CA2718868C - Polynucleotides and chimaera polypeptides for releasing a polypeptide of interest combined with exosomes and use thereof for the production of immunogenic compositions - Google Patents

Abstract

The invention relates to a chimaera polypeptide that comprises a plurality of polypeptide domains and that can be released in association with membrane vesicles and in particular exosomes. The invention also relates to a polypeptide comprising one of said domains for releasing a peptide or polypeptide of interest in association with membrane vesicles and in particular exosomes. The invention also relates to the use of the polypeptides of the invention and of polynucleotides coding for said polypeptides for producing immunogenic compositions containing exosomes or DNA or for screening proteic interactions. The invention also relates to the implementation of the properties of exosomes including a polypeptide of the invention, and of immunogenic compositions of the invention for preventing and/or treating an infection due to a pathogen agent, a pathogen organism, a tumoral antigen or a cytoplasmic antigen, in particular for eliciting or promoting in vivo in a host, particularly a human or non-human mammal or a bird, a humoral and/or cellular response against a virus, a bacteria, a parasite or a tumour.

Description

Polynucleotides and chimeric polypeptides allowing the secretion of a polypeptide of interest in association with exosomes and their use for the production of immunogenic compositions The invention relates to chimeric polynucleotides and polypeptides allowing the secretion of a polypeptide of interest in association with exosomes, and their use for the production of immunogenic compositions DNA or exosome base or for the screening of protein interactions.
The subject of the present invention is a chimeric polypeptide capable of being secreted in association with exosomes when expressed in cell suitable eukaryotes, said chimeric polypeptide comprising several polypeptide domains.
The subject of the present invention is also a polypeptide constituted by one of these areas, allowing secretion, in association with exosomes, of a peptide or polypeptide of interest with which it is associated.
The invention also relates to a membrane vesicle, in particular an exosome, which comprises a polypeptide of the invention, a composition immunogen based on such exosomes and a method of producing such exosomes.
The subject of the invention is also a polynucleotide encoding a polypeptide of the invention and an immunogenic composition comprising it, in particularly a DNA vaccine comprising it.
The present invention also relates to the implementation of the properties membrane vesicles and immunogenic compositions of the invention for prophylaxis and / or treatment of an agent infection pathogen, a pathogenic organism, a tumor antigen or a cytoplasmic antigen, in particular for eliciting or promoting in vivo, in a host (human or non-human) human), a humoral and / or cellular response against a virus, a bacterium, a parasite or a tumor.
The present invention also aims at the use of vesicles membranes of the invention to produce antibodies directed against the peptide or the polypeptide of interest or as part of a screening method of molecules

2 interacting with the peptide or polypeptide of interest.
Exosomes are in the form of small spheres limited by a lipid bilayer. These membrane vesicles are naturally secreted by different types of cells, especially cells epithelial, tumor cells and certain cells of the immune system, (mast cells, T and B lymphocytes, dendritic cells, especially Langerhans cells).
Exosomes are distinguished from other membrane vesicles secreted by particularly small cells (50 to 100 nm in diameter) and their membrane protein composition (adhesion molecules, transport molecules, of signal transduction and molecules of the major complex histocompatibility among others).
Exosomes could notably correspond to internal vesicles multivesicular endosomes (including late endosomes) secreted by the cell during the fusion of these endosomes with the plasma membrane;
multivesicular endosomes are usually involved in the transport of molecules in the lysosomal compartments (pathway of degradation of proteins) but in some cells such as reticulocytes and some antigen presenting cells, they could be directed to the membrane plasma, with which they would merge to release exosomes in the extracellular environment.
Previous studies have shown that exosomes are capable of to induce humoral and / or cellular immune responses (Delcayre et al., 2002). Exosomes are considered as antigen vectors capable to directly stimulate T cells in vitro antigenically specific. Indeed, exosomes secreted by dendritic cells express major histocompatibility complex (MHC) molecules of class I and II.
The functional peptide / MHC complexes carried by the exosomes would be transferred from one dendritic cell to another that has never seen the antigen whose derive the peptides associated with the MHC molecules. By stimulating from near close to naive dendritic cells, exosomes secreted and presenting their surface an antigenic peptide would contribute to the amplification of the reply Specific CD4 and T CD8 (Delcayre and Le Pecq, 2006). For example, loaded with tumor peptides and injected into mice, these exosomes are capable

3 promote a strong immune response and regress tumors pre-established solids (Zitvogel et al., 1998).
Exosomes are able to present exogenous antigens either in the form of native whole proteins, either in the form of peptides associated with MHC I and II molecules (Colino and Snapper 2006). The presentation antigen on the surface of exosomes is similar to a presentation at the membrane of a cell or enveloped virus. However, exosomes is not neither live nor infectious, they have the advantage of being able to be handled as ordinary product and without containment precautions, unlike a virus.
Exosomes can therefore be used as peptide presenters or antigenic polypeptides for immunization purposes. This technique called exosome display does not necessarily require the direct presentation of the antigen by MHC (Chaput et al., 2004). Nevertheless the development of this unprecedented vaccination technique requires a tool effective molecular mechanism for targeting antigenic proteins to exosomes. However, to date, such a tool has not been described.
The study of retroviruses, and more particularly of the immunodeficiency virus (HIV), has revealed their ability to divert cellular machinery from biogenesis of multivesicular endosomes to bud in the membrane plasma (Pornillos et al., 2002). These viruses can also use this machinery at the level of the endosomal membrane, its normal site of operation. Indeed, in macrophages, HIV buds at the level of the membrane of multivesicular endosomes, which thus accumulate a significant amount of viral particles (Raposo et al., 2002). This discovery, associated with the comparative study of exosomes and HIV particles led at the Trojan horses exosome hypothesis (Trojan Exosomes, Gould et al.
2003). In this case, the viruses would use the pre-existing route of biogenesis of exosomes, for the formation of viral particles.
Moreover, the virus assembly site could have a consequence significantly on the pathogenicity and development of the infection. In the case of HIV, it is currently known that infected macrophages constitute a important infectious reservoir. These cells appear, in fact, less likely at apoptosis normally induced by the presence of viral particles (Herbein and

4 al., 2002); their viral production is less sensitive to antiviral drugs and the viruses seem able to maintain their infectivity for long periods of time periods. The fact that HIV buds and accumulates in endosomes multivesicular of these cells could therefore have important consequences about this type of infection.
Retroviruses are enveloped viruses with an RNA genome and whose replication cycle is very particular since it uses a reverse transcriptase, which transcribes the viral RNA genome into double-stranded DNA, and a viral integrase, allowing the insertion of double-stranded DNA into the genome of the infected cell.
The envelope of retroviruses consists of the envelope protein external (SU), responsible for the receptor binding of the target cell, and the transmembrane glycoprotein (TM), responsible for the fusion between viral and cellular membranes.
The envelope glycoproteins SU and TM result from the cleavage of the mature precursor protein named ENV. The expression of the env gene leads to the synthesis of envelope glycoproteins of retroviruses, in the form of a protein precursor that transits through the Golgi before reaching the membrane (endosomal or plasma), which will serve as a viral envelope during budding virions. During this journey, this oligomeric precursor is glycosylated and cleaved into surface (SU) and transmembrane (TM) glycoproteins.
SU and TM proteins remain associated and are anchored in the membrane cell via a hydrophobic transmembrane helix of the TM protein.
The envelope glycoproteins (SU and TM) play a major role in the retroviral multiplication cycle. Initiation of infection is by fixing and fusion of the viral particle with the cellular plasma membrane. This fixation is generated by the binding of SU to a specific receptor present on the surface of the target cell.
The glycoprotein TM of retroviruses has many facets due to the association of its external, transmembrane and cytoplasmic domains (CDTM), which make it the only retrovirus protein communication on both sides of the membranes of the virus and the infected cell (Cann and al.

1992; Delamarre et al., 1996).
TM protein is involved in the phenomenon of virus penetration in the target cell, causing fusion between the viral membranes and cell. She would also be involved in the transmission of information enter

5 extra and intracellular media. There is a structural dependency but as well between the internal and external domains, which translates into a transfer information between these areas. Thus, the cytoplasmic domain can modulate the fusion activity of the TM protein, an activity yet carried by the region external of the molecule. In other cases, an external signal may be transduced via the CDTM to trigger an activation of the cell. This reveals that the CDTM
interacts more or less directly with proteins from the machinery of signal transduction of the cell.
During its intracellular journey, the TM protein is susceptible to influence the sorting, fate, targeting and budding of particles viral interactions through cytoskeleton and machinery ubiquitination and budding (Cann et al., 1992, Delamarre et al.
al., 1996;
Straub and Levy, 1999) An earlier study suggests that the cytoplasmic domain of the protein TM of two retroviruses, the bovine leukemia virus (BLV, for Bovine Leukemia Virus) and HIV, can induce addressing and secretion a recombinant protein in exosomes (De Gassart et al., 2004). of the cell of the K562 line (a erythroleukemic cell line of human origin), who secrete exosomes constitutively, have been transfected with retroviral vectors which make it possible, in the eukaryotic system, to express two types of chimeric protein: (i) a chimera comprising the extracellular domain of the murine CD8 protein and the transmembrane and cytoplasmic domains of the BLV glycoprotein TM (chimera TM-BLV / CD8), and (ii) a chimera comprising the extracellular and transmembrane domains of murine CD8 protein and the cytoplasmic domain of the HIV TM protein (TM-HIV / CD8 chimera). The two chimeras are expressed in both the transfected K562 cells and in the exosomes secreted by these cells. In particular, the expression of the chimeric protein TM-BLV / CD8 in cells of the K562 line disappears quickly after transit through the trans-Golgian network and the compartments

6 endosomal lesions to end up in the exosomes secreted by these cells. It seems that the chimera with the cytoplasmic domain of the BLV TM is more strongly targeted towards exosomes than the chimera comprising the cytoplasmic domain of the HIV TM protein.
However, as evidenced by the results presented in the section example of the present application, exosomes carrying the chimeric construction TM-BLV / CD8 described by De Gassart et al. are effectively produced only in cells of the K562 line, and are little or no efficiently produced in other cell types such as cells of the HEK293 line.
The invention relates to particular polypeptides that are distinguished particularly those described in the prior art and, in particular, those described in De Gassart et al, in that they make it possible to address in a very more effective peptide or polypeptide of interest to exosomes produced by the cells of the HEK293 line and thus, to amplify very strongly (from 10 to 100 times) the production of exosomes comprising said peptide or polypeptide of interest.
By elsewhere, unlike the constructions described in De Gassart et al, which born can be used effectively only in cells of the K562 line, these polypeptides can be addressed to the membrane of exosomes and secreted into association with membrane vesicles, in particular exosomes produced by different cell types, in particular cells HEK293 or T lymphocytes or B cells, and not just cells the K562 line.
Thus, the present invention makes it possible in particular to produce quantities important membrane vesicles, in particular exosomes, which can be in immunization and especially vaccination. Such membrane vesicles (including exosomes) could also be produced in vivo by a host human or non-human (in particular a human or non-human mammal or bird), which one wishes to immunize, and in particular to vaccinate, in administering this host, an immunogenic composition whose active principle is a polynucleotide coding for a polypeptide of the invention, in particular a composition DNA-based immunogen, and more particularly a DNA vaccine, or a immunogenic composition whose active ingredient consists of vesicles membranes (in particular exosomes) comprising a polypeptide

7 the invention.
A first subject of the present invention is a chimeric polypeptide characterized in that it comprises or consists of the following areas:
- (i) a peptide or polypeptide of interest;
- (ii) a membrane domain having the capacity to anchor in the lipid bilayer of a cell membrane; and (iii) a cytoplasmic domain (CD) of a membrane protein, allowing, in eukaryotic cells, the addressing of said polypeptide chimeric membrane vesicles, especially towards the vesicles forming exosomes, and / or to the cell compartment (s) (s) involved in the formation of membrane vesicles, and in particular vesicles forming the exosomes, or a mutated derivative of this CD domain, this mutated derivative being defined by the substitution, deletion and / or insertion of one or more residue (s) in the sequence of the reference CD domain and this mutated derivative retaining the aforementioned addressability of the CD domain, the CD domain or its mutated derivative comprising at least one YxxL motif, wherein Y represents a residue tyrosine x represents any residue and L represents a leucine residue; and it being understood that when the CD domain and a membrane domain of said chimeric polypeptide are derived from the same protein, so at least the CD domain, its mutated derivative or the membrane domain derived from the same protein that the CD domain is a mutated derivative by substitution and / or deletion a or more residue (s) in the sequence of the original domain.
In particular, said chimeric polypeptide is capable of being secreted into association with membrane vesicles, especially with exosomes, when expressed in appropriate eukaryotic cells.
The invention relates to any chimeric polypeptide in which it exists at minus one membrane domain positioned between the peptide or polypeptide of interest and the CD domain or its mutated derivative.
According to a preferred embodiment, the domains (i) to (iii) are positioned successively in the following order, from the N-terminus towards the C-terminal end in the chimeric polypeptide of the invention: peptide or polypeptide of interest - membrane domain - CD domain or its mutated derivative.
Alternatively, the domains (i) to (iii) are positioned for example in

8 the following order: CD domain or its mutated derivative - membrane domain -peptide or polypeptide of interest.
The term "chimeric" here designates a polypeptide that associates several domains, of at least two different types by their function and / or their cell localization, at least two of these domains from molecules distinct, in particular from different proteins of the same species or different species of the same protein of different species.
By domain of a protein or polypeptide is meant a region having a functional property for said protein or polypeptide.
So, the chimeric polypeptide of the invention comprises at least two different types of domains that are defined by their difference in cell location, when are contained in the chimeric protein: one or more domain (s) membrane (s), and a particular cytoplasmic domain.
The chimeric polypeptide of the invention necessarily comprises less one membrane domain but it can include several; the peptide or polypeptide of interest that may include zero, one or more domains membrane (see below), the chimeric polypeptide of the invention includes one or more membrane domains. When said chimeric polypeptide only one membrane domain, this one may or may not be derived from the same entity, in particular of the same protein as the peptide or polypeptide of interest of the chimeric polypeptide of the invention.
A chimeric polypeptide of the invention may be the expression product of a recombinant polynucleotide and can be expressed recombinantly in a host cell. Said chimeric polypeptide is therefore for example a fusion polypeptide.
The term "membrane vesicle" as used herein means asks for any vesicle composed of a lipid bilayer containing a cytosolic fraction as produced by eukaryotic cells. This expression includes including vesicles secreted into space extracellular, that is, exosomes.
By exosomes is meant, in the present application, nanovesicles cell membranes as defined above. These exosomes can be purified from the cell culture supernatants by centrifugation

9 differential, by ultra-filtration or by adsorption on a support or by other method, as illustrated in the examples.
Expression secreted in association with membrane vesicles, particularly with exosomes means, in this application, that a chimeric polypeptide of the invention and / or at least one of its degradation is secreted into the extracellular space, not in form soluble, but in a form anchored in the membrane of the membrane vesicles, in particular exosomes. This anchoring is done by means of the membrane domain (s) of said chimeric polypeptide or domain membrane of a MHC (class I or II) molecule to which a product of degradation of said chimeric polypeptide is associated. In a polypeptide so anchored in the membrane of a membrane vesicle (especially a exosome), the peptide or polypeptide of interest may be exposed (in whole or in part) outside said membrane vesicle, included (In totality or in part) in the membrane of said membrane vesicle (this is the case when said polypeptide or peptide of interest comprises one or more areas membrane) and / or included (in whole or in part) in the fraction cytosolic of said membrane vesicle.
According to a particular embodiment, the chimeric polypeptide of the invention is produced with and is integrated into the exosomes before they exit from cell.
The secretion of a peptide or polypeptide in association with Membrane vesicles (in particular exosomes) especially require (1) addressing said peptide or polypeptide to the site (s) of formation of membrane vesicles and in particular exosomes, and (2) the budding vesicle from the membrane in which said peptide or polypeptide is anchor.
The term addressing still called sorting, routing or routing intracellular refers in this application to the process that allows a polypeptide, whose synthesis begins in the cytosol, to reach the compartments involved in the budding of membrane vesicles, in particular vesicles forming the exosomes and / or reaching the vesicles membranes, in particular the vesicles forming the exosomes.

