CA2820739A1 - Microspore transformation methodology by macroinjection - Google Patents

Abstract

A method for introducing a cargo molecule into a microspore of a plant involves macroinjecting a bud of a donor plant in vivo with a complex comprising a nanocarrier and the cargo molecule. The method is particularly useful in a method of transforming plant cells by macroinjection of buds using a nanocarrier:nucleic acid complex. The method preferably involves transformation of microspores in vivo by macroinjection of donor plant buds with a nanocarrier:nucleic acid complex prior to culturing isolated microspores (immature pollen), and subsequent generation of a doubled-haploid homozygous transgenic plant from the transformed microspores.

Description

2 PCT/CA2011/001326 MICROSPORE TRANSFORMATION METHODOLOGY BY MACROINJECTION
Cross-reference to Related Applications This application claims the benefit of United States Provisional Patent Application Serial Number 61/420,900 filed December 8, 2010, the entire contents of which is herein incorporated by reference.
Field of the Invention The present invention is related to biotechnology, more particularly to methods of transforming plants by transfection of microspores through macroinjection of floral buds.
Background of the Invention The chromosomes of higher plants exist in homologous pairs, and are called diploid. Gametic cells contain half the normal number of chromosomes and are said to be haploid. When two gametic cells unite, the two sets of haploid chromosomes combine to create a set of diploid chromosomes.
A doubled haploid is formed when the chromosomes of a haploid cell are doubled such that each chromosome in a homologous pair is identical, which renders it useful in plant breeding. The use of doubled-haploid plants as a tool in plant breeding is well established and has become a routine practice for breeders of crops such as canola and barley. The main advantage of generating doubled-haploid plants is the greatly reduced time required to achieve homozygosity; years of selfing and recurrent selection are replaced by a single culture cycle. The use of haploid technologies results in the fixation of traits, allowing for efficient screening and selection of desirable phenotypes.
Haploid plants can be induced from male or female gametophytes. Microspores are immature pollen cells which can be used to generate doubled haploid plants in certain species. Isolated microspore culture protocols have been described for various Brassica species (Ferrie 1995; Ferrie 1999; Barro 1999). Factors that have been identified to contribute to induction and development of microspore-derived embryos include growth conditions of the parental plants, stage of microspore development, temperature stress, osmotic stress, and carbohydrate composition of the medium. Doubled haploid methodology has been used to produce homozygous Brassica napus lines which are useful in plant breeding.

The stable introduction of genetic material into plant cells is called transformation.
Since the 1970's, different techniques have been developed by plant molecular biologists to introduce nucleic acids into cells. Such techniques include biological techniques such as Agrobacterium-mediated transformation. Non-biological techniques have also been developed which use chemical or physical techniques to induce the uptake of nucleic acids by plant cells. Examples include particle bombardment and electroporation. As well, uptake of nanocarrier bound nucleic acids in vitro has been reported in tobacco suspension cells using gold nanoparticles (Samuel 2009) and cell penetrating peptides in Triticale (Eudes 2008).
A form of non-biological transformation uses injection-based methods.
Injection techniques comprise both microinjection and macroinjection. Microinjection refers to delivery of DNA into the plant cell or its nucleus by means of a glass microcapillary-injection pipette. This procedure is precise, however, it is slow and requires expensive equipment. Several plant species, such as oilseed rape and barley, have been transformed using microinjection.
Macroinjection is a transformation technique which utilizes hypodermic needles with diameters greater than the diameter of the cell. In one approach called Pollen-Tube Pathway (PIP), naked DNA is injected into ovaries to produce transformed progeny (Touraev 1997). A variation is the injection of a bacterial inoculum or plasmid DNA into inflorescences with pollen mother cells in the premeiotic stage without removing the stigma. Such an approach has been employed for rye (De la Pena 1987).
Different types of nanoparticles can act as carriers for nucleic acids in transformation of plant cells. Nanocarriers are positively charged small molecules or peptides that are able to interact noncovalently with nucleic acid molecules creating a nanocarrier:nucleic acid complex. Nanocarriers have been used in animal systems to deliver nucleic acid molecules to a variety of cells. The nanocarrier:nucleic acid complexes enter the cells and express genes that have been successfully delivered.
Unlike animal cells, plant cells have a cell wall that hinders nanocarrier:nucleic acid complex uptake. Removing the cell wall by enzymatic degradation aids the nanocarrier mediated uptake of nucleic acid molecules. However, the microspores of plant species, including the Brassicaceae, are surrounded by a thick exine layer composed of sporopollenin which is very resistant to enzymatic degradation.
Although in vitro nanocarrier uptake and transient expression of the attached nucleic acid molecule had previously been observed by the inventors in Brassica napus microspores, prior to the present invention, no further development into embryos was observed.
Accordingly, there has previously been no demonstration of an efficient method to transform Brassica microspores and develop a homozygous transgenic plant in one generation. Presently, Brassica transformation is done at the diploid level and requires several generations of selfing to obtain homozygosity.
Summary of the Invention It has now been found that in vivo macroinjection of donor plant buds with a complex comprising a nanocarrier and a cargo molecule is a very efficient method of introducing the cargo molecule into plant microspores. Cargo molecules include, for example, nucleic acids (e.g. DNA, RNA) proteins, hormones and combinations thereof.
Nucleic acids, especially DNA, are preferred cargo molecules.
One embodiment of the present invention discloses a method for transfection of microspores in vivo by macroinjection of donor plant buds with a nucleic acid prior to culturing isolated microspores (immature pollen) and the subsequent generation of doubled-haploid homozygous transgenic plant. In a preferred embodiment, the plant is a doubled-haploid plant.
In a preferred embodiment, the nucleic acid is carried on a nanoparticle.
Preferred nanoparticles include nanotubes formed from pyridio [4,5-D]
pyrimidin-2,5-diones and pyrido[4,3]pyridimin-2-ones, small peptides of the formula TAT2 and Pep1 and cationic lipids of the general structure:
tail cation spacer cation tail = =
A further embodiment of the present invention discloses a method of expressing a gene comprising transfecting microspores in vivo by macroinjection of donor plant buds with a nanocarrier:nucleic acid complex comprising the gene, generating embryos from said microspores and regenerating plants from said embryos, which plants express the gene.
Additional embodiments of the invention include genetically modified plant cells and method for generating them, wherein the plant cells have one or more nucleic acids introduced therein via methods of the present invention.

3 In another aspect, the present invention provides methods of creating regenerable plant cells for use in tissue culture comprising a nucleic acid introduced therein via the methods of the present invention. The tissue culture will preferably be capable of regenerating plants having substantially the same genotype as the regenerable cells.
Further aspects of the invention provide for the methods of generating stabilized plant lines comprising a desired trait wherein the desired trait is introduced by the methods of the present invention. Conventional methods of generating stabilized plant lines are well known to those of ordinary skill in the art and may include techniques such as, but not limited to, selfing, backcrosses, hybrid production, crosses to populations and the like. Additional embodiments include plant lines with improved composition and agronomic performance.
Nanocarrier-mediated transformation relies on the nanocarrier:DNA complex getting into the microspore (which is surrounded by a thick exine barrier).
Attempts to transform microspores in vitro involving extracting the microspores from buds, incubating the cells with different nanocarrier:DNA complexes prepared in different ratios, and culturing for embryogenesis resulted in some uptake of the nanocarrier:DNA
complex in some experiments, but transformed embryos could not be regenerated. These attempts involved 106 experiments involving three different plant species, 11 different carriers and over 21 different plasmids.
Macroinjection of naked DNA into plant tissues has been attempted in the prior art (Darbani 2008). Such attempts have resulted in transformed plants, but such plants are normal diploid or chimeric plants, not doubled-haploid transformed plants.
Further, transformation efficiencies are low. Furthermore, when bud macroinjection of naked DNA
was attempted in the present study, no successful transformants were generated.
It is clear, therefore, that neither in vitro nanocarrier-mediated transformation nor bud macroinjection with naked DNA result in successfully transforming microspores to generate doubled-haploid transformants.
In contrast, in the present invention it has been surprisingly found that bud macroinjection with nanocarrier:DNA complex successfully results in transformation of microspores while the microspores are still developing on the plant. The microspore exine may be formed after the nanocarrier:DNA complex has entered the cell. The buds are removed from the plant and the microspores are extracted. Not only does this result in the efficient transformation of the microspore with a nucleic acid molecule of interest, it also

