amino ,acid, one or more insertions and/or deletions, in which one or more amino acids are inserted or deleted, respectively, in the sequence of the naturally-occurring protein, and/or truncations of the amino acid sequence at either or both the amino or carboxy termini. A mutein may have the same but preferably has a cli-fferent biological activity compared to the naturally-occurring protein.
[53] A mutein has at least 50% overall sequence homology to its wild-type counterpart.
Even more preferred are muteins having at least 70%, 75%, 80%, 85% or 90%
overall sequence homology to the wild-type protein. In an even more preferred embodiment, a mutein exhibits at least 95% sequence identity, even more preferably 98%, even more preferably 99% and even more preferably 99.9% overall sequence identity.
Sequence homology may be measured by any common sequence analysis algorithm, such as Gap or Bestdt [54] Amino acid substitutions can include those which: (1) reduce susceptibility to proteolysis, (2) reduce susceptibility to oxidation, (3) alter binding affinity for forming protein complexes, (4) alter binding affinity or enzymatic activity, and (5) confer or modify other physicochemical or functional properties of such ariPlogs [55] As used herein, the twenty conventional amino acids and their abbreviations follow conventional usage. See Immunology ¨A Synthesis (Golub and Gren eds., Sinauer Associates, Sunderland, Mass., 2'd ed. 1991).
Stereoisomers (e.g., D-amino acids) of the twenty conventional amino acids, unnatural amino acids such as ce-,a-disubstituted amino acids, N-alkyl amino acids, and other unconventional amino acids may also be suitable components for polypeptides of the present invention. Examples of unconventional amino acids include: 4-hydroxyproline, &-carboxyglutamate, E-N,N,N-trimethyllysine, e-N-acetyllysine, 0-phosphoserine, N-acetylserine, N-formylmethionine, 3-methylhistidine, 5-hydroxylysine, N-methylarginine, and other similar amino acids and imino acids (e.g., 4-hydroxyproline). In the polypeptide notation used herein, the left-hand end corresponds to the amino terminal end and the right-hand end corresponds to the carboxy-terminal end, in accordance with standard usage and convention.
[56] A protein has 'homology' or is 'homologous to a second protein lithe nucleic acid sequence that encodes the protein Im a similar sequence to the nucleic acid sequence that encodes the second protein. Alternatively, a protein has homology to a second proteinif the two proteins have 'similar amino acid sequences. (Thus, the lerm 'homologous proteins' is defined to mean that the two proteins have citrular amino acid sequences.) In a preferred embodiment, a homologous protein is one that exhibits at least 65% sequence homology to the wild type protein, more preferred is at least 70%
.sequence homology. Even more preferred are horo.ologious proteins that exhibit at least 75%, 80%, 85% or 90% sequence homology to the wild type protein. In a yet more =.preferred-embodiment, a homologous protein exhibits at least 95%, 98%, 99%
or 99.9% sequence identity. As used herein, homology between two regions of amino acid sequence (especially with respect to predicted structural similarities) is interpreted as implying similarity in function.
[57] When 'homologous' is used in reference to proteins or peptides, it is recogni7ed that residue positions that are not identical often differ by conservative amino acid sub-- stitutions. A 'conservative amino acid substitution' is one in which an amino acid residue is substituted by another amino acid residue having a side chain (R
group) with similar chemical properties (e.g., charge or hydrophobicity). In general, a conservative amino acid substitution will not substantially change the functional properties of a protein. In cases where two or more amino acid sequences differ from each other by conservative substitutions, the percent sequence identity or degree of homology may be adjusted upwards to correct for the conservative nature of the substitution. Means for making this adjustment are well known to those of skill in the art. See, e.g., Pearson, 1994, Methods Mol. Biol. 24:307-31 and 25:365-89.
[58] The following six groups each contain amino acids that are conservative sub-stititions for one another: 1) Serine (S), Tlareonine (T); 2) Aspartic Acid (D), GlutRmic Acid (E); 3) Asparagine (N), Glutamirte (Q); 4) Arginine (R), Lysine (K); 5) lsoleucine (I), Leucine (L), Methionine (M), Alanine (A), Valine (V), and 6) Phenylalanine (F), Tyrosine (Y), Ttyptophan (W).
[59] Sequence homology for polypeptides, which is also referred to as percent sequence identity, is typically measured using sequence analysis software. See, e.g., the Sequence Analysis Software Package of the Genetics Computer Group (GCG), University of Wisconsin Biotechnology Center, 910 University Avenue, Madison, Wisconsin 53705. Protein analysis software matches similar sequences using a =
measure of homology assigned to various substitutions, deletions and other modi-fications, including conservative amino acid substitutions. For instance, GCG
contains programs such as 'Gap' and Sestfit which can be used with default parameters to determine sequence homology or sequence identity between closely related polypeptides, such as homologous polypeptides from different species of organisms or between a wild-type protein and a mutein thereof. See, e.g., GCG Version 6.1.
[60] A preferred algorithm when comparing a particular polypepitde sequence to a =
= database.containing a large number of sequences from different organisms is the = -*
.= computer program BLAST (Altschul at al., J. Mol. Biol. 215:403-410 (1990); Gish and = States, Nature Genet. 3:266-272 (1993); Madden et at., Meth. Enzymol.
266:131-141 = (1996); Altschul at al., Nucleic Acids Res. 25:3389-3402 (1997); Zhang and Madden, =
Genorne Res. 7:649-656 (1997)), especially blastp or.tblastn (Altschul etal., Nucleic Acids Res. 25:3389-3402 (1997)).
[61] Preferred parameters for BLASTp are: =
[62] Expectation value: 10 (default); Filter. seg (default); Cost to open a gap: 11 = (default); Cost to extend a gap: 1 (default); Max. alignments: 100 (default); Word size:
11 (default); No. of descriptions: 100 (default); Penalty Matrix: BLOWSUM62. -[63] The length of polypeptide sequences compared for homology will generally be at least about 16 amino acid residues, usually at least about 20 residues, more usually at least about 24 residues, typically at least about 28 residues, and preferably more than about 35 residues. When searching a database containing sequences from a large number of different organisms, it is preferable to compare amino acid sequences.
Database searching using amino acid sequences can be measured by algorithms other than blastp known in the art. For instance, polypeptide sequences can be compared using FASTA, a program in GCG Version 6.1. FASTA provides alignments and percent sequence identity of the regions of the best overlap between the query and search sequences. Pearson, Methods Erzzymol. 183:63-98 (1990), For example, percent sequence identity between amino acid sequences can be determined using FASTA with its default parameters (a word size of 2 and the PAM250 scoring matrix), as provided in GCG Version 6.1.