Addressing a peptide or polypeptide to the site (s) of formation of membrane vesicles and in particular at the location (s) of formation of exosome may in particular require that said peptide or polypeptide comprises a import signal peptide in the endoplasmic reticulum, as explained this-After that, so that said peptide or polypeptide can be inserted into a cell membrane, the anchoring function in the membrane being provided by the membrane domain.
The term secretion refers, in the context of the invention, to the process by which membrane vesicles, then called exosomes, are

Secreted, that is, released into the extracellular space from one or several cells (s). This process can occur in particular when multivesicular endosomes fuse with the plasma membrane of a cell, thus releasing the membrane vesicles they contain outdoors of the cell.
As illustrated in the examples below, a test to put in evidence of the addressing and secretion properties of a polypeptide chimerical of the invention consists in verifying that said chimeric polypeptide and / or its degradation products find themselves well associated with vesicles membranes (in particular exosomes) when said polypeptide is Express in appropriate eukaryotic cells.
A suitable eukaryotic cell is preferably a cell eukaryotic with internal secretory vesicles, cultivable, capable exocytosis, genetically modifiable and, preferentially, whose vesicles internal organs can be secreted by external stimulation. he is in particular of a mammalian cell and more particularly of a cell of human origin or a cell originating from a non-human mammal.
he may also be primary crops or immortalized lines. Of such Suitable eukaryotic cells include eukaryotic cells naturally able to produce exosomes, especially mast cells, T and B cells and dendritic cells (eg Langerhans) or cells derived from these cell types, as well as eukaryotic cells or engineered eukaryotic cell lines genetically so as to make them capable of secreting exosomes.

11 The term residue, as used in this application, refers to an amino acid residue. These residues are indicated using the short code at a letter (for example, Y for a tyrosine residue, L for a leucine residue and P
for a proline residue).
The term lipid bilayer refers to the basic structure of the plasma membrane and any biological membrane, that is to say all assembly of amphiphilic lipids in a double layer (or double layer) separating a cell or vesicle from its environment and delimiting the cytoplasm of a cell or a vesicle, or delimiting the organelles to inside the cytoplasm. This term therefore includes any membrane of the cell, that is to say both the plasma membrane and the membranes of different intracellular compartments, particularly those of the reticulum reticulum, those of the Golgi apparatus, or that of the membrane vesicles, by example that of exosomes or endosomes.
A membrane domain, in the present application, means domain capable of interacting with a lipid bilayer and in particular able to anchor - and thus anchor a polypeptide comprising it - in a bilayer lipid and especially in a cell membrane and in the membrane a exosome. According to a particular embodiment, this membrane domain is able to bind on the one hand to a first domain (for example a peptide or a polypeptide of interest) and secondly to a second domain (e.g.
cytoplasmic domain). It may for example have 10 to 50 residues, preferably 15 to 40 residues and more preferably 20 to 30 residues.
According to a particular embodiment, said membrane domain is a transmembrane domain, that is to say a membrane domain crossing entirely the lipid bilayer of a cell membrane. A domain transmembrane is generally arranged in a hydrophobic helix, the multi-crossing transmembrane proteins that may contain several, in particular 2, 3, 4, 5, 6, 7, 8, 9 or 10, or even 20 or more than 20 hydrophobic. It can also be arranged in a P-sheet. One or more transmembrane domains can also adopt a structure in 3 transmembrane barrel, generally composed of 8 to 22 strands P.

12 According to another particular embodiment, said membrane domain may not completely cross the lipid bilayer of a membrane cellular.
This is for example the case of the membrane domain of a membrane protein in contact with only one of the compartments defined by said membrane. said membrane domain can then be for example a hydrophobic helix parallel to the plane of the membrane or a hydrophobic loop.
Said membrane domain may be derived from one or more protein (s) membrane (s), in particular of one or more protein (s) transmembrane (s).
By membrane protein is meant any polypeptide chain with one or more membrane domains as defined above above.
The expression transmembrane protein as used in the present application denotes any polypeptide chain which passes through at least one once entirely a cell membrane, especially the plasma membrane of a cell. This protein, which is in contact with both compartments defined by the cell membrane it passes through (eg with space extracellular and cytosol) therefore comprises three types of domains, each in contact with a different composition environment (for example, when the crossed cell membrane is the plasma membrane), the ectodomain (s) (or extracellular domain (s)), transmembrane domain (s), and the) cytoplasmic domain (s) are respectively in contact with the medium extracellular, lipids of the plasma membrane, and cytosol). according to a particular embodiment, the transmembrane protein passes through a once a cellular membrane. According to another particular embodiment, the protein transmembrane crosses several times, in particular 2, 3, 4, 5, 6, 7, 8, 9 or 10 once or even 20 times or more a cell membrane.
Said membrane or transmembrane proteins can be especially chosen from: human proteins, proteins of an animal non-human, proteins of a pathogenic organism or pathogen, especially viral, bacterial, or expressed proteins by a parasite or a tumor cell.
The or at least one of the polypeptide domain (s) of the polypeptide

13 chimeric of the invention may be in particular that of one and the same membrane protein or be a mutated derivative of this domain. Said mutated derivative is defined by the substitution, deletion and / or insertion of one or several residue (s) in the sequence of the reference membrane domain and retains the ability of this reference domain to anchor in the lipid bilayer of a cellular membrane. Said mutated derivative can for example be obtained in replacing part of the sequence of the reference domain with a sequence derived from the membrane domain of another membrane protein.
The term derived from a particular protein indicates, in the present requires that the peptide or polypeptide of interest comprise or consist of particular protein, or into a fragment of said particular protein.
A mutated derivative of a membrane or cytoplasmic domain within the meaning of of the present application refers to any modified polypeptide or peptide by relative to the original or reference membrane or cytoplasmic domain, under reserve that this mutated derivative retains the function of insertion, anchoring in a lipid bilayer normally attached to the reference membrane domain or the addressing capability normally attached to the cytoplasmic domain of reference. Such a mutated derivative may therefore correspond for example to a fragment composed of contiguous residues of said membrane or cytoplasmic domain (this derivative being obtained in particular by deletion and optionally substitution of a or several residue (s) in the original sequence) or, conversely to a polypeptide larger than the membrane or cytoplasmic domain original, in particular a polypeptide comprising the membrane domain or cytoplasmic (this derivative being obtained in particular by insertion of one or several residue (s) in the original sequence).
According to a particular embodiment, the mutated derivative of the domain membrane within the meaning of the present application differs from the original sequence of the membrane domain by the substitution of at least one residue, preferably one, two, three, four, five or more than five residue (s), consecutive or no, in the sequence of the original membrane domain, these substitutions being conservative, semi-conservative or non-conservative, and / or deletion and / or the insertion of at least one residue, preferably one, two, three, four, five, or more than five residues, consecutive or not, in the sequence of the domain

14 original. The sequence of said mutated derivative of the membrane domain may present at least 60 or 70%, in particular at least 80%, 90% or 95%, of similarity or identity with the membrane domain of the membrane protein of which it derives, with reference to the complete sequence of said membrane domain.
Percentage of identity means, in this application, the number of identical residues relative to the total number of residues of the peptide or polypeptide studied. The percentage of similarity, defined the number of residues identical or chemically similar to the total number of residues of the peptide or polypeptide studied. The percentage of identity or similarity is determined by aligning the two sequences to compare and using algorithm Needleman and Wunsch, which allows for global alignment between two sequences. The percentage of similarity or identity is then calculated on the the entire length of these two sequences.
By cytoplasmic domain (CD) is meant, in this application, a particular cytoplasmic domain capable of being addressed to the vesicles membrane, especially towards the vesicles forming exosomes, or the cellular compartment (s) involved in the training of the vesicles membranes, and in particular vesicles forming the exosomes in eukaryotic cells; this area can be secreted into space extracellular in association with exosomes, when expressed in of the suitable eukaryotic cells. So, this domain allows, when it is integrated with a chimeric polypeptide comprising a peptide or a polypeptide of interest, to address said chimeric polypeptide to the membrane vesicles and / or to their place (s) of formation and in particular to address the said polypeptide chimeric membrane to membrane vesicles, so that said polypeptide can be secreted in association with membrane vesicles (in particular exosomes) by a cell, in particular a cell eukaryotic appropriate.
This CD domain comprises at least one YxxL pattern, in which x represents any residue. It may in particular include one, two or three YxxL patterns.
Said pattern or one of the motifs YxxL of the domain CD may be, for example, the YINL (SEQ ID NO: 91) or YSHL (SEQ ID NO: 97) pattern. According to a mode of particular embodiment, the CD domain comprises a DYxxL pattern, in which x represents any residue. As an example in the part experimental, one will quote the motif DYINL (SEQ ID NO 93).
Alternatively or in a complementary way, the CD domain comprises At least one pattern equivalent to a YxxL pattern, for example a YxxF pattern, in which x represents any residue. For example, the receiver of the transferin, which is a cellular protein, has such a domain.
Alternatively or in a complementary way, the CD domain comprises minus a pattern equivalent to a DYxxL pattern, for example a DYxxF pattern, in Which x represents any residue.
The description of the present application, made by reference to the field YxxL in general or as illustrated by particular sequences, is worth also for the DYxxL or DYxxF domains, defined in general terms or having specific sequences derived from the given examples of patterns.

According to a preferred embodiment, said CD domain further comprises at least one, in particular one, two, three or four pattern (s) PxxP, in which x represents any residue. According to a particular embodiment, the pattern PxxP or one of the PxxP patterns of the CD domain is the PSAP pattern (SEQ ID NO: 88) or PTAP (SEQ ID NO: 89).
The general or specific description of the chimeric polypeptides of the invention, mentioning one or more YxxL motifs, therefore applies also chimeric polypeptides which further comprise a PxxP motif.
According to a particular embodiment, the CD domain comprises at least minus a YxxL or DYxxL pattern (for example the YINL, YSHL or DYINL pattern) and a PxxP pattern (for example the PSAP or PTAP pattern).
In particular, the CD domain consists of a pattern having a pattern PxxP and a pattern YxxL (or YxxF, DYxxL or DYxxF). In one embodiment of the invention, the PxxP pattern of the CD domain is PSAP and the pattern YxxL
is YINL or YSHL.
In a particular embodiment, the YxxL pattern of the CD domain (by example the YINL or YSHL pattern), or one of the patterns is YxxL, located in position C-terminal with respect to the PxxP pattern (for example the PSAP pattern).
In a particular embodiment, the YxxL pattern of the CD domain (by

16 example the YINL or YSHL motif) is located in the N-terminal position by report on the PxxP pattern (for example the PSAP pattern).
Among the proteins having a CD domain having at least one motif YxxL includes, in particular, cellular proteins and viral proteins.
These viral proteins include enveloped virus proteins, in particular particular the glycoproteins TM of enveloped viruses as defined above, or herpesvirus proteins, for example LMP2-A protein, Epstein-Barr which has at least two YxxL patterns.
According to a particular embodiment, the CD domain is that of a TM protein of a retrovirus. The term retrovirus covers here everything retrovirus. This retrovirus can be chosen in particular from the two sub-families of retrovirus following, based on criteria of pathogenicity:
- Oncovirinae (Oncovirus), which are transforming viruses and which include BLV, which induces, in cattle, a proliferation of B cells that can cause leukemia, and the leukemia-lymphoma virus at T cells (or HTLV-1, for human T cell leukemia virus), lentivirinae (Lentivirus), which are cytopathogenic viruses, and which include HIV-1 and HIV-2 human immunodeficiency viruses.
By way of example, the CD domain may be that of a TM protein of one retrovirus selected from the bovine leukemia virus (BLV), a virus human immunodeficiency virus (HIV), in particular HIV type 1 or HIV
type 2, the T-cell leukemia-lymphoma (HTLV) virus, in particular the HTLV-1 or HTLV-2, and Mason-Pfizer Monkey Virus (MPMV).
According to a particular embodiment, the CD domain is that of the BLV TM protein. This BLV CD domain, which is composed of 58 residues, was for sequence SEQ ID NO.6. Domain (iii) of the chimeric polypeptide of the invention then corresponds to either the sequence SEQ ID NO.6 or a mutated derivative of the sequence SEQ ID NO.6.
In the particular case where domain (iii) comprises or consists of the CD domain the BLV TM protein, of sequence SEQ ID No. 6, the domain (s) membrane (s) of said chimeric polypeptide of the invention is (are) free (s) of the membrane domain of the BLV TM protein, which has the sequence SEQ ID
NO.4. A membrane domain of the chimeric polypeptide of the invention may in

17 contrast to correspond to a mutated derivative of the domain of sequence SEQ ID NO.4, said mutated derivative not comprising the sequence SEQ ID NO.4. Such a derivative mutated can be obtained by deletion and possibly substitution of one or several residue (s) in the sequence SEQ ID NO.4, as illustrated in the examples.
The mutated derivative of the CD domain within the meaning of the present application comprises at least one YxxL motif, where x represents a residue any. It may in particular comprise one, two or three YxxL pattern (s).
This mutated derivative may further comprise at least one, in particular one, two, three or four pattern (s) PxxP, where x represents any residue. This mutated derivative differs from the original cytoplasmic domain by substitution of minus one residue, preferably one, two, three, four, five or more five residues, consecutive or not, in the sequence of the cytoplasmic domain original, these substitutions may be conservative, semi-conservative or not conservative, and / or deletion and / or insertion of at least one residue, of preferably one, two, three, four, five or more than five residues, consecutive or no, in the sequence of the original cytoplasmic domain.
In a particular embodiment of the invention, the mutated derivative of CD domain is a native CD domain fragment consisting essentially of an amino acid sequence extending from the PSAP motif to the YxxL motif (by example YINL or YSHL) which, in a particular embodiment, follows it in C-terminal part. Where appropriate, one or more amino acid residues Naturellelment present in the CD domain, between these two motives, is substituted or deleted.
According to a particular embodiment, the mutated derivative of the CD domain comprises at least one YxxF or DYxxL motif (for example the YINL, YSHL or DYINL) and a pattern PxxP (for example the PSAP or PTAP pattern), in which x represents any residue.
According to a particular embodiment, the domain (iii) of the polypeptide of the invention, in particular the mutated derivative of the CD domain, is devoid of the sequence KCLTSRLLKLLRQ. So the mutated derivative of the domain CD may differ from the original CD domain in that its sequence is devoid of the sequence: KCLTSRLLKLLRQ.

