CA2864258A1 - Use of grb2, gata3, igm, and mavs genes to determine susceptible phenotypes and resistance to infectious salmon anemia (isa) in atlantic salmon (salmo salar) - Google Patents
Use of grb2, gata3, igm, and mavs genes to determine susceptible phenotypes and resistance to infectious salmon anemia (isa) in atlantic salmon (salmo salar) Download PDFInfo
- Publication number
- CA2864258A1 CA2864258A1 CA2864258A CA2864258A CA2864258A1 CA 2864258 A1 CA2864258 A1 CA 2864258A1 CA 2864258 A CA2864258 A CA 2864258A CA 2864258 A CA2864258 A CA 2864258A CA 2864258 A1 CA2864258 A1 CA 2864258A1
- Authority
- CA
- Canada
- Prior art keywords
- isa
- genes
- virus
- salmon
- fish
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Abandoned
Links
Landscapes
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Medicines Containing Antibodies Or Antigens For Use As Internal Diagnostic Agents (AREA)
Abstract
Using genes selected from the group consisting of Grb2, Gata3, IgM, MAVS and Regul genenes that serve as predictors to determine susceptible and resistant phenotypes to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar), quantifying the profile expression of these genes using PCR analysis in real time, and wherein a sample with the expression pattern for a defiance by cohabitation with ISA, which has no significant difference when compared to the expression pattern of these genes in a control sample without defiance by cohabitation to ISA, is indicative of ISA resistant phenotype, namely, which has as a characteristic, less than 40% mortality for the ISA virus and heritability of said character greater than or equal to 0.35; and a sample having a pattern of expression to a defiance of cohabitation to ISA
which happens to be low when compared to a control sample without defiance by cohabitation to ISA, is indicative of a susceptible phenotype to ISA, namely, presented as characteristic , a mortality rate exceeding 50% for the ISA virus and a heritability of such minor or equal to 0.34.
which happens to be low when compared to a control sample without defiance by cohabitation to ISA, is indicative of a susceptible phenotype to ISA, namely, presented as characteristic , a mortality rate exceeding 50% for the ISA virus and a heritability of such minor or equal to 0.34.
Description
FIELD OF THE INVENTION
The invention relates to the use of Grb2 genes (for its acronym in English, Growth factor receptor-bound protein 2) gene or receptor-bound protein 2 growth, Gata3, immunoglobulin M
(IgM), MAVS (for its acronym in English, Mitochondrial signaling antiviral protein) or mitocrondrial antiviral signaling protein and Regul to determine susceptible phenotypes and resistance to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar).
PRIOR ART
The Atlantic salmon (Salmo salar) is a widely cultivated and highly commercial aquaculture species worldwide. However, this species has susceptibility to various pathogens, resulting in losses for the salmon industry. One of the most important pathogens is the ISA virus, which can reach cumulative mortalities between 15% to 100%. Although, it has been observed in the field that there are families of fish that have a reduced mortality rate against the virus (resistant families), which could prove to be key to the development of effective treatments.
Moreover, at present, there is a clear consensus that conventional fisheries are in crisis, since as indicated according to scientific evidence, the quantities of catch have declined continuously over the past 5 years (The State of world
The invention relates to the use of Grb2 genes (for its acronym in English, Growth factor receptor-bound protein 2) gene or receptor-bound protein 2 growth, Gata3, immunoglobulin M
(IgM), MAVS (for its acronym in English, Mitochondrial signaling antiviral protein) or mitocrondrial antiviral signaling protein and Regul to determine susceptible phenotypes and resistance to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar).
PRIOR ART
The Atlantic salmon (Salmo salar) is a widely cultivated and highly commercial aquaculture species worldwide. However, this species has susceptibility to various pathogens, resulting in losses for the salmon industry. One of the most important pathogens is the ISA virus, which can reach cumulative mortalities between 15% to 100%. Although, it has been observed in the field that there are families of fish that have a reduced mortality rate against the virus (resistant families), which could prove to be key to the development of effective treatments.
Moreover, at present, there is a clear consensus that conventional fisheries are in crisis, since as indicated according to scientific evidence, the quantities of catch have declined continuously over the past 5 years (The State of world
2 fisheries and aquaculture, FAO (Food and Agricultural Organization), 2012;
http://www.fao.org/docrep/016/i2727e/i2727e.pdf). Which is vital because in the last five decades it has exceeded the population growth of 1.7% annually, which requires the production of larger quantities of food. Notably, in 2009, fish accounted for 16.6% of the animal protein intake of the world's population and some regions are almost entirely dependent on fishing.
With this scenario in between, aquaculture, which is to cultivate various species of freshwater or saltwater under controlled conditions, is emerging as an alternative to the growing demand which conventional fisheries cannot meet. This industry has presented a growth of about 7% a year (The State of world fisheries and aquaculture, FAO, 2012;
http://www.fao.org/docrep/016/i2727e/i2727e.pdf Among the branches of aquaculture, salmon farming is of great economic importance to Chile, reporting an annual growth rate of 20.5% between 1990 and 2008 (Report to the National Innovation Council for Competitiveness, http://biblioteca.cnic.cl/media/users/3/181868/files/18813/G Para da ACUI final.pdf), positioning salmon in 2008 as the fourth national export product and aquaculture as the third export CD, 02864258 2014-09-15
http://www.fao.org/docrep/016/i2727e/i2727e.pdf). Which is vital because in the last five decades it has exceeded the population growth of 1.7% annually, which requires the production of larger quantities of food. Notably, in 2009, fish accounted for 16.6% of the animal protein intake of the world's population and some regions are almost entirely dependent on fishing.
With this scenario in between, aquaculture, which is to cultivate various species of freshwater or saltwater under controlled conditions, is emerging as an alternative to the growing demand which conventional fisheries cannot meet. This industry has presented a growth of about 7% a year (The State of world fisheries and aquaculture, FAO, 2012;
http://www.fao.org/docrep/016/i2727e/i2727e.pdf Among the branches of aquaculture, salmon farming is of great economic importance to Chile, reporting an annual growth rate of 20.5% between 1990 and 2008 (Report to the National Innovation Council for Competitiveness, http://biblioteca.cnic.cl/media/users/3/181868/files/18813/G Para da ACUI final.pdf), positioning salmon in 2008 as the fourth national export product and aquaculture as the third export CD, 02864258 2014-09-15
3 sector after mining and forestry. Salmon production has grown exponentially since 1990, there were 24 thousand tons worth $ 116 million through 2008, production reached 445 thousand tons involving an income of $ 2,392 million for our country. The consolidation of the national salmon industry over the past two decades has led to Chile to position itself as a major salmon producers worldwide, with 31% of production, along with Norway (41%), United Kingdom (10 %) and Canada (7%). Salmonids with higher production in our country are Atlantic salmon (Salmo salar) with 46% of all salmon produced coho salmon (Oncorhynchus kisutch) with 26% and rainbow trout (Oncorhynchus mykiss) with 25% (Sernapesca 2010 Report, SalmonChile, ProChile).
The intensive nature of the crop has favored the emergence of a number of diseases that have caused mortalities, problems in production and economic impact on the industry. These pathogens in cropping systems are normally present in wild *fish populations; However, in natural environments they rarely cause mortalities due to the absence of stressful conditions such as handling, transport, high population density and changes in water quality, present in culture facilities (Toranzo A., B. and Magarinos Romalde Jl 2005 A Review Of The Main Bacterial Diseases In Fish Mariculture Aquaculture System. 246: 37-61). Within the
The intensive nature of the crop has favored the emergence of a number of diseases that have caused mortalities, problems in production and economic impact on the industry. These pathogens in cropping systems are normally present in wild *fish populations; However, in natural environments they rarely cause mortalities due to the absence of stressful conditions such as handling, transport, high population density and changes in water quality, present in culture facilities (Toranzo A., B. and Magarinos Romalde Jl 2005 A Review Of The Main Bacterial Diseases In Fish Mariculture Aquaculture System. 246: 37-61). Within the
4 pathogens that cause major impact on this industry are bacterial:
Salmon Rickettsial Septicemia (SRS) and Bacterial Kidney Disease (BKD), and viral: Infectious Pancreatic Necrosis (IPN) and Infectious Salmon Anemia (ISA). In recent years and particularly in 2007, domestic salmon industry has been severely affected by the ISA virus, a highly contagious disease of horizontal transmission producing a decrease in the levels of production and exports (17% in 2008-2009), the unlinking of more than 20 thousand of the 50 thousand workers in the sector and a corresponding to the loss in revenue of $ 883 million from exports (Carreno A. (2010) Impacto del virus ISA en Chile.
Publicaciones Fundacion Terram 2010) Impact del virus ISA en Chile. Publicaciones Fundacian Terram 2010).
Infectious salmon anemia (ISA) is a multisystem disease with high mortality caused by the only virus of the genus Isavirus, the Orthomyxoviridae family, which also owns the influenza virus (Dannevig B, Falk K,y Namork E. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol. 1995. 76:1353-1359;
Kawaoka, Y., Cox, N.J., Kaverin, N., Klenk, H.-D., Lamb, R.A., Mccauley, J., Nakamura,K., Palese, P., Webster, R.G., 2005.
Family Orthomyxoviridae. Disseminated around 2005, based on surface glycoprotein gene sequences. Virol. J.6, 88. 3245-3259).
The first recorded outbreak of this virus dates 1984 on the coast of southwestern Norway (Thorud K, Djupvik HO (1988) Infectious anemia in Atlantic salmon (Salmo salar L.) Bull Eur Assoc Fish Pathol. 8: 109-11). Subsequently, the disease has been reported in Canada in 1996 (Mullins JE, Groman D, Wadowska D (1998) Infectious salmon anaemia in salt water Atlantic salmon (Salmo salar L.) in New Brunswick, Canada. Bull Eur Assoc Fish Pathol 18(4): 110-114), in Scotland in 1998 (Rodger HD, Turnbull T, Muir F, Millar S, Richards RH (1998) Infectious salmon anaemia (ISA) in the United Kingdom. Bull Eur Assoc Fish Pathol 18(4):115-116), Faroe Islands in 1999 (LyngOy C (2003) Infectious salmon anaemia in Norway and the Faeroe Islands: An industrial approach. In:
Miller 0, Cipriniano RC (eds), International response to infectious salmon anaemia: Prevention, control and eradication, pp 97-10), in Chile 1999 (Kibenge F.S.B., Garate 0.N., Johnson G.
Arriagada R., Kibenge M.J.T. & Wadowska D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Dis. Aquat. Org ., 45, 9-18) and in Maine, USA, 2000 (Bouchard D.A., Brockway K., Giray C., Keleher W. &
Merrill P.L. (2001). First report of infectious salmon anemia CD, 02864258 2014-09-15 (ISA) in the United States. Bull. Eur. Assoc. Fish Pathol., 21,86-88).
This virus has a genome consisting of eight single-stranded RNA segments of negative polarity and hemagglutinating activity, receptor-destroying and capable of adsorptive (Dannevig B.H., Falk K. & Namork E. (1995). Isolation of the causal virus of infectious salmonanemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J. Gen. Virol., 76, 1353-1359;
Eliassen T.M., Froystad M.K., Dannevig B.H., Jankowska M., Brech A., Falk K.,Romoren K. & Gjoen T. (2000). Initial events in infectious salmon anemia virus infection: evidence for the requirement of a low-pH step. J. Virol., 74, 218-227; Falk K., Aspehaugv., VlasakR. & Endresen C. (2004). Identification and characterization ofviral structural proteins of infectious salmon anemia virus. J. Virol., 78, 3063-3071; Falk K, Dale OB. (2007):
Lack of receptor-destroying enzymatic activity of ISA-virus is an important virulence factor for development of ISA in Atlantic salmon. In Frisk Fisk Conference, Tromso: Jan 23-25th 2007;
Norway; Mjaaland, S., E. Rimstad, K. Falk, and B. H. Dannevig.
(1997). Genomiccharacterization of the virus causing infectious salmon anemia in Atlanticsalmon (Salmo sa1ar L.): an orthomyxo-like virus in a teleost. J. Viro1.71:7681-7686). Se ha descrito la secuencia nucleotidica de los 8 segmentos (Clouthier, S.C., Rector, T., Brown, N.E., Anderson, E.D., 2002. Genomic organization of infectious salmon anaemia virus. J. Gen. Virol.
83 (Pt. 2), 421-428) and we have identified four major structural proteins, including a nucleoprotein (NP) of 68 kDa, a protein matrix (MP) of 22 kDa, a hemagglutinin-esterase (HE) with receptor-destroying activity of 42 kDa and glycoprotein of 50 kDa with potential surface adsorption capacity (F), which are encoded in the genome segments; 3,8,6, and 5, respectively (Falk K., Aspehaugv., VlasakR. & Endresen C. (2004). Identification and characterization ofviral structural proteins of infectious salmon anemia virus. J. Virol., 78, 3063-3071). A total of 10 polypeptides exist, presenting the remaining 6, orthology to influenza genes (Cottet, L., Cortez-San Martin, M., Tello, M., Olivares, E., Rivas-Aravena, A., Vallejos, E., Sandino, A.M., Spencer, E., (2010). Bioinformatic analysis of the genome of infectious salmon anemia viruses associated with outbreaks of high mortality in Chile. J. Virol 84(22): 11916-11928). A
schematic representation of the ISA virus can be seen in the schematic representation of the ISA virus, given Bioinformatic analysis of the genome of infectious salmon anemia viruses associated with outbreaks of high mortality in Chile. J. Virol 84(22): 11916-1192).
Sequence analysis of the genomic segments have revealed differences between within isolated and defined geographical areas (Blake, S., Bouchard, D., Keleher, W., Opitz, M., Nicholson, B.L., (1999). Genomic relationships of the North American isolate of infectious salmon anemia virus (ISAV) to the Norwegian strain of ISAV. Dis. Aquat. Organ. 35 (2), 139-144;
Dannevig BH, Falk K y Namork E. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol. 1995. 76: 1353-1359;
Kibenge F.S.B., Garate 0.N., Johnson G. Arriagada R., Kibenge M.J.T. & Wadowska D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile.
Dis. Aquat. Org ., 45, 9-18). Accordingly, there are 2 main genotypes of ISA virus: European (I) genotype and America (II) genotype, which differ between 15 and 19% in their amino acid sequence of the fragments of 5 (F) and 6 (HE). Another way of classifying isolates lies with the ISA virus hemagglutinin-esterase gene, specifically in a region close to the transmembrane domain of a maximum of 35 amino acids called HPR
(Highly Polymorphic Region) which exhibits high variability in CD, 02864258 2014-09-15 pathogenic isolates given by insertions or deletions (Nylund, A., Devoid, M., Plarre, H., Isdal, E., Aarseth, M., (2003). Emergence and maintenance of infectious salmon anaemia virus (ISAV) in Europe: a new hypothesis. Dis. Aquat. Organ. 56 (1), 11-24;
Mjaaland, S., Hungnes, 0., Teig, A., Dannevig, B.H., Thorud, K., Rimstad, E., 2002. Polymorphism in the infectious salmon anemia virus hemagglutinin gene: importance and possible implications for evolution and ecology of infectious salmon anemia disease.
Virology 20 (304), 379-391). To date we have identified 35 HPRs, HPR1 and HPR2 being the most predominant, while the others are variants of these, where amino acids are added in the carboxyl region of hemagglutinin for HPR1 or in the amino region of HPR2.
In Chile, several types of HPRs have been found, HPR7b being the most prevalent in years 2007-2008 and responsible for high mortalities recorded for those years in our country (Kibenge, F.S., Godoy, M.G., Wang, Y., Kibenge, N.J., Gherardelli, V., Mansilla, S.,Lisperger, A., Jarpa, M., Larroquete, G., Avendano, F., Lara, M y Gallardo, A.. Infectious salmon anaemia virus (ISAV) isolated from the ISA disease outbreaksin Chile diverged from ISAV isolates from Norway around 1996 and was disseminated around 2005, based on surface glycoprOtein gene sequences. Virol J. 2009. 6:8-16.). A feature of this hypervariable region is the Mk 02864258 2014-09-15 existence of a variant that contains the reasons described for the other HPRs, of which the longest is called HPRO and is characterized by low pathogenic and not be cultivated in standard cell lines such as SHK-1 (Salmon Head Kidney), (McBeath, A.J., Bain, N., Snow, M., 2009. Surveillance for infectious salmon anaemia virusHPRO in marine Atlantic salmon farms across Scotland. Dis. Aquat. Organ. 87, 161 -169; Markussen, T., Jonassen, C.M., Numanovic, S., Braaen, S., Hjortaas, M., Nilsen, H.,. Mjaaland, S., 2008. Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus. Virology 374, 515-527).
Endothelial cells are one of the main objectives of the virus (Hovland T, Nylund A, Watanabe K, Endresen C. (1995).
Observation of Infectious salmon anemia virus in Atlantic salmon, Sa1mo-salar L. J Fish Dis 17:291-6) allowing the virus to replicate in different organs. In addition, we have detected the presence of the virus in polymorphonuclear cells and lymphocytes (Sommer A.I. & Mennen S. (1996). Propagation of infectious salmon anaemia virus in Atlantic salmon, Salmo salar L., head kidney macrophages. J. Fish Dis., 19, 179-183; Kawaoka, Y., Cox, N.J., Kaverin, N., Klenk, H.-D., Lamb, R.A., Mccauley, J., Nakamura,K., Palese, P., Webster, R.G., 2005. Family Orthomyxoviridae.
Mk 02864258 2014-09-15 Disseminated around 2005, based on surface glycoprotein gene sequences. Virol. J.6, 88. 3245-3259). In erythrocytes the ISA
virus are lined in the reaction of hemagglutination by interaction of sialic acid cell receptors and viral protein HE, process similar to the hemagglutination of the influenza virus in which 3 separate phenomena occurs: a) adsorption of the virus in the erythrocyte membrane, b) elution of the virus, which is not always complete c) virus absorption via endosome by erythrocytes (Kawaoka, Y., Cox, N.J., Kaverin, N., Klenk, H.-D., Lamb, R.A., Mccauley, J., Nakamura,K., Palese, P., Webster, R.G., 2005.
Family Orthomyxoviridae. Disseminated around 2005, based on surface glycoprotein gene sequences. Virol. J.6,88. 3245-3259;
Workenhe, S.T., Wadowska, D.W., Wright, G.M., Kibenge, N.J., Kibenge, F.S., (2007). Demonstration of infectious salmon anaemia virus (ISAV) endocytosis in erythrocytes of Atlantic salmon.
Virol. J. 4, 13). For the ISA virus the elution from erythrocytes is reported in various fish species except Atlantic salmon, which presents elution only in mild strains. This phenomenon would be associated with the receptor-destroying activity of the HE
protein has no effect on Atlantic salmon which would lead to severe clinical effects suffered by this species (Falk K, Dale OB. (2007): Lack of receptor-destroying enzymatic activity of ISA-virus is an important virulence factor for development of ISA
in Atlantic salmon. In Frisk Fisk Conference, Tromso: Jan 23-25th 2007; Norway). A schematic representation of the virus infectious cycle can be seen in the schematic representation of infection of a cell by ISA virus of Cottet, L., Cortez-San Martin, M., Tello, M., Olivares, E., Rivas-Aravena, A., Vallejos, E., Sandino, A.M., Spencer, E., (2010). Bioinformatic analysis of the genome of infectious salmon anemia viruses associated with outbreaks of high mortality in Chile. J. Virol 84(22): 11916-1192).
The disease in Atlantic salmon may occur with systemic and lethal nature, characterized by severe anemia and hemorrhages in various organs. The hematocrit usually is under 20% and in the most severe cases less than 10% (normal values between 35% to 64%). The virus affects mainly five organs: liver, kidney, heart, intestine and gills. Hepatic manifestation is characterized by the dark color of the liver caused by hemorrhagic necrosis. In the kidney inflammation with moderate interstitial hemorrhage and tubular necrosis occurs. The intestine appears deep red due to bleeding in the gut wall but not in the lumen. In the gill, besides pallid, in some cases the accumulation of blood occurs, particularly in the central venous sinus of these filaments. The most striking observable symptoms in Chilean cases reported for 2007 are pale gills, eye hemorrhage, exophthalmos, ascites in the abdominal cavity, hemorrhagic petechiae on the skin, abdominal jaundice, external darkening, congested liver and spleen and hemorrhages in basal fins (Godoy, M.G., Aedo, A., Kibenge, N.J., Groman, D.B., Yason, C.V., Grothusen, H., Lisperguer, A., Calbucura, M., Avendano, F., Imilan, M., Jarpa, M., Kibenge, F.S., (2008). First detection, isolation and molecular characterization of infectious salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) in Chile. BMC Vet. Res. 4, 28).
