CA2825924C - Respiratory metabolism-associated gene bnaox1 from brassica napus and use thereof - Google Patents

Abstract

The sequences of the AOX1 gene and protein from Brassica napus are provided. The use of AOX1 gene to increase seed oil content and thousand kernel weight in plants is also provided..

Description

RESPIRATORY METABOLISM-ASSOCIATED GENE BnA0X1 FROM B_RASSICA
NAPUS AND THE USE THEREOF
FIELD
The present disclosure relates to the field of plant genetic engineering, more particularly to a respiratory metabolism-associated enzyme BnA0X1 gene and protein, as well as to the use of the respiratory metabolism-associated enzyme BnA0X1 gene and protein to increase the yield and oil content of oil crops.
BACKGROUND
Rapeseed is one of the most important sources for edible vegetable oil and forage protein, as well as the most important raw material for biodiesel in Europe.
Rape (Brassica napus) is the oil crop of the largest acreage in China, and is the fifth-largest crop in China following rice, wheat, maize, and soybean. Rapeseed oil is the major edible oil for Chinese residents, accounting for more than 40% of the total domestic vegetable oil consumption. As the biggest country in consuming vegetable oil in the world, however, China has a self-supporting vegetable oil of less than 40%. To meet the conflicting need, in addition to expansion of planting area, increasing rape oil content and rape yield are the most efficient ways to increase rape oil yield per unit planting area. High yield of rape can significantly improve the benefit from rape production and increase the total profit of rapeseed.
There are several pathways for the mitochondrial electron transport chain in plants, mainly comprising the cytochrome main pathway and the cyanide-resistant alternative pathway. Cyanide-resistant respiration (alternative pathway) refers to a respiratory pathway insensitive to cyanide. An alternative oxidase (AOX) is the terminal oxidase of the cyanide-resistant respiratory pathway in plant mitochondrial respiratory chain, and is extensively found in higher plants and some of fungi and algae. While the alternative oxidase is a terminal oxidase of the alternative pathway, its endogenous substrates include the reduced ubiquinone and 02. The respiratory

2 PCT/CN2012/070283 electron flow of the alternative pathway branches off at ubiquinone in the main path (cytochrome pathway) and bypasses two ATP-formation sites of Complex III and IV.
Four electrons from the electron flow are transferred directly by AOX to an oxygen molecule, which is reduced to 1120, while the energy not used for ATP
synthesis is lost in the form of heat release.
The alternative oxidase is a di-iron carboxylate protein. It has structural features common to other di-iron carboxylate proteins and a function of eliminating molecular oxygen. More importantly, it can also regulate actively the operation degree of cyanide resistant respiratory pathway by alternating the structure itself, thus further regulating various aspects of the cellular metabolism and functionality, in order to adapt to variable environmental conditions, enhance the plants' adaptation to various adverse environments and regulate growth rate in plants. The alternative oxidase is involved in cellular apoptosis and photosynthesis. Regulation of the AOX
activity is affected by various factors. Environmental stresses, plant injury, frost, drought, osmotic pressure, pathogenic bacteria, etc. may induce the expression of AOX.
Salicylic acid (SA), hydrogen peroxide, ethylene, and the main respiratory chain inhibitors may also induce the expression of AOX in plants. Cyanide-resistant respiration activity and AOX expression level are higher in the spadix of the thermogenic plant. In the non-thermogenic plant, the AOX expression level is associated with the developmental stages. For example, AOX is expressed during senescence and fruit maturation.
AOX regulates energy metabolism. When the energy metabolism is saturated, AOX pathway releases the energy by way of heat elimination and maintains the electron transport and TCA. "The energy overflow hypothesis" put forward by Lambers (1982, Physiology Plant 55:478) states that transferring of electrons through AOX may enable TCA cycle and glycolysis to proceed when the main respiratory chain activity is inhibited or the reduction power within a cell is running high. The AOX
activity can be activated by pyruvate, a substrate in TCA cycle, indicating that transfer of part of the electrons through the AOX pathway can be induced when the substrate concentration in TCA cycle is too high. Environmental changes result in differences in the AOX

expression, which has effects both on mitochondrial functions and on cellular functions outside the mitochondria. Oxygen stress induces the expression of the AOX to effect anti-oxidation, that is, Oxidation mediated by the AOX can decrease reactive oxygen species (ROS) generated by the main respiratory chain when the cytochrome pathway is inhibited. The ROS level is decreased when AOX is over-expressed in a transgenic tobacco plant, while the ROS level is increased when AOX is not over-expressed in the transgenic tobacco plant. In measuring the thermal respiration, Hansen et al (2002, Thermochim Acta 388:415) found that environmental changes can alter the growth rate of a plant, that is, AOX plays a balancing role in growth kinetics of a plant. Heat released through AOX in the thermogenic plant may enable pollens to emanate fragrance, thus attract insect vectors (Meeuse, (1975) Annu Rev Plant Physiol 26:117). Expression of AOX in non-thermogenic plants is not associated to such a thermogenesis (Borecky and Vercesi (2005) Bioscience Reports 25:271). AOX can effectively control respiration rate and maintain energy homeostasis in cells to ensure normal growth of a plant encountering environmental changes (Hansen et al (2002) Thermochim Acta 388:415). AOX not only allows Ambidopsis thaliana to germinate at low temperatures, but also can prevent the generation of peroxides by plant tissues under adverse conditions, to avoid adverse effect on various cellular functions (Fiorani et al (2005) Plant Physiology 139:1795). AOX plays a key role in the cytoplasm and in some of the carbon metabolism pathways (Umbach et al (2005) Plant Physiol 139:1806).
A variety of environmental stresses can alter the proceeding of the cyanide-resistant pathway in plants. However, those studies in this regard are still very superficial, and the signal regulation mechanism and physiological significance of said proceeding is unclear yet.
The current disclosure provides methods and means to improve plant seed yield and seed oil content by increasing the expression of A0X1, as will become apparent from the following description, examples, drawings and claims provided herein.
SUMMARY
In a first embodiment, a method is provided for increasing oil

3 content, such as seed oil content, and/or seed yield, such as Thousand Kernel Weight in plants, comprising increasing expression of a nucleic acid encoding an A0X1 protein. In a further embodiment, said A0X1 protein has at least 60% sequence identity to SEQ ID
No. 2. In a further embodiment, said A0X1 protein has at least 80% sequence identity to SEQ ID No. 2. In yet a further embodiment, said nucleic acid has at least 80%
sequence identity to SEQ ID NO. 1.
In yet another embodiment, a method is provided for increasing seed oil content and/or seed yield, such as Thousand Kernel Weight in plants comprising increasing expression of a nucleic acid encoding a protein with has at least 80% sequence identity to the A0X1B protein from Arabidopsis thaliana. In yet a further embodiment, said nucleic acid has at least 80% sequence identity to the A0X1B coding sequence from Arahidopsis thaliana.
In a further embodiment, a method is provided for increasing oil content and/or seed yield, such as Thousand Kernel Weight in plants comprising increasing expression of a nucleic acid encoding an A0X1 protein comprising the steps of:
a) providing a plant cell with a chimeric gene comprising the following operably linked nucleic acid molecules:
i) a heterologous plant-expressible promoter;
said nucleic acid encoding an A0X1 protein; and optionally a DNA region involved in transcription termination and polyadenylation;
b) regeneration of said plant cell into a plant.
In a further embodiment, said plant-expressible promoter is a constitutive promoter, and in yet another embodiment, said constitutive promoter is the 35S

promoter. In a further embodiment, said plant-expressible promoter is a seed-specific promoter.
It is a further aspect of the disclosure to provide methods for increasing seed oil content and/or seed yield, such as Thousand Kernel Weight in seed oil plants, and it is yet another embodiment to provide methods