18 In addition, or alternatively, the sequence of the mutated derivative of the CD domain may have at least 60 or 70%, in particular at least 80%, 90% or 95%, similarity or identity to the original CD domain sequence devoid of of the sequence KCLTSRLLKLLRQ.
It may also be preferable that domain (iii) of the polypeptide chimeric of the invention, and in particular the mutated derivative of the CD domain is devoid of the PC sequence and / or the CP sequence. According to a mode of particular embodiment, said domain (iii), in particular the mutated derivative of field CD is notably deprived of the PCP sequence. So, if the CD domain original contains a PCP sequence, its mutated derivative can be obtained in particular by deleting, in the sequence of the original CD domain, the cysteine residue of said PCP sequence, or substituting it for another residue, preferably a non palmitoylable residue, for example an alanine residue.
According to a particular embodiment, the CD domain or its derivative is lacking both the PCP sequence and the sequence KCLTSRLLKLLRQ.
When the membrane domain (s) and cytoplasmic (s) derive from the same protein, especially when they derive from TM protein of BLV, it may be preferable to use, as domain (iii), a derivative transferred from CD domain lacking the PCP sequence and / or lacking the sequence KCLTSRLLKLLRQ.
In the particular case where one of the membrane domains of the polypeptide chimeric of the invention comprises or consists of the transmembrane domain of the BLV TM protein, of sequence SEQ ID No. 4, the CD domain or its mutated derivative is devoid of the CD domain of the BLV TM protein, of sequence SEQ ID NO.6. On the other hand, the CD domain or its mutated derivative may correspond to, or include a mutated derivative of the sequence SEQ ID NO.6. As illustrated in the examples, such a mutated derivative can be obtained, for example, in deleting residues located in the N-terminal part of the sequence SEQ ID
NO.6, in particular by deleting the sequence KCLTSRLLKLLRQ and / or deleting the PCP sequence in the sequence SEQ ID No. 6, or substituting for example the cysteine residue of the PCP sequence another residue, preferably by a non palmitoylable residue, for example an alanine residue.
By way of example, the mutated derivative of the CD domain the BLV TM protein

19 can comprise or consist of the sequence SEQ ID NO.8, which corresponds to the SEQ ID NO.6 sequence in which the 13 N-terminal residues were deleted.
By way of example also, the sequence of the mutated derivative of the TM protein of BLV may differ from the sequence of the CD domain the BLV TM protein by the substitution of at least one residue, preferably one, two, three, four, five or more than five residue (s), consecutive or not, and / or deletion and / or the insertion at least one residue, preferably one, two, three, four, five or more of five residue (s), consecutive or not in the sequence of said domain corresponding to the sequence SEQ ID NO.8.
By way of example, the sequence of the mutated derivative of the CD domain of the BLV TM protein (CD domain of sequence SEQ ID No. 6) may present at least 60 or 70%, in particular at least 80%, 90% or 95%, of similarity or identity with the sequence SEQ ID NO.8. Preferably, the sequence of said mutated derivative retains in particular the YINL, YSHL (or, where appropriate, DYINL) motif and the PSAP pattern of the sequence SEQ ID NO.8.
The sequence of said mutated derivative of the CD domain of sequence SEQ ID No. 6 is preferably devoid of PC motif (proline-cysteine) and CP (cysteine) -proline) and, more preferably, lacking a PCP motif (proline - cysteine -proline). For example, it may include or consist of the SEQ ID sequence NO. 10 or SEQ ID NO.12.
According to a particular embodiment, the CD domain or its derivative mutated, in particular the mutated derivative of the CD domain of sequence SEQ ID No. 6, comprises or consists of a sequence selected from the following sequences:
PxxPxxxxPxxPxSxYxxLxPxxPExYxxLxPxxPDYxxL;
PxxPxnPxxPxnSxYxxLxnPxxPExnYxxLxnPxxPDYxxL;
PxxPxxxxPxxPxSxYxxLxPxxPExYxxLxPxxPDYxxLxxxx; and PxxPxnPxxPxnSxYxxLxnPxxPExnYxxLxnPxxPDYxxLxxxx;
where x and xn respectively represent any residue and a or more residue (s).
According to a particular embodiment, the CD domain or its derivative mutated, in particular the mutated derivative of the CD domain of sequence SEQ ID No. 6, comprises or consists of a sequence selected from the following sequences:
PxxPxxxxxxxxxxxxYxxL;

PxxPxxxxxxxxxxxDYxxL;
Pxx PxxYxxxxxxxxxYxxL;
PxxPxxYxxxxxxxxDYxxL;
PxxPExYxxLxPxxPDYxxL;
PxxPxnYxxL;
PxxPxnDYxxL;
PxxPxnYxnYxxL;
PxxPxnYxnDYxxL;
PxxPExnYxxLxnPxxPDYxxL;
10 PxxPxxxxPxxPxxxYxxLxPxxPExYxxLxPxxPDYxxL;
PxxPxnPxxPxnYxxLxnPxxPEXnYxxLxnPxxPDYxxL;
PxxPxxxxPxxPxxxYxxLxPxxPExYxxLxPxxPDYxxLxxxx; and Pxx Pxn Pxx PxnYxx Lxn Pxx P EXnYxx Lxn Pxx P DYxx Lxxxx.
where x and xn respectively represent any residue and a 15 or more residue (s).
In particular n is greater than or equal to 1 and less than 50. n can have in especially any value between 1 and 20.
By way of example, the pattern PxxP which, in a particular embodiment, is in the N-terminal position in the sequences indicated above, may

20 be the PSAP or PTAP pattern.
Alternatively or in a complementary way, the YxxL motif which, in a particular embodiment, is in the C-terminal position in the sequences indicated above, can be for example the YINL or YSHL pattern.
In a particular embodiment of the invention, when the domain CD or its mutated derivative includes one of the above sequences, residues consecutive amino acids added upstream or downstream of this sequence do not form a PxxP pattern nor a YxxL, YxxF, DYxxL or DYxxF pattern.
According to a particular embodiment, said mutated derivative of the CD domain sequence SEQ ID No. 6 has 6 to 100 residues, in particular 20 to 80, 30 to 70 or 40 to 60, for example 40, 41, 42, 43, 44, 45, 46, 47, 48, 49 or 50 residues.
By way of example, the sequence of the mutated derivative of the CD domain can understand or consist of the sequence SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID
NO. 44 or SEQ ID NO. 95 or at least 60 or 70%, in particular at least

21 less than 80%, 90%, or 95%, similarity or identity to the SEQ ID sequence NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID NO. 95 by reference respectively to the sequence SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID NO. 95 complete.
By peptide or polypeptide of interest we mean a whole sequence of several (at least two) successive residues, forming the structure of a peptide or of a polypeptide. A peptide denotes a chain of 2 to 20 successive residues (in particular 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 or 20 residues), in particular a chain of 5 to 10, 10 to 15 or 15 to 20 residues successive.
A polypeptide, which also refers to a protein or fragment of a protein, is a sequence of more than 20 (at least 21) successive residues, in particular a chain of 21 to 1000 successive residues, preferably from 21 to 500, 21 to 250 or 21 to 150 successive residues, for example 21 to 50, 50 to 100, to 150 successive residues. The said peptide or polypeptide of interest may be particular comprise or consist of one or more domains of a protein soluble, membrane, transmembrane and / or multimeric.
According to a particular embodiment, said peptide or polypeptide of interest comprises or consists of one or more domains of a protein extracellular or fragment (s) of one or more of these areas).
According to a particular embodiment, said peptide or polypeptide of interest comprises or consists of one or more ectodomain (s) and / or multiple membrane domain (s) and / or one or more domains cytoplasmic (s) of a membrane protein, in particular a protein transmembrane, or one or more fragment (s) of one or more of these areas).
According to a particular embodiment, said peptide or polypeptide of interest comprises or consists of one or more domains of a protein cytosolic or fragment (s) of this (these) domain (s).
By fragment of a domain is meant, in the present application, a portion consisting of at least 6 contiguous residues of that domain, and particular a portion having at least 50%, preferably at least 60%, 70%, 80%, or at least 90% or even 100% identity with the complete sequence of said field. Anyway, a fragment is smaller than size of the

22 protein from which it derives.
According to a particular embodiment, said peptide or polypeptide of interest is antigenic, ie it is capable of eliciting reply directed against said peptide or polypeptide of interest. said peptide or The polypeptide of interest may in particular comprise or consist of one or several epitopes (s) of a protein.
According to a particular embodiment, said peptide or polypeptide of interest comes from a pathogenic organism, for example a virus, a bacterium or a parasite, or a pathogen, for example a tumor cell, a toxin .... Any peptide component of such an organism or pathogen can be used, whether or not it is a structural protein. It can be in particular a pathogen antigen, and in particular a viral antigen, bacterial or an antigen from a parasite.
The said peptide or polypeptide of interest may also come from a tumor antigen, cytoplasmic antigen, protein transmembrane, in particular an integrin or a co-receptor or an intervening protein in interactions (in particular ICAM, CD4, CD8 proteins) of a ligand receptor, especially a single membrane domain receptor, for example a cytokine receptor (especially the receptors of the family HER responding to EGF, for example the EGF-R1 receptor), including a receptor with multiple membrane domains, for example a seven-fold receptor transmembrane domains (in particular the HIV CXCR4 receptor or a gamma amino butyric acid (GABA) receptor), or a receptor, in particular a cytokine or a fragment thereof.
Depending on the type of peptide or polypeptide of interest chosen, the invention may be used in vivo, especially in immunization, in particular in vaccination, and / or in vitro, for example to screen molecules interacting with said peptide or polypeptide of interest (as described below).
According to a particular embodiment, said peptide or polypeptide of interest comes from a protein on the surface of a virus, example a protein responsible for fixing a viral particle to a receptor located on a target cell and / or responsible for the fusion of the viral envelope or the plasma membrane of a cell infected with the plasma membrane of a

23 target cell, or a fragment of such a protein.
By way of example, it is possible to use, as domain (i), a protein of the envelope of an enveloped virus or a fragment of this protein. This virus wrapped can be selected among the following families:
- Poxviridae, especially those of the genus Orthopoxvirus, which includes in particular the smallpox virus and the vaccinia virus;
- Herpesviridae, in particular those of the genus Herpesvirus, which includes Herpesvirus types 1 and 2, the Varicella virus, the virus Epstein Barr, Cytomegalovirus, and Herpesviruses 6, 7, 8;
- Hepadnaviridae, which include the hepatitis B virus;
- Orthomyxoviridae, in particular those of the genus Influenza virus A, B or C, which includes the bird flu virus H5N1, - Paramyxoviridae, in particular those of the genus Paramyxovirus, which including parainfluenzae and mumps viruses, genus Morbillivirus, which includes measles viruses, and those of Pneumovirus genus, which notably comprises respiratory syncytial virus, - Rhabdoviridae, in particular those of the genus Lyssavirus, which includes including the rabies virus;
Filoviridae, which include, in particular, Marburg virus and the virus Ebola;
- Togaviridae, in particular those of the genus Flavivirus, which includes including yellow fever virus and hepatitis C virus (HCV), those of genus Alphavirus and those of the genus Rubivirus, which includes the virus of rubella ;
- Coronaviridae, especially those of the genus Coronavirus, which includes especially viruses responsible for respiratory and digestive infections such as severe acute respiratory syndrome (SARS);
- Arenaviridae, especially those of the genus Arenavirus, which includes including Lassa virus, Bunyaviridae, in particular those of the genus Bunyavirus, Hantavirus, Phlebovirus; and Retroviridae, in particular those of the genus Lentivirus which comprises including human immunodeficiency virus (HIV).

24 By way of example, the peptide or polypeptide of interest may be of an envelope protein of an influenza virus, particularly of hemagglutinin (HA) of an influenza virus, and more particularly of HA protein from the H5N1 avian influenza virus. It can be the ectodomain of this protein or a fragment of this ectodomain or a fragment comprising or consisting of one or more epitopes of this ectodomain.
Other antigenic polypeptides of these viruses can naturally be used, such as the protein or a fragment of the HIV GAG polyprotein, the protein or a capsid fragment of the poliovirus or papillomavirus.
By way of example also, the peptide or polypeptide of interest can be from a protein in the outer envelope of one of these viruses. he can this is the envelope of one of these viruses. It can be the envelope of a virus a coronavirus, in particular the protein Spike (S) of a coronavirus, and more particularly the Spike protein of a respiratory syndrome coronavirus acute severe (SARS coronavirus or SARS-CoV). This peptide or polypeptide of interest may in particular comprise or consist of ectodomain of this protein or a fragment comprising or consisting of one or more epitope (s) of this ectodomain.
According to a preferred embodiment, said peptide or polypeptide of interest lies in its native conformation in the polypeptide of the invention.
According to a particular embodiment, the chimeric polypeptide of the invention further comprises at least one binding molecule (or linker). The term linker means any element that links two domains successive. This one may be of length and of variable nature.
According to a particular embodiment, at least two domains successive polypeptide of the invention are covalently bound, by example via peptide bonds. Thus, according to a mode of production particularly, said linker is a polypeptide or a peptide. This linker polypeptide can consist of a sequence of 2 to 50 residues, preferably 2 to 30 residues, for example 2 to 5, 5 to 10, 10 to 20 or 20 to 30 successive residues.
According to a particular embodiment, the nucleotide sequence encoding for said linker comprises or consists of a restriction site. By site of "restriction" means a particular nucleotide sequence recognized by a Type II restriction enzyme as a cleavage site in the molecule DNA. So, this linker maybe, for example, the RSR sequence linker, code by the nucleotide sequence AGGTCTAGA, which comprises the restriction site Xbal restriction enzyme (TCTAGA sequence).
According to a particular embodiment, the chimeric polypeptide of the invention comprises one or more import signal peptide in the endoplasmic reticulum.
By import signal peptide in the endoplasmic reticulum, means a small continuous polypeptide sequence of about 5 to about 60 10 residues, in particular from 15 to 60 residues and more particularly from 15 to residues, which allows the passage of a protein containing it through the endoplasmic reticulum membrane, the passage of the protein may be complete or partial, stopping the passage of the protein depending on the presence another (or other) additional signal (s). Signal peptides for The same destination being interchangeable from one protein to another, all signal peptide for targeting a protein to the reticulum endoplasmic may be used in the context of the present invention.
By way of example, it is possible to use as an import signal peptide in the endoplasmic reticulum a peptide of 27 residues of sequence SEQ ID
NO: 2.
By way of example also, one could also use as import signal peptide in the endoplasmic reticulum the signal peptide of a membrane protein such as CD4, CD8 and haemagglutinin proteins (HA), the signal peptide of a cytokine receptor such as IL1 R1, EGFR1 (HER1),

HER2, HER3 or HER4, or the signal peptide of a secreted protein, by example, that of a cytokine. Thus, one can use a signal peptide selected among: that of the human CD4 protein (peptide of sequence SEQ ID NO.:49) or mouse CD4 (peptide of sequence SEQ ID NO.:50), that of the CD8 protein mouse alpha (SEQ ID NO.:51 peptide), bovine alpha CD8 (peptide of sequence SEQ ID NO.:52), human CD8 alpha (peptide of SEQ ID sequence NO.:53), or CD8 alpha rat (peptide SEQ ID NO.:54), that of human IL1 R1 receptors (peptide of sequence SEQ ID NO.:55), EGFR1 (HER1) peptide (peptide of sequence SEQ ID NO.:56), human HER2 (peptide of

26 sequence SEQ ID NO.:57), human HER3 (peptide of sequence SEQ ID NO.:58) or human HER4 (peptide of sequence SEQ ID NO.:59), or that of cytokines Mouse IL-2 (peptide of sequence SEQ ID NO.:60), mouse IL-6 (peptide of sequence SEQ ID NO: 61), human IL-7 (peptide of sequence SEQ ID NO.:62), Mouse IL-10 (peptide of sequence SEQ ID NO.:63), or MIP-1 -alpha chemokine (peptide of sequence SEQ ID NO.:64), that of the hemagglutinin of Influenza B virus (peptide of sequence SEQ ID NO.:65), that of the hemagglutinin Influenza A H1N1 viruses (peptide of sequence SEQ ID NO.:66), Influenza A
H2N2 (peptide of sequence SEQ ID NO.:67), Influenza A H3N2 (peptide of sequence SEQ ID NO .: 68), Influenza A H4N6 (peptide of SEQ ID sequence NO.:69), Influenza A H5N1 (peptide of sequence SEQ ID NO: 70), Influenza A
H6N5 (peptide of sequence SEQ ID NO.:71), influenza A H7N7 (peptide of sequence SEQ ID NO .: 72), Influenza A H8N4 (Peptide SEQ ID sequence NO.:73), Influenza A H9N2 (peptide of sequence SEQ ID NO: 74), Influenza A
H1 ON7 (peptide of sequence SEQ ID NO.:75), Influenza A H11 N6 (peptide of sequence SEQ ID NO .: 76), Influenza A H12N5 (SEQ ID SEQ ID peptide NO.:77), or Influenza A H13N6 (peptide of sequence SEQ ID NO: 78).
According to another particular embodiment, said signal peptide import into the endoplasmic reticulum may be part of the peptide or polypeptide of interest of the chimeric polypeptide of the invention. It is by example the case when said peptide or polypeptide of interest is a protein membrane or a cytokine.
Independently or in combination with the embodiment above, said import signal peptide in the endoplasmic reticulum can be part of one of the membrane domains of the chimeric polypeptide of the invention. This can be for example the case when the membrane domain or one of the membrane domains of said polypeptide is derived from a seven transmembrane domains; it is indeed known in the state of the technical that for some receptors with seven transmembrane domains such as the CXCR4 receptor, the transmembrane domain in the N-terminal position office import signal in the endoplasmic reticulum. Do not put this because we sometimes does it to increase membrane targeting

