CA2808592C - A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome - Google Patents
A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome Download PDFInfo
- Publication number
- CA2808592C CA2808592C CA 2808592 CA2808592A CA2808592C CA 2808592 C CA2808592 C CA 2808592C CA 2808592 CA2808592 CA 2808592 CA 2808592 A CA2808592 A CA 2808592A CA 2808592 C CA2808592 C CA 2808592C
- Authority
- CA
- Canada
- Prior art keywords
- rna
- sequences
- seq
- fragment
- hiv
- Prior art date
- Legal status (The legal status is an assumption and is not a legal conclusion. Google has not performed a legal analysis and makes no representation as to the accuracy of the status listed.)
- Expired - Lifetime
Links
Classifications
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N15/00—Mutation or genetic engineering; DNA or RNA concerning genetic engineering, vectors, e.g. plasmids, or their isolation, preparation or purification; Use of hosts therefor
- C12N15/09—Recombinant DNA-technology
- C12N15/11—DNA or RNA fragments; Modified forms thereof; Non-coding nucleic acids having a biological activity
- C12N15/113—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing
- C12N15/1131—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses
- C12N15/1132—Non-coding nucleic acids modulating the expression of genes, e.g. antisense oligonucleotides; Antisense DNA or RNA; Triplex- forming oligonucleotides; Catalytic nucleic acids, e.g. ribozymes; Nucleic acids used in co-suppression or gene silencing against viruses against retroviridae, e.g. HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61P—SPECIFIC THERAPEUTIC ACTIVITY OF CHEMICAL COMPOUNDS OR MEDICINAL PREPARATIONS
- A61P31/00—Antiinfectives, i.e. antibiotics, antiseptics, chemotherapeutics
- A61P31/12—Antivirals
- A61P31/14—Antivirals for RNA viruses
- A61P31/18—Antivirals for RNA viruses for HIV
-
- A—HUMAN NECESSITIES
- A61—MEDICAL OR VETERINARY SCIENCE; HYGIENE
- A61K—PREPARATIONS FOR MEDICAL, DENTAL OR TOILETRY PURPOSES
- A61K38/00—Medicinal preparations containing peptides
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/11—Antisense
- C12N2310/111—Antisense spanning the whole gene, or a large part of it
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/10—Type of nucleic acid
- C12N2310/14—Type of nucleic acid interfering nucleic acids [NA]
-
- C—CHEMISTRY; METALLURGY
- C12—BIOCHEMISTRY; BEER; SPIRITS; WINE; VINEGAR; MICROBIOLOGY; ENZYMOLOGY; MUTATION OR GENETIC ENGINEERING
- C12N—MICROORGANISMS OR ENZYMES; COMPOSITIONS THEREOF; PROPAGATING, PRESERVING, OR MAINTAINING MICROORGANISMS; MUTATION OR GENETIC ENGINEERING; CULTURE MEDIA
- C12N2310/00—Structure or type of the nucleic acid
- C12N2310/50—Physical structure
- C12N2310/53—Physical structure partially self-complementary or closed
-
- Y—GENERAL TAGGING OF NEW TECHNOLOGICAL DEVELOPMENTS; GENERAL TAGGING OF CROSS-SECTIONAL TECHNOLOGIES SPANNING OVER SEVERAL SECTIONS OF THE IPC; TECHNICAL SUBJECTS COVERED BY FORMER USPC CROSS-REFERENCE ART COLLECTIONS [XRACs] AND DIGESTS
- Y02—TECHNOLOGIES OR APPLICATIONS FOR MITIGATION OR ADAPTATION AGAINST CLIMATE CHANGE
- Y02A—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE
- Y02A50/00—TECHNOLOGIES FOR ADAPTATION TO CLIMATE CHANGE in human health protection, e.g. against extreme weather
- Y02A50/30—Against vector-borne diseases, e.g. mosquito-borne, fly-borne, tick-borne or waterborne diseases whose impact is exacerbated by climate change
Landscapes
- Health & Medical Sciences (AREA)
- Life Sciences & Earth Sciences (AREA)
- Engineering & Computer Science (AREA)
- Genetics & Genomics (AREA)
- Biomedical Technology (AREA)
- Virology (AREA)
- Molecular Biology (AREA)
- Organic Chemistry (AREA)
- Chemical & Material Sciences (AREA)
- Biotechnology (AREA)
- Bioinformatics & Cheminformatics (AREA)
- Wood Science & Technology (AREA)
- General Engineering & Computer Science (AREA)
- Zoology (AREA)
- General Health & Medical Sciences (AREA)
- AIDS & HIV (AREA)
- Microbiology (AREA)
- Plant Pathology (AREA)
- Biophysics (AREA)
- Physics & Mathematics (AREA)
- Biochemistry (AREA)
- Chemical Kinetics & Catalysis (AREA)
- Communicable Diseases (AREA)
- Public Health (AREA)
- Animal Behavior & Ethology (AREA)
- Pharmacology & Pharmacy (AREA)
- Nuclear Medicine, Radiotherapy & Molecular Imaging (AREA)
- Medicinal Chemistry (AREA)
- General Chemical & Material Sciences (AREA)
- Oncology (AREA)
- Veterinary Medicine (AREA)
- Tropical Medicine & Parasitology (AREA)
- Medicines That Contain Protein Lipid Enzymes And Other Medicines (AREA)
- Pharmaceuticals Containing Other Organic And Inorganic Compounds (AREA)
- Medicinal Preparation (AREA)
- Medicines Containing Material From Animals Or Micro-Organisms (AREA)
- Measuring Or Testing Involving Enzymes Or Micro-Organisms (AREA)
- Micro-Organisms Or Cultivation Processes Thereof (AREA)
Abstract
The invention provides a set of nucleotides against HIV infection and their application for treatment and prevention of AIDS. The sequences of the nucleotides were shown in the sequences table. The invention was superior to the similar technology as following: High conserved RNA sequences were obtained by compare all the published HIV genome sequences. Double strand RNA sequences derived from the sequences can effectively inhibit the expression of target HIV gene. HIV gene expression can also be inhibited by double strand hairpin-like RNA transcribed in the cells harboring recombinant plasmid which contain the DNA sequences encoding the RNA sequences. Further, HIV gene expression can be knocked down by in cell transcribed double strand RNA corresponding to the RNA sequences encoded by recombinant adenovirus associated virus.