[64] The term 'region' as used herein refers to a physically contiguous portion of the primary structure of a biomolecule. In the case of proteins, a region is defmed by a contiguous portion of the amino acid sequence of that protein.
[65] The term 'domain' as used herein refers to a structure of a biomolecule that contributes to a known or suspected function of the biomolecule. Domains may be co-extensive with regions or portions thereof, domains may also include distinct, non-contiguous regions of a biomolecule. Examples of protein domains include, but are not limited to, an Ig domain, an extracellular domain, a transmembrane domain, and a cy-toplasmic domain. =
[66] As used herein, the term 'molecule' means any compound, including, but not limited to, a small molecule, peptide, protein, sugar, nucleotide, nucleic acid, lipid, etc., and such a compound can be natural or synthetic.
[67] The term 'elimination' as used with respect to mannosylphosphorylation refers to mannosphosphorylated glycan detection levels indicating no apparent detectable man-nosylphosphate residues using HPLC under the stated setting.
[68] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention pertains. Exemplary methods and materials are described below, although = methods and materials similar or equivalent to those described herein can also be used in the practice of the present invention and will be apparent to those of skill in the art. =
In case of conflict, the present specification, including definitions, will = control. The materials, methods, and examples are illustrative only and not intended, to .=
be limiting.
= [69] Methods For Producing a Fungal Host Strain Lacking Mannosylphosphorylation on Glycoproteins [70] The present invention provides methods for eliminating marmosylphosphate = transfer on glycans of glycoproteins in yeast or filamentous fungal host cells which = normally produce glycoproteins having mannosylphosphorylation. In one embodiment, the yeast or filamentous fungal host cell which normally produces glycoproteins having mannosylphosphorylation is engineered so that it is essentially free of manno-sylphosphorylation on glycans of glycoproteins. In another embodiment, the fungal hosts are genetically modified to have disrupted, attenuated or mutated at least one gene encoding a protein participating in mannosylphosphate transferase.
Preferably, the method involves disruption, attenuation or mutation of one or more genes selected from MNN4A, M3IN4B, MNN4C and PNOI.
[71] Using known genes encoding mannosylphosphate transferases, novel genes encoding mannosylphosphate transferase in P. pastoris were isolated. The MNN4 gene sequence from S. cerevisiae (Genbank accession # P36044) was blasted against the genome of P. pastoris (Integrated Genomics, Chicago, IL). This search resulted in the identification of three previously unknown ORFs in addition to the PNOI gene.
The three ORFs were designated as MNN4A (SEQ ID NO: 1), MNN4B (SEQ ID NO: 3), =
andMNN4C (SEQ ID NO: 1). These ORFs were amplified and subsequently sequenced and are shown respectively in Figs. 1-3 (Example 1). The encoded amino acid sequences for MNN4A (SEQ ID NO: 2),MNN4B (SEQ ID NO: 4),MNN4C (SEQ
ID NO: 6) are also set forth in Figs. 1-3.
[72] Nucleic Acid Sequences [73] In one aspect, the present invention provides a nucleic acid molecule comprising or consisting of a sequence which is a variant of the P. pastoris M1VN4 A gene having at least 50% identity to SEQ ID NO:l. The nucleic acid sequence can preferably have at least 65%, 70%, 75% or 80% identity to the wild-type gene. Even more preferably, the nucleic acid sequence can have 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the SEQ 11) NO:1. The present invention also provides polypeptide comprising or consisting of a sequence which is a variant of the P. pastoris gene having at least 50% identity to SEQ NO:2. The amino acid sequence can preferably have at least 65%, 70%, 75% or 80% identity to the wild-type gene.
Even =
= more preferably, the amino acid sequence can have 85%, 90%, 95%, 98%, 99%, =
=
= = = 99.9% or even higher identity to the SEQ ID NO:2.
=
= [74] = In another embodiment, the P . pastoris MNN4B gene is particularly useful in the = == elimination of mannosylphosphate transfer on glycans of glycoproteins in a yeast =
strain. The present invention provides a nucleic acid molecule comprising or consisting = .
of a sequence which is a variant of the P. pastoris M11N4 B gene having at least 50% -'identity to SEQ ID NO:3. The nucleic acid sequence can preferably have at least 65%, 70%, 75% or 80% identity to the wild-type gene. Even more preferably, the nucleic = acid sequence can have 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to -the SEQ ID NO:3. The present invention also provides polypeptide comprising or consisting of a sequence which is a variant of the P. pastoris MNN4B gene having at =
least 50% identity to SEQ ID NO:4. The amino acid sequence can preferably have at least 65%, 70%, 75% or 80% identity to the wild-type gene. Even more preferably, the amino acid sequence can have 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the SEQ ID NO:4.
[75] In yet another embodiment, the present invention provides a nucleic acid molecule comprising or consisting of a sequence which is a variant of the P. pastoris gene having at least 50% identity to SEQ ID NO:5. The nucleic acid sequence can preferably have at least 65%, 70%, 75% or 80% identity to the wild-type gene.
Even more preferably, the nucleic acid sequence can have 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the SEQ NO:5. The present invention also provides an polypeptide comprising or consisting of a sequence which is a variant .of the P. pastoris M1'sN4C gene having at least 50% identity to SEQ ID NO:6. The amino acid sequence can preferably have at least 65%, 70%, 75% or 80% identity to the wild-type gene. Even more preferably, the amino acid sequence can have 85%, 90%, 95%, 98%, 99%, 99.9% or even higher identity to the SEQ ID NO:6.
P6] Also provided are vectors, incluciiii,s expression vectors and knock-out vectors comprising the above nucleic acid molecules of the invention. A knock-out vector comprising a 101N4A, MNN4B or lvINN4C may be used to disrupt the MNN4A, MNN4B or MNN4C gene locus. Alternatively, an integration vector comprising a drug resistance marker or an auxotrophic marker is used to disrupt the M1VN4 gene locus.