27 Alternatively, according to another embodiment, said signal peptide is not part of any of the three areas (i), (ii) and (iii), and is, by therefore, added in addition to the three domains (i), (ii) and (iii) of that polypeptide chimerical. It can then be placed at different locations in the sequence linear of the chimeric polypeptide of the invention, but is generally found at an end of said polypeptide and is preferably in the N-terminal position in said polypeptide.
If a second signal peptide import into the reticulum endoplasmic is added in the chimeric polypeptide of the invention, it allows if necessary to increase the membrane targeting.
In a mature form, especially when anchored in the membrane of a membrane vesicle, for example an exosome, the polypeptide The chimeric method of the invention generally does not comprise signal N- or C- import terminal in the endoplasmic reticulum; after he has fulfilled its function, the signal peptide N- or C- terminal can be separated of polypeptide by proteolytic cleavage, for example in the reticulum endoplasmic or in the Golgi.
According to a preferred embodiment, said peptide or polypeptide of interest lies in its native conformation in the polypeptide of the invention.
According to a particular embodiment, said chimeric polypeptide is multimeric and in particular is in the form of a dimer or a trimer.
This may be the case, in particular, when the peptide or the polypeptide interest comes from a protein that, in its native form, dimerizes or trimerized.
According to a particular embodiment, the chimeric polypeptide further comprises a tag sequence, which makes it possible to purify it. For example, said tag sequence may comprise or consist of a plurality of residues histidine related consecutively, especially a sequence of 6 residues histidine consecutive.
According to a particular embodiment, the chimeric polypeptide further comprises a marker for detecting the chimeric polypeptide by ELISA or Western Blot. Preferably, said marker is an epitope recognized by a specific monoclonal antibody, for example a myc epitope.

28 The invention particularly relates to a polypeptide population in particular chimeric polypeptides glycosylated at the terminal stage, that is, in mature form, as a result of their targeting and association with exosomes. Such a population is advantageously devoid of glycosylated polypeptides at early or intermediate stages of glycosylation.
In a particular embodiment of the invention, in the polypeptides the peptide or polypeptide of interest advantageously has its native conformation (in particular is in the form of multimer, for example under dimer or trimer form) when associated with exosomes.
The subject of the present invention is also a polypeptide allowing the secretion of a peptide or polypeptide of interest with which it is associated, in association with membrane vesicles (especially exosomes) when expressed in a eukaryotic cell, characterized in that comprises or consists of a mutated derivative of the CD domain of the TM protein of a retrovirus, this mutated derivative being defined by substitution, deletion and / or insertion one or several residue (s) in the sequence of the reference CD domain and comprising at least one YxxL motif, in which Y represents a tyrosine residue, x represent any residue and L represents a leucine residue and this mutated derivative retaining the ability of said CD domain to address a peptide or polypeptide of interest to the membrane vesicles, especially to the vesicles forming exosomes, and / or towards the cell compartment (s) involved in the formation of membrane vesicles, and in particular vesicles forming the exosomes.
The definitions given above in the context of the chimeric polypeptide of the invention also apply by analogy to this polypeptide.
According to a particular embodiment, said mutated derivative is a derivative mutated from the CD domain of the BLV TM protein (SEQ sequence CD domain ID NO. : 6). This mutated derivative is as defined in the various aspects of the present invention concerning the chimeric polypeptide. Thus, said derivative mutated, which is usually devoid of KCLTSRLLKLLRQ sequence and / or lacking PCP peptide may comprise or consist of a sequence selected from the following sequences:

29 PxxPxxxxxxxxxxxxYxxL;
PxxPxxxxxxxxxxxDYxxL;
PxxPxxYxxxxxxxxxYxxL;
PxxPxxYxxxxxxxxDYxxL;
PxxPExYxxLxPxxPDYxxL;
PxxPxnYxxL;
PxxPxnDYxxL;
PxxPxnYxnYxxL;
PxxPxnYxnDYxxL;
PxxPExnYxxLxnPxxPDYxxL;
PxxPxxxxPxxPxxxYxxLxPxxPExYxxLxPxxPDYxxL;
PxxPxnPxxPxnYxxLxnPxxPEXnYxxLxnPxxPDYxxL;
PxxPxxxxPxxPxxxYxxLxPxxPExYxxLxPxxPDYxxLxxxx;
Pxx Pxn Pxx PxnYxx Lxn Pxx P EXnYxx Lxn Pxx P DYxx Lxxxx.
PxxPExxxPxKPDxDYxxLxPxxPExYxxLxPxxPDYxxLR;
PxxPExnPxKPDxnDYxxLxnPxxPEXnYxxLxnPxxPDYxxLR;
PxxPExxxPxKPDxDYxxLxPxxPExYxxLxPxxPDYxxLRxxxx and PxxPExnPxKPDxnDYxxLxnPxxPExnYxxLxn PxxP DYxxLRxxxx, where x and xn respectively represent any residue and a or more residue (s).
In particular n is greater than or equal to 1 and less than 50. n can have in especially any value between 1 and 20.
By way of example, the pattern PxxP which, in a particular embodiment, is in the N-terminal position in the sequences indicated above, may be the PSAP or PTAP pattern.
Alternatively or in a complementary way, the YxxL motif which, in a particular embodiment, is in the C-terminal position in the sequences indicated above, can be for example the YINL or YSHL pattern.
In particular, this mutated derivative of CD comprises exclusively the motifs PxxP and YxxL or DYxxL contained in the sequences described above.
According to a preferred embodiment, the mutated derivative of the CD domain of polypeptide of the invention comprises at least one YxxL or DYxxL motif (by YINL, YSHL or DYINL pattern) and a PxxP pattern (for example the pattern PSAP or PTAP) in which x represents any residue.
By way of example, the mutated derivative of the polypeptide of the invention may have for sequence SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID
NO. 95 or at least 60 or 70%, in particular at least 80%, 90% or 95%, of similarity or identity with the sequence SEQ ID NO. 30, SEQ ID NO.
42, SEQ ID NO. 44 or SEQ ID NO. 95 by reference to the sequence respectively SEQ ID NO. 30, SEQ ID NO. 42, SEQ ID NO. 44 or SEQ ID NO. 95 complete.
More specifically, the mutated derivative of the polypeptide of the invention may have as its sequence SEQ ID NO. 8 or at least 60% or 70%, particularly in 10 minus 80%, 90% or 95%, of similarity or identity with the SEQ ID sequence NO.
8 with reference to the sequence SEQ ID NO. 8 complete. For example, the sequence said mutated derivative may comprise or consist of the sequence SEQ ID NO.10 or SEQ ID NO.12. Preferably, the sequence of said mutated derivative YINL or YSHL (or DYINL) and the PSAP pattern of The sequence SEQ ID NO.8.
According to a particular embodiment, the polypeptide of the invention is in additionally associated or fused to a peptide or polypeptide of interest.
The present invention also relates to the use of a polypeptide chimeric of the invention or a polypeptide of the invention as defined in the Present application, to address (in vivo or in vitro) a peptide or polypeptide of interest to the membrane vesicles, especially to the vesicles forming exosomes, and / or towards the cell compartment (s) involved in the formation of membrane vesicles, and in particular vesicles forming the exosomes, and to thereby allow secretion, by eukaryotic cells Of said peptide or polypeptide of interest in association with said membrane vesicles.
The present invention also relates to a membrane vesicle, and more precisely an exosome, which comprises a chimeric polypeptide or a polypeptide of the invention as defined above, and / or one or more

Degradation product (s) of said chimeric polypeptide or said polypeptide, this (s) product (s) of degradation being possibly associated with a molecule of the major histocompatibility complex (MHC) type I and / or type II.
The chimeric polypeptide or the polypeptide of the invention and / or their

31 product (s) is (are) anchored in the membrane of the said vesicle Membrane through their or their domain (s) membrane (s) or via the membrane domain of the molecule of the MHC (Class I or II) to which he is (are) associated.
According to a particular embodiment, said degradation product comprises or consists of a fragment of the peptide or polypeptide of interest, particular to a fragment comprising or consisting of one or more epitope (s) said peptide or polypeptide of interest.
According to a particular embodiment, the peptide or the polypeptide interest or a fragment thereof is exposed, in whole or in part, to the area, outside the membrane vesicle. So, this membrane vesicle can be used in particular to produce or select in vivo or in vitro prokaryotic or eukaryotic cells or viruses (eg phage) or of the ribosomes interacting directly or indirectly with said peptide or polypeptide of interest or fragment thereof. This membrane vesicle can also to be used to produce in vivo or in vitro monoclonal antibodies or polyclonal, vaccinating or non-vaccinating, directed against said peptide or polypeptide of interest or fragment thereof. Such antibodies can be used particularly in diagnosis or to study protein interactions, in particular particular for performing high throughput screening of molecules such as of the drugs or cytokines capable of interacting with the peptide or polypeptide of interest or their fragment. In addition, this membrane vesicle can be used in vivo, in immunization, to elicit or promote, in a host (human or no human), a humoral and / or cellular response against a tumor, or against virus, bacterium or parasite whose peptide or polypeptide of interest derivative.
The immune response elicitated or favored for the membrane vesicle the invention, in particular by an exosome of the invention, can be, according to the nature polypeptides associated with exosomes, a tolerogenic or defense response.
A tolerogenic response may allow, for example, the host to fight asthma or to support a transplant.
According to a preferred embodiment, said peptide or polypeptide of interest or its fragment is exposed (in part or in whole) in its native conformation on the surface of the membrane vesicle.

32 According to a particular embodiment, the peptide or the polypeptide of interest or its fragment is included in part or in whole in the membrane of the membrane vesicle of the invention, and / or included in part or in whole in the cytosolic fraction of said membrane vesicle.
A pharmaceutical composition or an immunogenic composition, the active ingredient comprises one or more vesicle (s) membrane (s), in particular one or more exosome (s) as defined in this application or one or more chimeric polypeptide (s) of the invention, one or more polypeptide (s) of the invention as defined above makes also part of the invention. Said composition further comprises one or vehicle (s), diluent (s), and / or adjuvant (s) or any of their combinations.
In the case of injectable administration, it is possible in particular to choose a formulation in an aqueous solution, non-aqueous or isotonic.
The term "vehicle" means, in the present application, any support (that is, anything that can carry at least one active ingredient) that does not alter the effectiveness of the biological activity of the active substances of the invention.
Of many vehicles are known in the state of the art. The vehicles used can be, for example, water, saline, albumin serum, Ringer solution, polyethylene glycol, miscible solvents in water, sugars, linkers, excipients, pigments, vegetable oils or minerals, water-soluble polymers, surfactants, agents thickeners or gelling agents, cosmetic agents, solubilization, stabilizing agents, preservatives, agents alkalizing agents or acidifying agents or a combination thereof.
The term diluent means, in this application, an agent of dilution, and includes soluble diluents and insoluble diluents. We uses usually an insoluble diluent when the active ingredient is soluble and a diluent soluble when the active ingredient is insoluble. An insoluble active ingredient can be totally insoluble in aqueous media or have limited solubility (it's up to have a solubility of less than 10 mg / ml in 250 ml of water at a pH of 1.0 to 7.5) in an aqueous medium. Examples of insoluble diluents include cellulose microcrystalline, silicified microcrystalline cellulose, hydroxymethylcellulose, dicalcium phosphate, calcium carbonate, calcium sulphate,

33 magnesium carbonate, tricalcium phosphate, etc. Examples of Soluble diluents include mannitol, glucose, sorbitol, maltose, the dextrates, dextrins, dextrose, etc.
The term adjuvant means, in the present application, a product which, added to the content to an immunogenic composition, in particular to a vaccine, increases the intensity of the immune response induced in the host (human or no human) to which said composition is administered. An adjuvant can in particular to increase the amount of specific antibodies that said mammal is capable of of produce after administration of said composition and therefore increases the effectiveness of immunization. Adjuvants are particularly useful when antigen in use alone causes only a weak immune response to provide a good protection, to reduce the amount of antigen to be administered to a host, or again to facilitate certain modes of administration of said composition, by example in the case of mucosal administration. The additives likely to be used in the context of the invention are in particular of the saponins, aluminum phosphate (alum), peptidoglycans, carbohydrates, peptides, for example muramyl dipeptide (N-acetylmuramyl-L-alanyl-D-isoglutamine, MDP), oil / water emulsions, polysaccharides, cytokines, hormones, keyhole limpet hemocyanin, adjuvants of the family of unmethylated CpG dinucleotides, adjuvants from the family of poly IC, adjuvants from the family of monophosphoryl lipid A and acids nucleic acids, in particular bacterial DNAs or DNAs encoding a a protein having an adjuvant effect, for example a growth factor or a cytokine, more particularly GM-CSF or IL4.
According to a preferred embodiment, said vehicle (s), diluent (s), and / or adjuvant (s) or combination thereof are substances or a combination pharmaceutically acceptable substances, ie suitable for administration to a host (for example a human, a non-human mammal or a bird) for therapeutic or prophylactic purposes. Such a substance combination of substances is therefore preferentially non-toxic for the host to which it is administered.
The present invention also relates to a polynucleotide characterized in that it encodes a chimeric polypeptide or a polypeptide according to the