4 advantageously results in the ability to regenerate transformed embryos and regenerate them into transformed doubled-haploid plants in one generation. Thus, the timing (nanocarrier:DNA complex present during microspore development) and outcome (doubled-haploid transformed plant in one step) are particularly significant.
Further, the present invention can be successfully applied to a wide variety of plant species, nanocarriers, and DNA molecules, which evidences the surprisingly great versatility of the present invention. The present invention has provided transformation success ranging from glowing developing embryos to analyzed doubled-haploid plants in at least 7 different plant species, using 5 different nanocarriers and 4 different DNA
molecules. The present invention has further provided successful doubled-haploid transformants, which has not been possible with either in vitro nanocarrier-mediated transformation or bud macroinjection with naked DNA. As will be appreciated by one skilled in the art, not all combinations of nanocarrier and DNA molecule will be especially effective for a given plant species, since success depends on an efficient double haploidy protocol for each species. The particular combination of nanocarrier, DNA
molecule and double haploidy protocol that is most effective for a given plant species is readily determined by a set of structured experiments that are within the ambit of one skilled in the art.
In addition to a nucleic acid, incorporating one or more other cargo molecules (e.g. proteins, hormones, other nucleic acids, etc.) in the complex may be especially advantageous since the efficiency of regenerating homozygous doubled haploid plants can be increased by the presence of such other cargo molecules.
Further aspects and embodiments of the invention will become apparent in view of the following descriptions.
Brief Description of the Drawings In order that the invention may be more clearly understood, embodiments thereof will now be described in detail by way of example, with reference to the accompanying drawings, in which:
Fig. 1A is a bright field photograph of developing embryo following macroinjection of Brassica napus Topas 4079 donor bud with rosette nanotube nanocarrier:dsRed plasmid DNA complex.

5 Fig. 1B is a UV light with GFP filter photograph of developing embryos following macroinjection of Brassica napus Topas 4079 donor bud with rosette nanotube nanocarrier:dsRed plasmid DNA complex.
Fig. 2A is a bright field photograph of developing embryos following macroinjection of Brassica napus Topas 4079 donor bud with gemini surfactant nanocarrier:GFP
plasmid DNA complex.
Fig. 2B is a UV light with GFP filter photograph of developing embryos following macroinjection of Brassica napus Topas 4079 donor bud with gemini surfactant nanocarrier:GFP plasmid DNA complex;
Fig. 3A is a photograph taken under a confocal microscope in UV light using a GFP filter of a Brassica napus DH12075 developing embryo expressing GFP marker gene arising from macroinjection of donor bud with TAT2 and GFP plasmid DNA and subsequent, microspore extraction and culturing for embryogenesis.
Fig. 3B is a photograph taken under a confocal microscope in UV light using a GFP filter of a Brassica napus DH12075 developing embryo expressing GFP marker gene arising from macroinjection of donor bud with TAT2 and GFP plasmid DNA and subsequent, microspore extraction and culturing for embryogenesis (closer view of Fig.
3A).
Fig. 3C is a photograph taken under a confocal microscope in UV light using a GFP filter of Brassica napus DH12075 developing embryos which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 4A is a bright field photograph of developing embryos resulting from macroinjection of Brassica napus DH12075 donor bud with TAT2 nanocarrier:GFP plasmid DNA
complex.
Fig. 4B is a UV light with GFP filter photograph of developing embryos resulting from macroinjection of Brassica napus DH12075 donor bud with TAT2 nanocarrier:GFP
plasmid DNA complex.
Fig. 5A is a bright field photograph of developing embryos following macroinjection of Brassica napus DH12075 donor buds with K3T rosette nanotube nancarrier:dsRed plasmid DNA complex.

6 Fig. 5B is a UV light with GFP filter photograph of developing embryos following macroinjection of Brassica napus DH12075 donor buds with K3T rosette nanotube nanocarrier:dsRed plasmid DNA complex.
Fig. 6A is a bright field photograph of developing embryos following macroinjection of Brassica napus DH12075 donor bud with gemini surfactant nanocarrier:GFP
plasmid DNA complex.
Fig. 6B is a UV light with GFP filter photograph of developing embryos following macroinjection of Brassica napus DH12075 donor bud with gemini surfactant nanocarrier:GFP plasmid DNA complex.
Fig. 7A is a bright field photograph of developing embryos following macroinjection of Brassica napus genotype Topas 4079 with positively charged gold nanoparticles and GFP plasmid DNA.
Fig. 7B is a UV light with GFP filter photograph of developing embryos following macroinjection of Brassica napus genotype Topas 4079 with positively charged gold nanoparticles and GFP plasmid DNA.
Fig. 8A is a bright field photograph of developing embryos resulting from culture of Brassica napus Topas 4079 microspores which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 8B is a UV light with GFP filter photograph of developing embryos resulting from culture of Brassica napus Topas 4079 microspores which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 9A is a bright field photograph of developing embryos resulting from culture of Brassica napus DH12075 microspores which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 9B is a UV light with GFP filter photograph of developing embryos resulting from culture of Brassica napus DH12075 microspores which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 10A is a UV light with GFP filter photograph of microspores following macroinjection of Cameline sativa buds with rosette nanotube carrier:dsRed plasmid DNA.

7 Fig. 10B is a bright field photograph of microspores following macroinjection of Camelina sativa buds with rosette nanotube carrier:dsRed plasmid DNA.
Fig. 11A is a bright field photograph of microspores of Camelina sativa which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 11B is a UV light with GFP filter photograph of microspores of Camelina sativa which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 12A is a bright field photograph of microspores following macroinjection of Jatropha multifida buds with rosette nanotube carrier:dsRed plasmid DNA.
Fig. 12B is a UV light with GFP filter photograph of microspores following macroinjection of Jatropha multifida buds with rosette nanotube carrier:dsRed plasmid DNA.
Fig. 13A is a bright field photograph of microspores of Jatropha multifida which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 13B is a UV light with GFP filter photograph of microspores of Jatropha multifida which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 14A is a UV light with GFP filter photograph of microspores resulting from macroinjection of Triticum aestivum buds with rosette nanotube carrier:dsRed plasmid DNA.
Fig. 14B is a bright field photograph of microspores resulting from macroinjection of Triticum aestivum buds with rosette nanotube carrier:dsRed plasmid DNA.
Fig. 15A is a bright field photograph of microspores of Triticum aestivum which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 15B is a UV light with GFP filter photograph of microspores of Triticum aestivum which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 16A is a bright field photograph of microspores following macroinjection of Brass/ca napus Topas 4079 buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 16B is a fluorescence photograph of microspores following macroinjection of Brass/ca napus Topas 4079 buds with rosette nanotube nanocarrier:dsRed plasmid DNA.

8 Fig. 17A is a bright field photograph of microspores of Brassica napus Topas 4079 which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 17B is a fluorescence photograph of microspores of Brassica napus Topas which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 18A is a bright field photograph of microspores following macroinjection of Brassica carinata buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 18B is a fluorescence photograph of microspores following macroinjection of Brassica carinata buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 19A is a bright field photograph of microspores of Brassica carinata which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 19B is a fluorescence photograph of microspores of Brassica carinata which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 20A is a bright field photograph of microspores following macroinjection of Ricinus communis buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 20B is a fluorescence photograph of microspores following macroinjection of Ricinus communis buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 21A is a bright field photograph of microspores of Ricinus communis which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 21B is a fluorescence photograph of microspores of Ricinus communis which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 22A is a bright field photograph of microspores following macroinjection of Zea mays (Corn) buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 22B is a fluorescence photograph of microspores following macroinjection of Zea mays (Corn) buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 23A is a bright field photograph of microspores of Zea mays (Corn) which were not macroinjected with nanocarrier:DNA complex.
Fig. 23B is a fluorescence photograph of microspores of Zea mays (Corn) which were not macroinjected with nanocarrier:DNA complex (control).