The main cause of transmission is direct contact and cohabitation with infected specimens, due to natural secretions and excretions of fish, implying that the transmission is horizontal. Because of this the main route of infection is through the gills, but cannot exclude the oral input (Mikalsen, A.B., Teig, A., Helleman, A.L., Mjaaland, S., Rimstad, E., (2001). Detection of infectious salmon anaemia virus (ISAV) by RT-PCR after cohabitant exposure in Atlantic salmon Salmo salar.
Dis. Aquat. Organ. 47 (3), 175-181). However, it has been reported that vertical transmission also exist due to the sequence similarity of strains present in Norway and Chile in 2007, so the Norwegian origin of the Chilean outbreak suggests.
Note that Chile imports large quantities of embryos from Norway and these have been infected with the virus while bringing them into the country. There is still controversy as to whether vertical transmission actually occurs or whether it was due to poor disinfection of the eggs (Nylund A, Plarre H, Karlsen M, Fridell F, Ottem KF, Bratland A, Saether PA, (2007). Transmission of infectious salmon anaemia virus (ISAV) in farmed populations of Atlantic salmon (Sa1mo salar). Arch Virol 2007, 152:151-179;
Snow M., (2011). The contribution of molecular epidemiology to the understanding and control of viral diseases of salmonid aquaculture. Veterinary Research 2011, 42:56; Vike S., Nylund S., Nylund A., (2009) ISA virus in Chile: evidence of vertical transmission. Arch Virol (2009) 154:1-8) In experiments of viral transmission, other salmon species such as brown trout (Salmo trutta) Rainbow trout and Coho salmon, these show viral replication but not present clinical symptoms of the disease, which can be reservoirs or vectors of the virus spreading, (Nylund A, Jakobsen P (1995) Sea trout as a carrier of infectious salmon anaemia virus. J Fish Biol 47: 174 -1 76;
Kibenge F.S.B., Gdrate 0.N., Johnson G. Arriagada R., Kibenge M.J.T. & Wadowska D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile.
Dis. Aquat. Org . 45, 9-18; MacWilliams C, Johnson G, Groman D, Kibenge FS. Morphologic description of infectious salmon anaemia virus (ISAV)-induced lesions in rainbow trout Oncorhynchus mykiss compared to Atlantic salmon Salmo salar. Dis Aquat Organ. 2007;
78(1):1-12). We also detected the virus in non-salmonid species such as cod (Gadus morhua) and saithe (Pollachius virens) (Grove S, Hjortaas MJ, Reitan LJ, Dannevig BH. (2007). Infectious salmon anaemia virus (ISAV) in experimentally challenged Atlantic cod (Gadus morhua). Arch Virol.;152(10):1829-37; McClure CA, Hammell KL, Dohoo IR, Gagne N.(2004) Lack of evidence of infectious salmon anemia virus in pollock Pollachius virens cohabitating with infected farmed Atlantic salmon Salmo salar. Dis Aquat Organ.; 61(1-2):149-52).
A parasite to consider in the development of the disease and in the salmon industry is sea lice or Caligus (Caligus rogercresseyi). This copepod generated skin lesions and stress which leads to a depression of the immune system resulting in a greater susceptibility to pathogens such as ISA virus. Because of their direct contact with the salmon they are believed to act as a vector and may contribute to the spread of the virus (Bravo S.
(2009), "Estrategias de Manejo Integrado para el control de Caligus en la industria del salmon en Chile").
CD, 02864258 2014-09-15 Finally due to the high density of fish handled by the salmon farms (up to 30 kg / m 3) and the proximity between the farms of southern Chile, the optimal conditions for episodes of massive outbreaks and high mortalities are presented. According to public account Sernapesca of November 2009 there have been 141 outbreaks in salmon farms, and including these, a total of 228 centers have been detecting virus, January 2009 being the highest prevalence of the disease, ie the higher rate of affected areas in relation to those who were populated with susceptible species (Atlantic salmon), reaching the prevalence of positive centers in that month to 45% (Sernapesca, 2009).
Teleost fish like salmon have an immune system, although not equal, similar to higher vertebrates, comprising an innate immune system and an adaptive one. *Press CM, Evensen 0. (1999). The morphology of the immune system in teleost fishes. Fish Shellfish Immunol 309-318; Fernandez AB, Ruiz I, de Blas I. (2002) El sistema inmune de los teleasteos (II): Respuesta inmune inespecifica. Revista Aquatic disponible en:
http://www.revistaaquatic.com/aquatic/html/art1707/inmune2.htm) The fish skin is the first line of defense against pathogens, as well as the mucous membranes lining the gills and gastrointestinal tract. The mucus that coats the skin is an important defense mechanism, as it contains a variety of reactive compounds as antimicrobial lysozymes, proteases, complement factors, C-reactive protein, lectins, interferons, eicosanoids, transferrin, piscidins and various carbohydrates (Buchmann K, Lindenstrrm T, Bresciani J. (2001) Defence mechanisms against parasites in fish and the prospect for vaccines. ActaParasitol ;46:71-81; Magnadottir B. (2006) Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137-151; Manning M J.
(1998) Immune defence systems. In: Black KD, Pickering AD
editors. Biology of farmed fish. Sheffield: Sheffield Academic Press; 1998:180-221; Woo PTK. (2007) Protective immunity in fish against protozoan diseases. Parassitologia 49:185-191). As the complement we can mention that it is composed of a number of serum proteins having three main defensive functions: a) coating pathogens and particles outside the body to facilitate recognition and destruction by phagocytic cells (opsonization), b) initiate inflammatory responses stimulating vasodilation and lymphocyte chemoattractant and c) lyse pathogens by drilling their membranes (Boshra H, Li J, Sunyer JO. (2006) Recent advances on the complement system of teleost fish. Fish Shellfish Immunol 20:239-262; Janeway CA, Travers P, Walport M, Schlomchik MJ. (2005) Immunobiology; the immune system in health and disease. 6th ed. New York: Garland Science Publishing).
Eicosanoids include prostaglandins, thromboxanes and leukotrienes, and are potent pro-inflammatory mediators. Involved in various physiological processes such as hemostasis, immune regulation, increase phagocytosis and quimioatractanctes for neutrophils (Secombes CJ. (1996) The nonspecific immune system:
cellular defenses. In: Iwama G, Nakanishi T editors. The fish immune system: organism, pathogen and environment. London:
Academic Press Ltd.; 63-103) The nonspecific immune system:
cellular defenses. In: Iwama G, Nakanishi T editors. The fish immune system: organism, pathogen and environment. London:
Academic Press Ltd.; 63-10.; Manning MJ. (1998) Immune defence systems. In: Black RD, Pickering AD editors. Biology of farmed fish. Sheffield: Sheffield Academic Press; 1998:180-221).
Interferons (IFN) are a family of proteins heterologous to confer protection against viral infections (Secombes CJ. (1996) The nonspecific immune system: cellular defenses. In: Iwama G, Nakanishi T editors. The fish immune system: organism, pathogen and environment. London: Academic Press Ltd.; 63-103). There are the Type I, which includes the IFN and IFN-3 which are produced by cells infected with the virus and can produce any cell type, and type 2, which includes IFN which is a cytokine produced by T
lymphocytes (Magnadottir B. (2006) Innate immunity of fish (overview). Fish Shellfish Immunol 2006; 20:137-151). The answer = begins when the pathogen and host interact, leading to activation of pathogen recognition receptors (PRR), among which the most prominent are the family members of toll-like receptors (TLRs) that are able to recognize pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS) of Gram-negative bacteria, peptidoglycan from Gram-positive bacteria, RNA of double and single-stranded virus and Unmethylated CpG DNA (Iliev, D., Roach, J., MacKenzie, S., Planas, J. and Goetz, FW. (2005).
Endotoxin Recognition: In fish or not in fish. FEBS Letters 579 (29):6519-6528). To this date it has been reported the existence of at least 4 TLR, two of which have been associated with viral infection in salmon, one is TLR-8 in mammals whose function is to recognize single-stranded RNA. In salmon expression of TLR-8 =
messenger level is induced in cells treated with IFN- and IFN-(Skjaeveland, D. B. Iliev, & J. B. Jorgensen (2009).
Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar.) Developmental & Comparative Immunology. 33: 1011-1017). The other TLR-9 that recognize DNA
CpG unmethylated like in mammals (Skjaeveland, D. B. Iliev, J.
Zou T. Jorgensen & J. B. Jorgensen (2008). A TLR9 homolog that is ak 02864258 2014-09-15 up-regulated by IFN- in Atlantic salmon (Salmon salar).
Developmental and Comparative Immunology, 32, 603-607).
Another alternative route to sense viral RNA is through helicase RIG-I, acting through a molecule known as IPS-1 (also called MAVS, VISA and CARDIF) activates a signaling cascade that eventually leads to the activation of type I IFN (Onomoto K, Yoneyama M, Fujita T. (2007). Regulation of antiviral innate immune responses by RIG-I family of RNA helicases. Curr Top Microbiol Immunol. 316:193-205). In salmon it is known the existence of RIG-I and described that cells transfected with cloned IPS-1 are able to induce an antiviral state (Biacchesi, S., Leberre, M., Lamoureux, A., Louise, Y., Lauret, E., Boudinot, P., and Bremont, M. (2009) MAVS Plays a Major Role in Induction of the Fish Innate Immune Response against RNA and DNA Viruses.
J. Virol. 83 (16):7815-7827 (Journal)).
Salmonids as most non-mammalian exhibit no bone marrow or lymph nodes, however, the thymus, kidney and spleen assume this role. In kidney hematopoietic activity is observed, showing stem cells that perform this function (Hanington PC, Tam J, Katzenback BA, Hitchen SJ, Barreda DR, Belosevic M. (2009). Development of macrophages of cyprinid fish. Dev Comp Immunol 33:411-429), in addition together with the spleen have extensive lattice for trapping blood hauled and presented together macrophage and lymphocyte populations of particles capable of initiating immune responses (Press CM, Evensen 0. (1999). The morphology of the immune system in teleost fishes. Fish Shellfish Immunol 309-318).
It has also been reported that the kidney presents lymphoid activity and that is the main body of B cells and antigen production (Whyte S.K.. The innate immune response of finfish-A
review of current knowledge. Fish & Shellfish Immunology, 2007.
6:1127-1151). The adaptive immune response can be divided into humoral and cellular immunity, dependent largely on lymphocytes B
and T respectively (Fernandez AB, Ruiz I, de Blas I. (2002)The immune system of teleost (II): non-specific immune response.
Aquatic magazine available at:
http://www.revistaaquatic.com/aquatic/html/art1707/inmune2.htm).
Similar to as in mammals, humoral immunity involves the recognition and binding of antigens by B lymphocytes, which differentiate into plasma cells and memory cells to produce antigen-specific antibodies or immunoglobulins and generate fast responses and pronounced in subsequent infections respectively (Hansen JD, Landis ED, Phillips RB. (2005). Discovery of a unique Ig heavy-chain isotype (IgT) in rainbow trout: Implications for a distinctive B cell developmental pathway in teleost fish. Proc Nati Acad Sci. USA. 102:6919-6924). In viral infections the immunoglobulins can bind to the surface of viruses being the predominant neutralizing IgM, which may be associated with B cell membrane and act as receptor for antigen recognition, or in its secreted form (Janeway CA, Travers P, Walport M, Schlomchik MJ.
(2005) Immunobiology; the immune system in health and disease.
6' ed. New York: Garland Science Publishing). In addition to IgM
other immunoglobulins have been described in teleosts such as IgD, and IgZ IgT, which have been cloned in Atlantic salmon and have sequence similarity (Randelli, E., Buonocore, F., Scapigliati, G. (2008). Cell markers and determinants in fish immunology. Fish Shellfish Immunol. 25, 326-340).
On the other hand, the acquired cell mediated immunity involves the activation of T lymphocytes mainly, which are activates by the interaction of the major histocompatibility complex (MHC) loaded with an antigen and the T cell receptor (TCR) (Finelli, A., K. M. Kerksiek, S. E. Allen, N. Marshall, R.
Mercado, I. Pilip, D. H. Busch y Pamer.E.G MHC class I
restricted T cell responses to Listeria monocytogenes, an intracellular bacterial pathogen. Immunol. Res.1999.19:211-223).
There are two types of MHC class I and II. The MHC class I is found most cells and acts primarily against intracellular pathogens by activating cytotoxic T lymphocytes (CD8+), whereas MHC class II, is found only on antigen-presenting cells such as macrophages, dendritic cells and lymphocytes B, and they lead to the activation of T helper lymphocytes(linfocitos T helper) (CD4+) (Nakanishi T, Ototake M. (1999). The graft-versus-host reaction (GVHR) in the ginbuna crucian carp, Carassius auratus langsdorfii. Dev Comp Immunol 23:15-26). The interactions between cells are not only mediated by cell-cell contact, but also by soluble factors such as cytokines, which account for the different types of immune responses via differential expression depending on the pathogen to display the individual faced.
Against intracellular pathogens, CD4 + T cells differentiate into Thl cells by action of IL-12 and INF, which are secreted by progenitors expressing the T-bet gene, and this gene being the regulator key to produce Thl. Th1 cells secrete molecules finally as IL-2, INF-and TNF-3 mainly promoting cellular response, generating the activation of macrophages, increased antigen presentation and differentiation of CD8 + T lymphocytes.
Extracellular pathogens against CD4 + T cells differentiate into Th2 cells by action of IL-4, which is secreted by GATA3 progenitors expressing gene. These lymphocytes secrete IL-4, IL-
Salmon Rickettsial Septicemia (SRS) and Bacterial Kidney Disease (BKD), and viral: Infectious Pancreatic Necrosis (IPN) and Infectious Salmon Anemia (ISA). In recent years and particularly in 2007, domestic salmon industry has been severely affected by the ISA virus, a highly contagious disease of horizontal transmission producing a decrease in the levels of production and exports (17% in 2008-2009), the unlinking of more than 20 thousand of the 50 thousand workers in the sector and a corresponding to the loss in revenue of $ 883 million from exports (Carreno A. (2010) Impacto del virus ISA en Chile.
Publicaciones Fundacion Terram 2010) Impact del virus ISA en Chile. Publicaciones Fundacian Terram 2010).
Infectious salmon anemia (ISA) is a multisystem disease with high mortality caused by the only virus of the genus Isavirus, the Orthomyxoviridae family, which also owns the influenza virus (Dannevig B, Falk K,y Namork E. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol. 1995. 76:1353-1359;
Kawaoka, Y., Cox, N.J., Kaverin, N., Klenk, H.-D., Lamb, R.A., Mccauley, J., Nakamura,K., Palese, P., Webster, R.G., 2005.
Family Orthomyxoviridae. Disseminated around 2005, based on surface glycoprotein gene sequences. Virol. J.6, 88. 3245-3259).
The first recorded outbreak of this virus dates 1984 on the coast of southwestern Norway (Thorud K, Djupvik HO (1988) Infectious anemia in Atlantic salmon (Salmo salar L.) Bull Eur Assoc Fish Pathol. 8: 109-11). Subsequently, the disease has been reported in Canada in 1996 (Mullins JE, Groman D, Wadowska D (1998) Infectious salmon anaemia in salt water Atlantic salmon (Salmo salar L.) in New Brunswick, Canada. Bull Eur Assoc Fish Pathol 18(4): 110-114), in Scotland in 1998 (Rodger HD, Turnbull T, Muir F, Millar S, Richards RH (1998) Infectious salmon anaemia (ISA) in the United Kingdom. Bull Eur Assoc Fish Pathol 18(4):115-116), Faroe Islands in 1999 (LyngOy C (2003) Infectious salmon anaemia in Norway and the Faeroe Islands: An industrial approach. In:
Miller 0, Cipriniano RC (eds), International response to infectious salmon anaemia: Prevention, control and eradication, pp 97-10), in Chile 1999 (Kibenge F.S.B., Garate 0.N., Johnson G.
Arriagada R., Kibenge M.J.T. & Wadowska D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile. Dis. Aquat. Org ., 45, 9-18) and in Maine, USA, 2000 (Bouchard D.A., Brockway K., Giray C., Keleher W. &
Merrill P.L. (2001). First report of infectious salmon anemia CD, 02864258 2014-09-15 (ISA) in the United States. Bull. Eur. Assoc. Fish Pathol., 21,86-88).
This virus has a genome consisting of eight single-stranded RNA segments of negative polarity and hemagglutinating activity, receptor-destroying and capable of adsorptive (Dannevig B.H., Falk K. & Namork E. (1995). Isolation of the causal virus of infectious salmonanemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J. Gen. Virol., 76, 1353-1359;
Eliassen T.M., Froystad M.K., Dannevig B.H., Jankowska M., Brech A., Falk K.,Romoren K. & Gjoen T. (2000). Initial events in infectious salmon anemia virus infection: evidence for the requirement of a low-pH step. J. Virol., 74, 218-227; Falk K., Aspehaugv., VlasakR. & Endresen C. (2004). Identification and characterization ofviral structural proteins of infectious salmon anemia virus. J. Virol., 78, 3063-3071; Falk K, Dale OB. (2007):
Lack of receptor-destroying enzymatic activity of ISA-virus is an important virulence factor for development of ISA in Atlantic salmon. In Frisk Fisk Conference, Tromso: Jan 23-25th 2007;
Norway; Mjaaland, S., E. Rimstad, K. Falk, and B. H. Dannevig.
(1997). Genomiccharacterization of the virus causing infectious salmon anemia in Atlanticsalmon (Salmo sa1ar L.): an orthomyxo-like virus in a teleost. J. Viro1.71:7681-7686). Se ha descrito la secuencia nucleotidica de los 8 segmentos (Clouthier, S.C., Rector, T., Brown, N.E., Anderson, E.D., 2002. Genomic organization of infectious salmon anaemia virus. J. Gen. Virol.
83 (Pt. 2), 421-428) and we have identified four major structural proteins, including a nucleoprotein (NP) of 68 kDa, a protein matrix (MP) of 22 kDa, a hemagglutinin-esterase (HE) with receptor-destroying activity of 42 kDa and glycoprotein of 50 kDa with potential surface adsorption capacity (F), which are encoded in the genome segments; 3,8,6, and 5, respectively (Falk K., Aspehaugv., VlasakR. & Endresen C. (2004). Identification and characterization ofviral structural proteins of infectious salmon anemia virus. J. Virol., 78, 3063-3071). A total of 10 polypeptides exist, presenting the remaining 6, orthology to influenza genes (Cottet, L., Cortez-San Martin, M., Tello, M., Olivares, E., Rivas-Aravena, A., Vallejos, E., Sandino, A.M., Spencer, E., (2010). Bioinformatic analysis of the genome of infectious salmon anemia viruses associated with outbreaks of high mortality in Chile. J. Virol 84(22): 11916-11928). A
schematic representation of the ISA virus can be seen in the schematic representation of the ISA virus, given Bioinformatic analysis of the genome of infectious salmon anemia viruses associated with outbreaks of high mortality in Chile. J. Virol 84(22): 11916-1192).
Sequence analysis of the genomic segments have revealed differences between within isolated and defined geographical areas (Blake, S., Bouchard, D., Keleher, W., Opitz, M., Nicholson, B.L., (1999). Genomic relationships of the North American isolate of infectious salmon anemia virus (ISAV) to the Norwegian strain of ISAV. Dis. Aquat. Organ. 35 (2), 139-144;
Dannevig BH, Falk K y Namork E. Isolation of the causal virus of infectious salmon anaemia (ISA) in a long-term cell line from Atlantic salmon head kidney. J Gen Virol. 1995. 76: 1353-1359;
Kibenge F.S.B., Garate 0.N., Johnson G. Arriagada R., Kibenge M.J.T. & Wadowska D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile.
Dis. Aquat. Org ., 45, 9-18). Accordingly, there are 2 main genotypes of ISA virus: European (I) genotype and America (II) genotype, which differ between 15 and 19% in their amino acid sequence of the fragments of 5 (F) and 6 (HE). Another way of classifying isolates lies with the ISA virus hemagglutinin-esterase gene, specifically in a region close to the transmembrane domain of a maximum of 35 amino acids called HPR
(Highly Polymorphic Region) which exhibits high variability in CD, 02864258 2014-09-15 pathogenic isolates given by insertions or deletions (Nylund, A., Devoid, M., Plarre, H., Isdal, E., Aarseth, M., (2003). Emergence and maintenance of infectious salmon anaemia virus (ISAV) in Europe: a new hypothesis. Dis. Aquat. Organ. 56 (1), 11-24;
Mjaaland, S., Hungnes, 0., Teig, A., Dannevig, B.H., Thorud, K., Rimstad, E., 2002. Polymorphism in the infectious salmon anemia virus hemagglutinin gene: importance and possible implications for evolution and ecology of infectious salmon anemia disease.