34 present invention, according to the universal genetic code, and taking into account the degeneracy of this code. The term polynucleotide covers any molecule DNA or RNA (single or double stranded). This polynucleotide can be naked or, alternatively, it can be inserted into a cloning vector or expression, preferably a suitable vector for expression in cells eukaryotes.
This vector is preferably a plasmid. Said polynucleotide can be notably assembled by PCR. It preferably comprises 2000 to 50000 nucleotides.
The term code does not necessarily mean that said polynucleotide only includes the coding part. Said polynucleotide can indeed understand in addition to expression regulation sequences and in particular to understand a promoter, for example a eukaryotic promoter By way of example, said polynucleotide comprises as a sequence coding for the domain (iii) of the chimeric polypeptide of the invention a sequence comprising or consisting of a sequence selected from sequences SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9, SEQ ID NO. 11 SEQ ID
NO. 47 and SEQ ID NO. 94.
According to a preferred embodiment, said polynucleotide comprises a coding sequence for an import signal in the endoplasmic reticulum.
For example, this sequence may be the sequence SEQ ID NO.:1 or a sequence coding for a peptide of sequence SEQ ID NO.:49 to SEQ ID NO.:78.
As indicated above, the signal peptide encoded by this sequence, when it is in the N- or C-terminal position in the polypeptide encoded by said polypeptide, can be cleaved during a polypeptide processing step chimeric, which usually occurs in the endoplasmic reticulum or in the Golgi.
Said polynucleotide can be placed under the control of elements of regulation, cloning or expression.
Thus, according to a particular embodiment, said polynucleotide is inserted into a cloning or expression vector, preferably a vector expression and more preferably a vector suitable for expression in eukaryotic cells. Said vector is preferably a plasmid.
Said polynucleotide is generally placed under the control of a promoter eukaryotic, preferably a strong eukaryotic promoter such as a promoter viral, for example, the promoter of a virus chosen from: SV40 virus, Rous sarcoma, murine leukemia virus (MuLV), leukemia virus T-cell adult human (HTLV-I), bovine leukemia virus (BLV), the Cytomegalovirus, a hybrid promoter derived from these viral promoters or a viral promoter containing modified sequences.
Said polynucleotide may further comprise a kozak sequence, in particular the ACCATGG nucleotide sequence, in which the ATG sequence corresponds to the codon of initiation of the coding sequence.
In addition, said polynucleotide may further comprise an intron.
According to a particular embodiment, said polynucleotide comprises at least least one nucleotide linker encoding a polypeptide linker such as defined above above. This nucleotide linker may in particular comprise or consist of a restriction site. By restriction site, we mean a sequence Particular nucleotide recognized by a restriction enzyme of the type II
as a cleavage site in the polynucleotide. As an example, this linker nucleotide may consist of the nucleotide sequence AGGTCTAGA, which includes the restriction site of the restriction enzyme Xbal (sequence TCTAGA).
According to a particular embodiment, the sequence of said polynucleotide is optimized for use in a host (eg a host eukaryotic) in particular a human being, a non-human mammal and / or a bird.
The present invention also relates to a cloning vector or expression, which is preferably a plasmid, characterized in that comprises A polynucleotide insert consisting of a polynucleotide of the invention, under the control of regulatory, cloning or expression elements.
The subject of the invention is also a cell culture selected from the group comprising cell cultures of bacteria, cultures cell primary animal eukaryotic cells and cell lines, said culture Cell containing a polynucleotide of the invention, a vector of cloning or expression of the invention, or a chimeric polypeptide of the invention.
The present invention also relates to a composition immunogen comprising a nucleic acid, in particular a DNA, characterized in that it comprises or consists of a polynucleotide of the invention, and a carrier, diluent or pharmaceutically acceptable carrier.
According to a particular embodiment, said immunogenic composition further comprises an adjuvant as defined in the present application.
According to a particular embodiment, said nucleic acid is a DNA.
The DNA-based immunogenic compositions target in vivo the host to be immunized, in particular dendritic cells (especially cells of Langerhans), which are excellent producers of vaccinating exosomes. So, this immunogenic composition can make it possible to induce production by the own cells of a host immunized with said immunogenic composition, exosomes carrying the peptide or the polypeptide of interest or a fragment of this one.
According to a particular embodiment, said immunogenic composition is a vaccine, especially a DNA vaccine.
The subject of the present invention is also a recombinant cell producing exosomes, especially a cell of the immune system and more particularly a cell of the immune system chosen from mast cells, lymphocytes, particularly B and T lymphocytes, and cells dendritic, particularly Langerhans cells, characterized in that it is recombinant with one or more polynucleotide (s) of the invention, a vector of cloning or expression of the invention or that it has absorbed a vesicle membrane of the invention.
In addition, the present invention also relates to a polypeptide of the invention, a polypeptide of the invention, one or more vesicle (s) membrane (s) of the invention (in particular one or more exosome (s) of the invention), a polynucleotide of the invention or a composition immunogen of the invention for use as a medicament, particular for use for the prophylaxis and / or treatment of an infection bacterial, viral, parasitic, or tumor. They are intended in particular at use in immunization, especially to elicit or promote (that is to say amplification) in vivo, in a host (human or non-human) an humoral and / or cellular against the tumor, the virus, the bacterium or the parasite whose the peptide or polypeptide of interest is derived. They can be especially used in in vivo to elicit or amplify a specific CD4 and / or T CD8 T response directed against the peptide or polypeptide of interest and / or to produce antibody polyclonal and / or monoclonal directed against the peptide or polypeptide of interest, in particular antibodies directed against a peptide or a polypeptide comprising or consisting of one or more conformational epitopes.
The present invention also relates to the use of a polypeptide of the invention (in particular a chimeric polypeptide of the invention), one or several vesicle (s) membrane (s) of the invention (in particular one or many exosome (s) of the invention), a polynucleotide of the invention or a immunogenic composition of the invention for the manufacture of a medicament for the prophylaxis and / or treatment of a tumor or infection by a pathogen or pathogen, including an infection bacterial, viral or parasitic.
Following the administration of an immunogenic composition, the principle of which active is a polynucleotide of the invention or one or more vesicle (s) membrane (s) of the invention, to a host (human or non-human), the cells producing exosomes of this host, in particular dendritic cells, will producing exosomes, comprising a chimeric polypeptide or a polypeptide of the invention and / or a degradation product of these last polypeptides, this degradation product that can naturally associate with a molecule major histocompatibility complex. These membrane vesicles, in particular those on the surface of which the peptide or polypeptide of interest or a fragment is exposed (in part or in whole) will elicit or promote an immune response directed against the peptide or polypeptide of interest.
A host within the meaning of the present application means a human or a non-human animal.
The term non-human animal as used in the present application includes any non-human mammal, including a rodent (particularly a mouse, a rat, a hamster or a rabbit), a monkey, a camelid, a cat, a dog, a horse, a mullet, a cow, a sheep, a pig, and also includes a bird, especially a chicken.
The term infection as used in this application means that said host (human or non-human) has been exposed to a pathogenic organism or a particular pathogen to an enveloped virus as defined in the this request. In particular such an infection is able to evolve towards clinical signs of pathologies induced or accompanying said infection. The term infection therefore also includes any clinical sign, symptom or occurring in a host (human or non-human) following its exposure to a pathogen or pathogen. For example, an infection viral or bacterial infection within the meaning of the present application includes both the earliest phases of virus contamination, bacterial or parasite, the intermediate phases, and the later phases of the contamination, as well as the various pathologies that are the consequence of the contamination of a host by a virus, bacteria or parasite it includes also the presence of all or part of a genome of a pathogenic organism.
The term prophylaxis refers to any degree of retardation in the the time of clinical signs or symptoms of the infection or the appearance of a tumor, as well as any degree of inhibition of severity signs clinics or symptoms of the infection or tumor, including but not limitation to, total prevention of infection or cancer. This requires that the polypeptides of the invention, the polynucleotide of the invention, the vesicles membrane or immunogenic compositions of the invention is administered to the host that may be exposed to a pathogenic organism or an agent pathogenic and / or likely to develop a tumor before the onset of all clinical sign or symptom of the disease. Prophylactic administration can occur before the host is exposed to the organism or agent pathogenic responsible for the infection, or at the time of exposure. Such a administration prophylaxis serves to prevent, and / or reduce the severity of any subsequent infection. Prophylaxis within the meaning of this application covers also total prevention of infection or cancer.
Treatment means the therapeutic effect that is produced on a host the chimeric polypeptide, the polypeptide, the polynucleotide, the vesicles membrane or one of the immunogenic compositions of the invention when administered to said host at the time of exposure to an organism or agent following exposure or after the appearance of clinical signs or symptoms of the infection or after the appearance of a tumor. When the active substances of the invention are administered to a host after contamination by a virus, they can be administered during the primary infection, during the asymptomatic phase or after the onset of clinical signs or symptoms of the disease.
The term treatment includes any curative effect obtained through a active substance of the invention, as well as the improvement of the clinical signs or observed symptoms in the host (human or non-human), as well as improving the condition of the host. So, the term treatment covers in particular the slowdown, the decrease, the interruption, as well as the a Viral, bacterial or parasitic infection or tumor growth and or adverse consequences of infection or appearance of the tumor; a treatment does not necessarily require the complete elimination of all signs clinics of the infection or tumor and all the symptoms of the illness or even the complete elimination of the virus, bacteria, parasites or cell tumor.
The active substances of the invention can therefore be administered to a host who is at risk of being exposed to an organism or an agent pathogen and develop an infection or tumor (prophylaxis) or after exposure of the host to an organism or pathogen, in particular after the manifestation of the first clinical signs or symptoms of the disease, by example after proteins or antibodies specific for a virus, bacteria, parasites or a tumor have been detected in the blood of the host (treatment).
The invention also relates to a method for preventing and / or treating a viral, bacterial or parasitic infection or a tumor, said method comprising at least one step of administration in vivo, to a host on requiring, of the chimeric polypeptide or polypeptide of the invention, one or more vesicle (s) membrane (s) of the invention (in particular one or more exosome (s) of the invention), a polynucleotide of the invention or a immunogenic composition of the invention. Said method of treatment is, in particular, suitable for and intended to elicit or promote, in vivo, at said host, a humoral and / or cellular response against the tumor, the virus, the bacterium or the parasite whose peptide or polypeptide of interest is derived.

The terms administration and administration as used in the present application include any administration, regardless of the route chosen.
The routes of administration and dosages vary according to a 5 variety of parameters, for example depending on the state of the host, the type infection and the severity of the infection to be treated or the importance of the tumor.
The chimeric polypeptide or polypeptide of the invention, as well as a or more vesicle (s) membrane (s) of the invention (in particular one or several exosome (s) of the invention), the polynucleotide of the invention or a The immunogenic composition of the invention may be administered has a human or non-human host in dry, solid form (particularly cachet, powder, capsule, pill, granule, suppository, polymer capsule or tablet, and more precisely accelerated release tablet, gastroresistant tablet or prolonged-release tablet), in gelatinous form or in the form of a Solution or a liquid suspension (in particular syrup, solution injectable, infusible or drinkable, nebulisates, microvesicles, liposomes) or in the form of patch. These compounds can also be in the form of doses in dry form (powder, lyophilisate, etc.) to be reconstituted at the time of use using a suitable diluent. Moreover, they can to be Packaged for administration as a single dose (single dose) or multiple (multidose).
In order to increase the beneficial effects of the immunogenic compositions of the invention, it is indeed possible to carry out an administration under the form of several successive administrations, repeated at one or more 25 occasions, after a particular time interval. They can furthermore to be administered with a second therapeutic agent, in particular an agent antiviral, antibacterial, antiparasitic or antitumor.
In the context of vaccination use, it may also be better to immunize a host, initially with a composition Immunogen based on a polynucleotide of the invention, particularly with a DNA vaccine of the invention, then, in a second step, with the vesicles membrane of the invention, an immunogenic composition based on said vesicles or an immunogenic composition whose active ingredient is a polypeptide of the invention, a chimeric polypeptide of the invention or one or several fragment (s) thereof (said polypeptide, chimeric polypeptide or their fragment (s) can be obtained in particular by purification or by chemical synthesis).
Alternatively, it may also be preferable to immunize a host, in a first step with the membrane vesicles of the invention or a immunogenic composition based on said vesicles, then, in a second time, with an immunogenic composition based on a polynucleotide of the invention, in particular with a DNA vaccine of the invention.
The active substances of the invention can be formulated for a enteral, parenteral (intravenous, intramuscular) administration or subcutaneous), transcutaneous (or transdermal or percutaneous), cutaneous, oral, mucosal, in particular transmucosal-oral, nasal, ophthalmic, otologic (in the ear), vaginal, rectal, or intragastric ways, intracardiac, intraperitoneal, intrapulmonary or intratracheal.
The immunogenic compositions based on a polynucleotide of the invention and in particular, the DNA vaccines of the invention are preferably administered to a host intramuscularly or subcutaneously, using either a needle and a syringe, an injector without a needle, in particular a air gun tablet capable of propelling, within the cells of a host, microbeads gold, tungsten or platinum loaded with DNA (biolistic pistol or gun to gene), for example the company Helios Gene Gun System pistol BioRad.
The quantity of active ingredient administered to a human or non-human host is a therapeutically effective amount, i.e., an active amount, sufficient, at dosages and for necessary periods of time, for achieve a significant effect and in particular bring a profit significant to the host in the context of an administration for prophylaxis or treatment such than defined in this application. A therapeutically effective amount is also a quantity for which the beneficial effects outweigh a any toxic or harmful effect of the active ingredient (s). Such a quantity may correspond to an amount sufficient to inhibit the replication viral growth, bacterial growth or tumor growth significant or to make disappear, reduce, or improve any infection caused the pathogen or agent. The amount therapeutically effective varies depending on factors such as condition of infection, the age, sex or weight of the host. Dosage regimens can be adjusted in order to obtain an optimum therapeutic effect.
The subject of the present invention is also a process for obtaining in vivo membrane vesicles, in particular exosomes, characterized in that comprises a step of administering a polypeptide of the invention (in particular a chimeric polypeptide of the invention), one or more vesicle (s) membrane (s) of the invention (in particular one or more exosome (s) of the invention), a polynucleotide of the invention or a composition immunogenic of the invention to a host (human or non-human). This process can be implemented in the context of a method for prophylaxis and / or the treatment of a tumor or infection by a pathogenic organism or by a pathogen, including a bacterial, viral or parasitic.
The present invention further relates to an in vitro production process membrane vesicles and in particular exosomes containing a peptide or a polypeptide of interest and / or a degradation product of this peptide or a polypeptide of interest, this degradation product possibly being associate to a molecule of the major histocompatibility complex. Said method comprises the following steps:
a) the introduction into an exosome-producing cell of one or more polynucleotide (s) of the invention, which encodes (s) a polypeptide comprising said peptide or polypeptide of interest, or contacting a cell producer of exosomes with one or more vesicle (s) membrane (s) of the invention, who comprises (a) a polypeptide comprising said peptide or polypeptide of interest and / or a degradation product of this polypeptide, or with a composition with base of such vesicles;
b) culturing said exosome producing cell;
c) the recovery of membrane vesicles and in particular exosomes produced by said exosome producing cell.
According to a particular embodiment, the cell producing exosomes is a cell of the HEK293 line, or a derived line, or a cell of the immune system. In particular, the immune system cell can to be selected from mast cells, lymphocytes, in particular lymphocytes T and B, and dendritic cells. The immune system cell is preferably a dendritic cell, for example a Langerhans cell.
According to a particular embodiment, step a) consists in the implementation contact of one or more vesicle (s) membrane (s) of the invention, in particular of one or more exosome (s) of the invention, with a dendritic cell.