Description
A Set of Oligo-Nucleotides Against HIV Infection and Its Application in the Prevention and Treatment of Acquired Immune Deficiency Syndrome Technical Field The invention is regarded to a set of oligo -nucleotides against HIV
infection and its application in the prevention and treatment of Acquired Ininune Deficiency Syndrome (AIDS).
Technology background Recent findings proved that short double strand RNA function as interference RNA in a variety of mammalian cells, and gene expression can be specifically knocked down. Viral gene (including HIV) expression can be knocked down by this pathway. Due to the high frequency of mutation in HIV
genome, most of the interfere RNA can knock down the gene expression of specific isolates and can not be used as a universal approach in gene therapy of AIDS.
Invention disclosure The purpose of the invention is to provide a set of nucleotides for the prevention of HIV infection and treatment of AIDS.
The other purpose is to provide the application of the oligo-nucleotides mentioned above.
For the purposes, following approaches were employed.
AsetofRNAsequencesshownthereafter, or any fragments fromthe sequences, which demonstrate anti -HIV infection activity and be employed in prevention and treatment of AIDS. The nucleotides include single strand RNA, any fragment derived from the sequences, or double strand RNA derived by annealing of the sequences with its complements sequences.
(1) aucaaugaggaagcugcagaaugg;
infection and its application in the prevention and treatment of Acquired Ininune Deficiency Syndrome (AIDS).
Technology background Recent findings proved that short double strand RNA function as interference RNA in a variety of mammalian cells, and gene expression can be specifically knocked down. Viral gene (including HIV) expression can be knocked down by this pathway. Due to the high frequency of mutation in HIV
genome, most of the interfere RNA can knock down the gene expression of specific isolates and can not be used as a universal approach in gene therapy of AIDS.
Invention disclosure The purpose of the invention is to provide a set of nucleotides for the prevention of HIV infection and treatment of AIDS.
The other purpose is to provide the application of the oligo-nucleotides mentioned above.
For the purposes, following approaches were employed.
AsetofRNAsequencesshownthereafter, or any fragments fromthe sequences, which demonstrate anti -HIV infection activity and be employed in prevention and treatment of AIDS. The nucleotides include single strand RNA, any fragment derived from the sequences, or double strand RNA derived by annealing of the sequences with its complements sequences.
(1) aucaaugaggaagcugcagaaugg;
(2) gggaagugacauagcaggaacuacuag;
(3) uaaauaaaauaguaagaauguauagcccu;
(4) uaugggguaccugugugga;
(5) gccaauucccauacauuauugugc;
(6) uuaaauggcagucuagcagaa ;
(7) accacacacaaggcuacuucccugau;
(8) acagccgccuagcauuucaucac;
(9) ggauggugcuucaagcuaguaccaguu.
In the invention, conserved oligo-nucleotides sequences among all the HIV
genome published were obtained by homology alignment. HIV gene expression could be knocked down and HIV genome can be degraded when the RNA was introduced into mammalian cells. Pharmaceuticals derived from the conserved sequences can significantly decrease the drug resistant problems resulted from genomic mutagenesis.
A set of RNA sequences, which may be modified by other nucleotide at the 5' or 3' terminal. Usually UU were added at the 3' end of the RNA
fragment to assure the match between RNA with targeted mRNA.
A set of hairpin RNA sequences for the control of HIV infection and for the prevention and treatment of AIDS, the hairpin sequences were derived by the hybridization of the sequences (SEQ ID No. 1 ¨SEQ ID No. 9) or the relevant segments at 5' terminal with their complement sequences, in which RNA
sequences and the complement sequences were linked by a non complement sequence.
Hairpin-like RNA retains activity of RNA interference, and is particular employed to express interfere RNA in the cell since it is a RNA molecular.
A set of DNA sequences or their fragments which is against HIV infection and be used in the prevention and treatment of AIDS:
1) The DNA sequences or their fragments, which correspond to the RNA
sequences shown above or their fragments (SEQ ID No. 1¨SEQ ID No. 9 in table 1) ;or correspond to the double strand RNA sequence formed by hybridization of RNAs shown above with its complement sequence, or, 2)The DNA sequences or their fragments, which correspond to the RNA sequences described in 1) or to their fragments which were modified at their 5' or 3' by adding nucleotides; or 3) A single strand or double strand DNA sequence, which correspond to the hairpin like RNA sequence as described above.
A set of expression vectors including both DNA vectors and RNA vectors against HIV infection and used for the prevention or treatment of AIDS, in which RNA or DNA sequences described above were contained. Interfere RNA can be expressed when the vectors containing the DNA and RNA sequences mentioned above were introduced into cells under the control of regulatory elements. The vectors include RNA vectors and DNA vectors.
RNA vectors include but is not limited to retroviral vector, DNA vectors carrying DNA sequences indicated and control elements include Plasmid and viral vectors such as adenovirus associated virus (AAV).
A set of liposomes against HIV infection and for the prevention and treatment of AIDS, in which RNA, DNA sequences as well as the expression vectors indicated above against HIV infection and for AIDS treatment and prevention were coated. Interfere RNA or vectors expressing interfere RNA was introduced into cell by the liposome indicated above.
The approach to fight against HIV infection and for AIDS prevention and treatment, by which the above indicated RNAs, DNAs, expression vectors or liposomes were introduced into eukaryotic cell lines, animals or human beings. E. g. Approaches employing liposome and viral vectors.
The application of the nucleotides in the prevention of HIV infection and AIDS treatment. Pharmaceuticals for diagnosis, prevention and treatment of HIV infection and AIDS were derived from the above mentioned RNAs, DNAs, Expression vectors, liposomes or approaches.
Descriptions of the appendix figures Fig. 1. Construction of report plasmid pEGFP-gp120.
Fig.2 EGFP-gp120 expression was knocked down by double strand interfere RNA.
Fig.3 EGFP-gp120 expression was knocked down by double strand interfere RNA as demonstrated by Western¨Blot.
Fig. 4 The construction of p-H1-gp120i from which the hairpin RNA could be expressed in the cells.
Fig. 5 Construction of plasmid pAAV-120i.
Fig. 6 GFP-GP120 expression was knocked down by hairpin-like double strand RNA expressed by recombinant MV.
Best approaches to realize the invention All the protocols are generally based on the protocols described in Molecular Cloning, 3rd edition.