9 Fig. 24A is a bright field photograph of microspores following macroinjection of Glycine max (Soybean) buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 24B is a fluorescence photograph of microspores following macroinjection of Glycine max (Soybean) buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 25A is a bright field photograph of microspores of Glycine max (Soybean) which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 25B is a fluorescence photograph of microspores of Glycine max (Soybean) which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 26A is a bright field photograph of microspores following macroinjection of Helianthus annuus (Sunflower) buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 26B is a fluorescence photograph of microspores following macroinjection of Helianthus annuus (Sunflower) buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 27A is a bright field photograph of microspores of Helianthus annus (Sunflower) which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 27B is a fluorescence photograph of microspores of Helianthus annus (Sunflower) which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 28A is a bright field photograph of microspores following macroinjection of Anethum graveolens (Dill) buds with rosette nanotube nanocarrier:GFP plasmid DNA.
Fig. 28B is a fluorescence photograph of microspores following macroinjection of Anethum graveolens (Dill) buds with rosette nanotube nanocarrier:GFP plasmid DNA.
Fig. 29A is a bright field photograph of microspores of Anethum graveolens (Dill) which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 29B is a fluorescence photograph of microspores of Anethum graveolens (Dill) which were not macroinjected with nanocarrier:DNA complex (control).
Fig. 30A is a bright field photograph of multicellular proembryos 20 days after microspore extraction following macroinjection of Brassica napus Topas 4079 buds with gemini surfactant nanocarrier:dsRed plasmid DNA.

Fig. 30B is a fluorescence photograph of multicellular proembryos 20 days after microspore extraction following macroinjection of Brassica napus Topas 4079 buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 31A is a bright field photograph of multicellular proembryos 20 days after microspore extraction following macroinjection of Brassica carinata buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 31B is a fluorescence photograph of multicellular proembryos 20 days after microspore extraction following macroinjection of Brassica carinata buds with gemini surfactant nanocarrier:dsRed plasmid DNA.
Fig. 32A is a bright field photograph of multicellular proembryos 129 days after microspore extraction following macroinjection of Camelina sativa buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 32B is a fluorescence photograph of multicellular proembryos 129 days after microspore extraction following macroinjection of Camelina sativa buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 33A is a bright field photograph of a multicellular proembryo 56 days after microspore extraction following macroinjection of Camelina sativa buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 33B is a fluorescence photograph of a multicellular proembryo 56 days after microspore extraction following macroinjection of Camelina sativa buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 34A is a bright field photograph of a multicellular proembryo 250 days after microspore extraction following macroinjection of Ricinus communis (Castor bean) buds with rosette nanotube nanocarrier:GFP plasmid DNA.
Fig. 34B is a fluorescence photograph of a multicellular proembryo 250 days after microspore extraction following macroinjection of Ricinus communis (Castor bean) buds with rosette nanotube nanocarrier:GFP plasmid DNA.
Fig. 35A is a bright field photograph of a multicellular proembryo 30 days after microspore extraction following macroinjection of Helianthus annus (Sunflower) buds with rosette nanotube nanocarrier:dsRed plasmid DNA.

Fig. 356 is a fluorescence photograph of a multicellular proembryo 30 days after microspore extraction following macroinjection of Helianthus annus (Sunflower) buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 36A is a bright field photograph of a developing embryonic microspore 129 days after microspore extraction following macroinjection of Anethum graveolens (Dill) buds with rosette nanotube nanocarrier:GFP plasmid DNA.
Fig. 36B is a fluorescence photograph of a developing embryonic microspore 129 days after microspore extraction following macroinjection of Anethum graveolens (Dill) buds with rosette nanotube nanocarrier:GFP plasmid DNA.
Fig. 37A is a bright field photograph of embryos 23 days after microspore extraction following macroinjection of Brassica carinata buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 37B is a fluorescence photograph of embryos 23 days after microspore extraction following macroinjection of Brassica carinata buds with rosette nanotube nanocarrier:dsRed plasmid DNA.
Fig. 38A is a bright field photograph of secondary embryos developing on the hypocotyl of a plantlet (A4) arising from a glowing microspore derived embryo following macroinjection of Brassica napus Topas 4079 buds with rosette nanotube nanocarrier:GFP
plasmid DNA
complex.
Fig. 38B is a fluorescence photograph of secondary embryos developing on the hypocotyl of a plantlet (A4) arising from a glowing microspore derived embryo following macroinjection of Brassica napus Topas 4079 buds with rosette nanotube nanocarrier:GFP plasmid DNA complex.
Fig. 39 is a gel image of the GFP PCR products (544 bp) obtained using primers for the GFP gene with leaf tissue DNA from plants regenerated from microspore derived embryos from bud macroinjection with pDAB7221. Plants A7, A8, A9, A10, A24, and A29 are positive independent events. Legend: M = 100 bp marker, NT = no template (mix only) negative control, WT = wild type tissue (negative control), pDAB7221 =
plasmid (positive control).
Fig. 40 is a gel image of the YFP PCR products (504 bp) obtained using primers for the YFP gene with leaf tissue DNA from plants regenerated from microspore derived embryos from bud macroinjection with pDAB104200. Plants C9, 013, 014, 016 and are positive independent events. Legend: M = 100 bp marker, NT = no template (mix only) negative control, WT = wild type tissue (negative control), pDAB104200 =
plasmid (positive control).
Fig. 41 is a gel image of the PAT PCR products (540 bp) obtained using primers for the PAT gene with leaf tissue DNA from plants regenerated from microspore derived embryos from bud macroinjection with pDAB104200. Plants C9, C10, C15 and C17 are positive independent events. Legend: M = 100 bp marker, NT = no template (mix only) negative control, WT = wild type tissue (negative control), pDAB104200 =
plasmid (positive control).
Fig. 42 is an image of a developed membrane resulting from the non-radioactive Southern hybridization using a labeled GFP probe on double digested DNA of individual plantlets. The arrow at the right indicates the 740 bp bands found in transformed plants but not in wildtype tissue. The circle near the right edge indicates positive results for hybridization with GFP probe in MDE transformant (A37). The circle near the left edge indicates absence of band in Topas 4079 donor tissue (negative control).
Scratches made on membrane during hybridization cover positive results in more transformants (A4, A13).
Fig. 43 is a gel image of the GFP PCR products (544 bp) obtained using primers for the GFP gene on leaf tissue DNA from plants regenerated from MDE of primary independent transformants. Microspores from our GFP PCR (+), Southern (+) and sequence (+) primary transformants were extracted and cultured for embryogenesis. The resulting embryos were regenerated into plantlets and leaf tissue DNA was extracted and analyzed for presence of the GFP gene. Plant A37-2 scores positive for the GFP gene in the next generation proving inheritance of the foreign DNA. Legend: M = 100 bp marker, WT =
wild type tissue (negative control), NT = no template (mix only) negative control, pDAB7221 = plasmid (positive control).
Fig. 44A is a photograph taken under a confocal microscope in UV light using a YFP filter of Brassica napus Topas 4079 microspores showing YFP protein uptake arising from macroinjection of donor bud with K3T rosette nanotube:YFP protein complex and subsequent, microspore extraction and culturing for embryogenesis.
Fig. 44B is a photograph taken under a confocal microscope in UV light using a YFP filter of Brassica napus Topas 4079 microspores which were not macroinjected with nanocarrier:protein complex (control).