[77] Combination of Marmosylphosphorylation Gene Knock-huts [78] Each of the three newly identified P. pastoris genes, MNN4A, MIVN4B, 1IVN4C , is disrupted using the PCR overlap strategy as shown in Fig. 4 to determine the effect on mannosylphosphorylation. The individual Amnn4A, Amnn4B, and Amnn4C mutants did not show a significant decrease in mannosylphosphorylation transfer activity on glycans of the kringle 3 domain of human plasminogen (K.3) protein, whereas the 4no/mutant (YSH-49) displayed only an attenuation in mannosylphosphorylation transfer-decreased to 6% (Fig. 5C) - but not to the levels described previously in Miura et al. (WO 01/88143). It has been postulated that different glycoproteins may = display varying degrees and types of glycosylation in the same host cell (IvIontesino et al, 1998, Prot. .Fapr. Purif 14: 197-207). In one embodiment of the present invention, combinations of mill mutants were constructed, one of which, the double mutant Apno Amnn4b in P. pastoris resulted in undetectable levels of mannosylphosphorylation on glycans of the K3 reporter protein (Fig. SD). Similarly, other glycoproteins (e.g, CD40 and invertase) produced from the double mutant Apno 1 Amnn4b in P. pastoris also resulted in lack of mannosylphosphorylation. The double mutant, therefore, produces various glycoproteins of interest that are free of mannosylphosphorylation on glycang.
Accordingly, a method is provided for disrupting a combination of genes involved in, the transfer of mannosylphosphate residues on glycans of glycoproteins in a host (e.g., Pichia sp.). Preferably, the combination includes disruption ofMIVN4B and PNOI.
[79] In case the disruption of the P. pastoris 1011f4B locus alone does not, confer elimination of mannosylphosphorylation on glycans, a combination of mannosylphos-phorylation genes are disrupted. In a preferred embodiment, the disruption of the MNN4B locus is in combination with at least a second gene involved in manno-sylphosphate transfer, such as MNN4A, MIVN4B, MNN4C or PN01. The second gene in this case is preferably the?. pastoris PNO1 gene (Genbank accession #BD105434).
It is contemplated that a skilled artisan may disrupt or mutate any gene involved in oligosaccharide synthesis or a fragment thereof in combination with a disrupted or mutated .116NN4B, which would result in the elimination of mannosylphosphate transfer to glycans in other fungal hosts.
[80] In another embodiment, the method provides for disrupting a gene encoding MNN4B (SEQ ID NO: 3) in a host (e.g., P. pastoris) that already has attenuated man-nosylphosphate tranaferase activity. Additionally, it is contemplated that the elimination of mannosylphosphate transfer to glycans in other Pichia species involves the disruption or mutation of any combination of genes having homology to 1v1117N4.4 lvINN4C, orPN01.
[81] In yet another aspect of the invention each of the three newly identified P. pastoris genes, 1vflYN4A, MNN4B, PINN4C , was disrupted using a fusion knock out strategy as described in Example 3 in order determine if any combination of gene knockouts had an effect on mannosylphosphorylation of glycoproteins expressed in this mutant strain.
The individual dmnn4A, Amnn4B, and Amnn4C mutants as with the PCR overlap knockout strategy (Fig. 4) did not show a decrease in mannosylphosphorylation transfer activity on glycans of the kring,le 3 domain of human p3asminogen (K) protein (data not shown). However, the K3 reporter protein expressed in a Apnol Amnn4b double null mutant (YAS174) is essentially free of any marmosylphos-phorylation (Fig. 6C, compare with Fig. 6A, B). Note the absence of mannosylphos-phorylated glycans between 20 and 30 ruins. .
[82] Fieterologous Glycoprotein Expression System [83] Using established techniques for expressing heterologous glycoproteins in yeast and -filamentous fungi, a gene encoding a therapeutic glycoprotein is expressed. A
fungal recombinant protein expression system may typirnlly include promoters such as AOXI, A0X2, or other inducible promoters, transcriptional term:mat= such as CYC, selectable markers such as URA3, URA.5, G418, ADE1, ARG4, BIS4, Zeocin and secretion signals such as S. cerevisiae oNIF. In one embodiment, this expression system is modified to be at least a mnn4B mutant Preferably, the glycoproteins are produced in P. pastoris having at least oarinn4B.
[84] Glycoproteins of interest can be produced by anyin-nns through the use of the methods disclosed herein. Glycoprotein production can be provided by any rormis in a .
host cell, including accumnlation in an intracellular compartment or secretion from the cell into a culture supernatant. Host cells of the present invention may be propagated or cultured by any method known or contemplated in the art, including but not limited to growth in culture tubes, flasks, roller bottles, shake flasks or fermentors. Isolation andfor purification of the glycoprotein products may be conducted by any means known or contemplated in the art such as fractionation, ion exchange, gel filtration, hy-drophobic chromatography and Pfanity chromatography. An example of glycoprotein production and purification is disclosed in Example 7.
[85) The glycoproteins expressed without maminsylphosphorylated glycans using the methods described herein can include but are not limited to: erythropietin, cytokines such as interferon-a, interferon-$, interferon-6, interferon-c, TNF-ce, granulocyte-CSF, GM-CSF, interleukin,s such as IL-lra, coagulation factors such as factor VIII, factor D.:, human protein C, anfithrombin III and thrombopoeitin antibodies; IgG, IgA, IgD, IgE, IgM and fragments thereof, Pc and Fab regions, soluble IgE receptor a -chain, urolcina.se, chymase, and urea trypsin inhibitor, IGF-binding protein, epidermal growth factor, growth hormone-releasing factor, FSH, anrien V fusion protein, angiostatin, vascular endothelial growth factor-2, myeloid progenitor inhibitory factor-1, osteoprotegerin, a-1 antitryp sin, DNase II, a-feto proteins and glucocembrosidase.
[86] Production of Complex Glvcoproteins Laclthis Mannosvlphosphoryl tion [87] In another aspect of the invention, the present invention provides methods for producing complex N-linked glycans in fungi and yeast (e.g., P. pastoris) that comprises eliminating mannosylphosphate transfer to glycans on glycoproteins.
Such method provides a glycoprotein composition that is essentially free of manno-sylphosphate residues on glycoproteins. In one embodiment, the invention provides less than I% mannosylphosphorylated glycoproteins of total N-glycans. In a more preferred embodiment, the invention provides less than 0.5%
marmosylphosphorylated glycoproteins of total N-glycans.
[88] In another aspect of the present invention, the glycoprotein compositions are es- , sentia fly free of mannosylphospha e residues on complex N-glycans. The method to produce such glycans involve disrupting the PNO1 and MNAT4B genes in a host strain expressing complex N-glycans (e.g., P. pastoris YSH-44 expressing K3 reporter protein) (Hamilton et aL, 2003, Science, 301: 1244-1246) . The engineered strain comprisingpno/ mnn4B disruptions, designatpd as YAS-130, lacks manno-sylphosphate residues on glycans of glycoproteins (Example 5). Although a genetic disruption of the PNO1 gene in YSH-44 (designated YSH-49) rerInces the mole %