Example 1: Most conserved HIV RNA Sequcence:
HIV genome sequences published were selected and separated into 7Ont fragments based on functional genes of HIV. Homology of every fragment with more than 140, 000 sequceces in Genebank (National Center of Biological Information, USA), BEL (Nucleotide Sequence Database in Europe Molecular Biology Laboratory) , DDBJ (Japan nucleotide database) and GDB (gene database) was analyzed by BlastN 2. 2. 4/2. 2. 5. The conserved RNA sequences were selected by the following criteria: (1) The sequence is equal or longer than 19nt; (2) The sequence was 10096 homology with at least 1000 HIV sequences in the database;
(3) If 100% homology fragments can not be found , The sequences containing 1 mismatched nucleotide were included. The results of the analysis were shown in table 1 and table 2.
Table 1. Most conserved HIV RNA sequences found by homology analysis No HIV gene RNA sequence 1 gag-pol Aucaaugaggaagcugcagaaugg 2 gag-pol Gggaagugacauagcaggaacuacuag 3 gag-pol uaaauaaaauaguaagaauguauagcccu 4 env Uaugggguaccugugugga 5 env Gccaauucccauacauuauugugc . .
, 6 Env Uuaaauggcagucuagcagaa 7 Nef Accacacacaaggcuacuucccugau 8 3 -UTR Acagccgccuagcauuucaucac 9 LTR Ggauggugcuucaagcuaguaccaguu Table 2. Homology analysis of the conserved RNA sequences with sequences in database I
No I HIV gene Fragment HIV 1003 Sequence size sequence homology (s) with (nt) compared sequences Int mismatch 1 Gag-pol 24 1050 1050 0 2 Gag-pol 27 1051 1050 1 3 Gag-pol 29 1050 1048 2 4 env 19 1050 1050 0 env 24 1050 1050 0 6 env 21 1050 1050 0 7 nef 26 1082 1082 0 Example 2. HIV env gene expression was knocked down by chemically synthesized double strand RNA..
Positive and negative (complement strand) RNA strand were synthesized according to the SEQ ID41 with UU modification at 3' of the sequences.
5' uaugggguaccuguguggauu 3' uuauaccccauggacacaccu As showed in figure 1, plasmidpEGFPC1(Clontech, CA) was double digested with EcoRI and BamHI at 37 C for 1 hour. Large fragment was extracted and was used as vector; HIV gp120 gene was obtained by PCR using 2ng HIV cDNA ( Bru strain) as template plus gp120 primers (A:5' cggaattctaaagagcaca.aga cagtggac, B: 5' cggatcctactctaccgtcagcgtcattga 10Ong each) in a buffer containing 2.5u Pfu high fidelity DNA polymerase , dNFP 250 mol/L, 2. 5mmol/L MgC12, 25mmol/L TrisHC1 (pH8. 3). Polymerase chain reaction (PCR) was carried out using Perkin Elmer 9700 thermocyc ler (94 C 30s, 50 C
30s, 72 C 90s, 30cycles) , DNA fragment resulted PCR was double digested by EcoRI
and BamliI (Biolabs) after being purified by Qiagen Gel Extraction Kit and ligated with the vector described above. The ligated mixture was transformed into E. coli JM109 (Promega), and the plasmid pEGFP-gp120 was obtained.
Fusion protein of GFP and HIV gp120 should be expressed by transfection of the plasmid into mammalian cells.
HEK 293 cells (from ATCC) were co-transfected with li_tg plasmid pEGFP-gp120 and li_tg double strand RNA described above using LIPOFECTamine (rf. Manul from Invitrogen) , The cells were assayed by fluorescent microscopy and the cell lysate were analyzed by imuno-blotting with anti-GFP antibody (Clontech) 36h after transfection. A mock double strand RNA (rf. Ds RNA
correspond HIV GAG gene, see EXAPMLE 3) was employed as control.
Results: As shown in figure 2, expression of the fusion protein was knocked down by env specific double strand RNA compared to the control.
The experiment was repeated twice, and was shown as DsRNA1 and DsRNA2 respectively. As shown in figure 3, the expression level of GFP-HIV GP120 fusion protein was knocked down up to 80%.
EXPAMLE 3 HIV gag gene expression was knocked down by synthesized double strand RNA
Based on the conserved gag RNA sequence (Seq ID#2 in table 1), a 21nt oligonucleotides and its complement sequence was synthesized. The sequences , contain 19nt from Seq ID#2 and two U at 3' of each fragment. Double strand RNA was obtained by annealing.
5' gugacauagcaggaacuacuu 3' uucacuguaucguccuugaug Gag gene from HIV (LAY-1, Bru isolate) was amplified and cloned into pEGFP
Cl vector (Clontech, CA) as described in EXAMPLE 2, GFP-HIV gag fusion protein was expected to be expressed by the plasmid when it was transfected into cells.
The plasmid as well as double strand RNA was co-transfected into HEK 293 cells by LIPOFECTamine protocol, GFP-HIV gag protein was demonstrated to be knocked down by the double strand RNA compared to the mock double strand, as shown by the fluorescent microscopy of the cells 36h after transfection.
EXAMPLE 4. Nef gene expression was knocked down by synthesized double strand RNA.
According to the conserved nef sequence (SEQ ID#7 in table 1), a 21nt oligo-nucleotide was synthesized with it complement RNA sequence, in which the 5' 19 nt was derived from SEQ ID#7 and two U was added to the 3' of each oligo-nucleotide. Double strand RNA was obtained by annealing.
5' accacacacaaggcuacuuuu 3' uuugguguguguuccgaugaa Gene encoding nef protein was amplified and cloned into pEGFPC1 as shown in example 2, and the GPP-Nef fusion protein was expected to be expressed by the cells containing the recombinant plasmid.
HEK 293 cells were co-transfected with the plasmid obtained and the double strand RNA synthesized, it has demonstrated that the expression of the GFP-HIV nef fusion protein was knocked down by the nef specific double strand RNA as compared to the mock double strand RNA, as shown by fluorescent microscopy 36hours after transfect ion.
EXAMPLE 5. Expression of other HIV proteins could be knocked down by , synthesized double strand RNA (Tapbe 3) Table 3 Expression of other HIV genes were knocked down by the novo double strand described was cloned into pH1 at its BamHI and HindIII sites, and a new recombinant plasmid, pHl-gp120i, was obtained. Hairpin RNA could be transcribed by RNA polymerase III in the cells harboring pHl-gp120i.