Description of Preferred Embodiments All technical terms employed in this specification are commonly used in biochemistry, molecular biology and agriculture; hence, they are understood by those skilled in the field to which this invention belongs. Those technical terms can be found in the prior art (e.g. in: Sambrook and Russell 2001; Ausubel 1988; Ausubel 2002;
Green 1997). Methodology involving plant biology techniques are described here and also are described in detail in prior art treatises (e.g. Maliga 1995).
In order to provide a clear and consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided:
Embryo: An embryo may be the small plant contained within a mature seed.
Nanocarrier: A microscopic carrier with an overall positive charge. A
nanocarrier may be selected from: gold nanoparticles, silica nanoparticles, tungsten nanoparticles, semiconductor nanoparticles such as quantum dots, rosette nanotubes, lipid molecules (such as gemini surfactants) and small peptides such as TAT2 and Pep1.
dsRed: A 28 kDa protein that exhibits bright red fluorescence when exposed to UV light.
GFP (green fluorescent protein): A protein, consisting of 238 amino acids, which exhibits bright green fluorescence when exposed to UV light.
YFP (yellow fluorescent protein): A protein, being a genetic mutant of green fluorescent protein, which exhibits bright yellow fluorescence when exposed to UV light.
PAT (phosphinothricin acetyltransferase): A protein encoded by the bialaphos resistance gene (bar) from Streptomyces hygroscopicus conferring resistance to PPT and used as a selectable marker.
Nanocarrier:nucleic acid complex: The complex formed by the non-covalent interaction of the positively charged nanocarrier(s) and the negatively charged nucleic acid molecule(s).
According to embodiments of the present invention, a plant cell may be any plant cell from any plant. Examples of such plants include, but are not limited to, tobacco, carrot, maize, Brassica spp. (e.g. canola, rapeseed, etc.), cotton, rice, peanut, soybean, sugarcane, arabidopsis, camelina, jatropha, sugar beet, barley, peas, saponaria, sunflower, flax and wheat. Other examples of plants include, but are not limited to, castor bean, dill and mustard.
Preferred plants may be those from family Brassicaceae, Euphorbiaceae, Poaceae, Fabaceae, Asteraceae, Caryophyllaceae or Apiaceae, for example plants from the following genera: Brassica, Sinapis, Camelina, Crambe, Jatropha, Ricinus, Zea, Glycine, Pisum, Helianthus, Triticum, Hordeum, Saponaria or Anethum. Specific species of plants are Brassica napus, Brassica carinata, Brassica juncea, Brassica rapa, Brassica oteracea ssp. alboglabra, Sinapis alba, Camelina sativa, Crambe abyssinica, Jatropha multifida, Ricinus communis, Zea mays, Glycine max, Pisum sativum, Helianthus annuus, Triticum aestivum, Hordeum vulgare, Saponaria vaccaria or Anet hum graveolens.
The nucleic acids introduced in the present invention may confer traits such as herbicide resistance, insect resistance, bacterial resistance, fungal resistance, viral disease resistance, female sterility, male sterility, altered oil profile, enhanced nutritional quality and enhanced industrial functionality. Such foreign additional and/or modified genes are referred to herein as transgenes.
The nucleic acids introduced in the present invention may be operatively linked to a regulatory element (for example, a promoter).
A promoter includes a region of DNA that may be upstream from the start of transcription and that may be involved in recognition and binding of RNA
polymerase and other proteins to initiate transcription. A plant promoter may be a promoter capable of initiating transcription in plant cells. As will also be apparent to persons skilled in the art, it is possible to utilize plant promoters to direct up- or down-regulation of transgene expression, to target gene expression to particular cells, tissues (e.g., napin promoter for expression of transgenes in developing seed cotyledons), organs (e.g., roots), to a particular developmental stage, or in response to a particular external stimulus (e.g., heat shock).
Promoters for use herein may be inducible, constitutive, or tissue-specific or have various combinations of such characteristics. An inducible promoter may be a promoter that is under environmental control. An inducible promoter may be operably linked to a gene for expression in a cell. Exemplary inducible promoters include, but are not limited to: those from the ACE1 system that respond to copper; 1n2 gene from maize that respond to benzenesulfonamide herbicide safeners and Tet repressor from Tn10.

Other useful promoters include constitutive promoters. Exemplary constitutive promoters include, but are not limited to promoters from plant viruses, such as carnation etched ring virus (CERV), cauliflower mosaic virus (CaMV) 35S promoter, or more particularly the double enhanced cauliflower mosaic virus promoter, comprising two CaMV 35S promoters in tandem (referred to as a "Double 35S" promoter). The ALS
promoter, Xba1/Ncol fragment 5' to the Brassica napus ALS3 structural gene (or a nucleotide sequence similar to said Xba1/Ncol fragment) represents a particular useful constitutive promoter (Baszczynski 1996).
Other useful promoters include tissue-specific or developmentally regulated promoters. A tissue-specific promoter allows for overexpression in certain tissues without affecting expression in other tissues. By way of illustration, a promoter used in overexpression of enzymes in seed tissue is an ACP promoter (De Silva 1992).
Other exemplary tissue-specific promoters include, but are not limited to, a seed specific promoter such as that from the phaseolin gene, a leaf-specific and light-induced promoter such as that from cab or rubisco; an anther-specific promoter such as that from LAT52; a pollen-specific promoter such as that from Zm13 or a microspore preferred promoter such as that from apg.
The promoter and termination regulatory regions may be functional in the host plant cell and may be heterologous (that is, not naturally occurring) or homologous (derived from the plant host species) to the plant cell and the gene.
The termination regulatory region may be derived from the 3' region of the gene from which the promoter was obtained or from another gene. Suitable termination regions which may be used are well known in the art and include A. tumefaciens nopaline synthase terminator (Tnos), A. tumefaciens mannopine synthase terminator (Tmas) and the CaMV 35S terminator (T35S), the pea ribulose bisphosphate carboxylase small subunit termination region (TrbcS), or the Tnos termination region.
A nucleic acid construct for use herein may be comprised within a vector, most suitably an expression vector adapted for expression in an appropriate host (plant) cell. It will be appreciated that any vector which is capable of producing a plant comprising the introduced DNA sequence will be sufficient. Suitable vectors are well known to those skilled in the art and are described in general technical references (e.g.
Pouwels 1986).
The vector may be in the form of a plasmid and can be used alone or in combination with other plasmids to transform cells using the transformation methods described herein to incorporate the transgene into the genetic material of a plant cell.
Particularly suitable vectors include the Ti plasmid vectors.
The present invention includes the use of nanocarriers as carriers for nucleic acids in microspore transformation. Various nanocarriers are known in the art and are suitable for use in the present invention including gold nanoparticles, silica nanoparticles, tungsten nanoparticles, semiconductor nanoparticles such as quantum dots, rosette nanotubes, lipid molecules such as gemini surfactants and small peptides such as TAT2 and Pep1.
Among the nanoparticles investigated, nanotubes formed from pyridio [4,5-D]
pyrimidin-2,5-diones and pyrido[4,3]pyridimin-2-ones (Fenniri 2004) are effective carriers of DNA.
The present invention also contemplates the use of cationic lipids as carriers for DNA in transformation of plant cells. Examples, which are not intended to be limiting, include, dioleoylphosphatidylethanolamine (DOPE) and the synthetic cationic lipid N- 1-(2,3-dioleyloxy)propyl!-N,N,N-trimethylammonium chloride (DOTMA), LI POFECTAMINETm, a reagent containing 2,3-dioleyloxy-N-2-(sperminecarboxyamido)ethyl-N,N-dimethy1-1-propanaminium trifluoroacetate (DOSPA), and cationic derivatives of cholesterol. Particularly preferred are cationic lipids of the general structure shown below.
tail cation spacer cation tail = 0 Examples of suitable cationic lipids include compounds (referred to herein as "gemini surfactants"), which are known in the art (Chu 2000; Qiu 2007; Wettig 2007;
Donkuru 2008). Some specific examples of gemini surfactants are provided in Table 1.
Preferred examples are 12-3-12 (1,3-propanediyl-bis(dimethyldodecylammonium) dibromide) and 12-7NH-12 (1,9-bis(dodecy1)-1,1,9,9-tetramethy1-5-imino-1,9-nonanediammonium dibromide).