Virology 20 (304), 379-391). To date we have identified 35 HPRs, HPR1 and HPR2 being the most predominant, while the others are variants of these, where amino acids are added in the carboxyl region of hemagglutinin for HPR1 or in the amino region of HPR2.
In Chile, several types of HPRs have been found, HPR7b being the most prevalent in years 2007-2008 and responsible for high mortalities recorded for those years in our country (Kibenge, F.S., Godoy, M.G., Wang, Y., Kibenge, N.J., Gherardelli, V., Mansilla, S.,Lisperger, A., Jarpa, M., Larroquete, G., Avendano, F., Lara, M y Gallardo, A.. Infectious salmon anaemia virus (ISAV) isolated from the ISA disease outbreaksin Chile diverged from ISAV isolates from Norway around 1996 and was disseminated around 2005, based on surface glycoprOtein gene sequences. Virol J. 2009. 6:8-16.). A feature of this hypervariable region is the Mk 02864258 2014-09-15 existence of a variant that contains the reasons described for the other HPRs, of which the longest is called HPRO and is characterized by low pathogenic and not be cultivated in standard cell lines such as SHK-1 (Salmon Head Kidney), (McBeath, A.J., Bain, N., Snow, M., 2009. Surveillance for infectious salmon anaemia virusHPRO in marine Atlantic salmon farms across Scotland. Dis. Aquat. Organ. 87, 161 -169; Markussen, T., Jonassen, C.M., Numanovic, S., Braaen, S., Hjortaas, M., Nilsen, H.,. Mjaaland, S., 2008. Evolutionary mechanisms involved in the virulence of infectious salmon anaemia virus (ISAV), a piscine orthomyxovirus. Virology 374, 515-527).
Endothelial cells are one of the main objectives of the virus (Hovland T, Nylund A, Watanabe K, Endresen C. (1995).
Observation of Infectious salmon anemia virus in Atlantic salmon, Sa1mo-salar L. J Fish Dis 17:291-6) allowing the virus to replicate in different organs. In addition, we have detected the presence of the virus in polymorphonuclear cells and lymphocytes (Sommer A.I. & Mennen S. (1996). Propagation of infectious salmon anaemia virus in Atlantic salmon, Salmo salar L., head kidney macrophages. J. Fish Dis., 19, 179-183; Kawaoka, Y., Cox, N.J., Kaverin, N., Klenk, H.-D., Lamb, R.A., Mccauley, J., Nakamura,K., Palese, P., Webster, R.G., 2005. Family Orthomyxoviridae.
Mk 02864258 2014-09-15 Disseminated around 2005, based on surface glycoprotein gene sequences. Virol. J.6, 88. 3245-3259). In erythrocytes the ISA
virus are lined in the reaction of hemagglutination by interaction of sialic acid cell receptors and viral protein HE, process similar to the hemagglutination of the influenza virus in which 3 separate phenomena occurs: a) adsorption of the virus in the erythrocyte membrane, b) elution of the virus, which is not always complete c) virus absorption via endosome by erythrocytes (Kawaoka, Y., Cox, N.J., Kaverin, N., Klenk, H.-D., Lamb, R.A., Mccauley, J., Nakamura,K., Palese, P., Webster, R.G., 2005.
Family Orthomyxoviridae. Disseminated around 2005, based on surface glycoprotein gene sequences. Virol. J.6,88. 3245-3259;
Workenhe, S.T., Wadowska, D.W., Wright, G.M., Kibenge, N.J., Kibenge, F.S., (2007). Demonstration of infectious salmon anaemia virus (ISAV) endocytosis in erythrocytes of Atlantic salmon.
Virol. J. 4, 13). For the ISA virus the elution from erythrocytes is reported in various fish species except Atlantic salmon, which presents elution only in mild strains. This phenomenon would be associated with the receptor-destroying activity of the HE
protein has no effect on Atlantic salmon which would lead to severe clinical effects suffered by this species (Falk K, Dale OB. (2007): Lack of receptor-destroying enzymatic activity of ISA-virus is an important virulence factor for development of ISA
in Atlantic salmon. In Frisk Fisk Conference, Tromso: Jan 23-25th 2007; Norway). A schematic representation of the virus infectious cycle can be seen in the schematic representation of infection of a cell by ISA virus of Cottet, L., Cortez-San Martin, M., Tello, M., Olivares, E., Rivas-Aravena, A., Vallejos, E., Sandino, A.M., Spencer, E., (2010). Bioinformatic analysis of the genome of infectious salmon anemia viruses associated with outbreaks of high mortality in Chile. J. Virol 84(22): 11916-1192).
The disease in Atlantic salmon may occur with systemic and lethal nature, characterized by severe anemia and hemorrhages in various organs. The hematocrit usually is under 20% and in the most severe cases less than 10% (normal values between 35% to 64%). The virus affects mainly five organs: liver, kidney, heart, intestine and gills. Hepatic manifestation is characterized by the dark color of the liver caused by hemorrhagic necrosis. In the kidney inflammation with moderate interstitial hemorrhage and tubular necrosis occurs. The intestine appears deep red due to bleeding in the gut wall but not in the lumen. In the gill, besides pallid, in some cases the accumulation of blood occurs, particularly in the central venous sinus of these filaments. The most striking observable symptoms in Chilean cases reported for 2007 are pale gills, eye hemorrhage, exophthalmos, ascites in the abdominal cavity, hemorrhagic petechiae on the skin, abdominal jaundice, external darkening, congested liver and spleen and hemorrhages in basal fins (Godoy, M.G., Aedo, A., Kibenge, N.J., Groman, D.B., Yason, C.V., Grothusen, H., Lisperguer, A., Calbucura, M., Avendano, F., Imilan, M., Jarpa, M., Kibenge, F.S., (2008). First detection, isolation and molecular characterization of infectious salmon anaemia virus associated with clinical disease in farmed Atlantic salmon (Salmo salar) in Chile. BMC Vet. Res. 4, 28).
The main cause of transmission is direct contact and cohabitation with infected specimens, due to natural secretions and excretions of fish, implying that the transmission is horizontal. Because of this the main route of infection is through the gills, but cannot exclude the oral input (Mikalsen, A.B., Teig, A., Helleman, A.L., Mjaaland, S., Rimstad, E., (2001). Detection of infectious salmon anaemia virus (ISAV) by RT-PCR after cohabitant exposure in Atlantic salmon Salmo salar.
Dis. Aquat. Organ. 47 (3), 175-181). However, it has been reported that vertical transmission also exist due to the sequence similarity of strains present in Norway and Chile in 2007, so the Norwegian origin of the Chilean outbreak suggests.
Note that Chile imports large quantities of embryos from Norway and these have been infected with the virus while bringing them into the country. There is still controversy as to whether vertical transmission actually occurs or whether it was due to poor disinfection of the eggs (Nylund A, Plarre H, Karlsen M, Fridell F, Ottem KF, Bratland A, Saether PA, (2007). Transmission of infectious salmon anaemia virus (ISAV) in farmed populations of Atlantic salmon (Sa1mo salar). Arch Virol 2007, 152:151-179;
Snow M., (2011). The contribution of molecular epidemiology to the understanding and control of viral diseases of salmonid aquaculture. Veterinary Research 2011, 42:56; Vike S., Nylund S., Nylund A., (2009) ISA virus in Chile: evidence of vertical transmission. Arch Virol (2009) 154:1-8) In experiments of viral transmission, other salmon species such as brown trout (Salmo trutta) Rainbow trout and Coho salmon, these show viral replication but not present clinical symptoms of the disease, which can be reservoirs or vectors of the virus spreading, (Nylund A, Jakobsen P (1995) Sea trout as a carrier of infectious salmon anaemia virus. J Fish Biol 47: 174 -1 76;
Kibenge F.S.B., Gdrate 0.N., Johnson G. Arriagada R., Kibenge M.J.T. & Wadowska D. (2001). Isolation and identification of infectious salmon anaemia virus (ISAV) from Coho salmon in Chile.
Dis. Aquat. Org . 45, 9-18; MacWilliams C, Johnson G, Groman D, Kibenge FS. Morphologic description of infectious salmon anaemia virus (ISAV)-induced lesions in rainbow trout Oncorhynchus mykiss compared to Atlantic salmon Salmo salar. Dis Aquat Organ. 2007;
78(1):1-12). We also detected the virus in non-salmonid species such as cod (Gadus morhua) and saithe (Pollachius virens) (Grove S, Hjortaas MJ, Reitan LJ, Dannevig BH. (2007). Infectious salmon anaemia virus (ISAV) in experimentally challenged Atlantic cod (Gadus morhua). Arch Virol.;152(10):1829-37; McClure CA, Hammell KL, Dohoo IR, Gagne N.(2004) Lack of evidence of infectious salmon anemia virus in pollock Pollachius virens cohabitating with infected farmed Atlantic salmon Salmo salar. Dis Aquat Organ.; 61(1-2):149-52).
A parasite to consider in the development of the disease and in the salmon industry is sea lice or Caligus (Caligus rogercresseyi). This copepod generated skin lesions and stress which leads to a depression of the immune system resulting in a greater susceptibility to pathogens such as ISA virus. Because of their direct contact with the salmon they are believed to act as a vector and may contribute to the spread of the virus (Bravo S.
(2009), "Estrategias de Manejo Integrado para el control de Caligus en la industria del salmon en Chile").
CD, 02864258 2014-09-15 Finally due to the high density of fish handled by the salmon farms (up to 30 kg / m 3) and the proximity between the farms of southern Chile, the optimal conditions for episodes of massive outbreaks and high mortalities are presented. According to public account Sernapesca of November 2009 there have been 141 outbreaks in salmon farms, and including these, a total of 228 centers have been detecting virus, January 2009 being the highest prevalence of the disease, ie the higher rate of affected areas in relation to those who were populated with susceptible species (Atlantic salmon), reaching the prevalence of positive centers in that month to 45% (Sernapesca, 2009).
Teleost fish like salmon have an immune system, although not equal, similar to higher vertebrates, comprising an innate immune system and an adaptive one. *Press CM, Evensen 0. (1999). The morphology of the immune system in teleost fishes. Fish Shellfish Immunol 309-318; Fernandez AB, Ruiz I, de Blas I. (2002) El sistema inmune de los teleasteos (II): Respuesta inmune inespecifica. Revista Aquatic disponible en:
http://www.revistaaquatic.com/aquatic/html/art1707/inmune2.htm) The fish skin is the first line of defense against pathogens, as well as the mucous membranes lining the gills and gastrointestinal tract. The mucus that coats the skin is an important defense mechanism, as it contains a variety of reactive compounds as antimicrobial lysozymes, proteases, complement factors, C-reactive protein, lectins, interferons, eicosanoids, transferrin, piscidins and various carbohydrates (Buchmann K, Lindenstrrm T, Bresciani J. (2001) Defence mechanisms against parasites in fish and the prospect for vaccines. ActaParasitol ;46:71-81; Magnadottir B. (2006) Innate immunity of fish (overview). Fish Shellfish Immunol 2006;20:137-151; Manning M J.
(1998) Immune defence systems. In: Black KD, Pickering AD
editors. Biology of farmed fish. Sheffield: Sheffield Academic Press; 1998:180-221; Woo PTK. (2007) Protective immunity in fish against protozoan diseases. Parassitologia 49:185-191). As the complement we can mention that it is composed of a number of serum proteins having three main defensive functions: a) coating pathogens and particles outside the body to facilitate recognition and destruction by phagocytic cells (opsonization), b) initiate inflammatory responses stimulating vasodilation and lymphocyte chemoattractant and c) lyse pathogens by drilling their membranes (Boshra H, Li J, Sunyer JO. (2006) Recent advances on the complement system of teleost fish. Fish Shellfish Immunol 20:239-262; Janeway CA, Travers P, Walport M, Schlomchik MJ. (2005) Immunobiology; the immune system in health and disease. 6th ed. New York: Garland Science Publishing).
Eicosanoids include prostaglandins, thromboxanes and leukotrienes, and are potent pro-inflammatory mediators. Involved in various physiological processes such as hemostasis, immune regulation, increase phagocytosis and quimioatractanctes for neutrophils (Secombes CJ. (1996) The nonspecific immune system:
cellular defenses. In: Iwama G, Nakanishi T editors. The fish immune system: organism, pathogen and environment. London:
Academic Press Ltd.; 63-103) The nonspecific immune system:
cellular defenses. In: Iwama G, Nakanishi T editors. The fish immune system: organism, pathogen and environment. London:
Academic Press Ltd.; 63-10.; Manning MJ. (1998) Immune defence systems. In: Black RD, Pickering AD editors. Biology of farmed fish. Sheffield: Sheffield Academic Press; 1998:180-221).
Interferons (IFN) are a family of proteins heterologous to confer protection against viral infections (Secombes CJ. (1996) The nonspecific immune system: cellular defenses. In: Iwama G, Nakanishi T editors. The fish immune system: organism, pathogen and environment. London: Academic Press Ltd.; 63-103). There are the Type I, which includes the IFN and IFN-3 which are produced by cells infected with the virus and can produce any cell type, and type 2, which includes IFN which is a cytokine produced by T
lymphocytes (Magnadottir B. (2006) Innate immunity of fish (overview). Fish Shellfish Immunol 2006; 20:137-151). The answer = begins when the pathogen and host interact, leading to activation of pathogen recognition receptors (PRR), among which the most prominent are the family members of toll-like receptors (TLRs) that are able to recognize pathogen-associated molecular patterns (PAMPs) such as lipopolysaccharide (LPS) of Gram-negative bacteria, peptidoglycan from Gram-positive bacteria, RNA of double and single-stranded virus and Unmethylated CpG DNA (Iliev, D., Roach, J., MacKenzie, S., Planas, J. and Goetz, FW. (2005).
Endotoxin Recognition: In fish or not in fish. FEBS Letters 579 (29):6519-6528). To this date it has been reported the existence of at least 4 TLR, two of which have been associated with viral infection in salmon, one is TLR-8 in mammals whose function is to recognize single-stranded RNA. In salmon expression of TLR-8 =
messenger level is induced in cells treated with IFN- and IFN-(Skjaeveland, D. B. Iliev, & J. B. Jorgensen (2009).
Identification and characterization of TLR8 and MyD88 homologs in Atlantic salmon (Salmo salar.) Developmental & Comparative Immunology. 33: 1011-1017). The other TLR-9 that recognize DNA
CpG unmethylated like in mammals (Skjaeveland, D. B. Iliev, J.
Zou T. Jorgensen & J. B. Jorgensen (2008). A TLR9 homolog that is ak 02864258 2014-09-15 up-regulated by IFN- in Atlantic salmon (Salmon salar).
Developmental and Comparative Immunology, 32, 603-607).
Another alternative route to sense viral RNA is through helicase RIG-I, acting through a molecule known as IPS-1 (also called MAVS, VISA and CARDIF) activates a signaling cascade that eventually leads to the activation of type I IFN (Onomoto K, Yoneyama M, Fujita T. (2007). Regulation of antiviral innate immune responses by RIG-I family of RNA helicases. Curr Top Microbiol Immunol. 316:193-205). In salmon it is known the existence of RIG-I and described that cells transfected with cloned IPS-1 are able to induce an antiviral state (Biacchesi, S., Leberre, M., Lamoureux, A., Louise, Y., Lauret, E., Boudinot, P., and Bremont, M. (2009) MAVS Plays a Major Role in Induction of the Fish Innate Immune Response against RNA and DNA Viruses.
J. Virol. 83 (16):7815-7827 (Journal)).
Salmonids as most non-mammalian exhibit no bone marrow or lymph nodes, however, the thymus, kidney and spleen assume this role. In kidney hematopoietic activity is observed, showing stem cells that perform this function (Hanington PC, Tam J, Katzenback BA, Hitchen SJ, Barreda DR, Belosevic M. (2009). Development of macrophages of cyprinid fish. Dev Comp Immunol 33:411-429), in addition together with the spleen have extensive lattice for trapping blood hauled and presented together macrophage and lymphocyte populations of particles capable of initiating immune responses (Press CM, Evensen 0. (1999). The morphology of the immune system in teleost fishes. Fish Shellfish Immunol 309-318).
It has also been reported that the kidney presents lymphoid activity and that is the main body of B cells and antigen production (Whyte S.K.. The innate immune response of finfish-A
review of current knowledge. Fish & Shellfish Immunology, 2007.
6:1127-1151). The adaptive immune response can be divided into humoral and cellular immunity, dependent largely on lymphocytes B
and T respectively (Fernandez AB, Ruiz I, de Blas I. (2002)The immune system of teleost (II): non-specific immune response.
Aquatic magazine available at:
http://www.revistaaquatic.com/aquatic/html/art1707/inmune2.htm).
Similar to as in mammals, humoral immunity involves the recognition and binding of antigens by B lymphocytes, which differentiate into plasma cells and memory cells to produce antigen-specific antibodies or immunoglobulins and generate fast responses and pronounced in subsequent infections respectively (Hansen JD, Landis ED, Phillips RB. (2005). Discovery of a unique Ig heavy-chain isotype (IgT) in rainbow trout: Implications for a distinctive B cell developmental pathway in teleost fish. Proc Nati Acad Sci. USA. 102:6919-6924). In viral infections the immunoglobulins can bind to the surface of viruses being the predominant neutralizing IgM, which may be associated with B cell membrane and act as receptor for antigen recognition, or in its secreted form (Janeway CA, Travers P, Walport M, Schlomchik MJ.
(2005) Immunobiology; the immune system in health and disease.
6' ed. New York: Garland Science Publishing). In addition to IgM
other immunoglobulins have been described in teleosts such as IgD, and IgZ IgT, which have been cloned in Atlantic salmon and have sequence similarity (Randelli, E., Buonocore, F., Scapigliati, G. (2008). Cell markers and determinants in fish immunology. Fish Shellfish Immunol. 25, 326-340).
On the other hand, the acquired cell mediated immunity involves the activation of T lymphocytes mainly, which are activates by the interaction of the major histocompatibility complex (MHC) loaded with an antigen and the T cell receptor (TCR) (Finelli, A., K. M. Kerksiek, S. E. Allen, N. Marshall, R.
Mercado, I. Pilip, D. H. Busch y Pamer.E.G MHC class I
restricted T cell responses to Listeria monocytogenes, an intracellular bacterial pathogen. Immunol. Res.1999.19:211-223).
There are two types of MHC class I and II. The MHC class I is found most cells and acts primarily against intracellular pathogens by activating cytotoxic T lymphocytes (CD8+), whereas MHC class II, is found only on antigen-presenting cells such as macrophages, dendritic cells and lymphocytes B, and they lead to the activation of T helper lymphocytes(linfocitos T helper) (CD4+) (Nakanishi T, Ototake M. (1999). The graft-versus-host reaction (GVHR) in the ginbuna crucian carp, Carassius auratus langsdorfii. Dev Comp Immunol 23:15-26). The interactions between cells are not only mediated by cell-cell contact, but also by soluble factors such as cytokines, which account for the different types of immune responses via differential expression depending on the pathogen to display the individual faced.
Against intracellular pathogens, CD4 + T cells differentiate into Thl cells by action of IL-12 and INF, which are secreted by progenitors expressing the T-bet gene, and this gene being the regulator key to produce Thl. Th1 cells secrete molecules finally as IL-2, INF-and TNF-3 mainly promoting cellular response, generating the activation of macrophages, increased antigen presentation and differentiation of CD8 + T lymphocytes.
Extracellular pathogens against CD4 + T cells differentiate into Th2 cells by action of IL-4, which is secreted by GATA3 progenitors expressing gene. These lymphocytes secrete IL-4, IL-
5, IL-6, IL-9, IL-10, and IL-13 that activate B cells to CD, 02864258 2014-09-15 antibody-mediated response (Janeway CA, Travers P, Walport M, Schlomchik NJ. (2005) Immunobiology; the immune system in health and disease. 6th ed. New York: Garland Science Publishing).
The prior art, in particular the following patent documents may be mentioned:
WO 2004024956, where it describes the identification resistant Atlantic salmon and trout susceptible to viral diseases (ISA, IPN), and bacterial, to determine the genotype of a salmon kit, chip type, molecular markers typing containing gene sequences belonging to the described English Histocompability Main complex (MHC, its acronym in English Histocompability Main complex) class I and MHC class II alpha/beta. The use of technology is in the field of reproduction.