4 for increasing seed oil content in Brassicaceae plants.
In a further embodiment, plants are provided that are obtained by the methods according to the disclosure. Another embodiment provides seeds from plants obtained by the methods according to the disclosure. In yet another embodiment, oil from the seeds of plants obtained by the methods according to the disclosure are provided.
An isolated DNA encoding the Brassica napus A0X1 protein of SEQ ID No. 2 is disclosed, such as an isolated DNA consisting of SEQ ID No. 1. An isolated Brassica napus AOX protein consisting of the nucleotide sequence SEQ ID No. 2 is also disclosed.
The disclosure further provides a chimeric gene comprising the following operably linked nucleic acid molecules:
a) a heterologous plant-expressible promoter;
b) a nucleic acid encoding an A0X1 protein containing at least 60% sequence identity to SEQ ID No. 2; and optionally c) a DNA region involved in transcription termination and polyadenylation.
In another embodiment, said A0X1 protein contains at least 80% sequence identity to SEQ ID No. 2, whereas in yet another embodiment said nucleic acid encoding an A0X1 protein contains at least 80% sequence identity to SEQ ID No. 1. In a further embodiment, said plant-expressible promoter is a constitutive promoter, such as the 35S promoter, and in yet a further embodiment, said plant-expressible promoter is a seed-specific promoter.
The disclosure further relates to the use of the chimeric genes or of the isolated DNA according to the disclosure to increase plant seed oil content and/or Thousand Kernel Weight.
The disclosure further provides methods for producing oil, comprising harvesting seeds from the plants according to the disclosure and extracting the oil from said seeds.
In a further aspect, the disclosure provides a method of producing food or feed such as oil, meal, grain, starch, flour or protein, or an industrial product such as biofuel, fiber, industrial chemicals, a pharmaceutical or a neutraceutical, comprising obtaining the plant according to the disclosure or a part thereof, and preparing the food, feed, or industrial product from the plant or part thereof.
The invention disclosed and claimed herein pertains to a method for increasing oil content, seed yield or both in a seed oil plant comprising increasing expression of a nucleic acid encoding an A0X1 protein, wherein said A0X1 protein has at least 80%
sequence identity to SEQ ID NO:2. The invention disclosed and claimed herein also pertains to a method for increasing oil content, seed yield or both in a seed oil plant comprising the steps of: a) providing a seed oil plant cell with a chimeric nucleic acid construct comprising the following operably linked nucleic acid molecules: i) a heterologous plant-expressible promoter; and a nucleic acid encoding an A0X1 protein, wherein said A0X1 protein has at least 80% sequence identity to SEQ
ID
NO:2; and b) regeneration of said plant cell into the seed oil plant.
The invention disclosed and claimed herein also pertains to an isolated Brassica napus A0X1 DNA molecule comprising the nucleotide sequence of SEQ ID
NO:l.
The invention disclosed and claimed herein also pertains to an isolated Brassica napus A0X1 protein comprising the amino acid sequence of SEQ ID NO:2.
The invention disclosed and claimed herein also pertains to a chimeric DNA
construct comprising the following operably linked DNA molecules: a) a heterologous plant-expressible promoter; and b) DNA encoding an A0X1 protein containing at least 90% sequence identity to SEQ ID NO:2. Also claimed is a plant cell comprising such a chimeric DNA construct, a cell of a seed from a plant that comprises such a construct and use of such a construct to increase plant seed oil content, Thousand Kernel Weight or both. Also claimed is use of the aforementioned isolated DNA
molecule to increase plant seed oil content, Thousand Kernel Weight or both. Also claimed is a method for producing oil, comprising harvesting seeds from a plant comprising the aforementioned chimeric DNA construct and extracting the oil from said seeds.
Also claimed is a method of producing food, feed, or an industrial product comprising: a) obtaining a plant comprising the aforementioned chimeric DNA construct or a plant part thereof; and b) preparing the food, feed or industrial product from the plant or plant part.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1. Schematic representation of an Arabidopsis expression vector for a rape respiratory metabolism-associated gene BnA0X1.
Figure 2. PCR identification of the Arabidopsis thaliana T1 generation carrying a rape respiratory metabolism-associated gene BnA0X1 transgene.
Figure 3. Comparison of the seed sizes between the transgenic plant carrying a rape respiratory metabolism-associated gene BnAOX1 and the wild type control, wherein seeds from the wild type control are shown in Fig.8A, and those from the transgenic line are shown in Fig. 3B.
DETAILED DESCRIPTION
The current invention is based on the finding that overexpression of A0X1 in Arabidopsis results in increased seed oil content and increased Thousand Kernel Weight.
In a first embodiment of the invention, a method is provided for increasing oil content, such as seed oil content, in plants, and/or seed yield, such as Thousand Kernel Weight, comprising increasing expression of a nucleic acid encoding an protein. In yet a further embodiment, said A0X1 protein has at least 60%
sequence identity to SEQ ID No. 2. In yet a further embodiment, said A0X1 protein has at least 80% sequence identity to SEQ ID No. 2. In yet a further embodiment, said nucleic acid has at least 80% sequence identity to SEQ ID NO. 1. In yet another embodiment of the invention, said A0X1 protein has at least 80% sequence identity to the A0X1B
protein from Arabidopsis thaliana. In yet a further embodiment, said nucleic acid has at least 80% sequence identity to the A0X1B coding sequence from Arabidopsis thaliana.
Increasing oil content, such as seed oil content, in plants, and/or seed yield, such as Thousand Kernel Weight, as used herein, can be increasing oil content, or increasing 6a seed yield, or increasing both oil content and seed yield.
At least 60% sequence identity can be, for example, at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or 100% sequence identity.
At least 80% sequence identity can be, for example, at least 80%, or at least 83%, or at least 85%, or at least 87%, or at least 90%, or at least 95%, or at least 97%, or at least 98%, or at least 99%, or 100% sequence identity.
The methods and means described herein are believed to be suitable for all plant cells and plants, both dicotyledonous and monocotyledonous plant cells and plants including but not limited to cotton, Brassica, oilseed rape, wheat, corn or maize, barley, sunflowers, rice, oats, sugarcane, soybean, vegetables (including chicory, lettuce, tomato), tobacco, potato, sugarbeet, papaya, pineapple, mango, Arabidopsis thaliana, but also plants used in horticulture, floriculture or forestry. Especially suited are oil producing plants such as rapeseed (Brassica spp.), flax (Linum usitati ssi mum), safflower (Carthamus tinctorius), sunflower (Helianthus annuus), maize or corn (Zea mays), soybean (Glycine max), mustard (Brassica spp. and Sinapis alba), crambe(Crambe abyssinica), eruca (Eruca saiva), oil palm (Elaeis guineeis), cottonseed (Gossypium spp.), groundnut (Arac.his 12ypogaea), coconut (Cocus nucifera), castor bean (Ricinus communis), coriander (Coriandrum sativum), squash (Cucurbita maxima), Brazil nut (Bertholletia excelsa) or jojoba (Simmondsia chinensis) gold-of-pleasure (Camelina sativa), purging nut (Jatropha curcas), Echium spp., calendula (Calendula officinalis), olive (Olea europaea), wheat (Triticum spp.), oat (Avena spp.), rye (Secale cereale), rice (Oryza sativa), Lesquerella spp., Cup.hea spp., meadow foam (Limnanthes alba), avocado (Persea Americana), hazelnut (Corylus), sesame (Sesamum indicum), safflower (Carthamus tinctorius), tung tree (Aleurites fordii), poppy (Papaver somniferum) tobacco (1Vicotiana spp.).
The methods and means described herein can also be used in algae such as Scenedesmus dimorph us, Euglena gracilis, Phaeodactylum tricorn utum, Pleurochrysis carterae, Prymnesium parvum, Tetraselmis chui, Tetraselmis suecica, Isochrysis galbana, Nannochloropsis sauna, Botryococcus braunii, Duna tertiolecta, Nannochloris spp. or Spirulina spp.
As used herein, a "Brassica plant" is a plant which belongs to one of the species Brassica napus, Brassica rapa (or campestris), or Brassica juncea.
Alternatively, the plant can belong to a species originating from intercrossing of these Brassica species, such as B. napocampestris, or of an artificial crossing of one of these Brassica species with another species of the Cruciferacea. A Brassica oilseed plant refers to any one of the species Brassica nap us, Brassica rapa (or campestris), Brassica carinata, Brassica nigra or Brassica juncea.
An increase in seed oil content can be an increase with at least 2%, or at least 5%, or at least 10%, or at least 15%, or at least 20%, or at least 25%, or at least 30%, or at least 40%, or at least 50%. Said increase is an increase with respect to levels as obtained in control plants.
"Thousand Kernel Weight" as used herein, also "TKW", refers to the weight in grams of 1000 seeds. An increased TKW may result from an increase in seed size and/or an increase in seed weight.
An increase in Thousand Kernel Weight can be an increase with at least 2%, or at least 5%, or at least 10%, or at least 15%, or at least 20%, or at least 25%, or at least 30%, or at least 40%, or at least 50%. Said increase is an increase with respect to Thousand Kernel Weight as obtained in control plants.
The "control plant" as used herein is generally a plant of the same species which has wild-type levels of A0X1. "Wild-type levels of A0X1" as used herein refers to the typical levels of A0X1 protein in a plant as it most commonly occurs in nature. Said control plant has thus not been provided either with a nucleic acid molecule encoding A0X1, or with a nucleic acid activating expression of the endogenous A0X1, such as a T-DNA activation tag or a promoter with stronger activity than the endogenous promoter.
The A0X1 protein refers the Alternative Oxidase protein, which is the terminal oxidase of the cyanide-resistant respiratory pathway in the plant mitochondrial respiratory chain. Endogenous substrates of A0X1 include reduced ubiquinone and 02.
The respiratory electron flow of the alternative pathway branches off at ubiquinone in the main path (cytochrome pathway) and bypasses two ATP-formation sites of Complex III and IV. Four electrons from the electron flow are transferred directly by A0X1 to an oxygen molecule, which is reduced to H20, while the energy not used for ATP
synthesis is lost in the form of heat release. A0X1 is a di-iron carboxylate protein. It has structural features common to other di-iron carboxylate proteins and a function of eliminating molecular oxygen.
An A0X1 protein is a protein that contains at least 50%, or at least 55%, or at least 60%, or at least 65%, or at least 70%, or at least 75%, or at least 80%, or at least 85%, or at least 90%, or at least 95%, or at least 98%, or at least 99% sequence identity to any of the AOX proteins as described in this application.
Examples of AOX proteins are the Arabidopsis Monona A0X1 proteins A0X1A
(AT3G22370), A0X1B (AT3G22360), A0X1C (AT3G27620), and A0X1D (AT1G32350).
The "A0X1B protein from Arabidopsis thaliana", also AtA0X1B, as used herein refers to the protein with accession number At3g22360, whereas the "A0X1B
coding sequence from Arabidopsis Monona", also AtA0X1B, refers to the coding sequence with accession number At3g22360.
Based on the available sequences, the skilled person can isolate genes encoding A0X1 other than the genes mentioned above. Homologous nucleotide sequence may be identified and isolated by hybridization under stringent conditions using as probes identified nucleotide sequences.
"High stringency conditions" can be provided, for example, by hybridization at 65 C in an aqueous solution containing 6x SSC (20x SSC contains 3.0 M NaC1, 0.3 M
Na-citrate, pH 7.0), 5x Denhardt's (100X Denhardt's contains 2% Ficoll, 2%
Polyvinyl pyrollidone, 2% Bovine Serum Albumin), 0.5% sodium dodecyl sulphate (SDS), and jig/m1 denaturated carrier DNA (single-stranded fish sperm DNA, with an average length of 120 - 3000 nucleotides) as non-specific competitor. Following hybridization, high stringency washing may be done in several steps, with a final wash (about 30 min) at the hybridization temperature in 0.2-0.1x SSC, 0.1% SDS.
"Moderate stringency conditions" refers to conditions equivalent to hybridization in the above described solution but at about 60-62 C. Moderate stringency washing may be done at the hybridization temperature in lx SSC, 0.1% SDS.
"Low stringency" refers to conditions equivalent to hybridization in the above described solution at about 50-52 C. Low stringency washing may be done at the hybridization temperature in 2x SSC, 0.1% SDS. See also Sambrook et al. (1989) and Sambrook and Russell (2001).
Other sequences encoding A0X1 may also be obtained by DNA amplification using oligonucleotides specific for genes encoding A0X1 as primers, such as but not limited to oligonucleotides comprising or consisting of about 20 to about 50 consecutive nucleotides from the known nucleotide sequences or their complement.
As used herein, an A0X1 protein which has "at least 80% sequence identity to SEQ
ID No. 2" can be an A0X1 protein with 80%, or 83%, or 85%, or 87%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to SEQ
ID No. 2, or can be SEQ ID No. 2 itself. An AOX protein which has at least 80%