of glycans exhibiting mannosylphosphorylaticm (acidic fraction), rammosylphosphate residues still remain (Fig. 5C). Treatment of the glycans from YSH-44 with mild acid hydrolysis followed by PlicniinP phosphrtace demonstrates that the acidic fraction is comprised of about 5-15% of total glycans. This YSH-49 strain shows an acidic' fraction of about 6%, which does compare favorably with the about 9% acidic fraction of the YSH-44 (Fig. 513).
[89] . By contrast, Fig. 5D shows elimination of mannosylphosphate transfer to glycans in P. pastoris YAS-130 (Apno 1 Amnn4B) in comparison to Fig. 5A control -(H20), -Fig. 5B YSH-44 with about 9% mannosylphosphorylation, and Fig. 5C YSH-49 (Apno 1) With about 6% roannosylphosphorylation. Herein is described for the first time a yeast strain engineered to be essentially free of mannosylphosphorylated glycans.
[90] It is also contempl atd that other types of yeast and filamentous fungus can be modified to lack mannosylphosphate transfer activity using the methods described herein. While Pichia pastoris is the pi ________________ craned host strain for producing complex N-linked glycoproteins lacking mannos-ylphosphate residues, the following host cells may be also engineered: Pichia finlandica, Pichia trehalophik, koclamae, Pichia inembranaefaciens, Pichia methanolica, Pichia minuta (Ogataea minuta ,Pichia lindnerz), Pichia opuntiae, Pichia thermotolerans, Pichi salictaria, Pichia guercum, Pichia pijperi, Pichia stiptis, and Pichia ang,usta (Hansenula paymorpha).
[91] Therapeutic Glycoproteins Produced in Yeast (e.g., P. pastorisl [92] Different glycoproteins may display varying degrees and types of glycosylation in the same host cell (Montesino et a/, 1998). The present invention provides methods for producing various glycoproteins in a recombinant yeast strain that essentially lack mannosylphospborylation. Preferably, the method involves engineering expression of a heterologous glycoprotein in P. pastoris Apnol Amnn4B. As such, the present =
invention demonstrates elimination of mannosylphosphorylation from glycans on various therapeutic glycoproteins (Fig. 7A-E, Fig. 8).
[93] While the reporter protein 1C3, contains a single N-Iinked glycosylation site, the reporter protein His-erytbropoietin (E)0) disclosed herein contains three N-linked gly-cosylations sites, the reporter protein His-CD40 disclosed herein contnins two gly-cosylation sites, and the His-invertase protein disclosed herein contains up to 24 gly-cosylation sites. }Es-tagged erythropoietin (1fis-EPO) is expressed from P.
pastoris strain expressing mannosylphosphorylation in Fig. 7B and a P. pastoris dpnol dmn n4B strain lselcing mannosylphosphorylation in Fig. 7C. His-tagged CD40 (His-CD40) is expressed from P. pastoris strain expressing marmosylphosphorylation in Fig. 713 and P. pastoris L'.pnol Amnn4b strain lacking mannosylphosphorylation in Fig.
7E.
His-tagged invertase is expressed from P. pastoris strain lacking manno-sylphophorylation in Fig. 8. Strain construction for each of these glycoproteins is disclosed in Example 6.
194] ;dentification of MININ4 omologs [95] In another aspect of the present invention, a method is provided for identifying the homologs to a 1vJJN4 gene in any yeast preferably Pichia sp. or filamentous fungi. A
= skilled artisan can perform a BLAST database search using the amino acid sequence of :MNN4A, MNN4B, MNN4C or PN0.1 (Genbank accession gBD105434) against the gen:ome of any yeast, ineferably Pichia and obtain the homologs to any of these genes.
With the identification of the MNN4/PNOI homologs in Pichia yeast, one qlcilled in the art can subsequently disrupt or mutate any combination of these homologous genes. An alignment is shown in Figure 9 of ./i4NN4IPNO1 homologs in P.
pastoris, S.
cerevisiae, Neurospora crassa, Aspergillus nidulans, Candida albicans and Pichia angusta (Hansenula polymorpha). Upon screening for the presence of mannosylphos-phorylated glycans on proteins =pressed from the Pichia host (Example 7), one slcilled in the art can determinp the gene or combination of genes, which upon disruption confer the expression of glycoproteins from the Pichia host which are es-sentially free of mannosylphosphorylation.
[96] The disrupted genes or genes which encode for proteins participating in the transfer of mannosylphosphate to glycans of glycoproteins are preferably from a yeast strain belonging to the genus Pichia. Yeasts belonging to the genus Pichia according to the present invention include, but are not limited to: Fichte pastoris, Fichte finiandica, Pichia irehalophila, Fichte koclamae, Pickle membranaeaciens, Pichia methanolica, Pichia minutia (Ogataea mimaa ,Pichia lindnerz), Pichia opuntiae, Pichia titer-motolerans, Pichi salictaria, Pichia guercum, Pichia pijperi, Pichia stiptis, and Pichia angusta (Hansenula polymorpha). Pichia pastoris is preferably used among these.
Other yeast and filamentous fungi include Saccharomyces cerevisiae , Schizosac-charomyces pombe, Sczccharomyce sp. Hansenula polymorpha, lauyveronzyces sp., Cczndida sp., Candida albicans, Aspergilhz nidulans, Aspergillus niger, Aspergillus oryzae, Trichoderma reesei, Cloysosporium lucknowense, Fusarium sp., Fusarium gramineum, Fusarium venenatum and Neurospora crassa.
[97] The following are examples which illustrate the compositions and methods of this invention. These examples should not be construed as limiting¨the examples are included for the purposes of illustration only.
[98] Example 1 [99] Identification and sequencing of M/V7V4A. MATIV4B. MArN4C in P.
pastoris (Figs. 1-31 [100] The Saccharonryces cerevisiae PINN4 protein sequence (Genbank accession #
P36044) was blasted against a Pichi pastoris genomic sequence (Integrated Ge.n.omics, Chicago, IL) for open reading frames encoding for proteins with homology.
This search identified three ORFs with regions of homology to 1VINN4p. These ORFs were designated IviNN4A, MNN4B and kiNN4C. Each of these three genes was sub-sequently sequenced. The MNN4A gene was found to contain an open reading frame containing 2580.nucleotide bases coding for 860 amino acids (Fig. 1). The gene was found to.contain an open reading frame containing 1956 nucleotide bases' coding for 652 amino acids (Fig. 2), and the MMV4C gene was found to contain an open reading frame containing 2289 nucleotide bases coding for 763 amino acids (Fig.
3).
[101] Example.2 [102] Construction of P. pastoris strains: YSH-44 and YS'Ef-1 [103] P. pastoris YSH-44 and YSH-1 were engineered from BK64-1, an Aochl deletion mutant secreting 1(3, a reporter protein with a single N-linked glycosylation site (Choi et al., 2003, PNAS, 100: 5022-5027; Astnihon et aL, 2003, Science, 301: 1244-1246).
YSH-1 expresses glycopron,im having predominantly GleNAcMan5GlcliAn2 N-glycans and YSII-44 expresses glycoproteins having predominantly GIcNA.c2Man3 GloNAc2 N-glycans.
[104] Deletion of PNO1 gene in YSH-44 strain [105] The pnol deletion allele (pnoI::Hyg A ) in YSFI-44 was generated by the PCR
overlap method (Davidson et al., 1999, Microbial. 148:2607-2615'). Primers PNK.1 (5'-CATAGCCCACTGCTAAGCC-AGAATTCTAATATG-31) (SEQ ID NO:7) paired with PNK2 (5'-GCAGCGTACGAAGCTTCAGCTAGAATTGTAAAGTG-AATTATCAAG-TCT
TTC-3') (SEQ ID NO:8), PNK3 (51-CAGATCCACTAGTGGCCTATOCAACAA-TATAGCACCTCTCAAATACAC