W00226784 refers to the use of nucleotide sequences encoding the structural proteins M1 and M2 of the ISA virus for use in vaccines, generation of antibodies against proteins or diagnostic kits or detection of ISA virus.
W02012075597 describes a method for determining the virulence of a virus infection by infectious pancreatic necrosis (IPN), serotype Sp from a tissue sample of salmon. RNA sample is extracted first, amplified by PCR the gene region corresponding to the VP2 protein, the purified PCR product is sequenced, the nucleotide sequence into an amino acid sequence results, and finally the presence of threonine, proline or alanine amino acids were identified at a given position, and in this case it is determined if the IPN virus has high or medium virulence.
Furthermore, in the market the following products related to the area of the present invention.
The product Sb + Health SalmoBreed comprising eggs of Salmo salar (Atlantic salmon) species that are resistant to ISA and IPN
virus and furunculosis. These eggs are genetically selected to deliver better growth rates and survival throughout the life cycle of the salmon. This product is a selection made at a salmon parental level, based on various parameters, including among others, resistance to ISA.
The product AquaGen Atlantic QTL-innOva IPN/PD corresponds to eggs of Salmo salar species originating from spawning salmon that are highly resistant to infectious pancreatic necrosis virus (IPN, its acronym in English, Infectious Pancreatic Necrosis) and pancreas disease (PD, its acronym in English, Pancreas Disease), where using the technique of marker-assisted selection is selected directly parenting that are used in the production of eggs that have specific genetic markers or a quantitative trait locci, QTL (from its acronym in English, quantitative trait locci) which are associated with resistance to a virus. The selection is made at both family and individual levels, which ensures high resistance to IPN and/or PD virus in the offspring or the eggs.
The subunit vaccine against infectious salmon anemia (injectable) Centrovet is an ISA virus vaccine for S. salar made from this virus recombinant proteins produced in yeast cultures.
Help to prevention of infectious salmon anemia in pre-smolt salmonid fish starting from 30 grams of weight.
Transcriptome Sequencing services, LC Science, refer to an RNA sequencing service (RNA-seq) technology using high throughput sequencing to determine structures Illumina gene splicing patterns, posttranscriptional modifications, detecting new or rare transcripts and quantification of changes at the level of transcript expression in various organisms, and corresponds to a generic service and not focused only on salmon.
The technical assistance services, genetic and breeding programs in general are a service of aquaculture breeding species of interest including Atlantic salmon. His focus has been mainly improved the percentage of weight gain of salmon, being, between 5-8% for the Atlantic salmon.
Also, there have been developed or are being developed, a series of investigations in the field of the invention, for example, the following projects are listed below:
Project development and validation of a chip of SNPs to determine the molecular basis and genetic improvement of disease resistance in Salmo salar Aquainnovo SA 2012-2015. In this project a system of genetic screening to identify disease resistant Atlantic salmon produced by ISA and IPN virus, using the technique of Single nucleotide polymorphisms, SNPs (for its acronym in English, Single Nucleotide Polymorphism) in chip format.
Project development and validation of genetic markers of immune response to ISA of Fisheries and Oceans Canada, 2007-2009, identified from a genomic point of view using DNA microchips, immunological genetic markers involved in the response to ISA
virus. Validation of these markers in vivo provide information for the study of disease, the resistance of the salmon and the response thereof to vaccines.
The present invention relates to the use of Gata3, Grb2, IgM, MAVS and Regul genes determining phenotypes and Resist susceptible to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar).
In the present invention, the level of expression of selected genes specifically related to the response against ISA
virus in fish susceptible and quantified virus phenotypes and gene expression profiles associating, to each phenotype.
They were selected according to criteria ontological and functional genomics, genes from the group consisting in Gata3, Grb2, IgM, MAVS y Regul and others.
To quantify the expression levels of each gene of salmon with resistant and susceptible phenotypes, PCR was used in real-time from tissues obtained from salmon with resistant and susceptible phenotypes.
Generally, it resulted that the expression of selected genes tend to be lower in the fish susceptible phenotype,and then, Gata3, Grb2, IgM, MAVS and Regul and found useful as markers for differentiated phenotype "resistant" to "susceptible".
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 Graph of cumulative mortality of fish families corresponding to phenotypes resistant and susceptible. Each challenge was performed in duplicate for greater range.
Figure 2 Ribosomal bands of 18S and 28S RNAs corresponding to susceptible groups (A), and resistant controls (B), displayed on agarose gel at 1%.
Figure 3 Dissociation curves analyzed genes: annexin (A), cathepsin (B), Gata 3 (C), Grb2 (D), HSP90 (E), IgM (F), IgZ (G), Mays (H), Tbet (I), Regul (J). The presence of a single PCR
product was observed.
Figure 4 Normalized relative expression of candidate immune genes, IgM (A), Grb2 (B), HSP 90 (C), Annexin (D) and Regul (E) genes are shown. Bars with squares representing individuals and susceptible to fine lines resistant individuals. Data are the average of 9 individuals per phenotype, normalized against 18S
rRNA gene expression and adjusted for relative efficiency. (*) Denotes significant difference from control (* p <0.05, ** p <0.01, *** p <0.001).
Figure 5 Normalized relative expression of immune candidate genes, genes with similar expression pattern Cathepsin (A), IgZ
(B), Mays (C), Gata3 (D) and Tbet (E) are shown. Bars with squares representing individuals and susceptible to fine lines resistant individuals. Data are the average of 9 individuals per phenotype, normalized against 18S rRNA gene expression and adjusted for relative efficiency. (*) Denotes significant difference from control (* p <0.05, ** p <0.01, *** p <0.001) DETAILED DESCRIPTION OF THE INVENTION
In general, one of the search strategies of candidate genes is functional genomics, which aims to relate the sequence of a gene with the function that it has. To achieve this goal platforms like microarrays are used, which are based on the hybridization of fluorescently labeled complementary DNA from two different conditions, with thousands of genes present on the microarray chip (Belbin TJ, Gaspar J, Haigentz M, Perez .. -Soler R, Keller SM, Prystowsky MB, Childs G, Socci ND (2004) Indirect measurements of differential gene expression with cDNA
microarrays Biotechniques 2004, 36:.. 310-314). This results in differences in the expression of the genes studied under both conditions. However, microarray data are subject to tests (genes) that each platform may possess. A new "RNA sequencing" technology allows access to the RNA sequence with differential expression in a broad and comprehensive sense, making it an excellent tool in the search for candidate genes (Wang Z, Gerstein M, Snyder M.
(2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10(1):57-63).
Differential expression patterns of certain genes, representative of a particular phenotype can be analyzed using the Polymerase chain reaction (PCR). A variant of this reaction is the real-time PCR, which uses fluorescent markers for monitoring DNA amplification in each cycle. This is characterized by its sensitivity and specificity, making it suitable for detailed analysis of genes of interest (Pfaffl M.W. y Hageleit,M.
(2001) Validities of mRNA quantificationusing recombinant RNA and recombinant DNA external calibrationcurves in real-time RT-PCR.
Biotechnol. Lett., 23, 275-282).
In the present invention, the technique "RNA sequencing"
technology that uses Illumina-Solexa sequencing, and develop an experiment that includes resistant and susceptible Antlantic salmon families to the ISA virus. The genetic status of families was determined according to the level of heritability; which corresponds to a proportion of phenotypic variation in a population, attributable to genotypic variation among individuals. The value of heritability can vary (for each feature) in different populations or even in the same population at different points in its history. For purposes of this description, if the value is greater than or equal to 0.35 will be classified as resistant family and less than or equal to 0.34 for susceptible family. Besides the total mortalities within each family must be consistent with expectations (higher in susceptible).
The experiment results indicated RNA sequencing different candidates differentially expressed genes between the two phenotypes. Within the main ontological categories associated noted: a) signal transduction, b) regulation / proliferation of B
cells, c) a stress response, d) T-cell receptors, d) differentiation of T cells, e) immune response, f) regulation of transcription, g) regulation of endothelial cell migration h) viral response. For each of these categories were selected candidate genes representative. The genes, their function and their associated biological processes are detailed in Table 1.
Table 1. Candidate genes selected for Real time with their respective associated function and biological process.
Genes Process Function of its protein Candidates Biological Anexina A- Regulatory Inhibition of synthesis of 1 inflammatory prostaglandins, leukotrienes and Response thromboxanes, anti-inflammatory effect, inhibition of Leukocyte chemotaxis Cathepsin Lymphocyte Involved in proteolysis and antigen proliferatio production to charge MHC II.
n T and B
Gata 3 T Lymphocyte Signage for synthesis of Th2 differentiat lymphocytes.
ion Grb2 Signal Adapter protein, linked to signal transduction transduction of tyrosine kinases - regulation activated by lymphocyte antigen.
of the Linked to positive signaling by the transcriptio TCR.
HSP 90 Response to Proper folding of poly peptides, stress chaperone protein restauration.
IgM Humoral Identification and neutralization of Response pathogens, complement activation, precipitation, agglutination ak 02864258 2014-09-15 IgZ Humoral Identification and neutralization of Response pathogens, precipitation, agglutination MAVS Response to Adapter protein, involved in sensing virus viral RNA and activation of IFN-I
Tbet T lymphocyte Signage for synthesis of Thl differentiat lymphocytes ion Regul Regulation Negative regulator of G protein and of signaling pathway, acceleration GTP-endothelial GDP conversion, decrease of the migration effect of chemokines and immune cell Regulation migration of transcriptio 18S Ribosome Constitutive gene, used as reference assembly gene Al Annexin inhibits phospholipase protein 2, which releases arachidonic acid from the cell, this finally transformed into prostaglandins, leukotrienes and thromboxanes (Eicosanoids), which are associated with inflammatory processes. Note that prolonged inflammatory processes cause great damage to tissues and organs, so it is important to analyze genes related to the biosynthesis of eicosanoids (Glaser KB. (1995): Regulation of phospholipase A2 enzymes: selective inhibitors and their pharmacological potential. Adv Pharmacol 1995, 32:31-66).
Cathepsin S is a cysteine protease expressed in the antigen presenting cells, which has the function to generate antigens for loading on MHCII. It has been reported that deficiency in this gene produces deficient mitochondrial damage and increased levels of reactive oxygen species (ROS), as well as problems in signaling MHCII (Costantino CM, Hang HC, Kent SC, Hafler DA, Ploegh HL. (2008) Lysosomal cysteine and aspartic proteases are heterogeneously expressed and act redundantly to initiate human invariant chain degradation. J. Immunol 180:2876-2885. [PubMed:
18292509]). It is analyzed for its relation to the loading of MHCII antigens.
Grb2 is an adapter protein linked to the activation of the MAP kinase pathway and signal transduction in lymphocytes.
Positively regulates the signaling by the TCR (T cell receptor), with this development activating T cells and negatively signaling the BCR (B cell receptor, thereby inducing an immunity response linked more cellular than humoral (Jang IK., Zhang J., Gu H.
(2009) Grb2, a simple adapter with complex roles in lymphocyte development, function, and signaling. Inmunol Rev 232; 150-159).
HSP90is a protein involved in the correct folding of polypeptides, protein renaturation heat damaged and as chaperone.
It is expressed mainly by either osmotic stress, by contaminants, or immune response (Pearl LH y Prodromou C. Structure, function, and mechanism of the Hsp90 molecular chaperone. 2001. Adv Protein Chem 59: 157-186.). It is mainly used in this thesis as a marker of stress. IgZ and IgM immunoglobulins are the first of these present in greater amounts in salmon and as primary response against pathogens (Frazer, J.K. and J.D. Capra. Immunoglobulins:
structure and function. En Fundamental Immunology, 1999. 4th ed.
W.E. Paul, editor. Lippincott-Raven, Philadelphia. 37-74.). As IgZ not yet been described but its function is thought to be more specific immunoglobin(Gamez-Lucia Duato E. The major histocompatibility complex. In Manual of Veterinary Immunology 2007. Gomez-Lucia E, Blanco MM y Domenech A (eds.). Pearson-Prentice Hall. Madrid. pp. 1/7-136).Tbet and Gata3 antagonistic genes are involved in differentiation of T cells into Thl and Th2, respectively. Both genes are key regulators in the fate of CD4 + T lymphocytes and analyzed as markers of cellular and humoral immunity. Regul is a negative regulator of G protein signaling accelerates the conversion of GTP to GDP, reducing signaling downstream of G-protein function This repressive effect decreases by chemokines and immune cell migration (Tiffany Tran, Pedro Paz, Sharlene Velichko, Jill Cifrese, Praveen Belur, Ken D.
Yamaguchi, Karin Ku, Parham Mirshahpanah, Anthony T. Reder y Croze. E. Interferon-1b Induces the Expression of RGS1 a Negative Regulator of G-Protein Signaling. International Journal of Cell Biology. 2010. 7: 1-12).
Essentially, alternatives to control the infection caused by the ISA virus in Atlantic salmon can be grouped into three: i) vaccines, which corresponds to the currently used alternative mainly due to the obligation of the national authority (in Chile, Sernapesca) to vaccinate all fish in smoltification stage post (General fisheries and Aquaculture Law N 20.632 of Chile).
There are currently, in Chile, more than 10 commercial vaccines registered for ISA, which can be mono or polyvalent molecules inactivated virus and primarily injectable or oral type.
Unfortunately there is no information currently published regarding the actual coverage of vaccines against ISA, internal reports only restricted production companies. However, it is CD, 02864258 2014-09-15 widely known that the coverage of vaccines in field does not correspond to a 100% (Mikalsen, A.B., Sindre, H., Torgersen, J. y Rimstad, E. Protective effects of a DNA vaccine expressing the infectious salmon anemia virus hemagglutinin-esterase in Atlantic salmon. 2005. Vaccine 23:4895-4905; Lauscher a., KrossOy B., Frost P., Grove S., Kanig m., Bohlin J., Falk K., Austb0 L., Rimstad E. (2011). Immune responses in Atlantic salmon (Salmo salar) following protective vaccination against Infectious salmon anemia (ISA) and subsequent ISA virus infection. Vaccine, Volume 29, chapter 37, 6392-6401), ie not all vaccinated individuals fail to develop immunoprotection, ii) Genetics, which corresponds to a classical alternative selection in the context of genetic animal model, which is mainly based on the detection and utilization of resistant individuals with a given disease and subsequent design of controlled crosses. To date, this alternative has been very successful but only in certain companies which have the advantage of the heterogeneous resistant and iii) fish, which range from immunostimulating, antiviral and synthetic peptides.
By improving family because controlled crosses, fish families that have ISA virus resistance, finally resulted in lower cumulative mortalities were obtained (less than 40% for this CD, 02864258 2014-09-15 description and heritability (H) greater than or equal to 0.35) in compared to other sites. These are called resistant families.
At the same time there are also families who have high mortality (50% or higher for this description and H less than or equal to 0.34) against the virus, which will be classified as susceptible.
Taking these two phenotypes base (resistant and susceptible), the expression patterns of candidate genes and their relationship to the resistance or susceptibility to the pathogen compared.
For this, the following actions were taken:
= Quantify, evaluate and associated expression profiles of candidate genes in resistant and susceptible fish with ISA virus as the initial target phenotypes.
= Develop and standardize the analysis of real-time PCR
quantification of the expression of candidate genes as the next target.
= Quantified as relative candidate genes in susceptible and resistant phenotypes aim below.
= Analyze the feasibility of some of the selected genes may serve as a marker of resistance to the ISA virus, as the ultimate goal In the initial phase, a challenge test was performed with 2 families of S. salar (SNIR and Fanad, resistant and susceptible, CD. 02864258 2014-09-15 respectively) to determine the degree of resistance to ISA virus.
To this was used a Chilean viral isolate which was sequenced in the hypervariable region (HPR) resulting HPR type 7b which was inoculated intraperitoneally injected in the ventral midline at 0.2 mL inoculum per fish Trojan which contains a degree of 7.2 x 104 TCID50. Were infected only 40% of the fish pond, waiting for the remaining 60% were infected by cohabitation, thus infection resembles what happens in the field.
Before starting the test, the health status of fish in fish farming was confirmed source. A visit was made in the field to check the general condition of the fish of the selected group. At the same time, taking 30 fish sampled for analysis in the laboratory was performed. The analyzes cover 15 necropsies, gram analysis, Flavo, BKD, RT-PCR IPNV and RT-PCR ISA. If positive, the selected group of either fish pathogens analyzed, it is discarded and a new group of fish sought.
Tanks 720 L
Salinity 32 Temperature 12 C acclimatization and 14 C defiance Oxygen (saturation) 85-100%
Replacement rate 1.5 replacement/hour N of fish per tank 363 trojans y 528 (acclimatization) cohabitants N of fish per tank 110 trojans + 160 (cohabitation) cohabitants Density 20-30 kg/m3 In the following experimental design scheme associated with the challenge illustrated by cohabitation:
=
35 kg/m 3 Troyans 330 p FANAO > 330 Fish Aclimacion Cohabitants:
period of 160 p 160 p 160 p SNIR > 40 Fish 14 days j F ANAD < 40 Fish Tank 25,6 kg/m) Inoculation Trojan fish 37 kg/m 3 Experimental 110p 110p 110p Defiance for period 160 p 160 p 160p Cohabitation cohabitation:
Defiance for cohabitation SNIR > 40 fish AD
35 days FAN 40 fish 720 L
Tanks Trojans 40% FANAD> 110 Fish Cohabitant 60% Inoculated with ISAv CD, 02864258 2014-09-15 The trial looked at the reception of 528 Atlantic salmon fish (Salmo salar) with an average weight of 115 g, corresponding to the experimental design cohabitants previous scheme. These fish are all marked individually with finning for identification. Also relevant 363 Atlantic salmon fish fish contemplated "Trojans", which were injected once the acclimation with ISA virus inoculum.
All fish were transported to a recepted Experimental Centre on 1 720 L tank for the Trojans in 3 ponds and cohabitants. The fish were in brackish water at a salinity of 15 and then gradually increasing the salinity within the next 7 days to finally get to 32 fish remained in the 4 ponds for a period of 14 days as acclimatization period at a temperature of 12 C, the same temperature of fish origin. During this period the fish were manually fed a commercial diet, providing rations three times a day up to 2% BW (body weight / day) .Then, a total of 480 individuals, who cohabited with 330 infected individuals were challenged ISAv intraperitoneally with (40% of total 810 fish) injection. It is proposed to use a total of 4 720 L tanks, 3 permanent and 1 temporary pond. In each of the 3 permanent ponds were put 40 fish from each group (resistant or susceptible) to challenge by cohabitation, see diagram, ie, in each of the ponds was left with 160 cohabiting fish were individually marked with CD, 02864258 2014-09-15 cuts fin , average weight 155 g. In 330 temporary pond fish "Trojans" of the same weight, which were inoculated intraperitoneally with virus inoculum ISA once the acclimation were placed. This pond is only temporary and hosted the Trojans fish during the acclimation period (14 days). Concluded the acclimation phase, the inoculation was made by intraperitoneal injection of the virus, to which the fish were anesthetized Trojans benzocaine. The fish were fasted for 24 hours prior to inoculation. These fish are adipose fin cut for easy identification and 110 fish were placed in each of the permanent ponds containing 160 cohabiting fish. In this way they were three ponds with 40% of infected fish (Trojans) and 60% of cohabiting fish finning marked to identify at all times the different groups of fish. The cohabitation phase lasted 35 days. Fish mortality was recorded daily. To the moribund fish were extracted samples of kidney, spleen and heart.
Throughout the trial the fish will have a photoperiod regime of 24 hours light to ensure complete fish smoltification.
The fish were given a 12 C since the temperature of water in the fish breeding source is at that temperature. That temperature was maintained for the days of acclimatization.
Throughout the period of cohabitation challenge temperature at 14 CD, 02864258 2014-09-15 C was maintained. The temperature was automatically recorded every minute with a "logger". The oxygen was maintained between 85% and 100% during the acclimation period and cohabitation defiance.
For the acclimation period and cohabitation challenge a commercial diet was utilized, Golden Optima 4, of the Biomar company in caliber 4.0 mm. Feeding was done manually, delivering rations three times a day until completing the portion of the day.
9 pieces of each phenotype were selected to study to which they extracted the anterior kidney at day 15 post infection, which was stored in "RNA later", and then stored at -80 C for further analysis.