sequence identity to SEQ ID NO. 2 can be an AOX protein which has at least 80%

sequence identity to both SEQ ID NO. 2 and the A0X1B protein from Arabidopsis thaliana, such as an AOX protein having 87% sequence identity to both SEQ ID
NO. 2 and the A0X1B protein from Arabidopsis thaliana.
As used herein, a nucleic acid which has "at least 80% sequence identity to SEQ ID
NO. 1" can be a nucleic acid with 80%, or 83%, or 85%, or 87%, or 90%, or 91%, or 92%, or 93%, or 94%, or 95%, or 96%, or 97%, or 98%, or 99% sequence identity to SEQ ID No.
1, or can be SEQ ID No. 1 itself. A nucleic acid which has at least 80%
sequence identity to SEQ ID NO. 1 can be a nucleic acid which has at least 80% sequence identity to both SEQ ID NO. 1 and the A0X1B coding sequence from Arabidopsis thaliana, such as a nucleic acid having 83% sequence identity to both SEQ ID
NO. 1 and the A0X1B coding sequence from Arabidopsis thaliana.
It will be clear that mutant alleles or genes can be obtained by addition, substitution, insertion or deletion of one or more nucleotides with respect to the AOX
sequences according to the invention.
Increasing expression of a nucleic acid encoding an A0X1 protein can comprise increasing expression on a whole plant level. Alternatively, increasing expression of a nucleic acid encoding an A0X1 protein can comprise increasing expression in specific plant parts or tissues, such as seeds, or specific seed tissues.
Increasing expression of a nucleic acid encoding an A0X1 protein can conveniently be achieved by heterologously expressing a nucleic acid encoding A0X1.
Moreover, expression of the endogenous A0X1 encoding gene can be increased through, for example, T-DNA activation tagging, or by targeted genome engineering technologies in which, for example, the endogenous promoter is modified such that it drives higher levels of expression, or in which the endogenous promoter is replaced with a stronger promoter.
T-DNA activation tagging (Memelink, 2003, Methods Mol Biol. 236:345) is a method to activate endogenous genes by random insertion of a T-DNA carrying promoter or enhancer elements, which can cause transcriptional activation of flanking plant genes. The method can consist of generating a large number of transformed plants or plant cells using a specialized T-DNA construct, followed by selection for the desired phenotype.
Targeted genome engineering refers to generate intended and directed modifications into the genome. Such intended modifications can be insertions at specific genomic locations, deletions of specific endogenous sequences, and replacements of endogenous sequences. Targeted genome engineering can be based on homologous recombination. Targeted genome engineering to increase expression of the A0X1 endogene can consist of insertion of a promoter, stronger than the endogenous promoter, in front of the A0X1 coding sequence, or insert an enhancer to increase promoter activity, or insert elements enhancing RNA stability or enhancing translation of the encoded mRNA.
In a further embodiment of the invention, a method is provided for increasing oil content, such as seed oil content, and/or seed yield, such as Thousand Kernel Weight, in plants comprising increasing expression of a nucleic acid encoding an A0X1 protein comprising the steps of:
a) providing a plant cell with a chimeric gene comprising the following operably linked nucleic acid molecules:
i) a heterologous plant-expressible promoter;
said nucleic acid encoding an A0X1 protein; and optionally a DNA region involved in transcription termination and polyadenylation;
b) regeneration of said plant cell into a plant.
In a further embodiment, said plant-expressible promoter is a constitutive promoter, and in yet another embodiment, said constitutive promoter is the 35S