Table 1 Name Structure Reference 12-2-12 Qiu 2007 I I +
H3c¨N4L--(CH2)2¨N--C H3 .2Br 12-3-12 Qiu 2007 I I Donkuru 2008 H3C-NI---(CH2)3-NL--C H3 .2Br 12-6-12 CH3 CH3 Qiu 2007 H3C¨N-.---(CH2)6¨N,,¨C H3 .26r I I

12-5N-12 Wettig 2007 N¨

I I

12-8N-12 Wettig 2007 cl2H25 I I

12-7N-12 Wettig 2007 1 1 I Donkuru 2008 C12H25 12-7NH-12 Wettig 2007 I

The present invention also includes the use of cell penetrating peptides as nanocarriers. Examples of suitable peptides include TAT2 and Pep1. The amino acid sequence of TAT2 is SEQ ID NO: 1: RKKRRQRRRRKKRRQRRR. The amino acid sequence of Pepl is SEQ ID NO: 2: KETWWETWWTEWSQPKKKRKV.
Expression vectors may include at least one genetic marker, operably linked to a regulatory element (for example, a promoter) that allows transformed cells containing the marker to be either recovered by negative selection (i.e. inhibiting growth of cells that do not contain the selectable marker gene) or by positive selection (i.e.
screening for the product encoded by the genetic marker). Many selectable marker genes for transformation are well known in the transformation arts and include, for example, genes that code for enzymes that metabolically detoxify a selective chemical agent which may be an antibiotic or a herbicide, or genes that encode an altered target which may be insensitive to the inhibitor.
One commonly used selectable marker gene suitable for plant transformation may include the neomycin phosphotransferase II (nptII) gene under the control of plant regulatory signals, which confers resistance to kanamycin. Additional selectable marker genes of bacterial origin that confer resistance to antibiotics include gentamycin acetyl transferase, streptomycin phosphotransferase, aminoglycoside-3'-adenyl transferase, and the bleomycin resistance determinant. Other selectable marker genes confer resistance to herbicides such as glyphosate, glufosinate or bromoxynil.
Another class of marker genes suitable for plant transformation requires screening of plant cells rather than direct genetic selection of transformed cells for resistance to a toxic substance, such as an antibiotic. Commonly used genes for screening transformed cells include p-glucuronidase (GUS), p-galactosidase, luciferase and chloramphenicol acetyltransferase.
Recently, genes encoding fluorescent proteins have been utilized as markers for gene expression in prokaryotic and eukaryotic cells. For example, green fluorescent protein (GFP), a protein consisting of 238 amino acids which exhibits bright green fluorescence when exposed to UV light. Other fluorescent proteins include dsRed, EGFP, EBFP, ECFP and YFP (Chalfie 1994). Fluorescent proteins and mutated versions of fluorescent proteins may be used as screenable markers.
The present invention includes the use of macroinjection of buds to introduce a complex comprising a nanocarrier and a nucleic acid into the bud of a donor plant.
Macroinjection permits introduction of a nucleic acid at the level of a single cell.

With transgenic plants according to the present invention, foreign proteins can be expressed and extracted using methods known in the art. Similarly, genes introduced using the methods of the present invention can be expressed in transformed cells, resulting in phenotypes of agronomic interest. Examples of such phenotypes include, but are not limited to, plant disease resistance, pest resistance and herbicide resistance.
Genes introduced using the methods described herein can result in a value added trait such as modified seed oil profile or modified fatty acid metabolism.
In an embodiment of the present invention, donor plants are grown under conditions for optimum microspore culture. For example, Brassica napus donor plants are most embryogenic when the buds are grown at a day/night temperature regime of

10/5 C. Conditions for optimum microspore culture are known to those skilled in the art (e.g. Ferrie 1993, the contents of which are hereby incorporated by reference).
Nanocarrier and nucleic acid stock solutions are prepared. The positively charged nanocarriers and negatively charged nucleic acid are incubated together in an appropriate ratio which will result in an nanocarrier:nucleic acid complex with an overall positive charge. The nanocarrier:nucleic acid complexes are macroinjected into the donor plant buds as the buds remain on the donor plant. The buds continue to remain on the donor plant for a period of time to further in their development. The macroinjected buds are removed from the donor plant and surface sterilized as per normal microspore embryogenesis protocols (e.g. Maluszynski 2003). The nnicrospores are extracted and cultured for microspore embryogenesis using techniques described in the art (Ferrie 1995; Ferrie 1999). The developing embryos are observed for transgenic events.
The transgenic embryos are used to generate stabilized plant lines comprising a desired trait wherein the desired trait is introduced by the methods of the present invention. Methods of generating stabilized plant lines are well know to those of ordinary skill in the art and may include techniques such as, but not limited to, selfing, backcrosses, hybrid production, crosses to populations and the like (see, for example, Allard 1999).
Examples The present invention is further described in the following examples, which are offered by way of illustration and are not intended to limit the invention in any manner.

Example 1. Macroinjection of Brassica napus genotype Topas 4079 buds with Rosette nanotubes and dsRed plasmid DNA
Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-2$1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of 10/5 C.
Rosette nanotubes and plasmid DNA containing the dsRed gene were incubated in various (N/P042) molar ratios (VT= 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into Topas 4079 buds using a 1/2 cc tuberculin syringe. The buds remained on the donor plant at 10/5 C
conditions for 2 days prior to microspore extraction.
The Topas 4079 buds were removed from the plant and surface sterilized with 100% JavexTM bleach. The microspores were released by crushing the buds in 1/2 strength B5 (Gamborg 1968) with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN (Lichter 1982) media with 13% sucrose and 0.08% glutamine and cultured at 32 C for three days after which they were kept at 24 C.
The resulting embryos were observed for dsRed fluorescence using a microscope with a UV source and GFP filter. Embryos with dsRed signal were observed in transfected, but not control cultures as is shown in Fig. 1. A strong signal was observed in the root and shoot apical meristems whereas a no signal is shown in Fig. 8, the control (not macroinjected with nanocarrier:DNA complex) developing embryos.
Example 2. Macroinjection of Brassica napus genotype Topas 4079 buds with gemini Surfactants and GFP plasmid DNA
Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-25-1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of 10/5 C.
Gemini surfactants and plasmid DNA containing the GFP gene were incubated in 10:1 (N/P042) molar ratios (VT= 200 pL) at room temperature for one hour prior to use.
The nanocarrier:nucleic acid complexes were injected into Topas 4079 buds using a 1/2 cc tuberculin syringe. The buds remained on the donor plant at 10/5 C conditions for 2 days prior to microspore extraction.
The Topas 4079 buds were removed from the plant and surface sterilized with 100% JavexTM. The microspores were released by crushing the buds in 1/2 strength B5 with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 13% sucrose and 0.08%
glutamine and cultured at 32 C for three days after which they were kept at 24 C.
The resulting embryos were observed for GFP fluorescence using a microscope with a UV source and GFP filter. Embryos with GFP signal were observed as shown in Fig. 2. A strong signal was observed in the root and shoot apical meristems whereas no signal is shown in Fig. 8, the control (not macroinjected with nanocarrier:DNA
complex) developing embryos.
Example 3. Macroinjection of Brassica napus genotype DH12075 buds with TA T2 (cell penetrating peptide) and GFP plasmid Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-2s1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of 10/5 C.
TAT2 and plasmid DNA containing the GFP gene were incubated in various (W/PO4-2) molar ratios (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into DH12075 buds using a 1/2 cc tuberculin syringe. The buds remained on the donor plant at 10/5 C conditions for 2 days prior to microspore extraction.