G'TTG-3') (SEQ ID NO:9) paired with PNK4 (5'-TCTTGAAGTAGATTTGGAGA- GCGCTATG-3') (SEQ
NO:10) were used to amplify the 5' and 3' flanking regions of the PNOI gene from genomic DNA
(NRRL-Y11430). Primers KAN1 (5'-AGCTGAAGCT-TCGTACGCTGC-3') (SEQ
NO:11) paired with KAN2 (5'-GCATAGGCCACTAGTGGATCTG-3 (SEQ ID
NO:12) were used to amplify the Hyg resistance marker from vector pAG32 (Goldstein atul McCusker, 1999, Yeast, 14: 1541-1553). Primers PNIC1 and PNK4 were then used in a second reaction with all three products from first round of PCR
reactions to generate an overlap product The resulting fusion PCR product was used to transform strain YSH-44, an engineered P. pastoris strain expressing predominantly.
GIcNAc2Man3G1c,NAc2. Transfurmants were selected an YPD (1% yeast extract, 2%
peptone, 2% dextrose) medium contnining 200 mg/m1 of hygromycin B. Proper in-=
tegration of deletion allele pnol::Hyg Rwas confirmed by pca. This Apno I
strain was desigreed YSH-49.
[106] Example 3 [1073. PNOVIIINN4B knockout strategy in P. pastoris strain YSE1-49 Mg. 41 [108] YAS-130 (Apno1 Amnn4b) double mutant strain was achieved by PCR
overlap in YSH-49. The TAS54 (TTCAACGAGTG-ACCAATGTAGA) (SEQ ID NO: 13) and .
TAS51 (CCAT-CCAGTGTCGAAAACGAGCTGGCGAA(..ITT1 __ CTGGGTCGAAG) (SEQ ID NO:14) primers were used to amplify the 521 bp DNA fragment 5' of the predicted start codon from Pichia pastoris genomic DNA (NRRL-Y 11430). TAS51 = contains a 22 bp=overhang that is complimentary to the 5' end of a drug resistance marker. TAS49 (TGAAGACGTCCCL'i ii GAACA) (SEQ ID NO:15) and TAS52 (ACGAGGCAAGCTAAAC.AG-ATCTAGTTG'TITTTTCTATATAAAA.C) (SEQ
NO:16) were used to amplify the 503 bp DNA fragment 3' of the predicted stop codon.
TAS52 also contaim a 22 bp overhang that is complimentary to the 3' end of the drug resistance marker. PCR of the drag resistance marker used pAG29 (contains pat ORF) as the DNA source (Goldstein and McCuster, 1999). The drug resistance marker was amplified using primers TAS53 riCGA.CCCAGAAAAGITCGCCAGCTCG- fill CGACACTGGATGG) (SEQ
ID NO:17) and TAS50 (G ______________________________________________________ ATATAG-AAAAAACAACTAGATCTGTTTAGCTTGCCTCGT) (SEQ ID
NO:14). TAS53 has a22 bp overhang that is comp1immtaty to the 22 bp 5' to the predicted PINN4B start codon. TASK hoc a 22 bp overhang that is complimentary to the 22 bp 3' to the predicted WOMB stop codon. The 5' MIVN4B fragment, 3' fragment, and the gene that confers resistance to a selectable marker were combined in an equimolar ratio and used as template DNA with primers TAS54 and TA549 for the PCR overlap reaction.
[109] ,PNO1/AINN4B knockout strategy in P. pastoris strain YSH-1 [110) YSH-1 was transformed by electroporation with SA-digested pIN503b (Amnn4A