promoter. In a further embodiment, said plant-expressible promoter is a seed-specific promoter.
Said plant cell can be provided with a chimeric gene using methods well-known in the art. Methods to provide plant cells with a chimeric gene are not deemed critical for the current invention and any method to provide plant cells with a chimeric gene suitable for a particular plant species can be used. Such methods are well known in the art and include Agrobacterium- mediated transformation, particle gun delivery, microinjection, electroporation of intact cells, polyethyleneglycol-mediated protoplast transformation, electroporation of protoplasts, liposome-mediated transformation, silicon-whiskers mediated transformation etc. Said chimeric gene may be stably integrated into the genome of said plant cell, resulting in a transformed plant cell. The transformed plant cells obtained in this way may then be regenerated into mature fertile transformed plants.
As used herein, the term "plant-expressible promoter" means a DNA sequence that is capable of controlling (initiating) transcription in a plant cell. This includes any promoter of plant origin, but also any promoter of non-plant origin which is capable of directing transcription in a plant cell, i.e., certain promoters of viral or bacterial origin such as the CaMV35S (Harpster et al. (1988) Mal Gen Genet. 212(1):182-90, the subterranean clover virus promoter No 4 or No 7 (W09606932), or T-DNA gene promoters but also tissue-specific or organ-specific promoters including but not limited to seed-specific promoters (e.g., W089/03887), organ-primordia specific promoters (An et al. (1996) Plant Cell 8(1):15-30), stem-specific promoters (Keller et al., (1988) EMBO
J. 7(12): 3625-3633), leaf specific promoters (Hudspeth et al. (1989) Plant Mol Biol. 12:
579-589), mesophyl-specific promoters (such as the light-inducible Rubisco promoters), root-specific promoters (Keller et al. (1989) Genes Dev. 3: 1639-1646), tuber-specific promoters (Keil et al. (1989) EMBO J. 8(5): 1323-1330), vascular tissue specific promoters (Peleman et al. (1989) Gene 84: 359-369), stamen-selective promoters (WO
89/10396, WO 92/13956), dehiscence zone specific promoters (WO 97/13865) and the like.
A "heterologous promoter" as used herein refers to a promoter which is not normally associated in its natural context with the coding DNA region operably linked to it in the DNA molecules according to the invention. Accordingly, a heterologous promoter excludes the naturally associated promoter. A heterologous promoter to the nucleic acid encoding an A0X1 protein is therefore a promoter other than the promoter.
A chimeric gene comprising a heterologous promoter and a nucleic acid encoding an A0X1 protein can also be referred to as an artificial construct.
Constitutive promoters are well known in the art, and include the CaMV35S
promoter (Harpster et al. (1988) Mol Gen Genet. 212(1):182-90), Actin promoters, such as, for example, the promoter from the Rice Actin gene (McElroy et al., 1990, Plant Cell 2:163), the promoter of the Cassava Vein Mosaic Virus (Verdaguer et al., 1996 Plant Mol. Biol. 31: 1129), the GOS promoter (de Pater et al., 1992, Plant J.
2:837), the Histone H3 promoter (Chaubet et al., 1986, Plant Mol Biol 6:253), the Agrobacterium tumefaciens Nopaline Synthase (Nos) promoter (Depicker et al., 1982, J. Mol.
Appl.
Genet. 1: 561), or Ubiquitin promoters, such as, for example, the promoter of the maize Ubiquitin-1 gene (Christensen et al., 1992, Plant Mol. Biol. 18:675).
Seed specific promoters are well known in the art, including the USP promoter from Vicia faba described in DE10211617; the promoter sequences described in W02009/073738; promoters from Brassica napus for seed specific gene expression as described in W02009/077478; the plant seed specific promoters described in US2007/0022502; the plant seed specific promoters described in W003/014347;
the seed specific promoter described in W02009/125826; the promoters of the omega _3 fatty acid desaturase family described in W02006/005807 and the like.
A "transcription termination and polyadenylation region" as used herein is a sequence that drives the cleavage of the nascent RNA, whereafter a poly(A) tail is added at the resulting RNA 3' end, functional in plants. Transcription termination and polyadenylation signals functional in plants include, but are not limited to, 3'nos, 3'35S, 3'his and 3'g7.
It is a further aspect of the invention to provide methods for increasing seed oil content and/or Thousand Kernel Weight in seed oil plants, and it is yet another embodiment of the invention to provide methods for increasing seed oil content and/or Thousand Kernel Weight in Brassicaceae plants.
"Seed oil plants" as used herein refers to plants producing oil in their seeds.
Examples of seed oil plants are Brassica oilseeds (including Brassica napus, Brassica campestris (rapa), Brassica juncea or Brassica carinata), sunflower, safflower, soybean, palm, Jatropha, flax, crambe, camelina, corn, sesame, castor beans.
As used herein, "Brassicaceae plants" are plants which according to the current botanical standard would be classified into the family Brassicaceae (formerly Cruciferaeae). Brassicaceae (Mustard) family members are easy to distinguish.
They are annual or perannual plants with alternate leaves without stipules and possess simple inflorescence or branched racemes. The flowers are bilaterally symmetrical and hypogynous. With few exceptions, the flowers have 4 petals (free) alternating with 4 sepals (free) ; 6 stamens (4 long and 2 short), an ovary of 2 united carpels with parital placenta, 2 locular through the formation of a membranous false septum; fruit is a dehiscent capsule opening by 2 valves. Brassicaceae include inter alia the following genera: Sisyrnbrium, Descurania, Alliaria, Arabidopsis, Myagrum, Isatis, Bunia, Erysium, Hesperis, Makolmia, Matthiola, Chorispora, Euclidium, Barbarea, Rorippa, Armoracia, Nasturtium, Den taria, Cardamine, Cardaminopsis, Arabis, Lunaria, Alyssum, Berteroa, Lobularia, Draba, Erop.hila, Cochlearia, Camelina, Neslia, Capsella, Hornungia, Thlsapi, Iberis, Lepidium, Cardaria, Coronopus, Subularia, Conringia, Diplotaxis, Brassica, Sinapsis, Eruca, Erucastrum, Coincya, Hirschfeldia, Cakile, Rapistum, Crambe, Enarthrocarpus, Rhaphanus and Clausia.
In a further embodiment, plants are provided that are obtained by the methods according to the invention. Another embodiment provides seeds from plants obtained by the methods according to the invention. In yet another embodiment, oil from the seeds of plants obtained by the methods according to the invention is provided.
The obtained plants can be used in a conventional breeding scheme to produce more plants with the same characteristics or to introduce the characteristic of increased expression of a nucleic acid encoding an A0X1 protein according to the invention in other varieties of the same or related plant species, or in hybrid plants.
The obtained plants can further be used for creating propagating material.
Plants according to the invention can further be used to produce gametes, seeds (including crushed seeds and seed cakes), embryos, either zygotic or somatic, progeny or hybrids of plants obtained by methods of the invention. Seeds obtained from the obtained plants according to the invention are also encompassed by the invention.
"Creating propagating material", as used herein, relates to any means know in the art to produce further plants, plant parts or seeds and includes inter alia vegetative reproduction methods (e.g. air or ground layering, division, (bud) grafting, micropropagation, stolons or runners, storage organs such as bulbs, corms, tubers and rhizomes, striking or cutting, twin-scaling), sexual reproduction (crossing with another plant) and asexual reproduction (e.g. apomixis, somatic hybridization).
A further object of the invention is an isolated DNA encoding the Brassica napus A0X1 protein of SEQ ID No. 2, such as an isolated DNA consisting of SEQ ID No.
1.
Yet a further object of the invention provides an isolated Brassica napus A0X1 protein consisting of the nucleotide sequence of SEQ ID No. 2.