' The DH12075 buds were removed from the plant and surface sterilized with 100%
JavexTM. The microspores were released by crushing the buds in 1/2 strength B5 with 13%
sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 13% sucrose and 0.08% glutamine and cultured at 32 C for three days after which they were kept at 24 C.
The resulting embryos were observed for GFP fluorescence using a microscope with a UV source and GFP filter. Embryos expressing GFP signal were observed as shown in Fig. 3 and 4. A signal was observed throughout developing embryo but not observed in control (not macroinjected with nanocarrier:DNA complex) developing embryos shown in Fig. 9.
Example 4. Macroinjection of Brassica napus genotype DH12075 buds with Rosette Nanotubes and dsRed plasmid DNA
Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-2s1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of 10/5 C.
Rosette nanotubes (K3T) and plasmid DNA containing the dsRed gene were incubated in various (N+/PO4-2) molar ratios (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into buds using a 1/2 cc syringe. The buds remained on the donor plant at 10/5 C
conditions for 2 days prior to microspore extraction.
The DH12075 buds were removed from the plant and surface sterilized with 100%
JavexTM. The microspores were released by crushing the buds in half strength B5 with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 13% sucrose and 0.08%
glutamine and cultured at 32 C for three days, after which they were kept at 24 C.
The resulting embryos were observed for dsRed fluorescence using a microscope with a UV source and GFP filter. The embryos expressing dsRed signal produced a strong signal as shown in Fig. 5, whereas the control (not macroinected with nanocarrier:DNA complex) developing embryos produced no signal as shown in Fig. 9.
Example 5. Macroinjection of Brassica napus genotype DH12075 buds with gemini Surfactants and GFP plasmid DNA
Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-251) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of 10/5 C.
Gemini surfactant (12-3-12) and plasmid DNA containing the GFP gene were incubated in 10:1 (W/PO4-2) molar ratio (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into DH12075 buds using a 1/2 cc syringe. The buds remained on the donor plant at 10/5 C
conditions for 2 days prior to microspore extraction.
The DH12075 buds were removed from the plant and surface sterilized with 100%
JavexTM. The microspores were released by crushing the buds in half strength B5 with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 13% sucrose and 0.08%
glutamine and cultured at 32 C for three days, after which they were kept at 24 C.
The resulting embryos were observed for GFP fluorescence using a microscope with a UV source and GFP filter. The embryos expressing GFP signal produced a strong signal as shown in Fig. 6 whereas the control (not macroinjected with nanocarrier DNA:complex) developing embryos did not produce a signal, as shown in Fig. 9.
Example 6. Macroinjection of Brassica napus genotype Topas 4079 buds with Positively Charged Gold Nanoparticles (PGNP) and GFP plasmid DNA
Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-2s1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of PGNP and plasmid DNA containing the GFP gene were incubated in an appropriate (1\r/PO4-2) molar ratio (V-r = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into Topas 4079 buds using a 1/2 cc syringe. The buds remained on the donor plant at 10/5 C conditions for 2 days prior to microspore extraction.
The Topas 4079 buds were removed from the plant and surface sterilized with 100% JavexTM. The microspores were released by crushing the buds in half strength B5 with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 13% sucrose and 0.08%
glutamine and cultured at 32 C for three days, after which they were kept at 24 C.
The resulting embryos were observed for GFP fluorescence using a microscope with a UV source and GFP filter. The embryos expressing GFP signal produced a strong signal as shown in Fig. 7 whereas the control (not macroinjected with nanocarrier DNA:complex) developing embryos did not produce a signal, as shown in Fig. 8.
Example 7. Macroinjection of Camelina sativa buds with Rosette nanotubes and dsRed plasmid DNA
Donor plants of Camelina sativa (Order Brass/ca/es, Family Brassicaceae, Genus Camelina, Species Camelina sativa) for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and a few seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol rn-2s1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer.
Rosette nanotube (K3T) and plasmid DNA containing the dsRed gene were incubated together in an appropriate (N/P042) molar ratio (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into camelina buds using a 1/2 cc syringe. The buds remained on the donor plant for 3 days prior to microspore extraction.

The camelina buds were removed from the plant and surface sterilized with 100%

JavexTM. The microspores were released by crushing the buds in half strength B5 with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 12.5% sucrose and 12.5%
polyethylene glycol and cultured at 32 C for three days, after which they were kept at 24 C.
After eight days in culture, the microspores were observed for dsRed fluorescence using a microscope with a UV source and GFP filter. The microspores expressing dsRed signal produced a strong signal as shown in Fig. 10 whereas the control (not macroinjected with nanocarrier DNA:complex) microspores did not produce a signal, as shown in Fig. 11.
Example 8. Macroinjection of Jatropha multifida buds with Rosette Nanotubes and dsRed plasmid DNA
The donor plants of Jatropha multifida (Order Malpighiales, Family Euphorbiaceae, Genus Jatropha, Species Jatropha multifida) were grown under greenhouse conditions (20/15 C, 16 h photoperiod) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Rosette nanotube (K3T) and plasmid DNA

containing the dsRed gene were incubated together in an appropriate (N/P042) molar ratio (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into Jatropha buds using a 1/2 cc syringe. The buds remained on the donor plant for 3 days prior to microspore extraction.
The Jatropha buds were removed from the plant and surface sterilized with 100%

JavexTM. The microspores were released by crushing the buds in half strength B5 with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 90 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN media with 13% sucrose and 0.08%
glutamine and cultured at 32 C for three days, after which they were kept at 24 C.
After eight days in culture, the microspores were observed for dsRed fluorescence using a microscope with a UV source and GFP filter. The microspores expressing dsRed signal produced a strong signal as shown in Fig. 12 whereas the control (not macroinjected with nanocarrier DNA:complex) microspores did not produce a signal, as shown in Fig. 13.

Example 9, Macroinjection of Triticum aestivum cv. Fielder buds with Rosette Nanotubes and dsRed plasmid DNA
Donor plants of Triticum aestivum cv. Fielder (Order Poales, Family Poaceae, Genus Triticum, Species Triticum aestivum) for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and a few seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-2s-1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer.
Rosette nanotube (K3T) and plasmid DNA containing the dsRed gene were incubated together in an appropriate (N+/PO4-2) molar ratio (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:nucleic acid complexes were injected into Triticum aestivum cv. Fielder spikelets (buds) using a 1/2 cc syringe. The inflorescence remained on the donor plant for 3 days prior to microspore extraction.
The inflorescence containing the macroinjected spikelets was removed from the plant and surface sterilized with 100% JavexTM. The anthers were isolated and the microspores were released by crushing the anthers in NPB-99 (pH 7.0) wash media (Zheng 2003). The microspore suspension was filtered through a 90 pm filter and centrifuged at 350 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NPB-99 media with 10% ficoll (pH 7.0) and cultured at 32 C for three days, after which they were kept at 24 C.
After eight days in culture, the microspores were observed for dsRed fluorescence using a microscope with a UV source and GFP filter. The microspores expressing dsRed signal produced a strong signal as shown in Fig. 14 whereas the control (not macroinjected with nanocarrier DNA:complex) microspores did not produce a signal, as shown in Fig. 15.
Example 10. Macroinjection with Different Combinations of Plant Species, Nanocarriers and Nucleic Acid Molecules Macroinjection of nanocarrier:nucleic acid complexes in accordance with the present invention can be extended to different combinations of plant species, nanocarriers and nucleic acid molecules. Macroinjections of buds were carried out in a similar manner as previously described. Figs. 16-29 show bright field and fluorescence photographs of microspores following macroinjection involving 12 different combinations of plant species or varieties, nanocarriers and DNA molecules. Species and varieties include Brassica napus Topas 4079, Brassica napus DH12075, Brassica carinata, Camelina sativa, Jatropha multifida, Ricinus communis, Zea mays, Glycine max, Helianthus annuus, Triticum aestivum and Anethum graveolens. Nanocarriers include rosette nanotubes and gemini surfactants. Nucleic acid molecules include dsRed plasmid and GFP plasmid. Glowing microspores, both in bright field and fluorescence photography, demonstrate successful uptake of the nanocarrier:nucleic acid complex. It is evident that the method of the present invention has broad application across plant species, nanocarrier and nucleic acid molecule.
To better establish that the microspores were successfully transformed with the nucleic acid molecule following macroinjection of nanocarrier:nucleic acid complexes, bright field and fluorescence images were taken at different time intervals for 6 different plant species, 2 different nanocarriers and 2 different nucleic acid molecules. Figs. 30-37 demonstrate that developing embryos still glow from 20 to 250 days after macroinjection.
To yet further establish that transformation can be successfully accomplished using the present method, and to establish that transformed plants may be regenerable from plants grown from transformed microspores, a glowing microspore-derived embryo of a Brassica napus Topas 4079 bud macroinjected with rosette nanotube nanocarrier:GFP plasmid DNA complex was grown into a plantlet. Secondary embryos growing on the hypocotyl of the plantlet were photographed using bright field and fluorescence photography. Fig. 38 shows the bright field and fluorescence photographs, which demonstrate that the secondary embryos also glow, indicating that the GFP
transformed into the original microspore was incorporated into the genome of a secondary embryo of the plantlet derived from the original microspore.
Example 11: Transformed Plants To establish that bud macroinjection with nanocarrier:nucleic acid complex results in successfully transformed microspores from which embryos may be derived and then regenerated into transformed plants, PCR analysis and leaf paint assays were conducted on the leaves of plants that were successfully regenerated from the embryos.
Thus, Brassica napus Topas 4079 buds were macroinjected with nanocarrier:nucleic acid complexes and embryos were derived from the bud microspores as described previously. Three different nucleic acids were used: GFP (green fluorescent protein), YFP (yellow fluorescent protein) and PAT (phosphinothricin acetyltransferase).