HEK293 cells were co-transfected with 4 g pHl-gp120i plasmid (same amount of pH1 was used as control) and a plasmid expressing EGFP-HIV
GP120.The differential expression of EGFP-HIV GP120 was assayed as described in Expmple 2. The results demonstrated that RNAi encoded by plasmid containing DNA fragment encoding hairpin RNA can effectively inhibit the expression of target HIV gene.
Example 7. Expression of HIV GP120 was knocked down by RNAi transcribed in the cells infected by adenovirus associated virus MO which contain H1 promoter and the relevant DNA fragment encoding hairpin RNA as described in Example 6.
As shown in figure 5, plasmid pAAV-MCS (Stratagene) was digested with NotI and HindIII ; DNA fragment containing H1 promoter and DNA fragment encoding hairpin RNA corresponded to gp120 was obtained by digesting pHl-gp120 with NotI and HindIII. The fragment was ligated to vector by 14 DNA ligase, and plasmid pAAV-gp120i was constructed. HEK 293FT cells were co -transfected with the plasmid(414), helping plasmid pHelper(l g, Stratagene) and plasmid pAAV-RC(2 g Stratagene) by LIPOFECTamine, and empty vector (pAAV-MCS) was used as control. Recombinant AAV and control AAV was harvested 48 hour after transfection.
HEK 293 cells were transfected by pEGFP-GP120(1 g) as described and infected by the recombinant AAV encoding RNAi or empty AAV, fluorescent of GFP expressed was assayed 24h after infection by fluorescent microscope.
As shown in figure 6, GFP-GP120 expression was significantly inhibited by the recombinant AAV which encoded hairpin RNA.
Industrial Applicability The invention was superior to the current technology as shown below:
Highly conserved RNA fragments in all published HIV genome were obtained by homology analysis. Double strand RNA derived from the highly conserved RNA could effectively knock down the expression of HIV gene.
HIV gene expression could also inhibited by dsRNA encoded by plasmid as well as recombinant adenovirus associated virus containing corresponded DNA sequence.
Sequence Listing <110> Beijing SoloBio Genetechnology Company Ltd.
<120> A Set of Oligo-Nucleotides Against HIV Infection and Its Application in the Prevention and Treatment of Acquired Immune Deficiency Syndrome (Group D Divisional) <130> 45116-3004 <140> Division of CA 2,509,827 <141> December 16, 2003 <150> CA 2,509,827 <151> December 16, 2003 <150> PCT/CN2003/001068 <151> December 16, 2003 <150> CN 02156785.9 <151> December 18, 2002 <160> 9 <170> PatentIn version 3.1 <210> 1 <211> 24 <212> RNA
<213> Lentivirus genera <400> 1 aucaaugagg aagcugcaga augg 24 <210> 2 <211> 27 <212> RNA
<213> Lentivirus genera <400> 2 gggaagugac auagcaggaa cuacuag 27 <210> 3 <211> 29 <212> RNA
<213> Lentivirus genera <400> 3 uaaauaaaau aguaagaaug uauagcccu 29 <210> 4 <211> 19 <212> RNA
<213> Lentivirus genera <400> 4 uaugggguac cugugugga 19 <210> 5 <211> 24 <212> RNA
<213> Lentivirus genera <400> 5 gccaauuccc auacauuauu gugc 24 <210> 6 <211> 21 <212> RNA
<213> Lentivirus genera <400> 6 uuaaauggca gucuagcaga a 21 <210> 7 <211> 26 <212> RNA
<213> Lentivirus genera <400> 7 accacacaca aggcuacuuc ccugau 26 <210> 8 <211> 23 <212> RNA
<213> Lentivirus genera <400> 8 acagccgccu agcauuucau cac 23 <210> 9 <211> 27 <212> RNA
<213> Lentivirus genera <400> 9 ggauggugcu ucaagcuagu accaguu 27
In the invention, conserved oligo-nucleotides sequences among all the HIV
genome published were obtained by homology alignment. HIV gene expression could be knocked down and HIV genome can be degraded when the RNA was introduced into mammalian cells. Pharmaceuticals derived from the conserved sequences can significantly decrease the drug resistant problems resulted from genomic mutagenesis.
A set of RNA sequences, which may be modified by other nucleotide at the 5' or 3' terminal. Usually UU were added at the 3' end of the RNA
fragment to assure the match between RNA with targeted mRNA.
A set of hairpin RNA sequences for the control of HIV infection and for the prevention and treatment of AIDS, the hairpin sequences were derived by the hybridization of the sequences (SEQ ID No. 1 ¨SEQ ID No. 9) or the relevant segments at 5' terminal with their complement sequences, in which RNA
sequences and the complement sequences were linked by a non complement sequence.
Hairpin-like RNA retains activity of RNA interference, and is particular employed to express interfere RNA in the cell since it is a RNA molecular.
A set of DNA sequences or their fragments which is against HIV infection and be used in the prevention and treatment of AIDS:
1) The DNA sequences or their fragments, which correspond to the RNA
sequences shown above or their fragments (SEQ ID No. 1¨SEQ ID No. 9 in table 1) ;or correspond to the double strand RNA sequence formed by hybridization of RNAs shown above with its complement sequence, or, 2)The DNA sequences or their fragments, which correspond to the RNA sequences described in 1) or to their fragments which were modified at their 5' or 3' by adding nucleotides; or 3) A single strand or double strand DNA sequence, which correspond to the hairpin like RNA sequence as described above.
A set of expression vectors including both DNA vectors and RNA vectors against HIV infection and used for the prevention or treatment of AIDS, in which RNA or DNA sequences described above were contained. Interfere RNA can be expressed when the vectors containing the DNA and RNA sequences mentioned above were introduced into cells under the control of regulatory elements. The vectors include RNA vectors and DNA vectors.
RNA vectors include but is not limited to retroviral vector, DNA vectors carrying DNA sequences indicated and control elements include Plasmid and viral vectors such as adenovirus associated virus (AAV).
A set of liposomes against HIV infection and for the prevention and treatment of AIDS, in which RNA, DNA sequences as well as the expression vectors indicated above against HIV infection and for AIDS treatment and prevention were coated. Interfere RNA or vectors expressing interfere RNA was introduced into cell by the liposome indicated above.
The approach to fight against HIV infection and for AIDS prevention and treatment, by which the above indicated RNAs, DNAs, expression vectors or liposomes were introduced into eukaryotic cell lines, animals or human beings. E. g. Approaches employing liposome and viral vectors.