According to a particular embodiment, said method furthermore comprises an intermediate step between steps a) and b), during which the cell is selected and / or stimulated to induce and / or increase the secretion of exosomes or to obtain exosomes with defined qualities, in particular particular to induce specificity in the composition of exosomes in certain cellular proteins, for example the ICAM protein.
According to a particular embodiment, the introduction of one or more polynucleotide (s) of the invention in a cell producing exosomes step a) is carried out by transfection or by transduction.
According to a particular embodiment, step c) is carried out by purifying membrane vesicles and in particular exosomes from the supernatant of culture of the cell producing exosomes by centrifugation differential, by ultrafiltration, by adsorption on a support, or by any other method.
Membrane vesicles and in particular the exosomes obtained by this method are also part of the invention.
The present invention also relates to the use of one or more vesicle (s) membrane (s) of the invention, or an immunogenic composition to vesicle base (s) of the invention to produce antibody directed against the peptide or polypeptide of interest, these antibodies being destined for use in diagnosis or research.
The present invention also relates to a preparation process of a polyclonal serum directed against one or more peptide (s) or polypeptide (s) antigen (s) of interest expressed on the surface of membrane vesicles, in particular of exosomes, said method comprising the following steps:
(a) the administration, where appropriate repeated, to a non-human animal of membrane vesicles of the invention, an immunogenic composition of invention or a polynucleotide of the invention, whether or not associated with a adjuvant; and (b) the recovery of formed antibodies capable of recognizing the peptide (s) or antigenic polypeptide (s) of interest.
According to a particular embodiment, step a) is followed by a step of sacrifice of the non-human animal.
The subject of the present invention is also two preparation methods monoclonal antibodies directed against one or more peptide (s) or Antigenic polypeptide (s) expressed on the surface of vesicles membranous, in particular exosomes. The first method comprises the following steps:
a) fusion, with myeloma cells, of spleen cells previously obtained in a host (human or non-human), for example a Balb / c mice, which were administered membrane vesicles the invention, an immunogenic composition of the invention or a polynucleotide of the invention, the where appropriate in combination with an adjuvant and, where appropriate, administration repeated;
b) the cultivation and selection of hybridomas under conditions allowing antibody production;
c) the recovery of the monoclonal antibodies directed against the peptide (s) or antigenic polypeptide (s) of interest.
The second method of preparing monoclonal antibodies comprises the following steps:
a) the immortalization of antibody-producing cells, for example lymphocytes or lymphoblasts, from hematopoietic cells, more particularly of blood cells, previously obtained from a host (human or non-human), for example a Balb / c mouse, which has been administered membrane vesicles of the invention an immunogenic composition of the invention or a polynucleotide of the invention, if appropriate in combination with adjuvant and, if appropriate, repeated administration;
b) culture and selection of immortalized cells under conditions allowing the production of antibodies;
c) the recovery of the monoclonal antibodies directed against the peptide (s) or antigenic polypeptide (s) of interest.
Immortalization of the antibody-producing cells in step a) can be carried out in particular by infection of these cells with a immortalizing virus.
This immortalizing virus can be a herpes virus, for example the virus Epstein Barr. This immortalization can also be done by modifying the genome of the antibody-producing cells with an immortalizing component.
This immortalizing component can be a viral component, for example a virus herpes or a cellular gene, for example the telomerase gene.
The non-human animal to which membrane vesicles have been administered, an immunogenic composition or a polynucleotide of the invention in the context of process for preparing a polyclonal serum or methods of preparation Monoclonal antibodies can be especially a rodent (in particular a mice, for example a Balb / c mouse, a rat, a hamster or a rabbit), a bird, especially a chicken, or a mullet.
According to a particular embodiment of the two preparation methods monoclonal antibodies of the invention, the spleen cells or the cell 15 antibody producers of step a) were previously obtained from a non-human host after a sacrifice step of said non-human animal.
If necessary, the monoclonal or polyclonal antibodies produced by the methods for preparing antibodies of the invention may be "humanized", that is, modified by genetic engineering so as to replace as much as possible 20 Fc constant fragments of the original species by human fragments.
The present invention also relates to the use of a polypeptide of the invention, a polypeptide of the invention, one or more vesicle (s) membrane (s) of the invention or an immunogenic composition of the invention, for the detection (in particular in vitro) of specific Capable of interacting with said peptide or polypeptide of interest or with a fragment of said peptide or a polypeptide of interest.
The present application also relates to an in-line screening method.
of molecules or a method for selecting cells producing molecules interacting with a peptide or polypeptide of interest or with a Fragment of said peptide or polypeptide of interest, said method comprising:
a) contacting membrane vesicles of the invention with one or several molecules likely to interact with said peptide or polypeptide of interest;

b) the detection of a possible interaction between said peptide or polypeptide of interest or a fragment of said peptide or polypeptide of interest and said said molecules.
The interactions between said peptide or polypeptide of interest and a possible partner can be demonstrated in vitro by any technique allowing to demonstrate protein interactions and in particular between a protein and its ligand, for example, by coimmunoprecipitation experiments, by for example by ELISA, for example by flow cytofluorimetry, for example by PAGE-SDS or western blot electrophoresis, as well as by any high throughput screening technique to demonstrate protein interactions and in particular between a protein and its ligand, by example of techniques measuring changes in inositol phosphates, or in cAMP, or calcium, or energy transfers (eg FRET technique or BRET) between molecules or between two domains of molecules.
According to a particular embodiment, the membrane vesicles used in step a) of the screening method of the invention are such that at least a peptide or polypeptide of interest or at least one of their fragments is exposed, in part or in whole, outside of said vesicle membrane. said The peptide or polypeptide of interest may in particular be a receptor for multiple transmembrane domains, for example the CXCR4 receptor or a receptor with a single transmembrane domain, for example the CD4 receptor or EGF-R1.
Finally, the subject of the present invention is also a kit comprising a polynucleotide of the invention and a user guide.
Other features and advantages of the present invention appear in the examples and figures that follow.

DESCRIPTION OF THE DRAWINGS

Figure 1: Representation of different types of CD8-CDTM constructions studied. Construction X2 (sequence SEQ ID NO.79 and SEQ ID NO.80):
the CD8 ectodomain (ED) is fused with the transmembrane domains (tmD) and cytoplasmic (CD) BLV TM protein. This construction retains the two palmitoylation sites Cys 1 and Cys 2 as well as the residue non-palmitoylable cysteine regulator (Cys 3) of the BLV TM protein.
Construction X3 (sequence SEQ ID NO.81 and SEQ ID NO.82): ED and a portion tmD of CD8 are fused with a tmD portion of the BLV and the entire CDTM BLV. BLV's TmD is then amputated from its first 15 residues. This construction retains both sites of palmitoylation (cysteine residues in positions 153 and 158) as well as the regulating cysteine residue palmitoylable (the cysteine residue in the C-terminal position; Cys 3) of the BLV TM protein.
Construction X4 (sequence SEQ ID NO.83 to SEQ ID NO.86): The major part CDTM BLV is preserved. In this construction, the domain transmembrane of mouse CD8 alpha is linked by a sequence linker "RSR" to the CD domain of the BLV TM protein. This construction does not include that the non-palmitoylable regulating cysteine residue (Cys 3) of the TM protein of BLV.

Figure 2: Summary of the sequences of the chimeric proteins obtained at go mouse CD8 alpha protein and BLV TM protein. Residues underlined correspond to the residuals of the transmembrane helices of CD8 alpha and TM proteins. The three cysteine residues of the BLV TM protein which have been mutated (substitution by an alanine residue) are indicated by Cl, C2 and C3. The chimeric proteins created correspond to the constructs X2 (SEQ ID NO.79 and SEQ ID NO.80), X3 (SEQ ID NO.
SEQ ID NO.82) and X4 (sequence SEQ ID NO.83 to SEQ ID NO.86).

Figure 3: DNA preparations by the STET method. The numbers 1 to 7 correspond to the sample numbers of the STET products. M represents the size marker. The bands corresponding to the super plasmid DNA
wrapped are framed.

Figure 4: Control of the presence of DNA in purification products sure column. The bands corresponding to the super-coiled plasmid DNA are framed. A: DNA obtained by the STET method and deposited on a column. E and E
Fractions retained on the column then eluted. FT: Fraction not retained. M

Size marker.

Figure 5: Spectrometric assays of aliquots and adjustment of DNA concentrations after enzymatic digestion. The double arrow indicates that the concentrations have been readjusted.

Figure 6: Control of DNA identity after enzymatic digestion Discriminations of CD8-CDTM mutants. A: discrimination of mutants pX2 AAC and pX2 CCA. B: X2 mutant discrimination between them.

Figure 7: Western Blot Analysis of the Expression of the Different Chimeras CD8-CDTM. The CD8-CD ™ chimera is indicated by an arrow.

Figure 8: Western blot analysis of the expression of the different chimeras CD8-CDTM after immunoprecipitation. The CD8-CDTM chimera is indicated by an arrow.

Figure 9: Western Blot analysis of CD8-CD TM expression in exosomes isolated by ultracentrifugation. The signal at 55 kDa corresponds to the presence of CD8-CDTM

Figure 10: Western blot analysis of the CD8-CD TM content of the vesicles isolated after sedimentation on sucrose density gradient, for mutants pX4 --C and pX4 --A.

Figure 11: Western Blot Analysis of CD8-CDTM Expression After Lysis depending on the presence or absence of vesicular transport inhibitors.
The chimera CD8-CDTM is indicated by an arrow.

Figure 12: Western blot analysis of the expression of CD8-CD TM within the exosomes, depending on the presence or absence of vesicular transport inhibitors. The chimera CD8-CDTM is indicated by an arrow.

Figure 13: Confocal immunofluorescence imaging analysis of general phenotypes - Phenotype A - HEK293 cells transfected with pX2 CAC. This phenotype is found in pX2 mutants conserving Cys 3: pX2 CCC, pX2 ACC, pX2 CAC and pX2 AAC. (See results section, location by immunofluorescence) Figure 14: Confocal immunofluorescence imaging analysis of General phenotypes - Phenotype B - Cells transfected with pX2 CAA. This phenotype is found in pX2 mutants that do not retain Cys 3: pX2 CCA, pX2 ACA, pX2 CAA and pX2 AAA. (See results section, location by immunofluorescence) Figure 15: Confocal immunofluorescence imaging analysis of General phenotypes - Phenotype C - Cells transfected with pX3 CCC. This phenotype is found in the two pX3 mutants studied: pX3 CCC and pX3 ACC. (See results section, immunofluorescence localization) Figure 16: Confocal immunofluorescence imaging analysis of General phenotypes - Phenotype D - Cells transfected with pX4 --C. This phenotype is found in the two pX4 mutants studied: pX4 --C and pX4 --A.
(See results section, immunofluorescence localization) Figure 17: Confocal immunofluorescence imaging analysis of general phenotypes - Phenotype E - Cells transfected with pX4 stp. This phenotype is found only in pX4 stp. (See results section, immunofluorescence localization) Figure 18: Confocal Immunofluorescence Imaging Analysis of Zones perinuclear with a strong FITC signal. Cells transfected with pX3 CCC.

Figure 19: Representation of the CDTM mutant panel Figure 20: Scheme of the Topo plasmid (pCR-Blunt II-TOPO) used to clone the different PCR products. The Topo vector provides in the Topo-blunt kit cloning (Invitrogen) is linearized and has, at each of its ends 3'-phosphate, the Topoisomerase I of vaccinia virus, which allows to link the products of PCR
with the linearized Topo vector.

Figure 21: Expression vector pBluescript It KS (+).

Figure 22: Scheme of the plasmid pKSII-CD8a.

Figure 23: Schematic of the retroviral plasmid pLPCX used for the expression of chimeric genes. These genes are introduced at the multiple site of cloning.
Figure 24: Diagram of the final chimeric constructs cloned in the Retroviral expression vector pLPCX.

Figure 25: Expression Visualization and Exosomal Protein Targeting chimeras. Western blot anti-CD TM and anti-CD8a for cell lysates and exosomal of all mutant proteins and wild CD8a-CD TM (size ranging from 31 kDa to 27 kDa) as well as the negative control (expression vector PLPCX containing CD8a alone). Anti-CD TM and anti-CD8a rabbit sera are diluted to 1 / 200th. The secondary anti-rabbit IgG antibody coupled to the peroxidase is diluted to 1/5000 Figure 26: Comparative Results of Associated CD8a Detection Experiments to exosomes by flow cytofluorimetry and Western Blot. Table giving the 15 results of the expression and targeting to the exosomes of different protein chimeras analyzed. Mutants reported by a star are significant for the exosomal targeting. The presence of CD8a on exosomes is identified by flow cytofluorimetry using a mouse monoclonal antibody fluorescent specific for a conformational epitope of the CD8a protein (antibody 53-6.7 of 20 at Pharmingen).

Figure 27: Expression of CD8 on the surface of exosomes. Histogram representing the average measurements of the exposure of each chimeric protein on the surface of exosomes. These measurements were performed by cytofluorimetry 25 of flow. The exposure of each chimeric protein is expressed in percentage per relative to the exposure of the wild-type CD8a-CDTM chimeric protein (construction n 9 on the histogram = 100%). The standard deviation is indicated. The proteins chimeras analyzed are: 1: negative control (pLPCX expression vector containing the CD8a alone); 2: KS5; 3: KS6; 4: KS8; 5: KS9; 6: KS10; 7: KS12; 8: KS14;
9: wild-type sequence; 10: no construction; 11: KM4; 12: KM5; 13 : S;
14: KTMY; 15: KM8; 16: E; 17: KM9; 18: KM 11/1; 19: KM 11/3; 20:
D and 21: KM13. The observed results confirm the results presented in figures 25 and 26.

FIG. 28: Representation of various pLPCX expression plasmids obtained after cloning of chimeric genes encoding single or multiple transmembrane domains.

Figure 29: A. Western blot anti-CDTM-BLV analysis performed on the extracts cell protein from untransfected HEK293T cells (NT) or transfected with the pLPCX expression vectors containing the three constructs coding for the three chimeric proteins. Primary antibody of rabbit anti-CDTM-BLV is used diluted to 1/200. The secondary antibody IgG from rabbit coupled with peroxidase is used at 1/2000. B. The sizes of the bands observed correspond to the expected sizes and are noted on the right.

Figure 30: A. Western Blot anti-CDTM-BLV analysis performed on the extracts of exosomal proteins produced by untransfected HEK293T cells (N-T) or transfected with the pLPCX expression vectors containing the three constructs coding for the three chimeric proteins. Primary antibody of rabbit anti-CDTM-BLV is used diluted to 1/200. The secondary antibody IgG from rabbit coupled with peroxidase is used at 1/2000. B. The sizes of the bands observed correspond to the expected sizes and are noted on the right.

Figure 31: Coomassie Blue Disclosure of Protein Prints different cell extracts (A) and exosomes (B).

EXAMPLES

MATERIAL AND METHODS
1. Preparations of plasmid DNAs:
A. Transformation of bacteria:
DH5a competent bacteria (200 μl) are transformed by shock 12.5 ng of each of the 13 studied DNAs encoding CDTMs wild-type mutants of the BLV virus, as well as by a plasmid devoid of insert (pLPCX) acting as a negative control.
The bacteria are then spread on LB / Agar medium containing 50 μg / ml Ampicillin, at 37 C for 16h. They are then kept at 4 C.
B. Pre-culture and culture of bacteria:
A colony of each type of bacteria is then pre-cultured in 3 ml of LB medium containing 100 μg / ml of ampicillin, at 37 ° C.
agitation, for about 8 hours.
Each pre-culture will be used to inoculate, on 1/200, two bottles containing each 250 ml of LB / Amp (100 μg / ml). Incubation is at 37 C, under agitation, for 12 to 16 hours.

C. Maxreparation STET:
The resulting cultures are centrifuged (GR 412, Jouan) 20 min at a speed of 3600 rpm and at a temperature of 4 C. The pellets are included in ml of STET buffer (Sucrose 8%, Triton X100 5%, Tris HCI pH 8 50 mM, EDTA
50 mM), to which 500 μl of lysozyme (10 mg / ml, Sigma) and 250 μl of RNase (2 mg / ml, Sigma). The tubes are then incubated for 10 min at 100 ° C. then centrifuged at 16000 rpm for 30 min. The supernatants obtained are incubated 45 min at 65 ° C. in the presence of 1 mg / ml of proteinase K (Amresco). The Supernatants are taken and the DNA is precipitated with 0.15 volume of acetate sodium (AcNa) 3 M pH 6 and 0.6 volume of isopropanol. Solutions are centrifuged (Aventi 30, Beckman) at 4 C for 15 min at 15,000 rpm. The pellets obtained are washed with 10 ml of ethanol before being centrifuged again.
according to the previous parameters. The nucleic acids obtained are then dried and taken up in 2 ml of 1 X TE and kept at 4 C.
The presence of super-coiled DNA is verified, for each product of Maxpreparation, by electrophoresis of 0.2 μl and 1 μl of the products by electrophoresis on 0.8% agarose gel.