"Isolated DNA" as used herein refers to DNA not occurring in its natural genomic context, irrespective of its length and sequence. Isolated DNA can, for example, refer to DNA which is physically separated from the genomic context, such as a fragment of genomic DNA. Isolated DNA can also be an artificially produced DNA, such as a chemically synthesized DNA, or such as DNA produced via amplification reactions, such as polymerase chain reaction (PCR) well-known in the art. Isolated DNA
can further refer to DNA present in a context of DNA in which it does not occur naturally.
For example, isolated DNA can refer to a piece of DNA present in a plasmid.
Further, the isolated DNA can refer to a piece of DNA present in another chromosomal context than the context in which it occurs naturally, such as for example at another position in the genome than the natural position, in the genome of another species than the species in which it occurs naturally, or in an artificial chromosome.
"Isolated protein" as used herein refers to a protein not occurring in its natural cellular context, irrespective of its length and sequence. An isolated protein can, for example, refer to a protein present in a plant cell in which it does not naturally occur.
An isolated protein can also be a protein isolated from a plant cell in which it naturally occurs or in which it does not naturally occur. Further, an isolated protein can be a protein produced in a heterologous expression system well known in the art, such as a plant expression system, a yeast expression system, a microbial expression system, a mammalian expression system, where the isolated protein can reside within the cells of said expression system, can be extracted from the cells of said expression system, or can be purified from said expression system. Further, an isolated protein can be produced in an in vitro system, from which it can be extracted and purified.
The invention further provides a chimeric gene comprising the following operably linked nucleic acid molecules:
a) a heterologous plant-expressible promoter;
b) a nucleic acid encoding an A0X1 protein containing at least 60% sequence identity to SEQ ID No. 2; and optionally c) a DNA region involved in transcription termination and polyadenylation;

In another embodiment, said A0X1 protein contains at least 80% sequence identity to SEQ ID No. 2, whereas in yet another embodiment said nucleic acid encoding an A0X1 protein contains at least 80% sequence identity to SEQ ID No.
1. In a further embodiment, said plant-expressible promoter is a constitutive promoter, such as the 35S promoter, and in yet a further embodiment, said plant-expressible promoter is a seed-specific promoter.
The invention further relates to the use of the chimeric genes or of the isolated DNA according to the invention to increase plant seed oil content and/or to seed yield such as Thousand Kernel Weight.
The invention further provides methods for producing oil, comprising harvesting seeds from the plants according to the invention and extracting the oil from said seeds.
In a further aspect, the invention provides a method of producing food or feed such as oil, meal, grain, starch, flour or protein, or an industrial product such as biofuel, fiber, industrial chemicals, a pharmaceutical or a neutraceutical, comprising obtaining the plant according to the invention or a part thereof, and preparing the food, feed, or industrial product from the plant or part thereof.
As used herein "comprising" is to be interpreted as specifying the presence of the stated features, integers, steps or components as referred to, but does not preclude the presence or addition of one or more features, integers, steps or components, or groups thereof. Thus, e.g., a nucleic acid or protein comprising a sequence of nucleotides or amino acids, may comprise more nucleotides or amino acids than the actually cited ones, i.e., be embedded in a larger nucleic acid or protein. A chimeric gene comprising a DNA region which is functionally or structurally defined, may comprise additional DNA regions etc.
Unless stated otherwise in the Examples, all recombinant DNA techniques are carried out according to standard protocols as described in Sambrook et al.
(1989) Molecular Cloning: A Laboratory Manual, Second Edition, Cold Spring Harbor Laboratory Press, NY and in Volumes 1 and 2 of Ausubel et al. (1994) Current Protocols in Molecular Biology, Current Protocols, USA. Standard materials and methods for plant molecular work are described in Plant Molecular Biology Labfax (1993) by R.D.D. Croy, jointly published by BIOS Scientific Publications Ltd (UK) and Blackwell Scientific Publications, UK. Other references for standard molecular biology techniques include Sambrook and Russell (2001) Molecular Cloning: A Laboratory Manual, Third Edition, Cold Spring Harbor Laboratory Press, NY, Volumes I and II of Brown (1998) Molecular Biology LabFax, Second Edition, Academic Press (UK).
Standard materials and methods for polymerase chain reactions can be found in Dieffenbach and Dveksler (1995) PCR Primer: A Laboratory Manual, Cold Spring Harbor Laboratory Press, and in McPherson at al. (2000) PCR - Basics: From Background to Bench, First Edition, Springer Verlag, Germany.
SEQUENCES
SEQ ID NO: 1: Brassica napus A0X1 coding sequence.
SEQ ID NO: 2: Brassica napus A0X1 protein.
SEQ ID NO: 3: BnA0X1 forward primer.
SEQ ID NO: 4: BnA0X1 reverse primer.
SEQ ID NO: 5: AtA0X1B forward primer.
SEQ ID NO: 6: AtA0X1B reverse primer.
SEQ ID NO: 7: T7 primer.
SEQ ID NO: 8: 35S promoter specific primer.
EXAMPLES
The applicants of the present invention have screened out a set of genes including BnA0X1 gene, which are differentially expressed not only between two kinds of Brassica napus parent lines but also between the extremely segregated lines of generation, by analyzing the differences in gene expression between two kinds of parent lines with significantly different oil-content as well as between the mixed samples of the segregated lines of F2 generation exhibiting significantly different oil-content. In order to confirm if the gene has an effect on seed oil content and other traits of the seed, the applicants have cloned the full-length gene, constructed an expression vector comprising said full-length gene, and transformed thereof into the model plant Arabidopsis thaliana. The respiratory metabolism-associated gene BnA0X1 from Brassica napus is useful in increasing the oil content and the thousand kernel weight in oil crops.
Example 1: identification of the BnA0X1 gene I. Source of the gene:
A high-oil content Brassica napus line zy036 (oil content thereof being 51%) was crossed with a low-oil content Brassica napus line Y817 (oil content thereof being 35%) in order to establish a population of F2 generation. A total of 169 F2 offspring plantlets was used as the starting material. The silique (with pod shells and ovules) were collected respectively from each of F2 plants about 25 days post blossom; and the oil content was determined in mature seeds from the individual plants. The silique from individual plants having a determined oil content of greater than 47% and of less than 38.5% were weighed and mixed in equal amount of 200 mg respectively to constitute two mixed samples with two extreme oil contents, which samples are coded by H
and L, respectively. 11 plants had an oil content of greater than 47% and 11 plants had an oil content of less than 38.5%. There was difference of 11.1% between the average oil contents of the two mixed samples. Genes expressed in the two parents and two mixed samples were assayed. The genes whose expression levels were different between the parents as well as between the mixed samples of F2 generations were identified, from which the gene BnA0X1 originates.
Both the parent lines zy036 and Y817 used in the study had been established by the technicians of the biotechnical breeding team in the Oil Crops Research Institute (OCRI) of the Chinese Academy of Agricultural Sciences (CAAS) under the direction of the researcher Wang Hanzhong. The zy036 line is developed by establishing a recurrent selection population consisted of Zhongshuang No.4, Zhongshuang No.7, Zhongshuang No.9, Huashuang No.3, and Youyan No.9, performing recurrent selections of two generations, followed by recurrent selection of the third generation by microspore culture of excellent individual plants therefrom, and eventually conducting high oil content-directed selection. Y817 is a maintenance line for the hybrid cultivar Zhongyou hybrid No.1 (Study on techniques about seed production of Zhouyou Hybrid No.1 and their utilization, Rural Economy and Science-Technology, (10), 2001).
II. Cloning of the full-length gene:
By screening for gene expression difference, it had been found that the expression levels of the BnA0X1 gene in the Brassica napus high-oil-content parent and the mixed population of high-oil-content F2 generations are higher than those in the low-oil-content parent and the mixed population of low-oil-content F2 generations.
Brassica napus genomic sequences homologous to the A0X1 gene have been identified by means of the sequence of Arabidopsis thaliana A0X1B gene (AtA0X1B;
Accession Number At3g22360) and an in-house sequence database, then spliced them together, and designed primers flanking the coding regions of the gene of interest on the basis of the spliced sequence. RT-PCR amplification was performed using the cDNA
first strand from the parent zy036 as template. The amplified fragment was sequenced, to obtain the coding region sequence of BnA0X1 gene. A protein is disclosed, the base sequence encoding said protein is the nucleotide sequence shown in SEQ ID NO:
1. A
protein is disclosed, the sequence thereof being the amino acid sequence shown as SEQ
ID NO: 2. At the same time, primers for amplifying the sequence of the homologous gene AtA0X1B in Arabidopsis thaliana were designed by use of gene sequences (At3g22360).
III. Detailed description of cloning BnA0X1:
The published gene sequences of Arabidopsis in a sequence database were searched. EST sequences of Brassica napus were BLASTed and used in combination with Arabidopsis thaliana sequences to design a pair of primers flanking the coding regions of the gene of interest (BnA0X1F: forward primer: [5'-atgatgatgagtcgctacgg-31 (SEQ ID No. 3), BnA0X1R reverse primer: [5'- tcaatgatccaattggag-31 (SEQ ID No.
4)) for use in amplifying the corresponding sequence from cDNA of the Brassica napus 15-day-old siliques. Primers for amplification in Arabidopsis thaliana were as follows:
AtA0X1B forward primer: [5'-atgatgatgagtcgtcgcta-31 (SEQ ID No. 5) and reverse primer: [5'-tcaatgatatccaatgggagc-31 (SEQ ID No. 6), for use in direct amplification from cDNA of the Arabidopsis thaliana 10-day-old siliques.
1. Extraction of mRNAs from Brassica napus, Arabidopsis thaliana RNA extraction (extraction of RNA with TRIZOL TM Kit): grind 100 mg of raw material in liquid nitrogen.
A. Add 1 ml of TRIZOL, and the resultant mixture is left at room temperature (RT, 20-25 C, same hereinafter) for 5 min.
B. Add 200 pl of chloroform, agitate vigorously for 30 s, and the resultant mixture is left at RT for 2 min.
C. The mixture from step B is centrifuged at 4 C at 12000g for 15min. The resultant supernatant is transferred into a new tube. 500 pl of isopropanol is added and mixed well. Then, the resulting mixture is left at RT for 15 min.
D. The resulting mixture is centrifuged at 4 C at 12000g for 15min. The resultant supernatant is discarded. lml of 70% (vol/vol) ethanol is added and mixed well.
E. The resulting mixture is centrifuged at 4 C at 7500g for 7 min. The resultant supernatant is discarded and the RNA pellet is air-dried.
F. The air-dried RNA pellet is dissolved in DEPC-H20.
2. Reverse transcription of the first strand cDNA is performed with Revert-Aid H
Minus First Strand cDNA Synthesis Kit (Fermentas), with operation following the instruction of the kit used.
3. PCR amplification is performed by using the resulting cDNAs as a template, and BnA0X1 and AtA0X1B genes are obtained. The sequences of BnA0X1 and AtA0X1B