Apno1::URA3) to yield the Aochl Arram4A Apnol strain YAS159. The URA3 selectable marker was recovered in this strain by 5-FOA counterselection. The resulting strain, YAS164 (Aochl;
Amnn4A Apnol; ura3; his4; adel ; arg4), was transformed with SfiI-digested pAS19 (Amnn4B::URA3) giving rise to the Aochl Amnn4A Lipnol Amnn4B strain YAS170.
The YAS170 strain was subsequently countersele,cted on 5-FOA to yield the strain YAS174 (Aochl Amnn4A Apnol Amnn4B; ura3; his4; adel; arg4). YAS174 thus represents a Pichia pastoris strain that is deficient in mannose outer chain formation and void of mannosylphosphate on N-linked glycans.
[111] Example 4 = [112] PCR amplification [113] An Eppendorf*Mastercycler was used for all PCR reactions. PCR
reactions contained template DNA, 125 mM dNTPs, 0_2 mM each of forward and reverse primer, Ex Taq polymerase buffer (Takara Bio Inc.), and Ex Taq polymerase. The DNA fragments 5' to the predictedfrEVN4B ORF, 3' to the predicted .tlINN4B
ORF, and the drug resistance marker were amplified with 30 cycles of 15 sec at 97 C, 15 sec at 55 C and 90 sec at 72 C with an initial denaturation step of 2 min at 97 C and a final extension step of 7 min at 72 C. PCP. samples were separated by agarose gel elec-trophoresis and the DNA bands were extracted and purified using a Gel Extraction Kit from Qiagen. All DNA purifications were elated in 10 mM Tris, pH 8.0 except for the final PCR (overlap of all three fragments) which was elated in deionized H20.
- [114] Example 5 [115] DNA Transformations. Culture Conditions for Production of Comolex Glvcans in P.pastoris for marmosylphosphorylation analysis [116] DNA for transformation was prepared by adding sodium acetate to a frul con-centration of 0_3 M. One hunched percent ice cold ethanol was then added to a -R-rtal concentration of 70% to the DNA sample. DNA was pelleted by centrifugation (12000g x 10min) and washed twice with 70% ice cold ethanol. The DNA was dried and then resuspended in 50 ml of 10mM Tris, pH 8Ø YSH-49 and YAS-130 were prepared by expanding a yeast culture in BMGY (buffered minimal glycerol: 100 raM
potassium phosphate, pH 6.0; 134% yeast nitrogen base; 4x10-5% biotin; 1%
glycerol) to an OD. of ¨2-6. The yeast were made eleutiocompeteut by washing 3 times in sorbitol and resuspending in ¨1-2 mls IM sorbitol. DNA (1-2 mg) was mixed with ml of competent yeast and incubated on ice for 10 min. Yeast were then electroporated =
with a BTX Electrocell Manipulator 600 using the following parameters; 1.5 kV, ohms, and 25 mF One milliliter of YPDS (1% yeast extract, 2% peptone, 2%
dextrose, 1M sorbitol) was added to the electroporated cells. Transfomed yeast were sub-sequently plated on selective agar plates. Cells transformed with knockout constructs containing the hph resistance gene were spread onto YPD (1% yeast exiiact, 2%
peptone, 2% dextrose, 1.34% yeast nitrogen base without amino acids) agar plates *Trade mark containing 0.4 mg/m1 hygromycin B. Cells transformed with knockout constructs containing the pat resistance gene were spread onto defined medium (1.34%
yeast nitrogen base lacking amino acids and 1H4SO4, 2% dextrose, 0.1% L-proline, 4x10-5%
biotin) agar plates containing 0.6 mg/ml glufosinate. Colonies were patched onto another plate containing the same drug selection. DNA was isolated from these patches and analyzed by PCR for replacement of the wild-type MNN4B ORF with the drag resistance marker.
[117] Screening for knockouts was performed by PCR amplification (Example 4) of both the 5' and 3' portions of the knockout construct. TAS81 (TAGTCCAAGTACGA-AACGACACTATCG) (SEQ ID NO:19) and TAS08 (AGCTGCGCACGTCAAGAC-TGTCAAGG) (SEQ ID NO:20) primers were used to screen the 5' portion of the knockout construct while TAS82 (ACGACGGTGAGITCAAACAGTTTGGTT) (SEQ 13) NO:21) and TAS07 (TCGCTATACTGCTGTCGATTCGATAC) (SEQ ID NO:22) primers were used to = screen the 3' portion of the knockout construct Observation of a PCR
product in both screens is indicative of a successful knockout of the MNN4B ORF since primers TAS08 and TAS07 anneal at the 5' and 3' ends of the drag resistance marker sequence, respectively and TAS81 and TAS82 are complimentary to sequences in the genome that flank the 5' and 3' regions of DNA used in the knockout construct Ninety six transformants were screened with four testing positive as an MNN4B knockout All four Apno 1 Amnn4b strains expressed the 13 reporter protein without detectable levels of mannosylphosphate. An example of this is shown in Figure 5D.
[118] Example 6 [119] Strain construction for His-tagged EPO, CD40 and Invertase proteins Figs.
[120] For Ths-tagged erythropoietin (EPO), the first 166 amino acids of EPO
was amplified from a human Edney cDNA library (Clontech) and inserted into the C-terminal 6His pPICZA (Invitrogen) plaRmid at the BcoRI and KpiaI sites. This plasmid (pBK291) was transformed into two P. pastoris strains, resulting in the following strains expressing EPO-61fis: BK248 (ura3, izis4, adel, arg4, Aochi ::UR,43) and BK244 [YSH44 transformed with pBKI16 and p131C284 having the pnohnnn4b ( pno 1:.Hyg A) (mnn4b: :Kan 4) knockouts as described and shown in Example 2, Figure 4. pBK116 results from a 1551 bp A0X1 3'UTR DNA fragment isolated from NRRL11430 (ATCC) inserted into Invitrogen pPIC6A plasrnid at the Afila site and a 1952bp A0X1 5TUTR DNA fragment isolated from NRRL11430 inserted into the same pPIC6A plaRmid at the Bgla and BarnHT sites with the removal of the 573 bp Pmel/BamEl DNA fragment This pBK116 was then digested with Notl and the resulting NotI fragments were transformed into YSH44 in order to knock out the reporter 1(3 protein. pB1(284 results from a 3196 bp DNA fragment inclnriing the A0X1 promoter, A0X1 ORF and A0X1 terminator sequence isolated from NRRL11430 (ATCC) and cloned into the multiple cloning site of the Invitrogen plasmid pCR2.1-TOPO. This plasmid was then digested with MscI and Bsslil in order to delete the kanamycin gene. This resulted in pBK284 which was digested with PmeI