The application of the nucleotides in the prevention of HIV infection and AIDS treatment. Pharmaceuticals for diagnosis, prevention and treatment of HIV infection and AIDS were derived from the above mentioned RNAs, DNAs, Expression vectors, liposomes or approaches.
Descriptions of the appendix figures Fig. 1. Construction of report plasmid pEGFP-gp120.
Fig.2 EGFP-gp120 expression was knocked down by double strand interfere RNA.
Fig.3 EGFP-gp120 expression was knocked down by double strand interfere RNA as demonstrated by Western¨Blot.
Fig. 4 The construction of p-H1-gp120i from which the hairpin RNA could be expressed in the cells.
Fig. 5 Construction of plasmid pAAV-120i.
Fig. 6 GFP-GP120 expression was knocked down by hairpin-like double strand RNA expressed by recombinant MV.
Best approaches to realize the invention All the protocols are generally based on the protocols described in Molecular Cloning, 3rd edition.
Example 1: Most conserved HIV RNA Sequcence:
HIV genome sequences published were selected and separated into 7Ont fragments based on functional genes of HIV. Homology of every fragment with more than 140, 000 sequceces in Genebank (National Center of Biological Information, USA), BEL (Nucleotide Sequence Database in Europe Molecular Biology Laboratory) , DDBJ (Japan nucleotide database) and GDB (gene database) was analyzed by BlastN 2. 2. 4/2. 2. 5. The conserved RNA sequences were selected by the following criteria: (1) The sequence is equal or longer than 19nt; (2) The sequence was 10096 homology with at least 1000 HIV sequences in the database;
(3) If 100% homology fragments can not be found , The sequences containing 1 mismatched nucleotide were included. The results of the analysis were shown in table 1 and table 2.
Table 1. Most conserved HIV RNA sequences found by homology analysis No HIV gene RNA sequence 1 gag-pol Aucaaugaggaagcugcagaaugg 2 gag-pol Gggaagugacauagcaggaacuacuag 3 gag-pol uaaauaaaauaguaagaauguauagcccu 4 env Uaugggguaccugugugga 5 env Gccaauucccauacauuauugugc . .
, 6 Env Uuaaauggcagucuagcagaa 7 Nef Accacacacaaggcuacuucccugau 8 3 -UTR Acagccgccuagcauuucaucac 9 LTR Ggauggugcuucaagcuaguaccaguu Table 2. Homology analysis of the conserved RNA sequences with sequences in database I
No I HIV gene Fragment HIV 1003 Sequence size sequence homology (s) with (nt) compared sequences Int mismatch 1 Gag-pol 24 1050 1050 0 2 Gag-pol 27 1051 1050 1 3 Gag-pol 29 1050 1048 2 4 env 19 1050 1050 0 env 24 1050 1050 0 6 env 21 1050 1050 0 7 nef 26 1082 1082 0 Example 2. HIV env gene expression was knocked down by chemically synthesized double strand RNA..
Positive and negative (complement strand) RNA strand were synthesized according to the SEQ ID41 with UU modification at 3' of the sequences.
5' uaugggguaccuguguggauu 3' uuauaccccauggacacaccu As showed in figure 1, plasmidpEGFPC1(Clontech, CA) was double digested with EcoRI and BamHI at 37 C for 1 hour. Large fragment was extracted and was used as vector; HIV gp120 gene was obtained by PCR using 2ng HIV cDNA ( Bru strain) as template plus gp120 primers (A:5' cggaattctaaagagcaca.aga cagtggac, B: 5' cggatcctactctaccgtcagcgtcattga 10Ong each) in a buffer containing 2.5u Pfu high fidelity DNA polymerase , dNFP 250 mol/L, 2. 5mmol/L MgC12, 25mmol/L TrisHC1 (pH8. 3). Polymerase chain reaction (PCR) was carried out using Perkin Elmer 9700 thermocyc ler (94 C 30s, 50 C
30s, 72 C 90s, 30cycles) , DNA fragment resulted PCR was double digested by EcoRI
and BamliI (Biolabs) after being purified by Qiagen Gel Extraction Kit and ligated with the vector described above. The ligated mixture was transformed into E. coli JM109 (Promega), and the plasmid pEGFP-gp120 was obtained.
Fusion protein of GFP and HIV gp120 should be expressed by transfection of the plasmid into mammalian cells.
HEK 293 cells (from ATCC) were co-transfected with li_tg plasmid pEGFP-gp120 and li_tg double strand RNA described above using LIPOFECTamine (rf. Manul from Invitrogen) , The cells were assayed by fluorescent microscopy and the cell lysate were analyzed by imuno-blotting with anti-GFP antibody (Clontech) 36h after transfection. A mock double strand RNA (rf. Ds RNA
correspond HIV GAG gene, see EXAPMLE 3) was employed as control.
Results: As shown in figure 2, expression of the fusion protein was knocked down by env specific double strand RNA compared to the control.
The experiment was repeated twice, and was shown as DsRNA1 and DsRNA2 respectively. As shown in figure 3, the expression level of GFP-HIV GP120 fusion protein was knocked down up to 80%.
EXPAMLE 3 HIV gag gene expression was knocked down by synthesized double strand RNA
Based on the conserved gag RNA sequence (Seq ID#2 in table 1), a 21nt oligonucleotides and its complement sequence was synthesized. The sequences , contain 19nt from Seq ID#2 and two U at 3' of each fragment. Double strand RNA was obtained by annealing.
5' gugacauagcaggaacuacuu 3' uucacuguaucguccuugaug Gag gene from HIV (LAY-1, Bru isolate) was amplified and cloned into pEGFP
Cl vector (Clontech, CA) as described in EXAMPLE 2, GFP-HIV gag fusion protein was expected to be expressed by the plasmid when it was transfected into cells.
The plasmid as well as double strand RNA was co-transfected into HEK 293 cells by LIPOFECTamine protocol, GFP-HIV gag protein was demonstrated to be knocked down by the double strand RNA compared to the mock double strand, as shown by the fluorescent microscopy of the cells 36h after transfection.
EXAMPLE 4. Nef gene expression was knocked down by synthesized double strand RNA.
According to the conserved nef sequence (SEQ ID#7 in table 1), a 21nt oligo-nucleotide was synthesized with it complement RNA sequence, in which the 5' 19 nt was derived from SEQ ID#7 and two U was added to the 3' of each oligo-nucleotide. Double strand RNA was obtained by annealing.