genes are as follows: a respiratory metabolism-associated gene BnA0X1 from Brassica napus, encoding the BnA0X1 protein, the base sequence thereof is the nucleotide sequence shown in SEQ ID NO: 1; the BnA0X1 protein, the sequence of the protein is the amino acid sequence as shown in SEQ ID NO: 2, and gene sequences of Arabidopsis as published (database accession number At3g22360).
Example 2: Construction of the transgenic vector for transformation of Arabidopsis thaliana The method for using the cloned gene comprises the following steps:
1) The cloned Brassica napus gene was ligated into the plasmid PCR8/GW/TOPO, then the Brassica napus gene was transferred further to an expression vector plasmid pEarleygate100 by taking advantage of the feature that the plasmid can be recombined in vitro into the expression vector plasmid.
The method for cloning the Brassica napus gene according to the present invention is the one commonly used in the art, such as, CTAB protocol is used to extract DNA
from plant leaves. The methods for extracting mRNA are various and have been well-established, such as, TRIzol Reagent Protocol from Invitrogen Co. or Total RNA Extraction from Qiagen Co., all of which are commercially available.

cDNA library construction is also a conventional technique in molecular biology.
Methods for constructing and transforming the vector according to the present invention into a plant are also those commonly used in the art. The involved plasmids (the entry vector PCR8/GW/TOPO and the expression vector plasmid pEarleygate100) in the methods, host cells for transformation (e.g., Agrobacterium tumefaciens GV3101), and reagents (sucrose, etc.,) used are commercially available. The method most commonly used for polymorphic analysis of molecular marker is polyacrylamide gel electrophoresis in which the reagents used are commercially available, such as, acrylamide, methylene bisacrylamide, etc.
Detailed description of the construction of the transgenic vector:
The gene sequence obtained by PCR amplification was ligated into the TOPO
entry vector (Invitrogen Co.), then the obtained vector was transformed into DH5a competent cells (Invitrogen Co.). Screening of positive colonies with spectinomycin was performed.
The plasmid of interest with the forwardly ligated insert was identified by PCR
amplification using a vector-specific primer (T7 primer, TAATACGACTCACTATAGGG) (SEQ ID No. 7) and a gene-specific primer (the forward primer for the target gene, the sequence of which was shown in Example 1). The plasmid of interest was mini-prepared, then recombined into the vector pEarleygate 100 (Invitrogen Co.), and finally transformed into DH5a competent cells. Screening of the transformant with kanamycin was performed. The presence of the inserted fragment in the transformant was confirmed by PCR amplification using a vector-specific primer (35S
promoter-specific primer, CACGTCTTCAAAGCAAGTGGA) (SEQ ID No. 8) and a gene-specific primer (the reverse primer for the target gene, the sequence of which is shown in Example 1). The schematic map of the resulting plasmid is shown in Fig.l.
Example 3: Transformation of Arabidopsis The expression vector prepared in Example 2 was introduced into Agrobacterium tumefaciens GV3101 and further into Arabidopsis thaliana plants, using the following steps Transformation of Arabidopsis thaliana Formulation of the reagent Osmotic medium (10: 1/2 x Murashige-Skoog; 5% (mass percentage) sucrose; 0.5g of MES; adjusted with KOH to pH = 5.7; then supplemented with 10 pi of 1mg/m1 (6-benzylaminopurine) stock solution; 200 pl of Silwet L-77.
Transformation procedure:
(1) 10m1 of the suspension of Agrobacterium (GV3101, commercially available) transformed with the corresponding plasmid was prepared, then transferred into a large flask for overnight cultivation in the night just before the transformation day.
Next day upon use, 0D600 of the overnight culture of Agrobacterium should be between 1.2 and 1.6.

(2) The overnight culture was centrifuged at 5000 rpm at room temperature for min.
(3) The supernatant was discarded and the Agrobacterium pellet was resuspended in the corresponding volume of the osmotic media, resulting in 0D600 of about 0.8.
(4) A whole plant was immersed into the resulting Agrobacterium suspension for 30 s.