prior to transformation into the YSH44 stain transformed with pBK116 for integration into the AOXI promoter locus. HPLC glycan analysis of EPO-6His in BK248 and BK244 is shown in Fig. 7B, C. For His-tagged CD40, the human CD40 DNA was amplified by PCR from phCD40/GemT (Pullen et aL, 1999, JBC, 274: 14246-14254) using a 5' EcoRI primer and a 3' His10-Kpn.1 primer for cloning into pPICZ aA
resulting in pIC33. pJC33 was expressed in P. pastoris strain YJC12 (ura3, his4, ade I, arg4) and YAS252-2 (YAS-130 transformed with pBK116, pBK284 and = pRCD465 containing galactosyltransferase) resulting in YAS252. =
= HPLC
glycan analysis of CD49-6His in YJC12 and YAS252 is shown in Fig. 71), E. =
For His-tagged-invertase, the full length invertase sequence was amplified by PCR
from Kluyveromyces lactis genomic DNA, strain CBS683, purchased from Cen-- traalbureau voor Schimmelcultures. The invertase ORF was amplified using blunt ' ended 5' and 3' primers for insertion into pPICZA plasmid (providing the C-terminal =
6Efis tag) at the Pm1.1.site. This pPB147 was transformed into the P. pastoris strain =
YAS245-2 (YAS130 transformed with pBK116, pBK284, and pRCD465 = resulting in YAS253.
HPLC glycan analysis of invertase-6His in YAS253 =
is shown in Fig. 8. , =
[121] Example 7 [122] Determination of mannosylphosphorylation in P. pastoris =
[123] The extent of mannosylphosphate transfer to N-linked glycans in the strains shown in Figs. 5-8 was determined by secreting a His-tagged reporter protein (It:tingle 3 =
protein in Figs. 5,6; erythropoietin protein and CD40 protein in Fig. 7 and invertase protein in Fig. 8) expressed under the control of the methanol inducible AOXI
promoter. Briefly, a shake flask containing BMGY was inoculated with a fresh yeast culture (e.g., YAS-130) and grown to an O.D. of ¨20. The culture was centrifuged and the cell pellet washed with BMMY (buffered minimal methanol: same as BMGY
except 0.5% methanol instead of 1% glycerol). The cell pellet was resuspended in BMIvIY to a volume 1/5 of the original BMGY culture and placed in a shaker for 24 h.
The secreted protein was harvested by pelleting the biomass by centrifugation and = transferring the culture medium to a fresh tube. The His-tagged K3, EPO, CD40 and invertase proteins were then purified on a Ni-affinity column and digested with PNGase (Choi et al., 2003). Glycan was separated from protein and then labeled with .2-amino-ben7an-tide (2-AB). The 2-AB-labeled glycan was lyophili7ed, resuspended in HPLC grade water and subjected to HPLC using a GlycoSep C column (Glyco, Novato, CA). This analysis allows separation of neutral and acidic glycans.
These glycans were determined to be phosphoryIated from experiments with mild acid hydrolysis which removes the terminal mannose group, exposing the phosphate.
With subsequent alkaline phosphatase treatment, the terminal phosphate group can be cleaved, leaving a neutral glycan. Successive experiments showed that phosphorylated N-linked glycans (acidic glycans) in all strains migrated between 20 and 30 minutes.
Baseline conditions were assessed using dH20 as a blank. The percentage of phos-phorylation was calculated by dividing the acidic peak areas by the sum of the neutral and the acidic peaks. This HPLC analysis was performed under the conditions below.
[124] HPLC Analysis [125] The HPLC conditions are as follows: Solvent A (acetonitrile), solvent B (500mM
ammonium acetate, 500 raM, pH 4.5) and solvent C (water). The flow rate was 0.4 mL/min for 50 min. After eluting isocratically (20% A:80% C) for 10 min a linear solvent gradient (20% A:0% B:80% C to 20% A:50% B: 30%C) was employed over 30 min to elute the glycaus. The column was equilibrated with solvent (20% A:
80%C) for 20 min between runs.
Sequence List Text [126] SEQ ID NO:1 MNN4A (Fig. 1) [127] " SEQ ID NO:2 MNN4A AA (Fig. 1) [128] SEQ ID NO:3 MNN4B (Fig 2) . , [129]
SEQ ID NO:4 MNN4B AA (Fig. 2) =
[130] SEQ
ID NO:5 IANN4C (Fig 3) ==
[131]
SEQ ID NO:6 IVINN4C AA (Fig. 3) =
[132]
SEQ ID NO:7 PNK1: CATAGCCCACTGCTAAGCCAGAATTCTMTATG =
[133] SEQ ID NO:8 PN1C2: GCAGCGTACGAAGCTTCAGCTAGAATTGTAAAGT-GAATTATCAAGTCTTTC =
= =
[134] SEQ ID NO:9 PNIC.3: CAGATCCACTAGTGGCCTATGCAACAATATAG- =
CACCTCTCAAATACACGTTG
[135] SEQ ID NO:10 PNK4: TCTTGAAGTAGATTTGGAGATTTTGCGCTATG
[136] SEQ ID NO:11 KAN1: AGCTGAAGCTTCGTACGCTGC
[137] SEQ ID NO:12 KAM: GCATAGGCCACTAGTGGATCTG
[138) SEQ ID NO:13 TAS54: TTCAACGAGTGACCAATGTAGA
[139] SEQ ID NO:14 TAS51: CCATCCAGTGTCGAAAACGAGCTGGC-GAACI ff1 __________ CTGGGTCGAAG
[140] SEQ ID NO:15 TAS49: TGAAGACGTCCCCTTTGAACA
[141] SEQ ID NO:16 TAS52: ACGAGGCAAGCTAAACAGATCTAGTTG TTC-TATATAAAAC
[142] SEQ ID NO:17 TAS53: C'1'1CGACCCAGAAAAGTTCGCCAGCTCGTTTTC-GACACTGGATGG
[143] SEQ ID NO:18 TAS50: G1"1 I 1ATATAGAAAAAACAACTAGATCTGTT-TAGCTTGCCTCGT
[144] SEQ ID NO:19 TAS81: TAGTCCAAGTACGAAACGACACTATCG
[145] SEQ ID NO:20 TAS08: AGCTGCGCACGTCAAGACTGTCAAGG