RNA extraction was performed from anterior kidney samples using the RNeasy mini kit (Qiagen). Each sample was disaggregated using a tissue homogenizer (TissueRuptor, Qiagen) in 1 mL of Trizol LS (Invitrogen) according to what is established by the manufacturer. The homogenate was incubated 2 minutes at room temperature, then add 200 pL of chloroform, vortexed and centrifuged at 12,000 g for 15 minutes at 4 C to separate the phases. The aqueous phase to a tube containing 700 pL of 70%
ethanol and then the total volume was transferred to a mini-column (RNeasy Mini Kit, Qiagen) and centrifuged at 9000 g for 30 seconds was transferred. 600 pL of RW1 buffer was added and centrifuged at 9000 g for 30 seconds. Was further added a step of adding DNase treatment 80 pL of digestion solution (10 pL of enzyme DNase (Qiagen) and 70 1 of buffer according to the manufacturer RDD) to each column. Then washed 2 times with 500 pL
of buffer RPE, the first wash at 9000 g for 30 seconds and the second at 9000 g for 2 minutes to dry. Finally the column with 50 pL of nuclease free water was eluted, and aliquots of 10 1 of extracted RNA were prepared. RNA integrity was verified by gel electrophoresis in 1% agarose, stained with ethidium bromide. The presence of the 28S and 18S bands (ribosomal RNA) and the level of degradation, serve as an indicator of the integrity of samples. Simultaneously the concentration of RNA in a BioPhotometer (Eppendorf) was measured, which was performed by diluting 2 L of the extracted RNA plus 58 L of nuclease free water, and the absorbance was determined at 230, 260, 280 and 320 nm to verify the state and possible contaminations.
MMLV (Promega) enzyme and the method of Random Primers (Promega) was used for reverse transcription. To this pre 2.5 pg RNA incubated in water (12,875 pL final volume of the RT
reaction) at 60 C for 10 min and then quickly transferred to CD, 02864258 2014-09-15 ice. RT mix comprising 5X RT buffer, dNTPs 3.125 pL of 4 pM, 100 U of ribonuclease inhibitor RNasin (Promega), 100 U of MMLV and 0.5 pg of Random Primers, in a final volume of 12,125 pL of mix RT per reaction. RT mix in the 12,875 pL RNA was then added to obtain a pre incubated final reaction volume of 25 pL and reverse transcription was performed in a thermocycler with the following program: 60 minutes at 42 C, 5 minutes at 99 C for denaturar enzyme.
The primers of the selected genes were generated using the program Primer3 using preset parameters based on this Immune Genome database developed by our laboratory (Cepeda et. a/.2011) and multiple alignments performed with the BioEdit program to 5.09 of roughly determine the exon-exon junctions. The primers were synthesized by IDT (Integrated DNA Technologies). They were optimized conditions PCR primers for each set of varying concentrations of primers(0,5-2 pM) and CDNA directly charged to the reaction (1 to 3 pL) in order to obtain the cycle ct between 20 and 30 The real time PCR was carried out using the Green qPCR
kit TMSYBR Master Mix (Fermentas) in 96-well plates in the 7300 Real-Time PCR equipment System (Applied Biosystems). Dissociation curve was also done in order to determine dissociation temperatures and analyze the specificity of the amplicons. Sizes were also confirmed by agarose gels. The conditions employed in the real time PCR were 10 min at 95 C of pre incubation, followed by 40 cycles at 95 C for 30s, 53-62 C for 1 min and 72 C for 30 sec. Finally dissociation curve was performed from 60 C to 95 C. The primers for each gene are listed in Table 2.
Table 2. Sequences of PCR primers for candidate genes in real time Primer Gene Annexin Al F: CTCCAGGAAATTGAACACCGCGA
R: AAGGCTGCGATGAAGGACATGGT
Cathepsin S F: CGAAGG GAGGTCTGG
GAGAGGAAT
R: GCCCAGGTCATAGGTGTGCATGTC
Gata 3 F:
CCAAAAACAAGGTCATGTTCAGAAGG
R: TGGTGAGAGGTCGGTTGATATTGTG
Grb2 F: TGACTTTACTGCCACTGCTGAGGAC
R: CAGTCATCATTGGTGCCCAAGATC
HSP90 F:GAACCTCTGCAAGCTCATGAAGGA
ak 02864258 2014-09-15 IR: ACCAGCCTGTTTGACACAGTCACCT
IgM F: TTCTCTCCACCGGCTCATCATCA
R: ATACGGTGACCCTGACTTGCTACG
IgZ F: AGCACCAGGGACAACCACCAT
R: TTCACACTCGGTGGGTTAGAGTC
MAVS F: AGGAGGTGCTGCACAATGTTGCT
R: CGACGGCGACGGAGCCAGTA
Tbet F: GGTAACATGCCAGG GAACAGGA
R:
TGGTCTATTTTAGCTGGGTATGTCTG
Regul F: GACTCCTAACCTCCAATGCTTCGAC
R: CGAATCTCTCTCCATCAGCCCATA
18S F: CCTTAGATGTCCGGGGCT
R: CTCGGCGAAGGGTAGACA
Calibration curves were made for each gene from RNA
extractions from known concentration; to the point of maximum concentration of 2.5 pg total RNA, which was subjected to serial dilutions were used. Each standard curve consisting of at least 5 points in triplicate, plotting the mean Ct from each point versus the log of the concentration of RNA. From these curves FOR
efficiency for each gene was determined to be acceptable in the range between 90% and 110%.
The linear method described by Pffafl was used for relative quantification (Pfaffl, MW (2001) A new mathematical model for relative quantification in Real-time RT-PCR Nucleic Acids Res 29:... E45). This calculates the relative expression rate of a gene based on the efficiency and the Ct difference in the sample versus control. The Ct value of the gene of interest is normalized to a reference gene, which in this case is the 18S
gene. The formula used for the relative quantification by Pfaffl, shown below:
(E
ACT
target (control -sample) Exchange Rate = _______________________________________________________ ( e ERf ,\ ACT Ref ( control -sample) This equation takes into account the PCR efficiencies obtained from calibration curves of both the target gene (Etarget) that as the reference gene 18S (Ered, as well as the differences of cT of the candidate genes, (Acttarget (control-sample)) between control fish (no challenge ISA) and the sample (ISA under challenge, belonging to one of four phenotypes challenged). The same goes for the reference gene 18S (ACtref (control-muestra)).
The results obtained by the method were analyzed Pffafl and plotted with the program Graphpad Prism 4 (Graphpad software, Inc). From the results of analysis of RNA sequencing methodology with Illumina best housekeeping gene was determined as the 18S
(which has less variation), so it was used as reference gene.
This is consistent with that reported by Pfaffl, 2004 (Pfaffl, M.W. (2004). Quatification strategies in real time PCR. Chapter 3, pages 87-112).
The average efficiency corrected standardized expressions and expressions relating will be determined by processing the data of cT obtained for each condition and gene, in the program Q-gene (Simon P. (2003). Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics. 2003 Jul 22;19(11):1439-40).
An analysis of variance (ANOVA) one and two-way normalized expression data was performed to find differences with this control in the case of a road, and to analyze the effect of factor phenotype, and their contribution to the variance of the data in the case of two paths, that in each of the selected genes. In addition, a posteriori Tukey test and Bonferroni were performed to find differences between each of the groups (phenotypes) of study.
To assess whether the genes under study can be used as classifiers for phenotype markers and ROC curve analysis was performed to determine genes with greater predictive power.
CD, 02864258 2014-09-15 Subsequently already selected the best predictors genes, a discriminant analysis was performed with these, in order to determine whether it is possible to classify within the phenotypes under study, an individual was subjected to PCR
analysis in real time using using predictors genes. Also to simplify the visualization and understanding of data, a principal components analysis was also performed.
The results of the challenge test are shown in Figure 1 It can be seen that Trojans fishes have the highest cumulative mortality (100%) compared to the other study groups. The most extreme values of each duplicate were selected for further analysis by real-time PCR, which corresponds to a 70% cumulative mortality for the susceptible phenotype and 40% for heavy duty.
The total RNA extracted from resistant and susceptible individuals uninfected controls was quantified spectrophotometrically. The concentration range of the samples varied between 0.8-3 g / 1. The purity of the sample in terms of protein and organic solvents was determined by the ratio A26onm/A2sonm, which ranged between 1.8 and 2.0 for protein and reason A260runiA230 which varied between 1.95 and 2.5 for organic solvents. Both reasons are within acceptable ranges. RNA
integrity was assessed by electrophoresis on 1% agarose gel, in CD, 02864258 2014-09-15 Figure 2 the rRNA bands are seen 18S and 28S of samples resistant, susceptible and control subjects.
In order to determine the experimental efficiency of each set of Splitters, calibration curves were carried out from total RNA
of known concentration. The curves were prepared by plotting the Ct versus log of the concentration of RNA in each point of the curve (dilution). Each curve consists of a minimum of 5 points.
It was determined through the correlation coefficient points behave linearly and that efficiencies and slopes are within acceptable ranges (90 to 110% for efficiencies, -3.6 and -3.1 for earrings). The results are detailed in Table 3.
Table 3. Slopes and correlation coefficient efficiencies obtained from the calibration curve for each gene.
Gene Pending Correlation Eficiency (90-Coef. 110%) Annexin A-1 -3.4193 0.9839 96.09%
Cathepsin-S -3.4892 0.9695 93.65%
Gata 3 -3.4468 0.9459 95.04%
Grb2 -3.41 0.9926 96.45%
HSP90 -3.3956 0.9822 97.01%
IgM -3.3771 0.9762 97.75%
IgZ -3.5143 0.9621 92.55%
MAVS -3.3360 0.9892 99.42%
Tbet -3.1693 0.994 106.79%
Regul -3.3968 0.9985 96.97%
18S -3.5845 0.9956 90.10%
The method of real-time PCR with SYBR Green, possible to carry out an analysis of dissociation of each of the amplicons, allowing in turn to determine the melting temperatures of each amplicon, and confirm the existence of a single product of PCR.
In Figure 3, the melting curves for PCR products of each of the candidate genes, where the existence of single PCR product is confirmed whose size was confirmed by agarose gel.
In order to evaluate the expression levels of candidate genes and their relationship to immune response developed in resistant and susceptible to ISA virus fish anterior kidney samples from moribund fish or day 21 post infection were analyzed. . This sampling time is selected based on the modulation of an immune response and the incubation period described for the experimental induction of ISA (Joseph, T., Kibenge, M. T. y Kibenge, F. S. B.
Antibody-mediated growth of infectious salmon anaemia virus in macrophage-like fish cell lines. J Gen Virol. 2003. 84:1701-.
1710.; Totland GK, Hjeitnes BK y Flood PR. Transmission of infectious salmon anaemia (ISA) through natural secretions and excretions from infected smelts of Atlantic salmon (Salmo salar) during their presymptomatic phase. 1996. Dis Aquat Org 26:25-31).
The genes will be presented according to their expression profile. Grb2 IgM and show a similar expression profile, wherein in the susceptible phenotypes have low expression compared to the control are statistically significant (p < 0,001). For the susceptible phenotype Grb2 gene expression has a 49 fold lower than the control, respectively (p < 0,001).
For the Annexin gene individuals from the susceptible and resistant phenotypes significantly different from the control, with decreases in the expression of 32 and 27 times respectively.
In the case of Regul a significant overexpression of the gene is observed in subjects with increases of 57 times for the susceptible phenotype and 54 times for the resistant phenotype.
As for Cathepsin, IgZ, MAVS Tbet Gata3 and genes, have a similar expression profile comprising expression susceptible low compared with the control phenotype of 36.5, 23, 33, 43 and 39 times respectively.
In order to explain the variance of the data and the expression profile of each gene two-way ANOVA was performed, taking into account factors phenotype. This analysis shows the percentage contribution in the variability of the data. The results are shown in Table 4, showing high rates with low interaction between factors. Factor for the phenotype, 2 genes are those that contribute most to the variability; Grb2 with 88.62% of a 83.02% IgM. The genes mentioned above also have a low level of interaction (10% less), so that each factor separately presents greater explanatory power.
Table 4. Results of the analysis ANOVA Two Way phenotype factors. High percentages in the contribution of data variability, attributable to a single factor is shown in bold.
(*) Denotes significant difference (*p < 0,05; **p < 0,01; ***p <
0,001).
Gene %Interaction % Phenotype Annexin 8.44 *** 1.82 *
Cathepsin 22.16 *** 2.87 *
Gata 3 41.9 *** 8.07 ***
Grb2 5.22 ** 88.62 ***
HSP90 37.15 * 7.67 (ns) IgM 8.78 *** 83.02 ***
igz 7.8 *** 0.95 *
MAVS 26.72 *** 40.64 ***
Tbet 41.31 *** 8.04 ***
Regul 1.34 * 0.01 (ns) In order to find genes that may serve as better predictors of phenotype, ROC curve analysis with raw data normalized relative expression was performed, this in susceptible and resistant phenotypes. The results are shown in Table 5 5 genes which have 100% sensitivity and specificity, resulting in the absence of false negatives or positives are observed. These genes are Gata3, Grb2, IgM, MAVS and Regul. These genes loom as the top candidates to be used as predictors of phenotype and were used to perform a discriminant analysis to test its predictive power.
Table 5. Results of ROC curve analysis. Shown in bold italics, genes found to be the most suitable to be used as predictors of phenotype Cutoff Sensi- Speci- True True False False value bility ficity AUC (>-LOG) (%) (%) Posi Negat negat Posit tive ive ive ive Annexin 0.98 15.6902 100 88.89 88.9 100 11.1 0
The prior art, in particular the following patent documents may be mentioned:
WO 2004024956, where it describes the identification resistant Atlantic salmon and trout susceptible to viral diseases (ISA, IPN), and bacterial, to determine the genotype of a salmon kit, chip type, molecular markers typing containing gene sequences belonging to the described English Histocompability Main complex (MHC, its acronym in English Histocompability Main complex) class I and MHC class II alpha/beta. The use of technology is in the field of reproduction.
W00226784 refers to the use of nucleotide sequences encoding the structural proteins M1 and M2 of the ISA virus for use in vaccines, generation of antibodies against proteins or diagnostic kits or detection of ISA virus.
W02012075597 describes a method for determining the virulence of a virus infection by infectious pancreatic necrosis (IPN), serotype Sp from a tissue sample of salmon. RNA sample is extracted first, amplified by PCR the gene region corresponding to the VP2 protein, the purified PCR product is sequenced, the nucleotide sequence into an amino acid sequence results, and finally the presence of threonine, proline or alanine amino acids were identified at a given position, and in this case it is determined if the IPN virus has high or medium virulence.
Furthermore, in the market the following products related to the area of the present invention.
The product Sb + Health SalmoBreed comprising eggs of Salmo salar (Atlantic salmon) species that are resistant to ISA and IPN
virus and furunculosis. These eggs are genetically selected to deliver better growth rates and survival throughout the life cycle of the salmon. This product is a selection made at a salmon parental level, based on various parameters, including among others, resistance to ISA.
The product AquaGen Atlantic QTL-innOva IPN/PD corresponds to eggs of Salmo salar species originating from spawning salmon that are highly resistant to infectious pancreatic necrosis virus (IPN, its acronym in English, Infectious Pancreatic Necrosis) and pancreas disease (PD, its acronym in English, Pancreas Disease), where using the technique of marker-assisted selection is selected directly parenting that are used in the production of eggs that have specific genetic markers or a quantitative trait locci, QTL (from its acronym in English, quantitative trait locci) which are associated with resistance to a virus. The selection is made at both family and individual levels, which ensures high resistance to IPN and/or PD virus in the offspring or the eggs.
The subunit vaccine against infectious salmon anemia (injectable) Centrovet is an ISA virus vaccine for S. salar made from this virus recombinant proteins produced in yeast cultures.
Help to prevention of infectious salmon anemia in pre-smolt salmonid fish starting from 30 grams of weight.
Transcriptome Sequencing services, LC Science, refer to an RNA sequencing service (RNA-seq) technology using high throughput sequencing to determine structures Illumina gene splicing patterns, posttranscriptional modifications, detecting new or rare transcripts and quantification of changes at the level of transcript expression in various organisms, and corresponds to a generic service and not focused only on salmon.
The technical assistance services, genetic and breeding programs in general are a service of aquaculture breeding species of interest including Atlantic salmon. His focus has been mainly improved the percentage of weight gain of salmon, being, between 5-8% for the Atlantic salmon.
Also, there have been developed or are being developed, a series of investigations in the field of the invention, for example, the following projects are listed below:
Project development and validation of a chip of SNPs to determine the molecular basis and genetic improvement of disease resistance in Salmo salar Aquainnovo SA 2012-2015. In this project a system of genetic screening to identify disease resistant Atlantic salmon produced by ISA and IPN virus, using the technique of Single nucleotide polymorphisms, SNPs (for its acronym in English, Single Nucleotide Polymorphism) in chip format.
Project development and validation of genetic markers of immune response to ISA of Fisheries and Oceans Canada, 2007-2009, identified from a genomic point of view using DNA microchips, immunological genetic markers involved in the response to ISA
virus. Validation of these markers in vivo provide information for the study of disease, the resistance of the salmon and the response thereof to vaccines.
The present invention relates to the use of Gata3, Grb2, IgM, MAVS and Regul genes determining phenotypes and Resist susceptible to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar).
In the present invention, the level of expression of selected genes specifically related to the response against ISA
virus in fish susceptible and quantified virus phenotypes and gene expression profiles associating, to each phenotype.
They were selected according to criteria ontological and functional genomics, genes from the group consisting in Gata3, Grb2, IgM, MAVS y Regul and others.
To quantify the expression levels of each gene of salmon with resistant and susceptible phenotypes, PCR was used in real-time from tissues obtained from salmon with resistant and susceptible phenotypes.
Generally, it resulted that the expression of selected genes tend to be lower in the fish susceptible phenotype,and then, Gata3, Grb2, IgM, MAVS and Regul and found useful as markers for differentiated phenotype "resistant" to "susceptible".
BRIEF DESCRIPTION OF THE FIGURES
Figure 1 Graph of cumulative mortality of fish families corresponding to phenotypes resistant and susceptible. Each challenge was performed in duplicate for greater range.
Figure 2 Ribosomal bands of 18S and 28S RNAs corresponding to susceptible groups (A), and resistant controls (B), displayed on agarose gel at 1%.
Figure 3 Dissociation curves analyzed genes: annexin (A), cathepsin (B), Gata 3 (C), Grb2 (D), HSP90 (E), IgM (F), IgZ (G), Mays (H), Tbet (I), Regul (J). The presence of a single PCR
product was observed.
Figure 4 Normalized relative expression of candidate immune genes, IgM (A), Grb2 (B), HSP 90 (C), Annexin (D) and Regul (E) genes are shown. Bars with squares representing individuals and susceptible to fine lines resistant individuals. Data are the average of 9 individuals per phenotype, normalized against 18S
rRNA gene expression and adjusted for relative efficiency. (*) Denotes significant difference from control (* p <0.05, ** p <0.01, *** p <0.001).
Figure 5 Normalized relative expression of immune candidate genes, genes with similar expression pattern Cathepsin (A), IgZ
(B), Mays (C), Gata3 (D) and Tbet (E) are shown. Bars with squares representing individuals and susceptible to fine lines resistant individuals. Data are the average of 9 individuals per phenotype, normalized against 18S rRNA gene expression and adjusted for relative efficiency. (*) Denotes significant difference from control (* p <0.05, ** p <0.01, *** p <0.001) DETAILED DESCRIPTION OF THE INVENTION
In general, one of the search strategies of candidate genes is functional genomics, which aims to relate the sequence of a gene with the function that it has. To achieve this goal platforms like microarrays are used, which are based on the hybridization of fluorescently labeled complementary DNA from two different conditions, with thousands of genes present on the microarray chip (Belbin TJ, Gaspar J, Haigentz M, Perez .. -Soler R, Keller SM, Prystowsky MB, Childs G, Socci ND (2004) Indirect measurements of differential gene expression with cDNA
microarrays Biotechniques 2004, 36:.. 310-314). This results in differences in the expression of the genes studied under both conditions. However, microarray data are subject to tests (genes) that each platform may possess. A new "RNA sequencing" technology allows access to the RNA sequence with differential expression in a broad and comprehensive sense, making it an excellent tool in the search for candidate genes (Wang Z, Gerstein M, Snyder M.
(2009) RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet. 10(1):57-63).
Differential expression patterns of certain genes, representative of a particular phenotype can be analyzed using the Polymerase chain reaction (PCR). A variant of this reaction is the real-time PCR, which uses fluorescent markers for monitoring DNA amplification in each cycle. This is characterized by its sensitivity and specificity, making it suitable for detailed analysis of genes of interest (Pfaffl M.W. y Hageleit,M.
(2001) Validities of mRNA quantificationusing recombinant RNA and recombinant DNA external calibrationcurves in real-time RT-PCR.