5' accacacacaaggcuacuuuu 3' uuugguguguguuccgaugaa Gene encoding nef protein was amplified and cloned into pEGFPC1 as shown in example 2, and the GPP-Nef fusion protein was expected to be expressed by the cells containing the recombinant plasmid.
HEK 293 cells were co-transfected with the plasmid obtained and the double strand RNA synthesized, it has demonstrated that the expression of the GFP-HIV nef fusion protein was knocked down by the nef specific double strand RNA as compared to the mock double strand RNA, as shown by fluorescent microscopy 36hours after transfect ion.
EXAMPLE 5. Expression of other HIV proteins could be knocked down by , synthesized double strand RNA (Tapbe 3) Table 3 Expression of other HIV genes were knocked down by the novo double strand described was cloned into pH1 at its BamHI and HindIII sites, and a new recombinant plasmid, pHl-gp120i, was obtained. Hairpin RNA could be transcribed by RNA polymerase III in the cells harboring pHl-gp120i.
HEK293 cells were co-transfected with 4 g pHl-gp120i plasmid (same amount of pH1 was used as control) and a plasmid expressing EGFP-HIV
GP120.The differential expression of EGFP-HIV GP120 was assayed as described in Expmple 2. The results demonstrated that RNAi encoded by plasmid containing DNA fragment encoding hairpin RNA can effectively inhibit the expression of target HIV gene.
Example 7. Expression of HIV GP120 was knocked down by RNAi transcribed in the cells infected by adenovirus associated virus MO which contain H1 promoter and the relevant DNA fragment encoding hairpin RNA as described in Example 6.
As shown in figure 5, plasmid pAAV-MCS (Stratagene) was digested with NotI and HindIII ; DNA fragment containing H1 promoter and DNA fragment encoding hairpin RNA corresponded to gp120 was obtained by digesting pHl-gp120 with NotI and HindIII. The fragment was ligated to vector by 14 DNA ligase, and plasmid pAAV-gp120i was constructed. HEK 293FT cells were co -transfected with the plasmid(414), helping plasmid pHelper(l g, Stratagene) and plasmid pAAV-RC(2 g Stratagene) by LIPOFECTamine, and empty vector (pAAV-MCS) was used as control. Recombinant AAV and control AAV was harvested 48 hour after transfection.
HEK 293 cells were transfected by pEGFP-GP120(1 g) as described and infected by the recombinant AAV encoding RNAi or empty AAV, fluorescent of GFP expressed was assayed 24h after infection by fluorescent microscope.
As shown in figure 6, GFP-GP120 expression was significantly inhibited by the recombinant AAV which encoded hairpin RNA.
Industrial Applicability The invention was superior to the current technology as shown below:
Highly conserved RNA fragments in all published HIV genome were obtained by homology analysis. Double strand RNA derived from the highly conserved RNA could effectively knock down the expression of HIV gene.
HIV gene expression could also inhibited by dsRNA encoded by plasmid as well as recombinant adenovirus associated virus containing corresponded DNA sequence.
Sequence Listing <110> Beijing SoloBio Genetechnology Company Ltd.
<120> A Set of Oligo-Nucleotides Against HIV Infection and Its Application in the Prevention and Treatment of Acquired Immune Deficiency Syndrome (Group D Divisional) <130> 45116-3004 <140> Division of CA 2,509,827 <141> December 16, 2003 <150> CA 2,509,827 <151> December 16, 2003 <150> PCT/CN2003/001068 <151> December 16, 2003 <150> CN 02156785.9 <151> December 18, 2002 <160> 9 <170> PatentIn version 3.1 <210> 1 <211> 24 <212> RNA
<213> Lentivirus genera <400> 1 aucaaugagg aagcugcaga augg 24 <210> 2 <211> 27 <212> RNA
<213> Lentivirus genera <400> 2 gggaagugac auagcaggaa cuacuag 27 <210> 3 <211> 29 <212> RNA
<213> Lentivirus genera <400> 3 uaaauaaaau aguaagaaug uauagcccu 29 <210> 4 <211> 19 <212> RNA
<213> Lentivirus genera <400> 4 uaugggguac cugugugga 19 <210> 5 <211> 24 <212> RNA
<213> Lentivirus genera <400> 5 gccaauuccc auacauuauu gugc 24 <210> 6 <211> 21 <212> RNA
<213> Lentivirus genera <400> 6 uuaaauggca gucuagcaga a 21 <210> 7 <211> 26 <212> RNA
<213> Lentivirus genera <400> 7 accacacaca aggcuacuuc ccugau 26 <210> 8 <211> 23 <212> RNA
<213> Lentivirus genera <400> 8 acagccgccu agcauuucau cac 23 <210> 9 <211> 27 <212> RNA
<213> Lentivirus genera <400> 9 ggauggugcu ucaagcuagu accaguu 27
Claims
1. An RNA comprising anti-HIV infection activity, wherein said RNA is selected from the group consisting of:
a double stranded RNA composed of SEQ ID NO: 8 and the complementary sequence thereof; and a double stranded RNA composed of a fragment of SEQ ID NO: 8 selected from the group consisting of a 19 nt fragment of SEQ ID NO:8, a 20 nt fragment of SEQ ID NO:8, a 21 nt fragment of SEQ ID NO:8, a 22 nt fragment of SEQ ID NO:8, a 23 nt fragment of SEQ ID NO:8, a 24 nt fragment of SEQ ID NO:8,and a 25 nt fragment of SEQ ID NO:8, and the complementary sequence thereof.
2. The RNA comprising anti-HIV infection activity of claim 1, wherein said RNA
is modified at its 5' end or 3' end by adding two uracil nucleotides.
3. The RNA comprising anti-HIV infection activity of claim 1, wherein said RNA
is a Hairpin RNA consisting of a stem part and a loop part, wherein said stem part is the double stranded RNA as claimed in claim 1, which is composed of SEQ ID NO: 8 and the complementary sequence thereof; or a fragment of SEQ
ID NO: 8 selected from the group consisting of a 19 nt fragment of SEQ ID NO:8, a 20 nt fragment of SEQ ID NO:8, a 21 nt fragment of SEQ ID NO:8, a 22 nt fragment of SEQ ID NO:8, a 23 nt fragment of SEQ ID NO:8, a 24 nt fragment of SEQ ID NO:8,and a 25 nt fragment of SEQ ID NO:8, and the complementary sequence thereof , and wherein said loop is a non-complementary spacer.