(5) The treated plant was grown overnight with avoidance of light and then cultivated normally until producing seed. The seeds were harvested for further screening and identification.
Example 4: Screening and confirmation of transgenic Arabidopsis thaliana Screening of the transformants:
The vernalized Arabidopsis seeds were seeded in artificial soil irrigated with the saturated Hyponex NO.2 (commercially available) nutrient solution and covered with plastic wrap. Two days later, light was given, and three days later, the plastic wrap was removed.
Conditions in the artificial cultivation chamber were as follows: Relative humidity:
80%, constant temperature of 20-24 C, light intensity of 80-200 umol/M2/S, light cycle:
8h of Dark, 16 h of Light. After about one week, a herbicide (glyphosate) was sprayed to screen positive plants.
Identification of the transgene by PCR:
(1) Extraction of total DNA from a transformed plant for PCR.
A. Leaves were cleaned with 70% (vol/vol) ethanol and weighed about 100 mg.
B. 600 ill of extraction buffer (0.2 M Tris-HC1, 0.25 NaC1, 25mM EDTA, 0.5%
(mass percentage) SDS, pH 7.5) was added and rapid grinding was performed at room temperature.
C. the resulting mixture was vortexed for 5-10s in a 1.5ml Ependorff tube to homogeneity.
D. the vortexed mixture was centrifuged at 12000 rpm at room temperature for min. The supernatant was collected, followed by adding equal volume of isopropanol, then precipitated at -20 C overnight.
E. the resulting mixture from step C was centrifuged at 12000 rpm at room temperature for 15 min. DNA pellet was washed by adding 200 p.1 of 70%
(vol/vol) ethanol.
F. the resultant from step E was centrifuged at 12000 rpm at room temperature for 15 min. Ethanol was discarded. The tube with the DNA pellet was placed inversely on a paper towel until the ethanol was volatilized completely.
G. the extracted DNA pellet in the tube was dissolved in 100 pl of sterile water.
The DNA concentration was estimated with a spectrometer or by electrophoresis.
H. PCR was performed by using the total DNA as a template.
(2) PCR protocol Formulation ratio for the PCR reaction mixture was the same as that in identification of the plasmid by PCR, and based on the sequence of 35S
promoter in the plant expression vector and the sequences of the reverse primers for the BnA0X1 and AtA0X1B genes: [5'-tcaatgatccaattggag-31 (SEQ ID No. 4) and [5'-tcaatgatatccaatgggagc-31 (SEQ ID No. 6), respectively, the time and temperature for the reaction was as follows: 94 C 3 min, 30 cycles of 94 C 45s, 59 C 45s, 72 C 2 min 30s, then 72 C 5 min.
The result from the PCR identification demonstrated that an electrophoretic bands of expected size could be amplified from most of transformed plants, while no such band could be amplified from negative control, indicating that some transgenic Arabidopsis thaliana lines had been obtained (see Figure 2).
Example 5: Determination of seed oil content and thousand kernel weight of the transgenic Arabidopsis thaliana The transgenic homozygous lines were grown at 21-23 C in a greenhouse. The seeds were harvested and then tested the changes in the oil content and thousand kernel weight (Fig. 3).

The overall phenotype of the transgenic Arabidopsis thaliana plant overexpressing BnA0X1 gene or AtA0X1B gene was not significantly different from that of the wild type Arabidopsis thaliana control. After harvest of the seeds, it was found that the seeds from the transgenic plant were significantly larger than those frora the wild type control (Figure 3). The seed oil content was determined by pulse nuclear magnetic resonance spectrometer. The result showed that seed oil content of transgenic Arabidopsis thaliana was significantly increased in comparison with that of the wild type Arabidopsis thaliana, with the highest increase by above 20% (Table 1).
Moreover, the thousand kernel weight in transgenic Arabidopsis thaliana was also increased to some extent, with the highest increase by up to 25% (Table 1). It is clear from the above results that the Brassica napus A0X1 gene and the Arabidopsis thaliana A0X1B
gene can increase both the seed oil content and the kernel weight.
Table 1 - Determination of the oil content and the thousand kernel weight (TKW) in Arabidopsis thaliana overexpressing BnA0X1 (BnA0X1-1 to BnA0X1-4) or AtA0X1B(AtA0X1-1 to AtA0X1-4).
Oil content WT BnA0X1-1 BnA0X1-2 BnA0X1-3 BnA0X1-4 (%) 22.7 27.0 27.7 24.7 28.4 WT BnA0X1-1 BnA0X1-2 BnA0X1-3 BnA0X1-4 TKW(mg) 19.3 23.7 24.4 21.8 25.0 Oil content WT AtA0X1-1 AtA0X1-2 AtA0X1-3 AtA0X1-4 (%) 23.8 25.2 26.5 28.6 27.3 WT AtA0X1-1 AtA0X1-2 AtA0X1-3 AtA0X1-4 TKW (mg) 18.9 21.4 22.9 24.2 23.3 = CA 02825924 2013-07-26 SEQUENCE LISTING IN ELECTRONIC FORM
This description contains a sequence listing in electronic form in ASCII
text format. A copy of the sequence listing in electronic form is available from the Canadian Intellectual Property Office. The sequences in the sequence listing in electronic form are reproduced in the following Table.
SEQUENCE TABLE
<110> Oil Crops Research Institute, Chinese Academy of Agricultural Sciences <120> Respiratory metabolism-associated gene BnA0X1 from Brassica napus and the use thereof <130> 83169-7 <140> PCT/CN2012/070283 <141> 2012-01-20 <150> 201110031200.X
<151> 2011-01-27 <160> 8 <170> PatentIn version 3.5 <210> 1 <211> 975 <212> DNA
<213> Brassica napus <220>
<221> CDS
<222> (1)..(975) <400> 1 atg atg atg agt cgc tac gga gcc aag gta atg gta act act gga cca 48 Met Met Met Ser Arg Tyr Gly Ala Lys Val Met Val Thr Thr Gly Pro agg ctc ttc tct tcc agt gcc gtg tct ccc aac cat ctt ttg aat tct 96 Arg Leu Phe Ser Ser Ser Ala Val Ser Pro Asn His Leu Leu Asn Ser agg gtt ccg gcg aga gag ttc agc aag atg aca ttt gag aaa aag aag 144 Arg Val Pro Ala Arg Glu Phe Ser Lys Met Thr Phe Glu Lys Lys Lys =aaa acg gag gat aac caa tgg gag aaa ggt tca agt ggt ggc aag ggt 192 26a ' CA 02825924 2013-07-26 Lys Thr Glu Asp Asn Gln Trp Glu Lys Gly Ser Ser Gly Gly Lys Gly gat caa ggg aac aaa ggg gag caa tta atc gtt agc tat tgg gga gtg 240 Asp Gln Gly Asn Lys Gly Glu Gln Leu Ile Val Ser Tyr Trp Gly Val aag cct atg aaa atc acc aaa gat gat gga act gaa tgg aaa tgg agc 288 Lys Pro Met Lys Ile Thr Lys Asp Asp Gly Thr Glu Trp Lys Trp Ser tgc ttt cgg cca tgg gag acg tat aaa gca gat ctg aca ata gat ttg 336 Cys Phe Arg Pro Trp Glu Thr Tyr Lys Ala Asp Leu Thr Ile Asp Leu aag aag cat cat gtt cca tcg act tta ccg gac aaa tta gct tac tgg 384 Lys Lys His His Val Pro Ser Thr Leu Pro Asp Lys Leu Ala Tyr Trp acg gtt aaa tct ctc cga tgg cct acc gat ttg ttc ttc cag agg cgg 432 Thr Val Lys Ser Leu Arg Trp Pro Thr Asp Leu Phe Phe Gln Arg Arg tac gga tgc cga gcg atg atg ttg gaa acg gta gca gcg gtt cca gga 480 Tyr Gly Cys Arg Ala Met Met Leu Glu Thr Val Ala Ala Val Pro Gly atg gtc gga gga atg tta gta cac tgc aaa tcg ctg agg cgg ttt gaa 528 Met Val Gly Gly Met Leu Val His Cys Lys Ser Leu Arg Arg Phe Glu caa agc ggc ggt tgg atc aaa gca ctc ctt gaa gaa gca gag aac gag 576 Gln Ser Gly Gly Trp Ile Lys Ala Leu Leu Glu Glu Ala Glu Asn Glu aga atg cac ttg atg aca ttc atg gaa gtc gca aaa ccc aat tgg tac 624 Arg Met His Leu Met Thr Phe Met Glu Val Ala Lys Pro Asn Trp Tyr gaa cgt gcc ctc gtg atc gcc gtt caa ggc gtt ttc ttc aac gca tat 672 Glu Arg Ala Leu Val Ile Ala Val Gln Gly Val Phe Phe Asn Ala Tyr ttc ctc gga tac ata atc tcg ccc aag ttt gct cac cgt atg gtt gga 720 Phe Leu Gly Tyr Ile Ile Ser Pro Lys Phe Ala His Arg Met Val Gly tac ctt gag gaa gaa gca atc cac tct tac act gaa ttc ctc aag gaa 768 Tyr Leu Glu Glu Glu Ala Ile His Ser Tyr Thr Glu Phe Leu Lys Clu ctt gat aat ggt aac atc gaa aac gtt cct gca cca gcc ata gcc att 816 Leu Asp Asn Gly Asn Ile Glu Asn Val Pro Ala Pro Ala Ile Ala Ile 26b gat tac tgg agg ctc cct gct gat gca acg ctt cgt gat gtt gtc atg 864 Asp Tyr Trp Arg Leu Pro Ala Asp Ala Thr Leu Arg Asp Val Val Met gtg gtt cgt gct gat gaa gca cat cac cgt gac gtt aac cat tat gca 912 Val Val Arg Ala Asp Glu Ala His His Arg Asp Val Asn His Tyr Ala tcc gat att cat tac caa ggt cgt gaa ctt aag gaa gct cca gct cca 960 Ser Asp Ile His Tyr Gln Gly Arg Glu Leu Lys Glu Ala Pro Ala Pro att gga tat cat tga 975 ile Gly Tyr His <210> 2 <211> 324 <212> PRT
<213> Brassica napus <400> 2 Met Met Met Ser Arg Tyr Gly Ala Lys Val Met Val Thr Thr Gly Pro Arg Leu Phe Ser Ser Ser Ala Val Ser Pro Asn His Leu Leu Asn Ser Arg Val Pro Ala Arg Glu Phe Ser Lys Met Thr Phe Glu Lys Lys Lys Lys Thr Glu Asp Asn Gln Trp Glu Lys Gly Ser Ser Gly Gly Lys Gly Asp Gln Gly Asn Lys Gly Glu Gln Leu Ile Val Ser Tyr Trp Gly Val Lys Pro Met Lys Tie Thr Lys Asp Asp Gly Thr Glu Trp Lys Trp Ser Cys Phe Arg Pro Trp Glu Thr Tyr Lys Ala Asp Leu Thr Ile Asp Leu Lys Lys His His Val Pro Ser Thr Leu Pro Asp Lys Leu Ala Tyr Trp 26c ' CA 02825924 2013-07-26 Thr Val Lys Ser Leu Arg Trp Pro Thr Asp Leu Phe Phe Gln Arg Arg Tyr Gly Cys Arg Ala Met Met Leu Glu Thr Val Ala Ala Val Pro Gly Met Val Gly Gly Met Leu Val His Cys Lys Ser Leu Arg Arg Phe Glu Gln Ser Gly Gly Trp Ile Lys Ala Leu Leu Glu Glu Ala Glu Asn Glu Arg Met His Leu Met Thr Phe Met Clu Val Ala Lys Pro Asn Trp Tyr Glu Arg Ala Leu Val Ile Ala Val Gln Gly Val Phe Phe Asn Ala Tyr Phe Leu Gly Tyr Ile Ile Ser Pro Lys Phe Ala His Arg Met Val Gly Tyr Leu Glu Glu Glu Ala Ile His Ser Tyr Thr Glu Phe Leu Lys Glu Leu Asp Asn Gly Asn Ile Glu Asn Val Pro Ala Pro Ala Ile Ala Ile Asp Tyr Trp Arg Leu Pro Ala Asp Ala Thr Leu Arg Asp Val Val Met Val Val Arg Ala Asp Glu Ala His His Arg Asp Val Asn His Tyr Ala Ser Asp Ile His Tyr Gln Gly Arg Glu Leu Lys Glu Ala Pro Ala Pro Ile Gly Tyr His <210> 3 <211> 20 26d <212> DNA
<213> artificial <220>
<223> BnA0X1 Forward Primer <400> 3 atgatgatga gtcgctacgg 20 <210> 4 <211> 18 <212> DNA
<213> artificial <220>
<223> BnA0X1 Reverse Primer <400> 4 tcaatgatcc aattggag 18 <210> 5 <211> 20 <212> DNA
<213> artificial <220>
<223> AtA X1B Forward Primer <400> 5 atgatgatga gtcgtcgcta 20 <210> 6 <211> 21 <212> DNA
<213> artificial <220>
<223> AtA0X1B Reverse Primer <400> 6 tcaatgatat ccaatgggag c 21 <210> 7 <211> 20 <212> DNA
<213> artificial <220>
<223> T7 primer <400> 7 26e =
taatacgact cactataggg 20 <210> 8 <211> 21 <212> DNA
<213> artificial <220>
<223> 35S promoter specific primer <400> 8 cacgtcttca aagcaagtgg a 21 26f