Biotechnol. Lett., 23, 275-282).
In the present invention, the technique "RNA sequencing"
technology that uses Illumina-Solexa sequencing, and develop an experiment that includes resistant and susceptible Antlantic salmon families to the ISA virus. The genetic status of families was determined according to the level of heritability; which corresponds to a proportion of phenotypic variation in a population, attributable to genotypic variation among individuals. The value of heritability can vary (for each feature) in different populations or even in the same population at different points in its history. For purposes of this description, if the value is greater than or equal to 0.35 will be classified as resistant family and less than or equal to 0.34 for susceptible family. Besides the total mortalities within each family must be consistent with expectations (higher in susceptible).
The experiment results indicated RNA sequencing different candidates differentially expressed genes between the two phenotypes. Within the main ontological categories associated noted: a) signal transduction, b) regulation / proliferation of B
cells, c) a stress response, d) T-cell receptors, d) differentiation of T cells, e) immune response, f) regulation of transcription, g) regulation of endothelial cell migration h) viral response. For each of these categories were selected candidate genes representative. The genes, their function and their associated biological processes are detailed in Table 1.
Table 1. Candidate genes selected for Real time with their respective associated function and biological process.
Genes Process Function of its protein Candidates Biological Anexina A- Regulatory Inhibition of synthesis of 1 inflammatory prostaglandins, leukotrienes and Response thromboxanes, anti-inflammatory effect, inhibition of Leukocyte chemotaxis Cathepsin Lymphocyte Involved in proteolysis and antigen proliferatio production to charge MHC II.
n T and B
Gata 3 T Lymphocyte Signage for synthesis of Th2 differentiat lymphocytes.
ion Grb2 Signal Adapter protein, linked to signal transduction transduction of tyrosine kinases - regulation activated by lymphocyte antigen.
of the Linked to positive signaling by the transcriptio TCR.
HSP 90 Response to Proper folding of poly peptides, stress chaperone protein restauration.
IgM Humoral Identification and neutralization of Response pathogens, complement activation, precipitation, agglutination ak 02864258 2014-09-15 IgZ Humoral Identification and neutralization of Response pathogens, precipitation, agglutination MAVS Response to Adapter protein, involved in sensing virus viral RNA and activation of IFN-I
Tbet T lymphocyte Signage for synthesis of Thl differentiat lymphocytes ion Regul Regulation Negative regulator of G protein and of signaling pathway, acceleration GTP-endothelial GDP conversion, decrease of the migration effect of chemokines and immune cell Regulation migration of transcriptio 18S Ribosome Constitutive gene, used as reference assembly gene Al Annexin inhibits phospholipase protein 2, which releases arachidonic acid from the cell, this finally transformed into prostaglandins, leukotrienes and thromboxanes (Eicosanoids), which are associated with inflammatory processes. Note that prolonged inflammatory processes cause great damage to tissues and organs, so it is important to analyze genes related to the biosynthesis of eicosanoids (Glaser KB. (1995): Regulation of phospholipase A2 enzymes: selective inhibitors and their pharmacological potential. Adv Pharmacol 1995, 32:31-66).
Cathepsin S is a cysteine protease expressed in the antigen presenting cells, which has the function to generate antigens for loading on MHCII. It has been reported that deficiency in this gene produces deficient mitochondrial damage and increased levels of reactive oxygen species (ROS), as well as problems in signaling MHCII (Costantino CM, Hang HC, Kent SC, Hafler DA, Ploegh HL. (2008) Lysosomal cysteine and aspartic proteases are heterogeneously expressed and act redundantly to initiate human invariant chain degradation. J. Immunol 180:2876-2885. [PubMed:
18292509]). It is analyzed for its relation to the loading of MHCII antigens.
Grb2 is an adapter protein linked to the activation of the MAP kinase pathway and signal transduction in lymphocytes.
Positively regulates the signaling by the TCR (T cell receptor), with this development activating T cells and negatively signaling the BCR (B cell receptor, thereby inducing an immunity response linked more cellular than humoral (Jang IK., Zhang J., Gu H.
(2009) Grb2, a simple adapter with complex roles in lymphocyte development, function, and signaling. Inmunol Rev 232; 150-159).
HSP90is a protein involved in the correct folding of polypeptides, protein renaturation heat damaged and as chaperone.
It is expressed mainly by either osmotic stress, by contaminants, or immune response (Pearl LH y Prodromou C. Structure, function, and mechanism of the Hsp90 molecular chaperone. 2001. Adv Protein Chem 59: 157-186.). It is mainly used in this thesis as a marker of stress. IgZ and IgM immunoglobulins are the first of these present in greater amounts in salmon and as primary response against pathogens (Frazer, J.K. and J.D. Capra. Immunoglobulins:
structure and function. En Fundamental Immunology, 1999. 4th ed.
W.E. Paul, editor. Lippincott-Raven, Philadelphia. 37-74.). As IgZ not yet been described but its function is thought to be more specific immunoglobin(Gamez-Lucia Duato E. The major histocompatibility complex. In Manual of Veterinary Immunology 2007. Gomez-Lucia E, Blanco MM y Domenech A (eds.). Pearson-Prentice Hall. Madrid. pp. 1/7-136).Tbet and Gata3 antagonistic genes are involved in differentiation of T cells into Thl and Th2, respectively. Both genes are key regulators in the fate of CD4 + T lymphocytes and analyzed as markers of cellular and humoral immunity. Regul is a negative regulator of G protein signaling accelerates the conversion of GTP to GDP, reducing signaling downstream of G-protein function This repressive effect decreases by chemokines and immune cell migration (Tiffany Tran, Pedro Paz, Sharlene Velichko, Jill Cifrese, Praveen Belur, Ken D.
Yamaguchi, Karin Ku, Parham Mirshahpanah, Anthony T. Reder y Croze. E. Interferon-1b Induces the Expression of RGS1 a Negative Regulator of G-Protein Signaling. International Journal of Cell Biology. 2010. 7: 1-12).
Essentially, alternatives to control the infection caused by the ISA virus in Atlantic salmon can be grouped into three: i) vaccines, which corresponds to the currently used alternative mainly due to the obligation of the national authority (in Chile, Sernapesca) to vaccinate all fish in smoltification stage post (General fisheries and Aquaculture Law N 20.632 of Chile).
There are currently, in Chile, more than 10 commercial vaccines registered for ISA, which can be mono or polyvalent molecules inactivated virus and primarily injectable or oral type.
Unfortunately there is no information currently published regarding the actual coverage of vaccines against ISA, internal reports only restricted production companies. However, it is CD, 02864258 2014-09-15 widely known that the coverage of vaccines in field does not correspond to a 100% (Mikalsen, A.B., Sindre, H., Torgersen, J. y Rimstad, E. Protective effects of a DNA vaccine expressing the infectious salmon anemia virus hemagglutinin-esterase in Atlantic salmon. 2005. Vaccine 23:4895-4905; Lauscher a., KrossOy B., Frost P., Grove S., Kanig m., Bohlin J., Falk K., Austb0 L., Rimstad E. (2011). Immune responses in Atlantic salmon (Salmo salar) following protective vaccination against Infectious salmon anemia (ISA) and subsequent ISA virus infection. Vaccine, Volume 29, chapter 37, 6392-6401), ie not all vaccinated individuals fail to develop immunoprotection, ii) Genetics, which corresponds to a classical alternative selection in the context of genetic animal model, which is mainly based on the detection and utilization of resistant individuals with a given disease and subsequent design of controlled crosses. To date, this alternative has been very successful but only in certain companies which have the advantage of the heterogeneous resistant and iii) fish, which range from immunostimulating, antiviral and synthetic peptides.
By improving family because controlled crosses, fish families that have ISA virus resistance, finally resulted in lower cumulative mortalities were obtained (less than 40% for this CD, 02864258 2014-09-15 description and heritability (H) greater than or equal to 0.35) in compared to other sites. These are called resistant families.
At the same time there are also families who have high mortality (50% or higher for this description and H less than or equal to 0.34) against the virus, which will be classified as susceptible.
Taking these two phenotypes base (resistant and susceptible), the expression patterns of candidate genes and their relationship to the resistance or susceptibility to the pathogen compared.
For this, the following actions were taken:
= Quantify, evaluate and associated expression profiles of candidate genes in resistant and susceptible fish with ISA virus as the initial target phenotypes.
= Develop and standardize the analysis of real-time PCR
quantification of the expression of candidate genes as the next target.
= Quantified as relative candidate genes in susceptible and resistant phenotypes aim below.
= Analyze the feasibility of some of the selected genes may serve as a marker of resistance to the ISA virus, as the ultimate goal In the initial phase, a challenge test was performed with 2 families of S. salar (SNIR and Fanad, resistant and susceptible, CD. 02864258 2014-09-15 respectively) to determine the degree of resistance to ISA virus.
To this was used a Chilean viral isolate which was sequenced in the hypervariable region (HPR) resulting HPR type 7b which was inoculated intraperitoneally injected in the ventral midline at 0.2 mL inoculum per fish Trojan which contains a degree of 7.2 x 104 TCID50. Were infected only 40% of the fish pond, waiting for the remaining 60% were infected by cohabitation, thus infection resembles what happens in the field.
Before starting the test, the health status of fish in fish farming was confirmed source. A visit was made in the field to check the general condition of the fish of the selected group. At the same time, taking 30 fish sampled for analysis in the laboratory was performed. The analyzes cover 15 necropsies, gram analysis, Flavo, BKD, RT-PCR IPNV and RT-PCR ISA. If positive, the selected group of either fish pathogens analyzed, it is discarded and a new group of fish sought.
Tanks 720 L
Salinity 32 Temperature 12 C acclimatization and 14 C defiance Oxygen (saturation) 85-100%
Replacement rate 1.5 replacement/hour N of fish per tank 363 trojans y 528 (acclimatization) cohabitants N of fish per tank 110 trojans + 160 (cohabitation) cohabitants Density 20-30 kg/m3 In the following experimental design scheme associated with the challenge illustrated by cohabitation:
=
35 kg/m 3 Troyans 330 p FANAO > 330 Fish Aclimacion Cohabitants:
period of 160 p 160 p 160 p SNIR > 40 Fish 14 days j F ANAD < 40 Fish Tank 25,6 kg/m) Inoculation Trojan fish 37 kg/m 3 Experimental 110p 110p 110p Defiance for period 160 p 160 p 160p Cohabitation cohabitation:
Defiance for cohabitation SNIR > 40 fish AD
35 days FAN 40 fish 720 L
Tanks Trojans 40% FANAD> 110 Fish Cohabitant 60% Inoculated with ISAv CD, 02864258 2014-09-15 The trial looked at the reception of 528 Atlantic salmon fish (Salmo salar) with an average weight of 115 g, corresponding to the experimental design cohabitants previous scheme. These fish are all marked individually with finning for identification. Also relevant 363 Atlantic salmon fish fish contemplated "Trojans", which were injected once the acclimation with ISA virus inoculum.
All fish were transported to a recepted Experimental Centre on 1 720 L tank for the Trojans in 3 ponds and cohabitants. The fish were in brackish water at a salinity of 15 and then gradually increasing the salinity within the next 7 days to finally get to 32 fish remained in the 4 ponds for a period of 14 days as acclimatization period at a temperature of 12 C, the same temperature of fish origin. During this period the fish were manually fed a commercial diet, providing rations three times a day up to 2% BW (body weight / day) .Then, a total of 480 individuals, who cohabited with 330 infected individuals were challenged ISAv intraperitoneally with (40% of total 810 fish) injection. It is proposed to use a total of 4 720 L tanks, 3 permanent and 1 temporary pond. In each of the 3 permanent ponds were put 40 fish from each group (resistant or susceptible) to challenge by cohabitation, see diagram, ie, in each of the ponds was left with 160 cohabiting fish were individually marked with CD, 02864258 2014-09-15 cuts fin , average weight 155 g. In 330 temporary pond fish "Trojans" of the same weight, which were inoculated intraperitoneally with virus inoculum ISA once the acclimation were placed. This pond is only temporary and hosted the Trojans fish during the acclimation period (14 days). Concluded the acclimation phase, the inoculation was made by intraperitoneal injection of the virus, to which the fish were anesthetized Trojans benzocaine. The fish were fasted for 24 hours prior to inoculation. These fish are adipose fin cut for easy identification and 110 fish were placed in each of the permanent ponds containing 160 cohabiting fish. In this way they were three ponds with 40% of infected fish (Trojans) and 60% of cohabiting fish finning marked to identify at all times the different groups of fish. The cohabitation phase lasted 35 days. Fish mortality was recorded daily. To the moribund fish were extracted samples of kidney, spleen and heart.
Throughout the trial the fish will have a photoperiod regime of 24 hours light to ensure complete fish smoltification.
The fish were given a 12 C since the temperature of water in the fish breeding source is at that temperature. That temperature was maintained for the days of acclimatization.
Throughout the period of cohabitation challenge temperature at 14 CD, 02864258 2014-09-15 C was maintained. The temperature was automatically recorded every minute with a "logger". The oxygen was maintained between 85% and 100% during the acclimation period and cohabitation defiance.
For the acclimation period and cohabitation challenge a commercial diet was utilized, Golden Optima 4, of the Biomar company in caliber 4.0 mm. Feeding was done manually, delivering rations three times a day until completing the portion of the day.
9 pieces of each phenotype were selected to study to which they extracted the anterior kidney at day 15 post infection, which was stored in "RNA later", and then stored at -80 C for further analysis.
RNA extraction was performed from anterior kidney samples using the RNeasy mini kit (Qiagen). Each sample was disaggregated using a tissue homogenizer (TissueRuptor, Qiagen) in 1 mL of Trizol LS (Invitrogen) according to what is established by the manufacturer. The homogenate was incubated 2 minutes at room temperature, then add 200 pL of chloroform, vortexed and centrifuged at 12,000 g for 15 minutes at 4 C to separate the phases. The aqueous phase to a tube containing 700 pL of 70%
ethanol and then the total volume was transferred to a mini-column (RNeasy Mini Kit, Qiagen) and centrifuged at 9000 g for 30 seconds was transferred. 600 pL of RW1 buffer was added and centrifuged at 9000 g for 30 seconds. Was further added a step of adding DNase treatment 80 pL of digestion solution (10 pL of enzyme DNase (Qiagen) and 70 1 of buffer according to the manufacturer RDD) to each column. Then washed 2 times with 500 pL
of buffer RPE, the first wash at 9000 g for 30 seconds and the second at 9000 g for 2 minutes to dry. Finally the column with 50 pL of nuclease free water was eluted, and aliquots of 10 1 of extracted RNA were prepared. RNA integrity was verified by gel electrophoresis in 1% agarose, stained with ethidium bromide. The presence of the 28S and 18S bands (ribosomal RNA) and the level of degradation, serve as an indicator of the integrity of samples. Simultaneously the concentration of RNA in a BioPhotometer (Eppendorf) was measured, which was performed by diluting 2 L of the extracted RNA plus 58 L of nuclease free water, and the absorbance was determined at 230, 260, 280 and 320 nm to verify the state and possible contaminations.
MMLV (Promega) enzyme and the method of Random Primers (Promega) was used for reverse transcription. To this pre 2.5 pg RNA incubated in water (12,875 pL final volume of the RT
reaction) at 60 C for 10 min and then quickly transferred to CD, 02864258 2014-09-15 ice. RT mix comprising 5X RT buffer, dNTPs 3.125 pL of 4 pM, 100 U of ribonuclease inhibitor RNasin (Promega), 100 U of MMLV and 0.5 pg of Random Primers, in a final volume of 12,125 pL of mix RT per reaction. RT mix in the 12,875 pL RNA was then added to obtain a pre incubated final reaction volume of 25 pL and reverse transcription was performed in a thermocycler with the following program: 60 minutes at 42 C, 5 minutes at 99 C for denaturar enzyme.
The primers of the selected genes were generated using the program Primer3 using preset parameters based on this Immune Genome database developed by our laboratory (Cepeda et. a/.2011) and multiple alignments performed with the BioEdit program to 5.09 of roughly determine the exon-exon junctions. The primers were synthesized by IDT (Integrated DNA Technologies). They were optimized conditions PCR primers for each set of varying concentrations of primers(0,5-2 pM) and CDNA directly charged to the reaction (1 to 3 pL) in order to obtain the cycle ct between 20 and 30 The real time PCR was carried out using the Green qPCR
kit TMSYBR Master Mix (Fermentas) in 96-well plates in the 7300 Real-Time PCR equipment System (Applied Biosystems). Dissociation curve was also done in order to determine dissociation temperatures and analyze the specificity of the amplicons. Sizes were also confirmed by agarose gels. The conditions employed in the real time PCR were 10 min at 95 C of pre incubation, followed by 40 cycles at 95 C for 30s, 53-62 C for 1 min and 72 C for 30 sec. Finally dissociation curve was performed from 60 C to 95 C. The primers for each gene are listed in Table 2.
Table 2. Sequences of PCR primers for candidate genes in real time Primer Gene Annexin Al F: CTCCAGGAAATTGAACACCGCGA
R: AAGGCTGCGATGAAGGACATGGT
Cathepsin S F: CGAAGG GAGGTCTGG
GAGAGGAAT
R: GCCCAGGTCATAGGTGTGCATGTC
Gata 3 F:
CCAAAAACAAGGTCATGTTCAGAAGG
R: TGGTGAGAGGTCGGTTGATATTGTG
Grb2 F: TGACTTTACTGCCACTGCTGAGGAC
R: CAGTCATCATTGGTGCCCAAGATC
HSP90 F:GAACCTCTGCAAGCTCATGAAGGA
ak 02864258 2014-09-15 IR: ACCAGCCTGTTTGACACAGTCACCT
IgM F: TTCTCTCCACCGGCTCATCATCA
R: ATACGGTGACCCTGACTTGCTACG
IgZ F: AGCACCAGGGACAACCACCAT
R: TTCACACTCGGTGGGTTAGAGTC
MAVS F: AGGAGGTGCTGCACAATGTTGCT
R: CGACGGCGACGGAGCCAGTA
Tbet F: GGTAACATGCCAGG GAACAGGA
R:
TGGTCTATTTTAGCTGGGTATGTCTG
Regul F: GACTCCTAACCTCCAATGCTTCGAC
R: CGAATCTCTCTCCATCAGCCCATA
18S F: CCTTAGATGTCCGGGGCT
R: CTCGGCGAAGGGTAGACA
Calibration curves were made for each gene from RNA
extractions from known concentration; to the point of maximum concentration of 2.5 pg total RNA, which was subjected to serial dilutions were used. Each standard curve consisting of at least 5 points in triplicate, plotting the mean Ct from each point versus the log of the concentration of RNA. From these curves FOR
efficiency for each gene was determined to be acceptable in the range between 90% and 110%.
The linear method described by Pffafl was used for relative quantification (Pfaffl, MW (2001) A new mathematical model for relative quantification in Real-time RT-PCR Nucleic Acids Res 29:... E45). This calculates the relative expression rate of a gene based on the efficiency and the Ct difference in the sample versus control. The Ct value of the gene of interest is normalized to a reference gene, which in this case is the 18S
gene. The formula used for the relative quantification by Pfaffl, shown below:
(E
ACT
target (control -sample) Exchange Rate = _______________________________________________________ ( e ERf ,\ ACT Ref ( control -sample) This equation takes into account the PCR efficiencies obtained from calibration curves of both the target gene (Etarget) that as the reference gene 18S (Ered, as well as the differences of cT of the candidate genes, (Acttarget (control-sample)) between control fish (no challenge ISA) and the sample (ISA under challenge, belonging to one of four phenotypes challenged). The same goes for the reference gene 18S (ACtref (control-muestra)).
The results obtained by the method were analyzed Pffafl and plotted with the program Graphpad Prism 4 (Graphpad software, Inc). From the results of analysis of RNA sequencing methodology with Illumina best housekeeping gene was determined as the 18S
(which has less variation), so it was used as reference gene.
This is consistent with that reported by Pfaffl, 2004 (Pfaffl, M.W. (2004). Quatification strategies in real time PCR. Chapter 3, pages 87-112).
The average efficiency corrected standardized expressions and expressions relating will be determined by processing the data of cT obtained for each condition and gene, in the program Q-gene (Simon P. (2003). Q-Gene: processing quantitative real-time RT-PCR data. Bioinformatics. 2003 Jul 22;19(11):1439-40).
An analysis of variance (ANOVA) one and two-way normalized expression data was performed to find differences with this control in the case of a road, and to analyze the effect of factor phenotype, and their contribution to the variance of the data in the case of two paths, that in each of the selected genes. In addition, a posteriori Tukey test and Bonferroni were performed to find differences between each of the groups (phenotypes) of study.