D. Column purification:
STET maxipréparations allow to obtain large quantities plasmids, but the degree of purity can be improved. For this, we have purified each of the 14 plasmids by performing a double pass on AX100 columns (PC Nucleobond Kit 100, Macherey Nagel). After precipitation to isopropanol, the purified plasmids obtained are taken up in 500 μl of TE1X
and kept at 4 OC.
The presence of super-coiled DNA is then verified by electrophoresis agarose gel (0.8%) for each eluate obtained as well as for the fraction no-retained on the columns (FT = flow-trough).
The DNA concentration of the solutions obtained is evaluated by spectrophotometry at a wavelength of 260 nm.

E. Aliquoting and EtOH precipitation:
Each type of DNA is aliquoted in tubes of 50 or 100 μg, and then a precipitation with ethanol (EtOH) and NaCl, under a flow hood laminar, so to sterilize the plasmids. The pellets obtained are taken up at the rate of 200 of TE1X per 100 μg of plasmids, a concentration of 500 ng / μl. The presence of DNA in the aliquots is verified by agarose gel electrophoresis 0.8 %.
F. Spectrophotometric Assays of the Aliquots Obtained:
The aliquots are determined spectrophotometrically at a wavelength of 260 nm. The samples are diluted to 1/50 and are dosed in a volume final 500 pl.

G. Enzymatic digestion The identity of each plasmid is controlled by digestion of 20 ng of each of them by restriction enzymes (New England Biolabs): the couple Hind III / Not I, Xba I, Aat II, Pac I, Sfo I. The plasmids are discriminated according to number of bands obtained and their molecular weight, after electrophoresis on gel agarose (0.8%) of each digestion product.

IL Analysis of the expression of chimeras A. Cell culture:
HEK293 (Human Embryonic Kidney cells, cells human kidney embryos) are grown in DMEM (Dulbecco's modified Eagle's medium), supplemented with 10% fetal calf serum (FCS) and 20 μg / ml gentamicin, at 37 ° C under 5% CO 2.

B. Transfection:
For transfections, 5.105 cells are seeded into 2 ml of medium per well of 9.6 cm2 (6-well plates). After incubation overnight at 37 OC sub 5%
of CO2, the medium is replaced by complete DMEM without antibiotics.
The cells are then transfected with a polyplex formed by the complexation, in a NaCl buffer (0.15 M), of 6 μl of Jet PEI (Qbiogen) and 3 pg of each nucleic acid to be tested; A LacZ-expressing plasmid serves of positive control for transfection. After 24 hours of incubation at 37 OC under 5%
of CO 2, the medium is removed and replaced with complete DMEM with 20 μg / ml of gentamicin. The optimum expression of the plasmids is obtained 48 h after the beginning of transfection.
In some cases, to analyze the importance of vesicular transport in the degradation and targeting of CDTM, we used inhibitors of vesicular transport which are bafilomycin and Ly 294002. 32 h after transfection, each inhibitor is added to the culture medium at a concentration 0.5 μM for bafilomycin and 10 μM for Ly 294002.

C. Protein extraction:
48 h after transfection the cells are lysed by a buffer TNE-NP40 0.5% to which 0.1 mM PMSF is added. After clarification by centrifugation (14000 rpm, 15 min, 4 C, Eppendorf 5417R), the lysates are assayed by spectrophotometry (at 595 nm) according to the Bradford technique.
For each sample, we take 200 μg of protein that we complete by lysis buffer for a final volume of 30 pl to which we add 10 pl of 4X sample buffer (4X CB: 200mM NaOH, 20mM EDTA, 2% SDS, Green of bromocresol 0.05%, glycerol 10%).

D. Preparation of exosomes:
Before lysis of the cells, the culture media are recovered and precentrifuged at 10000 rpm for 20 min at a temperature of 4 OC (Aventi 30, Beckman). The supernatants obtained are then ultracentrifuged (Optima LE-80K, rotor Ti 50, Beckman) at 100000 g for 2 h at a temperature of 4 C.
The pellets obtained are taken up in 100 μl of CB 1 X.
We also analyzed the exosomes by gradient sedimentation.
sucrose density. The pellets obtained after ultracentrifugation of the media of The culture is then taken up in 100 μl of a 0.25 M sucrose solution.

The vesicles are then deposited on a sucrose gradient prepared with 8 layers (1.2 ml) of different densities (in molarity): 0.5 / 0.75 / 1 /
1.25 /
1.5 / 1.75 / 2 / 2.5. The tubes are then centrifuged (Optima LE-80K, rotor SW 41, Beckman) at 39,000 rpm for 16 h, at a temperature of 4 C.
After centrifugation, the gradient was taken in fractions of 700 μl. The Proteins are then precipitated by the addition of the same volume of TCA 30%.
The tubes are kept for 2 hours at 4 C and then centrifuged (Eppendorf, 5417R) at temperature of 4 OC for 20 min at 13000 rpm. The pellets are included in 500 μl of acetone and new centrifuges as before.
The pellets then obtained are taken up in 80 μl of CB1X and analyzed by Acrylamide-SDS and Western Blot gel migration.

E. Western Biot and Immunoprecipitation:
The protein samples obtained are analyzed by western blot: after migration and separation on acrylamide gel (12.5%), the proteins are Transferred onto PVDF hydrophobic membrane (Immobillon-P, Millipore).
The presence of the mutants of the TM protein is revealed by immunostaining at using the following anti-bodies:
= Primary antibody: Anti-CDTM BLV rabbit antiserum (Dilution 1/200).
= Secondary antibody: Anti-rabbit IgG labeled with peroxidase (Dilution 1/5000; Jackson Immuno Research, JIR) The presence of transferrin receptors is revealed by immunostaining using the following antibodies:
Primary antibody: Mouse anti-human TFR mouse IgG (Dilution 1/200; Zymed) = Secondary Antibody: Mouse Anti-IgG (Dilution 1/5000; JIR) In order to selectively increase the concentration of the protein under study, we we also performed immunoprecipitations on protein lysates, prior to gel migration. After normalization of the quantities of proteins, the adsorption of the lysate is done on sepharose 6B, so to eliminate nonspecific reactions and immunoprecipitation is performed with protein Sepharose 6A, in the presence of 2.5 μg of the following antibodies:
= Primary antibodies:
Mouse Anti-CD8 Mouse IgG (19/178) (JIR) Rat Anti-CD8 Rat IgG (53/672) (JIR) = Secondary antibodies:
Anti-mouse IgG (JIR) Anti-rat IgG (JIR) The pellets obtained are then taken up in 70 μl of 1.5 × CB.
III. Localization by immunofluorescence A. Preparation of the coverslips Coverslips are sterilized with absolute EtOH
laminar flow, then placed in wells of 1.9 / cm2 (24-well plates) before to be coated with poly-L-Lysine (25 μg / ml, Sigma) for 1 hour at 37 ° C.
After washing with PBS, the coverslips are stored at 4 ° C. in 1 ml of PBS.

B. Cell culture and transfection.
HEK293 cells are cultured and transfected according to the method described in the Analysis part of the expression of chimeras. 24 hours after transfection the cells are taken up in 35 ml of complete DMEM and then distributed in of the 1.9 cm2 well (24-well plates), containing the slides sterilized and coated, at a rate of 1 ml of cell dilution per well.
The Cells thus cultured are incubated for 24 h at 37 ° C. under 5% CO 2.

C. Fixation and permeabilization.
The cells are then fixed for 30 min with a solution of formaldehyde (4%) then permeabilized with Triton X-100 (0.2% final). After 3 10 min rinses with PBS, the slides are preserved with 1 ml of PBS, at 4 OC.

D. Markings for immunofluorescence.
The different antibodies available have allowed us to test several markings for immunofluorescence localization:

CD8 markings:
N 1: mouse IgG / mouse anti-CD8 (19/178) (JIR) + mouse anti-IgG
FITC
(JIR) N 2: mouse mouse anti-mouse (19/178) (JIR) + anti-mouse IgG
mouse FITC (JIR) N 3: rat IgG / mouse anti-CD8 (53/672) (JIR) + FITC rat anti-IgG
(JIR) N 4: rat IgG (53 / 6.7) / mouse anti-CD8 FITC (Pharmingen) Markings of intracellular compartments:
N 5: Mouse IgG / Anti-CD63 (Lamp3) Human (Zymed) + Mouse Anti-IgG
Cy3 (Sigma) N 6: mouse IgG / anti-human Lampl + Cy3 mouse anti-IgG (Sigma) N 7: mouse IgG / anti-human Tf2 (Zymed) + Cy3 mouse anti-IgG (Sigma) N 8: Rabbit IgG / anti-caveolin (BD) + Rabbit Anti-IgG TRITC (JIR) RESULTS
Knowledge about the exosome formation process is partial. Similarly, the functions associated with the cytoplasmic domain of Env are poorly characterized. This study is based on the assumption that the model The BLV is a good tool for studying the formation phenomena of exosomes and viral particles and that the cytoplasmic domain of the protein TM (CDTM) of the BLV is a potentially interesting tool for the development vaccination with exosome display.
To evaluate these potentialities and to characterize the functions responsible for the targeting of the BLV TM protein, and more specifically the role palmitoylated cysteine residues or not, we have developed several vectors allowing expression within eukaryotic cells of proteins chimeric transmembrane comprising the ectodomain of the CD8 protein of mouse and the CDTM domain (chimeric CD8-CDTM proteins). CD8 chimeras Wild CDTMs as well as mutated CD8-CD TM chimeras were expressed.
The mouse CD8 ectodomain is, in a human cell, an element Neutral does not interfere with cellular receptors. The chimeras used We thus ensure the absence of interactions between the ectodomain of protein and cell structures.
As a consequence, these chimeras make it possible to study specifically the cytoplasmic and transmembrane domains of the TM protein, avoiding the phenomena caused by the ectodomain of the TM protein and the SU protein associated with it.
Three types of constructions were used (see Figures 1 and 2). From of these constructs we have developed different pLPCX expression vectors allowing the expression of wild-type or mutated CD8-CD TM residues cysteine 1, 2 and 3 (schematized by the acronym CCC). The cysteine residues are so replaced, or not, by alanine residues, which can not be palmitoylated.
The wild or mutated CD8-CD TM proteins studied are:
= 1: pX2 CCC (wild type) = 2: pX2 ACC
= 3: pX2 CAC
= 4: pX2 AAC
= 5: pX2 CCA
= 6: pX2 ACA
= 7: pX2CAA
= 8: pX2 AAA
= 9: pX3 CCC (wild type) = 10: pX3 CAC
= 11: pX4 - - C (wild type) = 12: PX4 - A
= 13: pX4 stp (pX4 stp is composed only by ED, tmD and a small part of CDTM CD8).
These constructions allowed us to study, at the level of the targeting of the protein TM: the consequences of the mutation of cysteine residues, the importance of the integrity of the trans-membrane domain of TM protein, and the importance of cytoplasmic domain of TM protein (CDTM) 1. Preparation of plasmid DNAs:
At first, we produced, in large quantities, each of our 13 DNAs as well as a vector without insert (pLPCX) acting as a control negative. After culturing bacteria transformed by our different plasmids, the The resulting DNAs were purified successively by the STET method and then column. The identity of the plasmids obtained was then checked by digestion enzyme.

A. DNA preparations by the STET method:
In order to verify the integrity of plasmid DNAs and the yield of STET preparations, we performed a migration of 1 μl and 0.20 μl of each of them, on agarose gel (0.8%, see Figure 3). The non-degradation of DNA
is highlighted by the presence of distinct bands of super-coiled DNA of homogeneous sizes.

B. Control of the presence of DNA in the products of column purification:
The DNAs obtained by the STET method are purified on columns, the retained fractions then elected and the fractions not retained are then analyzed by gel electrophoresis to verify DNA integrity purified obtained. The gel shown in Figure 4 tells us that the super-coiled DNA is well present in the pure eluted fractions of columns (E and E ') but undetectable in non-retained fractions (FT).

C. Spectrometric assays of aliquots and adjustment of DNA concentrations after enzymatic digestion:
The purified DNAs are then assayed with the spectrophotometer. The concentrations then obtained vary, depending on the aliquots, between pg / ml and 584 μg / ml. After precipitation with EtOH, the DNAs of the aliquots are taken again in TE1X and adjusted to the same concentration.
In order to verify the DNA concentrations, we have linearized the plasmids by enzymatic digestion, using the Hind III / Not I pair, and then we analyzed them on gel electrophoresis (see Figure 5, upper profile).
It is appeared that the intensity of the bands obtained was still variable. We have therefore readjusted the concentrations according to the spectrometric assays and of the intensity of the bands obtained after digestion (see Figure 5 - profile inferior).
Obtaining bands of equal intensity, in addition to ensuring the accuracy of concentrations of our DNA before transfection into cells, will allow a better legibility of electrophoresis after enzymatic digestion, during the control of plasmid identity.

D. DNA identity control after enzymatic digestion.
1) General principle:
In order to ensure the identity of the 14 DNAs prepared, all are controlled by digestion with restriction enzymes Hind III and Not I, Xba I, Aat II, Pac I
5 as well as Sfo I which must result in different combinations of profiles on gels for each of the DNAs. Agarose gel migration (0.8%) of the products of digestions allows the discrimination of DNAs depending on the number and the cut obtained, as shown in Table 1 (note: bands less than one hundred base pairs are not visible sure 10 our electrophoresis gels):

Nin1) re of the dièonque F? T? Telms apre ~ Ii estl ~ lis Table 1 1 \ 1 Pla3irride Hitid IILN +; t I <ba I Aat II I Sfo I Pac I
1 pX2 w. ~ = T TI \ .I

15 p \ 2I` ('A 4 (k) 3 pX2I1.12 2 9 4 1 (1) 4 pX2 114 4 r 0 P, 72 tf p 21t116 8> (~) 1 pX2 lt it? 9 to 1 8 pX2 M 18 9 0 PX: GZ't TIt1 2? 8 4 0 (B) `(t 10 pX3 NI15 -, -1 1 11 p ~ ~ 4 wt TM 1 $ 1 (vs) 12 p ~ 4 NI1S 1} tg) 8 1 pX4; tp 1 (d) "_ (l1) 8 d The digestion of the constructions studied makes it possible to ascertain the identity of each plasmid. Discrimination of major construction types CD8-CDTM
is done by analyzing the number and size of the bands obtained after digestion with the enzymes Hind Ill / Not I and Xba I. Discrimination between different mutants of cysteine residues is done after digestion with Aat II enzymes, Pac I
30 and Sfo I. The number of bands then obtained is greater than with the digests by Hind Ill / Not I and Xba I, and the discrimination is carried out in based on mainly on the presence or absence of specific bands (in bold).

Sizes of the expected bands (in bp):

a): 7206/49 (g): 6552/610 (b): 6868/311 (h): 6552/385 (c): 7162 (i): 4285/1055/801/498/294/186/83/53 (d): 6937 (j): 3423/1055/862/801/294/186/83/53 (e): 6822/367/66 (k): 4276/2538/310/131 (f): 6812/367 (I): 4276/1839/699/310/131 2) Example:
For discrimination of mutants pX2 AAC and pX2 CCA, the gels get are shown in Figure 6A.