Claims (28)

1. A method for increasing oil content, seed yield or both in a seed oil plant comprising increasing expression of a nucleic acid encoding an AOX1 protein, wherein said AOX1 protein has at least 80% sequence identity to SEQ ID NO:2.

2. A method for increasing oil content, seed yield or both in a seed oil plant comprising the steps of:
a) providing a seed oil plant cell with a chimeric nucleic acid construct comprising the following operably linked nucleic acid molecules:
i) a heterologous plant-expressible promoter; and ii) a nucleic acid encoding an AOX1 protein, wherein said AOX1 protein has at least 80% sequence identity to SEQ ID NO:2; and b) regeneration of said plant cell into the seed oil plant.

3. The method according to claim 2, wherein said operably linked nucleic acid molecules further comprises a DNA region involved in transcription termination and polyadenylation.

4. The method according to claim 2 or 3, wherein said plant-expressible promoter is a constitutive promoter.

5. The method according to claim 4, wherein said constitutive promoter is the 35S promoter.

6. The method according to claim 2 or 3, wherein said plant-expressible promoter is a seed-specific promoter.

7. The method according to any one of claims 1 to 6, wherein said oil content is seed oil content.

8. The method according to any one of claims 1 to 7, further characterized in that the Thousand Kernel Weight is increased.

9. The method according to any one of claims 1 to 8, wherein said nucleic acid encoding the AOX1 protein has at least 80% sequence identity to SEQ ID
NO:1.

10. The method according to any one of claims 1 to 9, wherein said AOX1 protein has at least 90% sequence identity to SEQ ID NO:2.

11. The method according to any one of claims 1 to 10, wherein said seed oil plant is a Brassicaceae plant.

12. An isolated Brassica napus AOX1 DNA molecule comprising the nucleotide sequence of SEQ ID NO:1.

13. The isolated DNA molecule of claim 12, consisting of said nucleotide se quence.

14. An isolated Brassica napus AOX1 protein comprising the amino acid sequence of SEQ ID NO:2.

15. The isolated protein of claim 14, consisting of said amino acid sequence.

16. A chimeric DNA construct comprising the following operably linked DNA molecules:
a) a heterologous plant-expressible promoter; and DNA encoding an AOX1 protein containing at least 90% sequence identity to SEQ ID NO:2.

17. The chimeric DNA construct according to claim 16, wherein said operably linked DNA molecules further comprise a DNA region involved in transcription termination and polyadenylation.

18. The chimeric DNA construct according to claim 16 or 17, wherein said nucleic acid encoding the A0X1 protein has at least 90% sequence identity to SEQ
ID NO:1.

19. The chimeric DNA construct according to claim 16, 17 or 18, wherein said plant-expressible promoter is a constitutive promoter.

20. The chimeric DNA construct according to claim 19, wherein said constitutive promoter is the 35S promoter.

21. The chimeric DNA construct according to claim 16, 17 or 18, wherein said plant-expressible promoter is a seed-specific promoter.

22. A plant cell comprising the chimeric DNA construct as defined in any one of claims 16 to 21.

23. A cell of a seed from a plant that comprises the chimeric DNA construct as defined in any one of claims 16 to 21.

24. Use of the isolated DNA molecule as defined in claim 12 or 13, to increase plant seed oil content, Thousand Kernel Weight or both.

25. Use of the chimeric DNA construct as defined in any one of claims 16 to 21, to increase plant seed oil content, Thousand Kernel Weight or both.

26. A method for producing oil, comprising harvesting seeds from a plant comprising the chimeric DNA construct as defined in any one of claims 16 to 21, and extracting the oil from said seeds.

27. A method of producing food, feed, or an industrial product comprising:
a) obtaining a plant comprising the chimeric DNA construct as defined in any one of claims 16 to 21 or a plant part thereof; and b) preparing the food, feed or industrial product from the plant or plant part.

28. The method of claim 27, wherein a) the food or feed is oil, meal, grain, starch, flour or protein; or b) the industrial product is biofuel, fiber, an industrial chemical, a pharmaceutical or a nutraceutical.