To assess whether the genes under study can be used as classifiers for phenotype markers and ROC curve analysis was performed to determine genes with greater predictive power.
CD, 02864258 2014-09-15 Subsequently already selected the best predictors genes, a discriminant analysis was performed with these, in order to determine whether it is possible to classify within the phenotypes under study, an individual was subjected to PCR
analysis in real time using using predictors genes. Also to simplify the visualization and understanding of data, a principal components analysis was also performed.
The results of the challenge test are shown in Figure 1 It can be seen that Trojans fishes have the highest cumulative mortality (100%) compared to the other study groups. The most extreme values of each duplicate were selected for further analysis by real-time PCR, which corresponds to a 70% cumulative mortality for the susceptible phenotype and 40% for heavy duty.
The total RNA extracted from resistant and susceptible individuals uninfected controls was quantified spectrophotometrically. The concentration range of the samples varied between 0.8-3 g / 1. The purity of the sample in terms of protein and organic solvents was determined by the ratio A26onm/A2sonm, which ranged between 1.8 and 2.0 for protein and reason A260runiA230 which varied between 1.95 and 2.5 for organic solvents. Both reasons are within acceptable ranges. RNA
integrity was assessed by electrophoresis on 1% agarose gel, in CD, 02864258 2014-09-15 Figure 2 the rRNA bands are seen 18S and 28S of samples resistant, susceptible and control subjects.
In order to determine the experimental efficiency of each set of Splitters, calibration curves were carried out from total RNA
of known concentration. The curves were prepared by plotting the Ct versus log of the concentration of RNA in each point of the curve (dilution). Each curve consists of a minimum of 5 points.
It was determined through the correlation coefficient points behave linearly and that efficiencies and slopes are within acceptable ranges (90 to 110% for efficiencies, -3.6 and -3.1 for earrings). The results are detailed in Table 3.
Table 3. Slopes and correlation coefficient efficiencies obtained from the calibration curve for each gene.
Gene Pending Correlation Eficiency (90-Coef. 110%) Annexin A-1 -3.4193 0.9839 96.09%
Cathepsin-S -3.4892 0.9695 93.65%
Gata 3 -3.4468 0.9459 95.04%
Grb2 -3.41 0.9926 96.45%
HSP90 -3.3956 0.9822 97.01%
IgM -3.3771 0.9762 97.75%
IgZ -3.5143 0.9621 92.55%
MAVS -3.3360 0.9892 99.42%
Tbet -3.1693 0.994 106.79%
Regul -3.3968 0.9985 96.97%
18S -3.5845 0.9956 90.10%
The method of real-time PCR with SYBR Green, possible to carry out an analysis of dissociation of each of the amplicons, allowing in turn to determine the melting temperatures of each amplicon, and confirm the existence of a single product of PCR.
In Figure 3, the melting curves for PCR products of each of the candidate genes, where the existence of single PCR product is confirmed whose size was confirmed by agarose gel.
In order to evaluate the expression levels of candidate genes and their relationship to immune response developed in resistant and susceptible to ISA virus fish anterior kidney samples from moribund fish or day 21 post infection were analyzed. . This sampling time is selected based on the modulation of an immune response and the incubation period described for the experimental induction of ISA (Joseph, T., Kibenge, M. T. y Kibenge, F. S. B.
Antibody-mediated growth of infectious salmon anaemia virus in macrophage-like fish cell lines. J Gen Virol. 2003. 84:1701-.
1710.; Totland GK, Hjeitnes BK y Flood PR. Transmission of infectious salmon anaemia (ISA) through natural secretions and excretions from infected smelts of Atlantic salmon (Salmo salar) during their presymptomatic phase. 1996. Dis Aquat Org 26:25-31).
The genes will be presented according to their expression profile. Grb2 IgM and show a similar expression profile, wherein in the susceptible phenotypes have low expression compared to the control are statistically significant (p < 0,001). For the susceptible phenotype Grb2 gene expression has a 49 fold lower than the control, respectively (p < 0,001).
For the Annexin gene individuals from the susceptible and resistant phenotypes significantly different from the control, with decreases in the expression of 32 and 27 times respectively.
In the case of Regul a significant overexpression of the gene is observed in subjects with increases of 57 times for the susceptible phenotype and 54 times for the resistant phenotype.
As for Cathepsin, IgZ, MAVS Tbet Gata3 and genes, have a similar expression profile comprising expression susceptible low compared with the control phenotype of 36.5, 23, 33, 43 and 39 times respectively.
In order to explain the variance of the data and the expression profile of each gene two-way ANOVA was performed, taking into account factors phenotype. This analysis shows the percentage contribution in the variability of the data. The results are shown in Table 4, showing high rates with low interaction between factors. Factor for the phenotype, 2 genes are those that contribute most to the variability; Grb2 with 88.62% of a 83.02% IgM. The genes mentioned above also have a low level of interaction (10% less), so that each factor separately presents greater explanatory power.
Table 4. Results of the analysis ANOVA Two Way phenotype factors. High percentages in the contribution of data variability, attributable to a single factor is shown in bold.
(*) Denotes significant difference (*p < 0,05; **p < 0,01; ***p <
0,001).
Gene %Interaction % Phenotype Annexin 8.44 *** 1.82 *
Cathepsin 22.16 *** 2.87 *
Gata 3 41.9 *** 8.07 ***
Grb2 5.22 ** 88.62 ***
HSP90 37.15 * 7.67 (ns) IgM 8.78 *** 83.02 ***
igz 7.8 *** 0.95 *
MAVS 26.72 *** 40.64 ***
Tbet 41.31 *** 8.04 ***
Regul 1.34 * 0.01 (ns) In order to find genes that may serve as better predictors of phenotype, ROC curve analysis with raw data normalized relative expression was performed, this in susceptible and resistant phenotypes. The results are shown in Table 5 5 genes which have 100% sensitivity and specificity, resulting in the absence of false negatives or positives are observed. These genes are Gata3, Grb2, IgM, MAVS and Regul. These genes loom as the top candidates to be used as predictors of phenotype and were used to perform a discriminant analysis to test its predictive power.
Table 5. Results of ROC curve analysis. Shown in bold italics, genes found to be the most suitable to be used as predictors of phenotype Cutoff Sensi- Speci- True True False False value bility ficity AUC (>-LOG) (%) (%) Posi Negat negat Posit tive ive ive ive Annexin 0.98 15.6902 100 88.89 88.9 100 11.1 0
6 Catheps 0.54 14.9695 87.5 22.22 50 66.67 50 33.33 in 2 Gata 3 1 19.814 100 100 100 100 0 Grb2 1 15.0971 100 100 100 100 0 0 HSP90 0.65 4.1932 100 33.33 57.1 100 42.9 0 IgM 1 12.5262 100 100 100 100 0 0 IgZ 0.83 12.3401 66.67 100 100 75 0 25 MAVS 1 21.8213 100 100 100 100 0 0 Tbet 0.61 9.1247 100 55.56 66.7 100 33.3 0 Regul 1 =22.2873 100 /00 /00 /00 0 0 In order to test the predictive power of the genes thrown by the ROC curve analysis, (Gata3, Grb2, IgM, and Regul MAVS), a discriminant analysis was performed. This one in the first instance, was performed taking into account two phenotypes, which could discriminate 100% resistant to susceptible individuals. The summary of results in Table 6 are shown below.
Table 6. Discriminant analysis used Gata3, Grb2, IgM, and Regul MAVS genes as predictors. It is observed that the 9 individuals are correctly classified with a rate corresponding to 1, which is equivalent to 100% correct classification.
Classification Table Group Prediction by Group (Std) Correctly classified Susceptible Resistant Susceptible 9 0 1.000 Resistant 0 9 1.000 Correct Global Rate 1.000 CD, 02864258 2014-09-15 This paper was able to establish that there are differences in the expression of genes involved in innate and adaptive immune responses. between resistant and susceptible to ISA virus phenotypes by relative quantification of transcripts by real-time PCR.
With respect to the technique used (real time PCR). one can mention that has several important factors to be considered for a reliable quantification. One factor to consider is the integrity and quality of RNA. which has a chemical nature unstable and is susceptible to hydrolysis by base catalysis or RNase own tissues (Houseley JM y Tollervey D. The many pathways of RNA
degradation. 2009 Cell. 136: 763-776;; DeRose. V.J. Two decades of RNA catalysis. 2002. Chem. Biol. 9: 961-969.). The effect of the degradation of RNA on the real time PCR results in less reproducible and more late Ct values (Fleige S. y Pfaffl M.W. RNA
integrity and the effect on the real-time qRT-PCR performance.
2006.Mol. Aspects Med. 27:126-139.).). As seen in Figure 2. the RNA does not have significant degradation and can therefore be used for further analysis without making errors in the relative quantification of the candidate genes.
The presence of a single PCR product was verified by analysis of the melting curves. The fluorophore SYBR Green is 25 to 100 CD, 02864258 2014-09-15 times more sensitive than ethidium bromide (Schneeberger C.
Speiser P. Kury F and Zeillinger R. Quantitative detection of reverse transcriptase-PCR products by Means of a novel and sensitive DNA stain. 1995. PCR Methods Appl 4: 234-238). and therefore more likely to detect unspecific products by analyzing the melting curves, which by electrophoresis on agarose gel stained with ethidium bromide. As seen in Figure 3. the melting curves show a single PCR product. although the products were also analyzed by agarose gel electrophoresis to verify the occurrence of the expected size of band.
One aspect to consider when evaluating gene expression levels in biological samples from the same species and treatment. the interindividual variation, which in many cases prevents statistically significant differences are found between experimental groups. One way to overcome the bias introduced by heterogeneity is to increase the sample size. and thus deliver a greater statistical weight to the results. In the case of this thesis interindividual variations not desired can occur due to differences in the effectiveness of the infection by the pathogen or genetic differences in the immune response of the individual.
However, large sample size (n = 9) in order to reduce bias was employed.
CD. 02864258 2014-09-15 As for the relative quantification of gene expression profiles are observed like in some genes for the phenotypes being studied. Two genes that show a similar expression pattern are IgM
and Grb2. In these. a decrease is observed in susceptible phenotypes compared to resistant and control. IgM is the dominant immunoglobulin in salmon and a first line of defense (Bengten E.
Wilson M. Miller N. Clem LW. Pilstrom L and Warr GW.
Immunoglobulin isotypes: structure. function. and genetics. Curr Top Microbiol Immunol. 2000. 248:189-219). however this immunoglobulin turns out to be of little specificness (Hordvik I.. Lindstrom C.D.. Voie A.M.. Jacob A.L.J and Endresen C.
Structure and organization of the immunoglobulin M heavy chain genes in Atlantic salmon. Salmo salar. 1997. Molecular Immunology. 34. 631-639) and with few neutralizing antibodies.
but despite this the importance lie in the recognition and binding to the virus for containment and complement activation.
which increases the number of neutralizing antibodies. as well as B lymphocytes with what is promotes activation of adaptive immunity, and therefore the effectiveness of the system to counteract the virus (Olesen NJ. y Jsrgensen PEV. Quantification of serum immunoglobulin in rainbow trout Salmo gairdneri under various environmental conditions. 1986. Dis Aquat Org 1. 183-189;
1.
Boes. M. Role of natural and immune IgM antibodies in immune responses. 2000. Molecular Immunolology 37:1141-1149). Thus. the subject to have low levels of IgM expression individuals would delay the activity of the immune system and present a low activity and this reaction.
Moreover Grb2 is an adapter molecule related to the antigen-activated signaling both T (TCR) and B lymphocytes (BCR) receptors. This signaling both development and lymphocyte activation is regulated both. Antigen stimulation to occur. the activated receptor tyrosine kinases of the Src family, resulting in phosphorylation of several substrates and multiple signalosomas assembly. The coordination of signaling components in signalosomas. start the corresponding signaling cascades that control transcription and thereby cell fate. activation or other biological processes (Samelson. L. E. Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. 2000. Annu. Rev. Immunol. 20:371-394). To counteract antigen stimulation. the antigen-activated receptor as negative regulators must recruit tyrosine kinases and phosphatases negative in signalosomas (Shaw A yThomas ML. Coordinate interactions of protein tyrosine kinases and protein tyrosine phosphatases in T-cell receptor- mediated signalling. 1991.-Curr Opin Cell Biol.;3:862-868). The balance of positive and negative signals are essential for proper development, activation and induction of lymphocytes. Grb2 described which is essential in the activation of Ras-MAPK pathway and the regulation of MAPKs.
JNK and p38 which are involved in both positive and negative selection of T cells (Houtman JC. Yamaguchi H. Barda Saad M.
Braiman A. Bowden B. Appella E. Schuck P y Samelson LE.
Oligomerization of sig- naling complexes by the multipoint binding of GRB2 to both LAT and SOS1.2006. Nat Struct Mol Biol 13:798-805). This regulation occurs at the beginning of the cascade triggered by TCR. It has also been described which would be involved in the regulation of signaling for positive selection of T cells CD4+ y CD8+ (Jang IK.. Zhang J.. Gu H. (2009) Grb2. a simple adapter with complex roles in lymphocyte development.
function. and signaling. Inmunol Rev 232; 150-159).B lymphocytes have been reported to both positively and negatively regulate the signaling of the BCR and also regulate Ca2 + signaling (Stork B.
Grb2 and the non-T cell activation linker NTAL Constitute a Ca (2 +) - regulating signal circuit in B lym- phocytes.2004 Immunity.
21:. 681-691). The low expression of the Grb2 gene in individuals susceptible phenotype would realize a reduction in the activation of receptor-mediated immune response of antigen. generating this CD. 02864258 2014-09-15 lower regulation in selection and development of T and B
lymphocytes. the opposite occurs in individuals with resistant phenotype. The differential expression of this gene in susceptible and resistant phenotypes suggests that the induction of T and B lymphocytes would be associated with ISA virus resistance.
Annexin while significant differences with control individuals of both phenotypes (susceptible and resistant).
showing a lower expression of the gene. There could be the possibility that the virus has an inhibitory effect on this gene as described that some viruses have an immunosuppressive effect on some genes (Ronneseth A. Wergeland HI. Pettersen EF y Neutrophils and B-cells in Atlantic cod (Gadus morhua L.). 2007.
Fish Shellfish Immunol. 3:493-503).
Regul has a high expression of this in individuals. Regul is a negative regulator of G protein as it accelerates the hydrolysis of GTP to the G protein activated subunits This inhibitory effect induced by chemokines acting on signals. which have an important role in the movement of immune cells to sites of inflammation . Described that this gene is highly expressed in cells, suggesting a role in the regulation of the immune cell.
Also described is a strong relationship between the expression of Regul and B cell migration (C. Moratz. J. R. Hayman. H. Gu. and J. H. Kehrl. "Abnormal B-cell responses to chemokines. disturbed plasma cell localization, and distorted immune tissue architecture in RGS1-/- mice." Molecular and Cellular Biology.
vol. 24. no. 13. pp. 5767-5775. 2004). Inhibition by Regul results in reducing the effects of chemokines and decreased immune cell migration. which eventually creates a vacuum in the immune response.
The following five genes have a similar expression pattern in which individuals have a resistant phenotype similar to the control with no significant differences in individual expression.
whereas susceptible individuals have low gene expression compared to control.
Cathepsin S is a cysteine protease that plays a critical role in antigen processing and presentation. Described that Cathepsin S is essential for antigen presentation by MHC-II and its inhibition leads to a reduced response of T lymphocytes CD4+
(Gupta S. Dennis J. Thurman RE. Kingston R. Stamatoyannopoulos JA. Predicting Human Nucleosome Occupancy from Primary Sequence.
2008. PLoS Comput Biol 4:1-9). Also. its deficiency has been linked to low mobility of antigen presenting cells and B cells (Faure-Andre G. Vargas P. Yuseff MI. Heuze M. Diaz J. Lankar D.
ak 02864258 2014-09-15 1.
Steri V. Manry J. Hugues S. Vascotto F. Boulanger J. Raposo G.
Bono MR. Rosemblatt M. Piel M. Lennon-Dumenil AM. Regulation of dendritic cell migration by CD74. the MHC class II-associated invariant chain. 2008. Science. 322:1705-1710. The susceptible phenotype has low expression of the gene. which could present problems in the antigen presentation and immune cell mobility.
affecting mainly with this acquired immunity. This effect may contribute to the susceptibility of individuals in this phenotype.
Mays is an adapter molecule that acts after the senses helicase RIG-I viral RNA by activating a signaling cascade ultimately leading to the activation of expression of type I IFN
generating other signaling cascades that lead to activated transcription of interferon (ISGs) in which genes are those encoding proteins with antiviral function. In the case of salmon.
it may be mentioned to Mx-1 which is capable of protecting cells by preventing the replication of IPNV. (Larsen. R.. Rokenes. T..
Robertsen. B. (2004). Inhibition of infectious pancreatic necrosis virus replication by atlantic salmon MX1 protein. J
virol 78. 7938-7944). In this way individuals with low expression of Mays will present less antiviral activity to be inhibited CD. 02864258 2014-09-15 signaling cascade associated with IFN. which would contribute to the susceptibility phenotype.
IgZ is an immunoglobulin recently discovered in zebrafish which has not much information about their biological function.
It has been recently reported to be associated with mucosal immunity and neutralizing antigens in the blood (Ryo S. Wijdeven RH. Tyagi A. Hermsen T. Kono T. Karunasagar I. Rombout JH. Sakai M. Verburg-van Kemenade BM y Sayan R. Common carp have two subclasses of bonyfish specific antibody IgZ
showing differential expression in response to infection. 2010.
Dev Comp Immunol.
34:1183-1190). This immunoglobulin is expressed in smaller amounts than IgM. but would help in neutralizing the virus and signaling for the activation of the immune system. Because individuals with susceptible phenotype have low gene expression, one could infer that have lower virus neutralization and hence further progress of the disease.
T-bet and Gata3 are antagonistic transcription factors involved in cell fate commitment and T. which eventually lead to the development of Thl and Th2 lymphocytes. T-bet promotes differentiation into Thl cells. which protect against intracellular parasites and viruses causing factors such as IFN.
IL-2 and TNF which will induce activation of macrophages and NK
cells, production of cytotoxic T lymphocytes (CTL) and complement activation, generating a response primarily of cell type (Jenner RG. Townsend NJ. Jackson I. Sun K. Bouwman RD. Young RA. Glimcher LH y Lord GM. The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes. 2009. Proc Natl Acad Sci U S A. 106:17876-17881). Gata3 on another part promotes differentiation towards Th2 lymphocytes. which by action of interleukins as IL-4. IL-5.
IL-6 and IL-13 produce effects such as activating antibody-mediated immunity. eosinophil differentiation. inflammation processes and elimination of macrophages. primarily creating a humoral response. The effectors of both pathways have an inhibitory effect on the other. this destination polarizing towards the Thl or Th2 lymphocytes. IFN-y inhibits Th2 polarization while IL-4 does so with Thl (Constant SL y Bottomly K. Induction of Thl and Th2 CD4+ T cell responses the alternative approaches. 1997. Annu Rev Immunol. 15:297-322). Thus as can be seen in the graphs of Figure 5. in susceptible individuals, it was observed that both channels are decreased or inhibited which realizes differentiation and polarization of T lymphocytes are not occur or do so measuring less compared to resistant individuals or controls. For the same reason the susceptibility of individuals is explained.
The ROC curve analysis was employed using data from gross normalized relative expression of resistant and susceptible individuals with the aim of finding genes that could differentiate the two phenotypes prediction mode and that they possess a high level of sensitivity and specificity, resulted in a area under the curve (AUC) equal to or close to 1 When analyzing 5 are genes having an AUC of 1. where these Gata3.
Grb2. IgM. Mays and Regul. presenting 100% success. For this reason these genes were selected for discriminant analysis. which also could discriminate both phenotypes perfectly. checking the predictive power of the ROC curve thrown genes. Comparing thrown by the ROC curve analysis with results of two-way ANOVA genes. we noticed that Grb2. IgM and Regul genes have significant percentages of the variation in the data. whether this be associated with the effect of the phenotype in the case IgM and Grb2. because this changes only affect the susceptible phenotype so statistically decreases their influence, resulting in smaller percentages.
Table 6. Discriminant analysis used Gata3, Grb2, IgM, and Regul MAVS genes as predictors. It is observed that the 9 individuals are correctly classified with a rate corresponding to 1, which is equivalent to 100% correct classification.