Plasmid pDAB7221 was used with the GFP and plasmid pDAB104200 with the YFP and PAT. Embryos were then regenerated into doubled-haploid plants using established methods (Ferrie 1993). DNA from leaf tissue of the regenerated plants was extracted and FOR products obtained using primer pairs for each of the nucleic acids (SEQ ID
NO: 3 and SEQ ID NO: 4 for GFP, SEQ ID NO: 5 and SEQ ID NO: 6 for YFP, and SEQ ID
NO:
7 and SEQ ID NO: 8 for PAT).
Fig. 39 is the gel image of the GFP PCR products (544 bp) obtained using the primers for the GFP gene with the leaf tissue DNA. Plants A7, A8, A9, A10, A24, and A29 are positive independent events. M = 100 bp marker, NT = no template (mix only) negative control, WT = wild type tissue (negative control), pDAB7221 = plasmid (positive control). The PCR product was sequenced and the sequence confirms the presence of GFP sequence in the leaf tissue of the transformed plant. Transgenic line A7 arose from bud macroinjection with Gemini surfactant 12-3-12. A similar experiment with GFP in transgenic line D1 using TAT2 also revealed the presence of GFP sequence in the leaf of the regenerated plant.
Fig. 40 is a gel image of the YFP PCR products (504 bp) obtained using primers for the YFP gene with the leaf tissue DNA. Plants 09, 013, 014, 016 and C20 are positive independent events. M = 100 bp marker, NT = no template (mix only) negative control, WT = wild type tissue (negative control), pDAB104200 = plasmid (positive control). The FOR product was sequenced and the sequence confirms the presence of YFP sequence in the leaf tissue of the transformed plant.
Fig. 41 is a gel image of the PAT FOR products (540 bp) obtained using primers for the PAT gene with the leaf tissue DNA. Plants 09, 010, 015 and 017 are positive independent events. M = 100 bp marker, NT = no template (mix only) negative control, WT = wild type tissue (negative control), pDAB104200 = plasmid (positive control). The FOR product was sequenced and the sequence confirms the presence of PAT
sequence in the leaf tissue of the transformed plant.
Fig. 42 is an image of a developed membrane resulting from non-radioactive Southern hybridization using a labeled GFP probe on double digested DNA of individual plantlets. The arrow at the right indicates 740 bp bands found in transformed plants but not in wildtype tissue. The circle near the right edge indicates positive results for hybridization with GFP probe in microspore-derived embryo (MDE) transformant A37.
The circle near the left edge indicates absence of band in Topas 4079 donor tissue (negative control). Scratches made on membrane during hybridization cover positive results in more transformants (A4, A13). This further illustrates success at regenerating transformed double haploid plants from embryos derived from transformed microspores resulting from bud macroinjection with nanocarrier:nucleic acid complex.
Fig. 43 is a gel image of the GFP PCR products (544 bp) obtained using primers for the GFP gene on leaf tissue DNA from plants regenerated from microspore-derived embryos of primary independent transformants. Microspores from GFP PCR (+), Southern (+) and sequence (+) primary transformants were extracted and cultured for embryogenesis. The resulting embryos were regenerated into plantlets and leaf tissue DNA was extracted and analyzed for presence of the GFP gene. Plant A37-2 scores positive for the GFP gene in the next generation showing inheritance of the foreign DNA.
M = 100 bp marker, WT = wild type tissue (negative control), NT = no template (mix only) negative control, pDAB7221 = plasmid (positive control). Thus, nucleic acid molecules transformed into plants using the method of the present invention is inheritable from one generation of plants to the next.
While both PCR and Southern molecular analysis confirm the presence and integration of the selectable marker genes introduced into the transformants by the nanocarrier:DNA complexes, a leaf paint assay indicates the functionality of the PAT
gene selectable marker used in pDAB104200. One half of a leaf of the putative transformants was painted with 300 mg/L glufosinate ammonium and the leaf health of the painted half was scored after three days. The transformant C76 showed very little leaf damage turning a slightly paler green and was scored as resistant. The painted half of transformant 078 became very yellow and died and was scored susceptible.
Wildtype Topas 4079 leaf used as a negative control in this assay also turned very yellow and died and was scored susceptible.
Example 12: Macroinjection of Brassica napus genotype Topas 4079 buds with Rosette nanotubes and YFP protein In this example, buds were macroinjected with a nanocarrier:protein complex instead of a nanocarrier:nucleic acid complex.
Donor plants for isolated microspore culture were prepared as follows. Six-inch pots filled with Sunshine #3 soil mix containing approximately 1 g of slow release fertilizer (14-14-14 - Nutricote) were thoroughly soaked with water and two seeds were placed in each pot. Pots were placed in a growth cabinet (20/15 C, 16 h photoperiod, 400 pmol m-2s1) and watered three times weekly with 0.4 g/L of 20-20-20 (N-P-K) fertilizer. Prior to bolting, growth cabinet temperatures were adjusted to a day/night temperature regime of 10/5 C.
Rosette nanotubes and YFP protein were incubated together in an appropriate ratio (VT = 200 pL) at room temperature for one hour prior to use. The nanocarrier:protein complex was injected into Topas 4079 buds using a 1/2 cc tuberculin syringe.
The buds remained on the donor plant at 10/5 C conditions for 2 days prior to microspore extraction.
The Topas 4079 buds were removed from the plant and surface sterilized with 100% JavexTM bleach. The microspores were released by crushing the buds in %
strength B5 (Gamborg 1968) with 13% sucrose (pH 6.0) wash media. The microspore suspension was filtered through a 41 pm filter and centrifuged at 150 g for 3 min. The pellet was washed two more times before the microspores were resuspended in NLN
(Lichter 1982) media with 13% sucrose and 0.08% glutamine and cultured at 32 C
for three days after which they were kept at 24 C.
The resulting microspores were observed for YFP fluorescence using a confocal microscope with a UV source and YFP filter. Microspores with YFP signal were observed in transfected cultures as is shown in Fig. 44A. No signal is shown in Fig.
44B, the control (not macroinjected with nanocarrier:protein complex) microspores.
Free Listing of Sequences:
SEQ ID NO: 1 - TAT2 peptide (18 amino acids) RKKRRQRRRRKKRRQRRR
SEQ ID NO: 2 - Pep1 (21 amino acids) KETWWETWWTEWSQPKKKRKV
SEQ ID NO: 3 ¨ GFP primer (20 nucleotides) CCTGAAGTTCATCTGCACCA
SEQ ID NO: 4 ¨ GFP primer (20 nucleotides) GAACTCCAGCAGGACCATGT
SEQ ID NO: 5 ¨ YFP primer (20 nucleotides) GTATGCTAAAGGTGTGGCCA
SEQ ID NO: 6 ¨ YFP primer (22 nucleotides) MGCCTTGACCATTGAGTTTGA
SEQ ID NO: 7 ¨ PAT primer (20 nucleotides) TCTCAACTGGTCTCCTCTCC
SEQ ID NO: 8¨ PAT primer (20 nucleotides) CCTAACTGGCCTTGGAGGAG
References: The contents of the entirety of each of which are incorporated by this reference.
Allard RW. (1999) Principles of Plant Breeding. 2nd Ed. John Wiley and Sons, NY. 254 Ausubel, et al., eds. (1988) Current Protocols in Molecular Biology. Greene Publishing Associates and Wiley-Interscience, New York (including periodic updates).
Ausubel, et al., eds. (2002) Short Protocols in Molecular Biology: A
Compendium of Methods from Current Protocols in Molecular Biology. 5th ed., vol. 1-2. John Wiley &
Sons, Inc.
Baszczynski C, Barbour E, Miki B. (1996) ALS3 Promoter. International Patent Publication WO 96/30530 published October 3, 1996.
Barro F, et al. (1999) Response of different genotypes of Brassica carinata to microspore culture. Plant Breeding. 118, 79-81.
Chalfie, et al. (1994) Science. 26, 802.
Chu Y, Masoud M, Gebeyehu G. (2000) Transfection Reagents. International Patent Publication WO 00/27795 published May 18, 2000.
Darbani B, Farajnia S, Toorchi M, Zakerbostanabad S, Noeparvar S, Stewart Jr CN.
(2008) DNA-Delivery Methods to Produce Transgenic Plants. Biotechnology. 7(3), 402.