[146] SEQ ID NO:21 TAS82: ACGACGGTGAGTTCAAACAGTTTGGTT
[147] SEQ NO:22 TAS07: TCGCTATACTGCTGTCGATTCGATAC
=
=
= = =
=

DEMANDES OU BREVETS VOLUMINEUX
LA PRESENTE PARTIE DE CETTE DEMANDE OU CE BREVETS
COMPREND PLUS D'UN TOME.

NOTE: Pour les tomes additionels, veillez contacter le Bureau Canadien des Brevets.
JUMBO APPLICATIONS / PATENTS
THIS SECTION OF THE APPLICATION / PATENT CONTAINS MORE
THAN ONE VOLUME.

NOTE: For additional volumes please contact the Canadian Patent Office.

Claims (8)

1. An isolated polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of:
(a) SEQ ID NO: 1;
(b) a nucleic acid sequence that is a degenerate variant of SEQ ID NO: 1;
(c) a nucleic acid sequence at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 1;
(d) a nucleic acid sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 2;
(e) a nucleic acid sequence that encodes a polypeptide at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 2;
(f) a nucleic acid sequence that hybridizes under stringent conditions to SEQ
ID NO: 1;
and (g) a nucleic acid sequence comprising a fragment of any one of (a) - (f) that is at least 60 contiguous nucleotides in length.

2. An isolated polypeptide comprising or consisting of a polypeptide sequence selected from the group consisting of (a) SEQ ID NO: 2; (b) a polypeptide sequence at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 2; and (c) a polypeptide sequence comprising a fragment of any one of (a) - (b) that is at least 20 contiguous amino acids in length.

3. An isolated polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of:
(a) SEQ ID NO: 3;
(b) a nucleic acid sequence that is a degenerate variant of SEQ ID NO: 3;
(c) a nucleic acid sequence at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 3;
(d) a nucleic acid sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 4;
(e) a nucleic acid sequence that encodes a polypeptide at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 4;
(f) a nucleic acid sequence that hybridizes under stringent conditions to SEQ
ID NO: 3;
and (g) a nucleic acid sequence comprising a fragment of any one of (a) - (f) that is at least 60 contiguous nucleotides in length.

4. An isolated polypeptide comprising or consisting of a polypeptide sequence selected from the group consisting of (a) SEQ ID NO: 4; (b) a polypeptide sequence at least 50%, at least 60%, at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 4; and (c) a polypeptide sequence comprising a fragment of any one of (a) - (b) that is at least 20 contiguous amino acids in length.

5. An isolated polynucleotide comprising or consisting of a nucleic acid sequence selected from the group consisting of:
(a) SEQ ID NO: 5;
(b) a nucleic acid sequence that is a degenerate variant of SEQ ID NO: 5;
(c) a nucleic acid sequence at least 50% at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 5;
(d) a nucleic acid sequence that encodes a polypeptide having the amino acid sequence of SEQ ID NO: 6;
(e) a nucleic acid sequence that encodes a polypeptide at least 50% at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 6;

(f) a nucleic acid sequence that hybridizes under stringent conditions to SEQ
ID NO: 5;
and (g) a nucleic acid sequence comprising a fragment of any one of (a) - (f) that is at least 60 contiguous nucleotides in length.

6. An isolated polypeptide comprising or consisting of a polypeptide sequence selected from the group consisting of (a) SEQ ID NO: 6; (b) a polypeptide sequence at least 50%
at least 60% at least 65%, at least 70%, at least 75%, at least 80%, at least 85%, at least 90%, at least 95%, at least 98%, at least 99% or at least 99.9% identical to SEQ ID NO: 6; and (c) a polypeptide sequence comprising a fragment of any one of (a) - (b) that is at least 20 contiguous amino acids in length.

7. A modified host cell characterized in that the host does not express or has reduced expression or has a disruption, deletion or mutation in the polynucleotide of claims 1, 3 or 5.

8. A modified host cell characterized in that the host does not produce a functional gene product encoded by the polypeptide of claims 2, 4, or 6.