4. A double-stranded DNA encoding the Hairpin RNA of claim 3.5. An expression vector, wherein said vector contains the DNA of claim 4.
6. A liposome, wherein said liposome encapsulates any one of the RNA of claims 1-3, the DNA of claim 4 and the vector of Claim 5.
a double stranded RNA composed of SEQ ID NO: 8 and the complementary sequence thereof; and a double stranded RNA composed of a fragment of SEQ ID NO: 8 selected from the group consisting of a 19 nt fragment of SEQ ID NO:8, a 20 nt fragment of SEQ ID NO:8, a 21 nt fragment of SEQ ID NO:8, a 22 nt fragment of SEQ ID NO:8, a 23 nt fragment of SEQ ID NO:8, a 24 nt fragment of SEQ ID NO:8,and a 25 nt fragment of SEQ ID NO:8, and the complementary sequence thereof.
2. The RNA comprising anti-HIV infection activity of claim 1, wherein said RNA
is modified at its 5' end or 3' end by adding two uracil nucleotides.
3. The RNA comprising anti-HIV infection activity of claim 1, wherein said RNA
is a Hairpin RNA consisting of a stem part and a loop part, wherein said stem part is the double stranded RNA as claimed in claim 1, which is composed of SEQ ID NO: 8 and the complementary sequence thereof; or a fragment of SEQ
ID NO: 8 selected from the group consisting of a 19 nt fragment of SEQ ID NO:8, a 20 nt fragment of SEQ ID NO:8, a 21 nt fragment of SEQ ID NO:8, a 22 nt fragment of SEQ ID NO:8, a 23 nt fragment of SEQ ID NO:8, a 24 nt fragment of SEQ ID NO:8,and a 25 nt fragment of SEQ ID NO:8, and the complementary sequence thereof , and wherein said loop is a non-complementary spacer.
4. A double-stranded DNA encoding the Hairpin RNA of claim 3.5. An expression vector, wherein said vector contains the DNA of claim 4.
6. A liposome, wherein said liposome encapsulates any one of the RNA of claims 1-3, the DNA of claim 4 and the vector of Claim 5.
Applications Claiming Priority (3)
| Application Number | Priority Date | Filing Date | Title |
|---|---|---|---|
| CN02156785.9 | 2002-12-18 | ||
| CNB021567859A CN1301263C (en) | 2002-12-18 | 2002-12-18 | Nucleotide sequence for anti HIV infection and preventing AIDS and use thereof |
| CA2509827A CA2509827C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
Related Parent Applications (1)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA2509827A Division CA2509827C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
Publications (2)
| Publication Number | Publication Date |
|---|---|
| CA2808592A1 CA2808592A1 (en) | 2004-07-01 |
| CA2808592C true CA2808592C (en) | 2015-04-28 |
Family
ID=32514455
Family Applications (5)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2808592 Expired - Lifetime CA2808592C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA 2808318 Expired - Lifetime CA2808318C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA 2808584 Expired - Lifetime CA2808584C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA2509827A Expired - Lifetime CA2509827C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA2808190A Expired - Lifetime CA2808190C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
Family Applications After (4)
| Application Number | Title | Priority Date | Filing Date |
|---|---|---|---|
| CA 2808318 Expired - Lifetime CA2808318C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA 2808584 Expired - Lifetime CA2808584C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA2509827A Expired - Lifetime CA2509827C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
| CA2808190A Expired - Lifetime CA2808190C (en) | 2002-12-18 | 2003-12-16 | A set of oligo-nucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
Country Status (11)
| Country | Link |
|---|---|
| US (5) | US7906641B2 (en) |
| EP (5) | EP1584623B1 (en) |
| JP (4) | JP2006516122A (en) |
| CN (1) | CN1301263C (en) |
| AP (1) | AP2388A (en) |
| AU (1) | AU2003292852A1 (en) |
| CA (5) | CA2808592C (en) |
| EA (1) | EA009290B1 (en) |
| ES (5) | ES2395334T3 (en) |
| OA (1) | OA13148A (en) |
| WO (1) | WO2004055035A1 (en) |
Families Citing this family (7)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| CN100395334C (en) * | 2004-08-24 | 2008-06-18 | 暨南大学 | siRNA duplexes inhibiting bcl-2 gene expression |
| CN1948475B (en) * | 2004-10-13 | 2010-12-08 | 厦门大学 | Recombinant expression vector, modified hematopoietic stem cell and method useful for treating AIDS |
| CN103316356B (en) | 2012-03-22 | 2016-08-17 | 北京三诺佳邑生物技术有限责任公司 | A kind of recombined lentivirus vector preparation |
| US20170298357A1 (en) * | 2014-08-28 | 2017-10-19 | Chantelle Lisa Evelyn AHLENSTIEL | Treatment of HIV |
| GB202002052D0 (en) | 2020-02-14 | 2020-04-01 | Mexichem Fluor Sa De Cv | Compositions |
| CN114081950B (en) * | 2020-08-24 | 2023-07-28 | 深圳市诺瑞博泰生物科技有限公司 | Application of CREM/ICER gene or transcript thereof as target spot in preparation of anti-HIV (human immunodeficiency virus) medicine |
| JP7716263B2 (en) | 2021-07-30 | 2025-07-31 | 株式会社ブリヂストン | tire |
Family Cites Families (20)
| Publication number | Priority date | Publication date | Assignee | Title |
|---|---|---|---|---|
| US595768A (en) * | 1897-12-21 | And clarence ran | ||
| ATE423856T1 (en) * | 1989-06-02 | 2009-03-15 | Pasteur Institut | NUCLEOTIDE SEQUENCES OF HIV-1, HIV-2 AND SIV RETROVIRUS GENOMES, THEIR USE FOR AMPLIFYING POL SEQUENCES OF THESE RETROVIRUSES AND FOR IN VITRO DIAGNOSTIC INFECTIONS CAUSED BY THESE VIRUSES |
| US6174666B1 (en) * | 1992-03-27 | 2001-01-16 | The United States Of America As Represented By The Department Of Health And Human Services | Method of eliminating inhibitory/instability regions from mRNA |