De la Pena, et al. (1987) Nature. 325, 274-276.
De Silva J, Safford R, Hughes S. (1992) Plant Promoter Involved In Controlling Lipid Biosynthesis In Seeds. International Patent Publication WO 92/118634 published October 29, 1992.
Donkuru M. (2008) Non-Viral Gene Delivery with pH-Sensitive gemini Nanoparticles:
Synthesis of gemini Surfactant Building Blocks, Characterization and In Vitro Screening of Transfection Efficiency and Toxicity. M.Sc. Thesis, University of Saskatchewan.
Saskatoon, Saskatchewan.
Eudes F, Chugh A. (2008) Nanocarrier Based Plant Transfection and Transduction.
International Patent Publication WO 2008/148223 published December 11,2008.
Fenniri H. (2004) Method and Associated Pyrimido[ 4,5-D]Pyrimidine-2,5-Diones and Pyrid0[4,3-D]Pyrimidin-2-ones for Forming Nanotubes. United States Patent US
6,696,565 issued February 24, 2004.
Ferrie, et at. (1993) Haploid Embryogenesis in In Vitro Embryogenesis in Plants. Kluwer Academic Publishers, pp. 209-344.
Ferrie A, et al. (1995) Microspore culture for haploid plant production. In:
O.L. Gamborg, and G.C. Phillips (eds.) Plant Cell, Tissue and Organ Culture: fundamental methods.
Springer: Berlin, pp.155-164.
Ferrie A, et al. (1999) Microspore embryogenesis of high sn-2 erucic acid Brassica oleracea germplasm, Plant Cell, Tissue and Organ Culture. 57, 79-84.
Gamborg, et at. (1968) Exp. Cell Res. 50, 151-158.
Green, et al., eds. (1997) Genome Analysis: A Laboratory Manual. vol. 1-2, ed.
Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Lichter. (1982) Z. Pflanzenphysiol. 105, 427-434.
Maliga, et al., eds. (1995) Methods in Plant Molecular Biology: A Laboratory Course Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Maluszynski M., et al. (2003) Doubled Haploid Production in Crop Plants: A
Manual.
Kluwer Academic Publishers, Dordrecht.

Pouwels, et al. (1986) Cloning Vectors. A Laboratory Manual. Elsevier, Amsterdam.
Qiu L-G, Jiang X, Gu L-N, Hi G. (2007) gemini metallomicellar catalysis:
Hydrolysis of p-nitrophenyl picolinate catalyzed by Cu(II) and Ni(II) complexes of macrocyclic ligands in gemini surfactant micelles. Journal of Molecular Catalysis A: Chemical. 277, 15-20.
Samboju, NC, Samuel JP, Lin G, Webb SR, Burroughs FG. (2011) Plant Peptide Gamma-Zein for Delivery of Biomolecules into Plant Cells. International Patent Publication WO 2011/126644 published October 13, 2011.
Sambrook and Russell, eds. (2001) Molecular Cloning: A Laboratory Manual. 3rd ed. vol.
1-3. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
Samuel JP, Burroughs F, Zettler MW, Dixit SK. (2009) Methods For Transferring Molecular Substances Into Plant Cells. International Patent Publication WO

published April 9, 2009.
Samuel J, Petolino J, Samboju N, Webb S, Yau K. (2010) Nanoparticle Mediated Delivery of Sequence Specific Nucleases. International Patent Publication WO

published October 14, 2010.
Samuel JP, Samboju NC, Yau KY, Webb SR, Burroughs FG. (2011) Use of Dendrimer Nanotechnology for Delivery of Biomolecules into Plant Cells. International Patent Publication WO 2011/046786 published April 12, 2011.
Touraev, et al. (1997) Plant J. 12, 949-956.
Wettig SD, Badea I, Donkuru M, Verrall RE, Foldvari M. (2007) Structural and transfection properties of amine-substituted gemini surfactant-based nanoparticles. J Gene Med. 9, 649-658.
Zheng, et al. (2003) Doubled haploid production in crop plants. Kluwer Academic Publishers, pp. 83-94.
Other advantages that are inherent to the invention are obvious to one skilled in the art. The embodiments are described herein illustratively and are not meant to limit the scope of the invention as claimed. Variations of the foregoing embodiments will be evident to a person of ordinary skill and are intended by the inventor to be encompassed by the following claims.

Claims (18)

Claims:

1. A method for introducing a cargo molecule into a microspore of a plant, the method comprising macroinjecting a bud of a donor plant in vivo with a complex comprising a nanocarrier and the cargo molecule.

2. The method according to claim 1, wherein the cargo molecule comprises a nucleic acid, a protein, a hormone or any combination thereof.

3. A method for producing a doubled-haploid transformed plant, said method comprising macroinjecting a bud of a donor plant in vivo with a complex comprising a nanocarrier and a nucleic acid, producing a microspore culture from said injected bud, generating an embryo from said microspore culture and growing a doubled-haploid transformed plant from said embryo, said plant comprising the nucleic acid.

4. A method of expressing a gene comprising transfecting microspores in vivo by macroinjection of a donor plant bud with a nanocarrier:nucleic acid complex comprising the gene, generating an embryo from said microspores and producing a plant by regenerating the plant from said embryo, which plant expresses the gene.

5. The method according to any one of claims 3 to 4, wherein the nucleic acid comprises a DNA molecule.

6. The method according to any one of claims 3 to 5, wherein the complex further comprises one or more proteins, hormones or other nucleic acids.

7. The method according to any one of claims 1 to 6, wherein the plant is from family Brassicaceae, Euphorbiaceae, Poaceae, Fabaceae, Asteraceae, Caryophyllaceae or Apiaceae

8. The method according to any one of claims 1 to 6, wherein the plant is tobacco, carrot, maize, canola, rapeseed, cotton, rice, peanut, soybean, sugarcane, arabidopsis, camelina, jatropha, barley, peas, saponaria, sunflower, flax or wheat.

9. The method according to any one of claims 1 to 6, wherein the plant is wheat.

10. The method according to any one of claims 1 to 6, wherein the plant is castor bean, dill or mustard.

11. The method according to any one of claims 1 to 6, wherein the plant is Brassica spp.

12. The method according to any one of claims 1 to 11, wherein the nanocarrier comprises a gold nanoparticle, a silica nanoparticle, a tungsten nanoparticle, a semiconductor nanoparticles, a rosette nanotube, a lipid molecule or a peptide.

13. The method according to any one of claims 1 to 11, wherein the nanocarrier comprises a rosette nanotube formed from pyridio [4,5-D] pyrimidin-2,5-diones and pyrido[4,3]pyridimin-2-ones.

14. The method according to any one of claims 1 to 11, wherein the nanocarrier comprises a gemini surfactant.

15. The method according to claim 14, wherein the gemini surfactant is 1,3-propanediyl-bis(dimethyldodecylammonium) dibromide or 1,9-bis(dodecyl)-1,1,9,9-tetramethyl-5-imino-1,9-nonanediammonium dibromide.

16. The method according to any one of claims 1 to 11, wherein the nanocarrier comprises a peptide having the amino acid sequence as set forth in SEQ ID NO:
1.

17. The method according to any one of claims 1 to 11, wherein the nanocarrier comprises a gold nanoparticle.

18. A plant produced by a process using the method as defined in any one of claims 1 to 17.