Classification Table Group Prediction by Group (Std) Correctly classified Susceptible Resistant Susceptible 9 0 1.000 Resistant 0 9 1.000 Correct Global Rate 1.000 CD, 02864258 2014-09-15 This paper was able to establish that there are differences in the expression of genes involved in innate and adaptive immune responses. between resistant and susceptible to ISA virus phenotypes by relative quantification of transcripts by real-time PCR.
With respect to the technique used (real time PCR). one can mention that has several important factors to be considered for a reliable quantification. One factor to consider is the integrity and quality of RNA. which has a chemical nature unstable and is susceptible to hydrolysis by base catalysis or RNase own tissues (Houseley JM y Tollervey D. The many pathways of RNA
degradation. 2009 Cell. 136: 763-776;; DeRose. V.J. Two decades of RNA catalysis. 2002. Chem. Biol. 9: 961-969.). The effect of the degradation of RNA on the real time PCR results in less reproducible and more late Ct values (Fleige S. y Pfaffl M.W. RNA
integrity and the effect on the real-time qRT-PCR performance.
2006.Mol. Aspects Med. 27:126-139.).). As seen in Figure 2. the RNA does not have significant degradation and can therefore be used for further analysis without making errors in the relative quantification of the candidate genes.
The presence of a single PCR product was verified by analysis of the melting curves. The fluorophore SYBR Green is 25 to 100 CD, 02864258 2014-09-15 times more sensitive than ethidium bromide (Schneeberger C.
Speiser P. Kury F and Zeillinger R. Quantitative detection of reverse transcriptase-PCR products by Means of a novel and sensitive DNA stain. 1995. PCR Methods Appl 4: 234-238). and therefore more likely to detect unspecific products by analyzing the melting curves, which by electrophoresis on agarose gel stained with ethidium bromide. As seen in Figure 3. the melting curves show a single PCR product. although the products were also analyzed by agarose gel electrophoresis to verify the occurrence of the expected size of band.
One aspect to consider when evaluating gene expression levels in biological samples from the same species and treatment. the interindividual variation, which in many cases prevents statistically significant differences are found between experimental groups. One way to overcome the bias introduced by heterogeneity is to increase the sample size. and thus deliver a greater statistical weight to the results. In the case of this thesis interindividual variations not desired can occur due to differences in the effectiveness of the infection by the pathogen or genetic differences in the immune response of the individual.
However, large sample size (n = 9) in order to reduce bias was employed.
CD. 02864258 2014-09-15 As for the relative quantification of gene expression profiles are observed like in some genes for the phenotypes being studied. Two genes that show a similar expression pattern are IgM
and Grb2. In these. a decrease is observed in susceptible phenotypes compared to resistant and control. IgM is the dominant immunoglobulin in salmon and a first line of defense (Bengten E.
Wilson M. Miller N. Clem LW. Pilstrom L and Warr GW.
Immunoglobulin isotypes: structure. function. and genetics. Curr Top Microbiol Immunol. 2000. 248:189-219). however this immunoglobulin turns out to be of little specificness (Hordvik I.. Lindstrom C.D.. Voie A.M.. Jacob A.L.J and Endresen C.
Structure and organization of the immunoglobulin M heavy chain genes in Atlantic salmon. Salmo salar. 1997. Molecular Immunology. 34. 631-639) and with few neutralizing antibodies.
but despite this the importance lie in the recognition and binding to the virus for containment and complement activation.
which increases the number of neutralizing antibodies. as well as B lymphocytes with what is promotes activation of adaptive immunity, and therefore the effectiveness of the system to counteract the virus (Olesen NJ. y Jsrgensen PEV. Quantification of serum immunoglobulin in rainbow trout Salmo gairdneri under various environmental conditions. 1986. Dis Aquat Org 1. 183-189;
1.
Boes. M. Role of natural and immune IgM antibodies in immune responses. 2000. Molecular Immunolology 37:1141-1149). Thus. the subject to have low levels of IgM expression individuals would delay the activity of the immune system and present a low activity and this reaction.
Moreover Grb2 is an adapter molecule related to the antigen-activated signaling both T (TCR) and B lymphocytes (BCR) receptors. This signaling both development and lymphocyte activation is regulated both. Antigen stimulation to occur. the activated receptor tyrosine kinases of the Src family, resulting in phosphorylation of several substrates and multiple signalosomas assembly. The coordination of signaling components in signalosomas. start the corresponding signaling cascades that control transcription and thereby cell fate. activation or other biological processes (Samelson. L. E. Signal transduction mediated by the T cell antigen receptor: the role of adapter proteins. 2000. Annu. Rev. Immunol. 20:371-394). To counteract antigen stimulation. the antigen-activated receptor as negative regulators must recruit tyrosine kinases and phosphatases negative in signalosomas (Shaw A yThomas ML. Coordinate interactions of protein tyrosine kinases and protein tyrosine phosphatases in T-cell receptor- mediated signalling. 1991.-Curr Opin Cell Biol.;3:862-868). The balance of positive and negative signals are essential for proper development, activation and induction of lymphocytes. Grb2 described which is essential in the activation of Ras-MAPK pathway and the regulation of MAPKs.
JNK and p38 which are involved in both positive and negative selection of T cells (Houtman JC. Yamaguchi H. Barda Saad M.
Braiman A. Bowden B. Appella E. Schuck P y Samelson LE.
Oligomerization of sig- naling complexes by the multipoint binding of GRB2 to both LAT and SOS1.2006. Nat Struct Mol Biol 13:798-805). This regulation occurs at the beginning of the cascade triggered by TCR. It has also been described which would be involved in the regulation of signaling for positive selection of T cells CD4+ y CD8+ (Jang IK.. Zhang J.. Gu H. (2009) Grb2. a simple adapter with complex roles in lymphocyte development.
function. and signaling. Inmunol Rev 232; 150-159).B lymphocytes have been reported to both positively and negatively regulate the signaling of the BCR and also regulate Ca2 + signaling (Stork B.
Grb2 and the non-T cell activation linker NTAL Constitute a Ca (2 +) - regulating signal circuit in B lym- phocytes.2004 Immunity.
21:. 681-691). The low expression of the Grb2 gene in individuals susceptible phenotype would realize a reduction in the activation of receptor-mediated immune response of antigen. generating this CD. 02864258 2014-09-15 lower regulation in selection and development of T and B
lymphocytes. the opposite occurs in individuals with resistant phenotype. The differential expression of this gene in susceptible and resistant phenotypes suggests that the induction of T and B lymphocytes would be associated with ISA virus resistance.
Annexin while significant differences with control individuals of both phenotypes (susceptible and resistant).
showing a lower expression of the gene. There could be the possibility that the virus has an inhibitory effect on this gene as described that some viruses have an immunosuppressive effect on some genes (Ronneseth A. Wergeland HI. Pettersen EF y Neutrophils and B-cells in Atlantic cod (Gadus morhua L.). 2007.
Fish Shellfish Immunol. 3:493-503).
Regul has a high expression of this in individuals. Regul is a negative regulator of G protein as it accelerates the hydrolysis of GTP to the G protein activated subunits This inhibitory effect induced by chemokines acting on signals. which have an important role in the movement of immune cells to sites of inflammation . Described that this gene is highly expressed in cells, suggesting a role in the regulation of the immune cell.
Also described is a strong relationship between the expression of Regul and B cell migration (C. Moratz. J. R. Hayman. H. Gu. and J. H. Kehrl. "Abnormal B-cell responses to chemokines. disturbed plasma cell localization, and distorted immune tissue architecture in RGS1-/- mice." Molecular and Cellular Biology.
vol. 24. no. 13. pp. 5767-5775. 2004). Inhibition by Regul results in reducing the effects of chemokines and decreased immune cell migration. which eventually creates a vacuum in the immune response.
The following five genes have a similar expression pattern in which individuals have a resistant phenotype similar to the control with no significant differences in individual expression.
whereas susceptible individuals have low gene expression compared to control.
Cathepsin S is a cysteine protease that plays a critical role in antigen processing and presentation. Described that Cathepsin S is essential for antigen presentation by MHC-II and its inhibition leads to a reduced response of T lymphocytes CD4+
(Gupta S. Dennis J. Thurman RE. Kingston R. Stamatoyannopoulos JA. Predicting Human Nucleosome Occupancy from Primary Sequence.
2008. PLoS Comput Biol 4:1-9). Also. its deficiency has been linked to low mobility of antigen presenting cells and B cells (Faure-Andre G. Vargas P. Yuseff MI. Heuze M. Diaz J. Lankar D.
ak 02864258 2014-09-15 1.
Steri V. Manry J. Hugues S. Vascotto F. Boulanger J. Raposo G.
Bono MR. Rosemblatt M. Piel M. Lennon-Dumenil AM. Regulation of dendritic cell migration by CD74. the MHC class II-associated invariant chain. 2008. Science. 322:1705-1710. The susceptible phenotype has low expression of the gene. which could present problems in the antigen presentation and immune cell mobility.
affecting mainly with this acquired immunity. This effect may contribute to the susceptibility of individuals in this phenotype.
Mays is an adapter molecule that acts after the senses helicase RIG-I viral RNA by activating a signaling cascade ultimately leading to the activation of expression of type I IFN
generating other signaling cascades that lead to activated transcription of interferon (ISGs) in which genes are those encoding proteins with antiviral function. In the case of salmon.
it may be mentioned to Mx-1 which is capable of protecting cells by preventing the replication of IPNV. (Larsen. R.. Rokenes. T..
Robertsen. B. (2004). Inhibition of infectious pancreatic necrosis virus replication by atlantic salmon MX1 protein. J
virol 78. 7938-7944). In this way individuals with low expression of Mays will present less antiviral activity to be inhibited CD. 02864258 2014-09-15 signaling cascade associated with IFN. which would contribute to the susceptibility phenotype.
IgZ is an immunoglobulin recently discovered in zebrafish which has not much information about their biological function.
It has been recently reported to be associated with mucosal immunity and neutralizing antigens in the blood (Ryo S. Wijdeven RH. Tyagi A. Hermsen T. Kono T. Karunasagar I. Rombout JH. Sakai M. Verburg-van Kemenade BM y Sayan R. Common carp have two subclasses of bonyfish specific antibody IgZ
showing differential expression in response to infection. 2010.
Dev Comp Immunol.
34:1183-1190). This immunoglobulin is expressed in smaller amounts than IgM. but would help in neutralizing the virus and signaling for the activation of the immune system. Because individuals with susceptible phenotype have low gene expression, one could infer that have lower virus neutralization and hence further progress of the disease.
T-bet and Gata3 are antagonistic transcription factors involved in cell fate commitment and T. which eventually lead to the development of Thl and Th2 lymphocytes. T-bet promotes differentiation into Thl cells. which protect against intracellular parasites and viruses causing factors such as IFN.
IL-2 and TNF which will induce activation of macrophages and NK
cells, production of cytotoxic T lymphocytes (CTL) and complement activation, generating a response primarily of cell type (Jenner RG. Townsend NJ. Jackson I. Sun K. Bouwman RD. Young RA. Glimcher LH y Lord GM. The transcription factors T-bet and GATA-3 control alternative pathways of T-cell differentiation through a shared set of target genes. 2009. Proc Natl Acad Sci U S A. 106:17876-17881). Gata3 on another part promotes differentiation towards Th2 lymphocytes. which by action of interleukins as IL-4. IL-5.
IL-6 and IL-13 produce effects such as activating antibody-mediated immunity. eosinophil differentiation. inflammation processes and elimination of macrophages. primarily creating a humoral response. The effectors of both pathways have an inhibitory effect on the other. this destination polarizing towards the Thl or Th2 lymphocytes. IFN-y inhibits Th2 polarization while IL-4 does so with Thl (Constant SL y Bottomly K. Induction of Thl and Th2 CD4+ T cell responses the alternative approaches. 1997. Annu Rev Immunol. 15:297-322). Thus as can be seen in the graphs of Figure 5. in susceptible individuals, it was observed that both channels are decreased or inhibited which realizes differentiation and polarization of T lymphocytes are not occur or do so measuring less compared to resistant individuals or controls. For the same reason the susceptibility of individuals is explained.
The ROC curve analysis was employed using data from gross normalized relative expression of resistant and susceptible individuals with the aim of finding genes that could differentiate the two phenotypes prediction mode and that they possess a high level of sensitivity and specificity, resulted in a area under the curve (AUC) equal to or close to 1 When analyzing 5 are genes having an AUC of 1. where these Gata3.
Grb2. IgM. Mays and Regul. presenting 100% success. For this reason these genes were selected for discriminant analysis. which also could discriminate both phenotypes perfectly. checking the predictive power of the ROC curve thrown genes. Comparing thrown by the ROC curve analysis with results of two-way ANOVA genes. we noticed that Grb2. IgM and Regul genes have significant percentages of the variation in the data. whether this be associated with the effect of the phenotype in the case IgM and Grb2. because this changes only affect the susceptible phenotype so statistically decreases their influence, resulting in smaller percentages.
Claims
1.
Using genes selected from the group consisting of Grb2.
GATA3 IgM and MAVS and Regul genes CHARACTERIZED because they serve as predictors to determine phenotypes susceptible and resistant to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar), quantifying the expression profile of these genes using real-time PCR analysis, and where a sample with expression pattern for a defiance Lr cohabitation with ISA, which has no significant difference when compared to the expression pattern of these genes in a control sample without defiance from cohabitation to ISA, is indicative of phenotype resistance to ISA. namely having characteristic, a mortality rate less than 40%
for the ISA virus and heritability of said character greater than or equal to 0.35; and a sample having a pattern of expression to a defiance of cohabitation to ISA which happens to be low when compared to a control sample without defiance of cohabitation to ISA, is indicative of a phenotype susceptible to ISA, namely presented as a characteristic, mortality rate exceeding a 50% for the ISA virus and a heritability of less than or equal to 0.34.
Using genes selected from the group consisting of Grb2.
GATA3 IgM and MAVS and Regul genes CHARACTERIZED because they serve as predictors to determine phenotypes susceptible and resistant to infectious salmon anemia (ISA) in Atlantic salmon (Salmo salar), quantifying the expression profile of these genes using real-time PCR analysis, and where a sample with expression pattern for a defiance Lr cohabitation with ISA, which has no significant difference when compared to the expression pattern of these genes in a control sample without defiance from cohabitation to ISA, is indicative of phenotype resistance to ISA. namely having characteristic, a mortality rate less than 40%
for the ISA virus and heritability of said character greater than or equal to 0.35; and a sample having a pattern of expression to a defiance of cohabitation to ISA which happens to be low when compared to a control sample without defiance of cohabitation to ISA, is indicative of a phenotype susceptible to ISA, namely presented as a characteristic, mortality rate exceeding a 50% for the ISA virus and a heritability of less than or equal to 0.34.
Applications Claiming Priority (2)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CL2013002663A CL2013002663A1 (en) | 2013-09-16 | 2013-09-16 | Use of grb2, gata3, igm, mavs and regul genes to determine phenotypes susceptible and resistant to infectious salmon anemia (isa) in Atlantic salmon (salmo salar). |
| CL2663-2013 | 2013-09-16 |
Publications (1)
| Publication Number | Publication Date |
|---|---|
| CA2864258A1 true CA2864258A1 (en) | 2015-03-16 |
Family
ID=52686622
Family Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA2864258A Abandoned CA2864258A1 (en) | 2013-09-16 | 2014-09-15 | Use of grb2, gata3, igm, and mavs genes to determine susceptible phenotypes and resistance to infectious salmon anemia (isa) in atlantic salmon (salmo salar) |
Country Status (3)
| Country | Link |
|---|---|
| CA (1) | CA2864258A1 (en) |
| CL (1) | CL2013002663A1 (en) |
| NO (1) | NO20141117A1 (en) |
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018220385A1 (en) * | 2017-05-31 | 2018-12-06 | Blue Genomics Chile Spa. | Genetic identification of piscirickettsia salmonis resistant salmonids |
| CN117737257A (en) * | 2024-01-12 | 2024-03-22 | 湖南农业大学 | SNP molecular marker of grass carp C3.1 gene and application thereof in identifying hemorrhagic disease resistance of grass carp |
-
2013
- 2013-09-16 CL CL2013002663A patent/CL2013002663A1/en unknown
-
2014
- 2014-09-15 CA CA2864258A patent/CA2864258A1/en not_active Abandoned
- 2014-09-16 NO NO20141117A patent/NO20141117A1/en not_active Application Discontinuation
Cited By (2)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| WO2018220385A1 (en) * | 2017-05-31 | 2018-12-06 | Blue Genomics Chile Spa. | Genetic identification of piscirickettsia salmonis resistant salmonids |
| CN117737257A (en) * | 2024-01-12 | 2024-03-22 | 湖南农业大学 | SNP molecular marker of grass carp C3.1 gene and application thereof in identifying hemorrhagic disease resistance of grass carp |
Also Published As
| Publication number | Publication date |
|---|---|
| NO20141117A1 (en) | 2015-03-17 |
| CL2013002663A1 (en) | 2014-04-11 |
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| He et al. | Transcriptome analysis reveals strong and complex antiviral response in a mollusc | |
| Tran et al. | Transcriptome analysis and microsatellite discovery in the blunt snout bream (Megalobrama amblycephala) after challenge with Aeromonas hydrophila | |
| Zhang et al. | Transcriptome profiling and digital gene expression analysis of Nile tilapia (Oreochromis niloticus) infected by Streptococcus agalactiae | |
| Zhu et al. | Trancriptomic profiling revealed the signatures of acute immune response in tilapia (Oreochromis niloticus) following Streptococcus iniae challenge | |
| Ye et al. | Applications of transcriptomics and proteomics in understanding fish immunity | |
| Hori et al. | A moderate increase in ambient temperature modulates the Atlantic cod (Gadus morhua) spleen transcriptome response to intraperitoneal viral mimic injection | |
| Valenzuela-Miranda et al. | High-throughput transcriptome analysis of ISAV-infected Atlantic salmon Salmo salar unravels divergent immune responses associated to head-kidney, liver and gills tissues | |
| Rise et al. | Impact of asymptomatic nodavirus carrier state and intraperitoneal viral mimic injection on brain transcript expression in Atlantic cod (Gadus morhua) | |
| Hoon-Hanks et al. | Longitudinal and cross-sectional sampling of serpentovirus (nidovirus) infection in captive snakes reveals high prevalence, persistent infection, and increased mortality in pythons and divergent serpentovirus infection in boas and colubrids | |
| Jiang et al. | Transcriptome analysis provides insights into molecular immune mechanisms of rabbitfish, Siganus oramin against Cryptocaryon irritans infection | |
| Labella et al. | Transcriptomic profiles of Senegalese sole infected with nervous necrosis virus reassortants presenting different degree of virulence | |
| Díaz-Rosales et al. | Microarray-based identification of differentially expressed genes in families of turbot (Scophthalmus maximus) after infection with viral haemorrhagic septicaemia virus (VHSV) | |
| Ye et al. | Characterization of spleen transcriptome of Schizothorax prenanti during Aeromonas hydrophila infection | |
| He et al. | Differential immune-related gene expression in the spleens of duck Tembusu virus-infected goslings | |
| Lu et al. | Differential expression of innate and adaptive immune genes in the survivors of three gibel carp gynogenetic clones after herpesvirus challenge | |
| Pereiro et al. | Turbot (Scophthalmus maximus) vs. VHSV (viral hemorrhagic septicemia virus): a review | |
| Gjessing et al. | The Atlantic salmon gill transcriptome response in a natural outbreak of salmon gill pox virus infection reveals new biomarkers of gill pathology and suppression of mucosal defense | |
| Martínez et al. | Turbot (Scophthalmus maximus) genomic resources: application for boosting aquaculture production | |
| Eslamloo et al. | Characterization and transcript expression analyses of Atlantic cod viperin | |
| Zhu et al. | Basal polarization of the immune responses to Streptococcus agalactiae susceptible and resistant tilapia (Oreochromis niloticus) | |
| Medina-Gali et al. | Chromatin immunoprecipitation and high throughput sequencing of SVCV-infected zebrafish reveals novel epigenetic histone methylation patterns involved in antiviral immune response | |
| Aoki et al. | Microarray technology is an effective tool for identifying genes related to the aquacultural improvement of Japanese flounder, Paralichthys olivaceus | |
| Wang et al. | Transcriptome analysis reveals temperature-dependent early immune response in flounder (Paralichthys olivaceus) after Hirame novirhabdovirus (HIRRV) infection | |
| Solbakken et al. | Disentangling the immune response and host-pathogen interactions in Francisella noatunensis infected Atlantic cod | |
| Dar et al. | Genetics of disease resistance in chicken |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| FZDE | Discontinued |
Effective date: 20211213 |