| WO1993023574A1 (en) * | 1992-05-14 | 1993-11-25 | Kozal Michael J | Polymerase chain reaction assays for monitoring antiviral therapy |
| US5693535A (en) * | 1992-05-14 | 1997-12-02 | Ribozyme Pharmaceuticals, Inc. | HIV targeted ribozymes |
| WO1995004818A1 (en) * | 1993-08-06 | 1995-02-16 | Ribozyme Pharmaceuticals, Inc. | Method and reagent for inhibiting human immunodeficiency virus replication |
| EP0865282A4 (en) * | 1995-08-25 | 2002-01-16 | Univ California | CHEMICAL ANTIVIRAL AGENTS INCORPORATING REV BINDING NUCLEIC ACIDS |
| US6071743A (en) * | 1997-06-02 | 2000-06-06 | Subsidiary No. 3, Inc. | Compositions and methods for inhibiting human immunodeficiency virus infection by down-regulating human cellular genes |
| AU8160298A (en) * | 1997-06-23 | 1999-01-04 | Emory University | Human immunodeficiency viruses causing aids in a nonhuman primate |
| CA2300352A1 (en) | 1997-08-19 | 1999-02-25 | Hybridon, Inc. | Novel hiv-specific synthetic oligonucleotides and methods of their use |
| US6168784B1 (en) * | 1997-09-03 | 2001-01-02 | Gryphon Sciences | N-terminal modifications of RANTES and methods of use |
| US6506559B1 (en) * | 1997-12-23 | 2003-01-14 | Carnegie Institute Of Washington | Genetic inhibition by double-stranded RNA |
| JP3351773B2 (en) * | 1999-06-15 | 2002-12-03 | 学校法人慶應義塾 | HIV-1 subtype determination method |
| US7098030B2 (en) * | 1999-12-31 | 2006-08-29 | Mirus Bio Corporation | Polyampholytes for delivering polyions to a cell |
| US6506596B2 (en) * | 2000-06-01 | 2003-01-14 | Anna-Lena Spetz-Holmgren | Method of DNA transfer |
| US20040259247A1 (en) * | 2000-12-01 | 2004-12-23 | Thomas Tuschl | Rna interference mediating small rna molecules |
| US20040006035A1 (en) * | 2001-05-29 | 2004-01-08 | Dennis Macejak | Nucleic acid mediated disruption of HIV fusogenic peptide interactions |
| US20030175950A1 (en) * | 2001-05-29 | 2003-09-18 | Mcswiggen James A. | RNA interference mediated inhibition of HIV gene expression using short interfering RNA |
| AU2002361797A1 (en) * | 2001-12-19 | 2003-07-09 | The Regents Of The University Of California | Cell lines with latent immunodeficiency virus and methods of use thereof |
| US20030203868A1 (en) * | 2002-02-06 | 2003-10-30 | Bushman Frederic D. | Inhibition of pathogen replication by RNA interference |
-
2002
- 2002-12-18 CN CNB021567859A patent/CN1301263C/en not_active Expired - Lifetime
-
2003
- 2003-12-16 EA EA200500873A patent/EA009290B1/en unknown
- 2003-12-16 US US10/539,446 patent/US7906641B2/en active Active
- 2003-12-16 EP EP03782054A patent/EP1584623B1/en not_active Expired - Lifetime
- 2003-12-16 OA OA1200500190A patent/OA13148A/en unknown
- 2003-12-16 ES ES10158895T patent/ES2395334T3/en not_active Expired - Lifetime
- 2003-12-16 CA CA 2808592 patent/CA2808592C/en not_active Expired - Lifetime
- 2003-12-16 ES ES10158896T patent/ES2394270T3/en not_active Expired - Lifetime
- 2003-12-16 ES ES10158898T patent/ES2396371T3/en not_active Expired - Lifetime
- 2003-12-16 ES ES10158897T patent/ES2394723T3/en not_active Expired - Lifetime
- 2003-12-16 AP AP2005003344A patent/AP2388A/en active
- 2003-12-16 EP EP10158898A patent/EP2266995B1/en not_active Expired - Lifetime
- 2003-12-16 AU AU2003292852A patent/AU2003292852A1/en not_active Abandoned
- 2003-12-16 EP EP10158895A patent/EP2243786B1/en not_active Expired - Lifetime
- 2003-12-16 CA CA 2808318 patent/CA2808318C/en not_active Expired - Lifetime
- 2003-12-16 CA CA 2808584 patent/CA2808584C/en not_active Expired - Lifetime
- 2003-12-16 EP EP10158897A patent/EP2246358B1/en not_active Expired - Lifetime
- 2003-12-16 WO PCT/CN2003/001068 patent/WO2004055035A1/en not_active Ceased
- 2003-12-16 CA CA2509827A patent/CA2509827C/en not_active Expired - Lifetime
- 2003-12-16 CA CA2808190A patent/CA2808190C/en not_active Expired - Lifetime
- 2003-12-16 JP JP2004559574A patent/JP2006516122A/en active Pending
- 2003-12-16 EP EP10158896A patent/EP2246357B1/en not_active Expired - Lifetime
- 2003-12-16 ES ES03782054T patent/ES2393870T3/en not_active Expired - Lifetime
-
2010
- 2010-08-27 JP JP2010191119A patent/JP2011015692A/en active Pending
- 2010-08-27 JP JP2010191120A patent/JP2011016822A/en active Pending
- 2010-08-27 JP JP2010191118A patent/JP2011036250A/en active Pending
-
2011
- 2011-01-10 US US12/987,776 patent/US8383804B2/en not_active Expired - Fee Related
- 2011-01-10 US US12/987,494 patent/US8779113B2/en not_active Expired - Lifetime
- 2011-01-10 US US12/987,711 patent/US8263761B2/en not_active Expired - Fee Related
- 2011-01-10 US US12/987,597 patent/US8283462B2/en not_active Expired - Fee Related
Also Published As
Similar Documents
| Publication | Publication Date | Title |
|---|---|---|
| JP4330797B2 (en) | Ribozyme capable of inhibiting expression of CCR5 receptor | |
| US8779113B2 (en) | Group of nucleic acid fragments for prevention of HIV infection or AIDS and the usage thereof | |
| HK1150055B (en) | Oligonucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome | |
| HK1151029B (en) | Oligonucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome | |
| HK1151294B (en) | Oligonucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome | |
| HK1150449B (en) | Oligonucleotides against hiv infection and its application in the prevention and treatment of acquired immune deficiency syndrome |
Legal Events
| Date | Code | Title | Description |
|---|---|---|---|
| EEER | Examination request |
Effective date: 20130304 |
|
| MKEX | Expiry |
Effective date: 20231218 |