Interpretation:
Digestion by Hind III / Not I: Obtaining a single band at approximately 7206 bp, corresponds to the presence of X2 or X4 constructs in each of the two samples.
Xbal digestion: obtaining two bands at about 6822 (or 6812) and 367 bp correspond to the presence of X2 or X3 constructs in each of the two samples.
By cross-checking these two results we can say that we are so well in the presence of two constructions of type X2.
We then try to discriminate mutants X2 with each other (see FIG. 6B):
Interpretation:
= Digestion by AatII
- Sample 4: obtaining a specific band around 3423 bp (red) corresponds to the presence of one of the following X2 plasmids: pX2 CAC, pX2 AAC, pX2 CAA or pX2 AAA.
- Sample 5: obtaining a specific band around 4285 bp (blue) corresponds to the presence of one of the following X2 plasmids: pX2 CCC, pX2 ACC, pX2 CCA or pX2 ACA.
= Digestion by Sfo I
- Sample 4: obtaining a specific band around 2538 bp (red) corresponds to the presence of one of the following X2 plasmids: pX2 CCC, pX2 ACC, pX2 CAC, pX2 AAC. By cross-checking this result with that of digestion by Aat II

we can then infer that we are in the presence of one of the following plasmids: pX2 AAC or pX2 CAC.
- Sample 5: obtaining 2 specific bands around 1839 bp (black) and 699 (green) pb corresponds to the presence of one of the following X2 plasmids: pX2 CCA
pX2 ACA, pX2 CAA, pX2 AAA. By cross-checking this result with that of the digestion by Aat II, we can then deduce that we are in presence of one of the following plasmids: pX2 CCA or pX2 ACA.
Digestion by Pac I:
We obtain for each sample, 1 low intensity band corresponding to non-supercoiled pDNA as well as a strong band intensity corresponding to our super-coiled (blue) pDNAs highlighting the absence of Pac I digestion for these samples.
Samples 4 and 5 correspond respectively to pX2 mutants AAC and pX2 CCA.
This process has been applied to the identification of all plasmids.
3) Conclusion:
During this DNA preparation step, we obtained several milligrams of each of the 14 purified plasmids and their identities all have summer confirmed after control by enzymatic digestion and analysis on gels. Of more, all the DNAs were adjusted to the same concentration.

IL Analysis of the expression of chimeras:
In order to evaluate the expression of the DNAs, the same amount of each of the Plasmids were transfected into HEK293 cells. Proteins as well expressed are analyzed by gel migration followed by transfer to PVDF membrane. The membranes are then revealed using a serum of anti-CDTM rabbit and a secondary antibody Anti-Rabbit labeled at the peroxidase.
A. Analysis of the Presence of CD8-CD TM Within Cell Lysates:
1) Analyzes of crude lysates:
After 48 hours of transfection, the cells are lysed and the extracts obtained are dosed according to the Bradford technique. We analyzed 200pg of crude proteins, from these lysates, by gel migration and western blot revealed with an anti-CD TM antibody (see Figure 7).
Different specific signals are then observable according to the samples:
= A double band at 50 kDa (blue) corresponding to the presence of CD8-ICRMW. The two bands correspond to two levels of glycosylation of CD8.
= A signal at approximately 20 kDa (red) of undetermined origin.
The pX2 CCC, pX2 ACC, pX2 CAC, pX2 AAC, pX4 stp and pLPCX do not present these bands.

2) Analysis of Lysates After Immunoprecipitation with Antibody CD8:
To lower the detection threshold of CD8-CDTM in lysates cells, we used a large amount of extract and concentrated the chimeras by immunoprecipitation with specific monoclonal antibodies of a conformational epitope of the ectodomain of CD8.
After 48 hours of transfection, the cells are lysed and the extracts obtained are dosed according to the Bradford technique. After normalization of concentrations in proteins, the extract is immunoprecipitated in the presence of and protein A sepharose. The products obtained are analyzed by migration sure gel and Western Blot revealed with an anti-CDTM antibody (see Figure 8).
Different Signals are then observable according to the samples:

= A 55 kDa double band (blue) corresponding to the presence of CD8-CDTM

= An unidentified signal, found for each sample, at approximately 66 kDa.
= One or more signals with a molecular weight greater than 66 KDa probably corresponding to the presence of CD8-CD TM proteins multimerized.
Here, the pX2 AAC sample has a detectable signal at 50KDa unlike the analysis performed without immunoprecipitation. On the other hand no signal is not detectable for pX2 CCC, pX2 ACC, pX2 CAC, pX4 samples stp and pLPCX.

3) Summary of the analysis of CD8-CD TM expression within Cell lysates:
Correlating western blot data on cell lysates with the characteristics of each chimera (integrity of tmD BLV, presence of third cysteine residue and number of cysteine residues), we can establish Table 2 below.
It appears that, in addition to the BLV CDTM, two factors may play a role in presence of CD8-CDTM chimeras. These factors are: the presence or absence of tmD
BLV, and the presence or absence of the third cysteine residue (Cys 213).
`pst f`: rt: trrD E% L: V Nhr8 dp. .: t tr E). r; t Table 2 =>, BLV

X2: C .C rnp Eet Naked ..............................................
................................. ...: ............. ......................
..........................................
pX2 Ace Conz pE> = f.lt E

p :, X 2 CAC t 2 E; .SE
.................................................. .............................
.................... .............................. ...........
pX: C trttpEi 3 pX. ~ c =:, anr: t; 2! '++ - 3-PX
.........................................
.... ........................................
................................... ............... ....................
pX CA C n ~ pEr ~ t J - - 4_ ---------------------------------------------- ---- -------------------------------- ----------------------------------- ----------- -------------------------------pX $ AAA L, .`? I ape; ~; ti} - .. ~ ...

p X 3 f -, wct. a - + - 4-..............................................; ... .............................
.....
.................................................. ...........................
E 1 iiar pX4 - -C

~ rX4 - A --------- _a- -t a- -------------------------pX: stp n, zs'z.z {zt. 0 p L: ---------------------B. Analysis of the Association of CD8-CD TM with Exosomes:
The different DNAs used vary only a few nucleotides. It is therefore likely that the amounts of CD8-CDTM synthesized are equivalent.
However, it appeared during the analysis of the expression of CDTM within cell lysates, that some chimeras are not detectable 48h after transfection. This absence of a signal would reflect the disappearance of some of our chimeric proteins. This disappearance could be due either to a rapid degradation of these chimeras, either to their secretion in form exosomes.
We therefore sought to detect the presence of CD8-CD TM within 5 exosomes.

1) CD8-CD TM content of vesicles isolated by centrifugation After 48 hours of transfection, the culture media are recovered and centrifuged to isolate the exosomes. The resulting pellets are then analyzes by gel migration and Western blot revealed with an anti-CD TM antibody (see Figure 9).
Depending on the samples, a 55 kDa signal can be displayed corresponding to the presence of CD8-CDTM. This signal is undetectable for pX2 CCC, pX2 ACC, pX2 CAC, pX2 AAC, pX4 stp and pLPCX samples.

2) Content in CD8-CD TM after sedimentation of the vesicles on gradient 15 of sucrose density:
In order to ensure that the signal obtained after ultracentrifugation of culture media is due to the presence of chimeras within exosomes and not to the presence of cell debris containing CD8-CDTM, we have analyzed the pellets of exosomes obtained according to the method described previously By sedimentation on a sucrose density gradient. Exosomes float then at a density ranging from 1.13 to 1.20 g / ml depending on the cells used and of the composition of the vesicles. After sedimentation by ultracentrifugation, the gradient is taken in fractions of 700pl. Proteins are precipitated to ugly of TCA and analyzed by gel migration then Western Blots revealed with a Anti-CD TM antibody and an anti-transferrin receptor antibody (RTF) to detect the presence of cell vesicles (endosomes or exosomes). This analysis was carried out for pX4 -C and pX4 mutants -To have Figure 10).
At pX4 --C and pX4 --A, a signal corresponding to CD8-CDTM is detected In fractions of density ranging from 1.13 to 1.25 g / ml. For these same densities, we could also detect a signal corresponding to RTf. These results reveal the presence of CD8-CD TM in fractions containing exosomes.

3) Summary of the analysis of the association of exosomes with CD8-CDTM:

The combination of CD8-CD TM with exosomes has been detected for all mutants containing CDTM except for pX2 possessing Cys 213. Mutants pX4 --C and pX4 --A appear to be very effectively targeted in the exosomes. Mutants pX3 and pX2 not having Cys 213 are also found in exosomes but to a lesser extent than for mutants pX4 --C and pX4 - A.
It therefore appears that, in addition to the presence of the viral CDTM, two factors can play on the targeting of CD8-CD TM chimeras in exosomes.
These factors are:
= The presence or absence of the transmembrane domain of BLV.
= The presence or absence of the Cys 3.

C. Influence of Vesicular Transport Inhibition on Expression CD8-CDTM chimeras:
The lack of detection of pX2 CCC, pX2 ACC, pX2 CAC and pX2 chimeras As AAFC was not due to increased exosomal secretion, we sought to whether it could be due to degradation by the sorting pathway protein from MVBs to lysosomes.
For this, we used the vesicular transport inhibitors that are bafilomycin and Ly294002. These inhibitors block the way of lysosomal degradation, thus promoting the secretion of proteins by exosomes. Inhibitors are added to culture media 32 hours after transfection; 16 hours later, the cells are lysed and the cultures are recovered and centrifuged to isolate the exosomes. The samples obtained are then analyzed by gel migration and Western Blot revealed with a antibody anti-CD TM. We thus analyzed the expression of the pX2 CCC, pX2 chimeras CCA, pX3 CCC, pX4 - C, pX4 - A and pX4 stp (see Figures 11 and 12).
It appears that for these mutants, the profile of Western blots of proteins obtained in the presence of inhibitors is the same as in the analysis without inhibitor, whether for cell lysates or for exosomes.
The absence of the CCC pX2, pX2 ACC, pX2 CAC and pX2 AAC chimeras is therefore apparently due neither to an accelerated exosomal exit nor to a degradation in lysosomes. It is likely that it is the consequence of a degradation very early at the level of the system of control of the folding within the reticulum endoplasmic (ER) and TGN.
Ill. Immunofluorescence localization:
In order to appreciate the membrane targeting of CD8-CDTM as well as its localization in cell compartments, we realized observations in confocal immunofluorescence microscopy. 48 hours later transfection, the cells were fixed and then labeled using different antibody.

A. Choice of antibodies:
As a first step, each type of marking (see Materials and Methods) is tested, with varying antibody dilutions, on cell fixed cells expressing pX4 - C or pLPCX. After observation on a microscope classical immunofluorescence (ZEISS Axiovert 200 M), we have tested the different antibodies available (see Materials and Methods section) and determined their effectiveness as well as their optimal dilutions. He appeared than several anti-intracellular compartment antibodies null signal or aspecific.
For observation in confocal imaging, we could therefore only use two types of markings:
= CD8-CDTM labeling Rat IgG (53 / 6.7) FITC mouse anti-CD8 (Pharmingen, 1/50 dilution) = Lamp3 labeling:
Human anti-CD63 (Lamp3) mouse IgG (Zymed, 1/50 dilution) + Anti-IgG
Cy3 mouse (Sigma, dilution 1/500) B. Observations of the distribution of CD8-CD TM
After fixing and labeling the cells using our different antibodies, we observed the distribution of the CD8-CD TM labeling as well as its colocalization with Lamp3 using a confocal microscope (ZEISS LSM 510).
Cells expressing pLPCX (negative control) do not show a signal FITC. This witness therefore allows us to ensure that FITC fluorescence visualized for the other mutants is due to the presence of CD8-CDTM
Surprisingly, despite a lack of Western Blot detection, pX2 constructs including Cys 3 are visible, although weakly, in immunofluorescence.

Analysis of general phenotypes:
HEK293 cells are transfected for 48 hours and then fixed.
The observation is made using a ZEISS LSM 510 confocal microscope (X63 immersion lens).
CD8: FITC labeling (green) revealing the presence of chimeras containing CD8.
Lamp3: Cy3 labeling (red) revealing the presence of the Lamp3 protein characteristic of late endosomes.
CD8-CDTM 1 Lamp3: Overlay of FITC and Cy3 images. The yellow shade obtained demonstrates the colocalization of CD8-CD TM with Lamp3.
After observations, we were able to distinguish 5 general phenotypes (see Figures 13 to 17) based on the appearance (vesicular, membrane or perinuclear) and the intensity of FITC labeling. Colocation of the marking FITC vesicular appearance with Lamp3 does not qualify for the determination of these phenotypes as it is proven in all mutants. Of the more this co-location is always partial.

Analysis of perinuclear areas with a strong FITC signal For all samples, except for pX4 stp, we find more or less constant homogeneous perinuclear CD8 signal important at the periphery of the nucleus. The intensity settings required for viewing the most part of the FITC fluorescence present in the cells cause the saturation from this area. Since a saturated signal is not very exploitable, we have realized acquisitions of lower intensity parameters, focusing on analysis of these areas, in particular to determine the relevance of collocations they present with Lamp3.
CD8-CDTM 1 Lamp3 [a]: Colocalization of CD8-CDTM (green) with Lamp3 (red).
The intensity parameters for acquisition, even weak ones, lead to a saturation of the perinuclear signal and the appearance of yellow shades at this level, highlighting a partial collocation between these two markings. In because of the saturation of the signal, it is impossible to say whether the collocation put in evidence is real or artifactual.
CD8-CDTM [d]: FITC signal from CD8-CDTM. The intensity parameters have have been lowered substantially in order to eliminate any saturation signal.
The FITC signal appears diffuse, homogeneous and not punctuated.
CD8-CDTM 1 Lamp3 [d]: Colocalization of CD8-CDTM (green) with Lamp3 (red).
The intensity parameters have been lowered substantially to eliminate all saturation phenomenon of the signal. This results in an absence of yellow shades highlighting the lack of collocation between FITC and Lamp3.
According to these acquisitions, the marking from Lamp3 appears in fact as being located within this perinuclear zone but is not at all case never collocated with the FITC mark (see Figure 18).
In addition, CD8-CD TM labeling of these perinuclear zones appears diffuse, homogeneous and not punctuated, and seems to highlight the presence of CD8-CD TM within a cellular structure. The location and the appearance of this marking, as well as the absence of real collocation with suggest the presence of CD8-CDTM in the Golgi apparatus.
This phenotype is found, more or less intensively, in all mutants, except pX4 stp. In the mutants pX4 --C and pX4 --A, this phenotype is visible only in a minority of cells, unlike pX2 mutants and with whom he is constantly present.
Thus, the specific observation of perinuclear areas strongly marked by FITC allowed us to highlight the likely presence of CD8-CDTM within the TGN.
According to the data obtained, we can establish the summary table below (see Table 3).
These observations confirm that, in addition to the viral CDTM, two factors play a role on the stability and targeting of our chimeras.
These factors are:
= The presence or absence of tmD BLV.
= The presence or absence of N-terminal residues of the BLV CDTM
= The presence or absence of the Cys 3.

Location of FITC marking Phenotype Mutants Intensity FITC Vesicular Membrane TGN

pX2 CCC + +++ - ++
A pX2 ACC + +++ - ++
pX2 CAC + +++ - ++
pX2 AAC + +++ - ++
pX2 CCA +++ ++++ - ++
B pX2 ACA +++ ++++ - ++
10 pX2 CAA +++ ++++ - ++
pX2 AAA +++ ++++ - ++
pX3 CCC +++++++ +++ +++++
C pX3 CAC +++++++ +++ +++++
pX4 - C ++++++ ++++++
D pX4 - A ++++++ ++++++
E pX4 stp ++++ + +++ -Table 3 CONCLUSION:
During our analyzes, it appeared that the chimera pX4 stp, composed Only ectodomain and CD8 tmD accumulates in the cells HEK293 is effectively targeted to the plasma membrane.
In the same way, the pX4 --C and pX4 --A chimeras accumulate and found in the plasma membrane but in higher proportions important that pX4 stp. These chimeras are very efficiently secreted within Exosomes.
The pX3 chimeras as for them are very present within the apparatus of Golgi, unlike pX4 chimeras. Their targeting within the plasma membrane and in the exosomes seems less effective than in the pX4 chimeras but remains important.
The pX2 chimeras appear unstable and are found within the TGN but not in the plasma membrane. The pX2 constructions comprising Cys 3 are very unstable in cells and are not detected in the exosomes. The substitution of the terminal Cys in this type of constructions seems to contribute to a gain in stability of the chimeric proteins. Indeed, the pX2 constructs without Cys 3 are detectable in cells and in exosomes.
All the studied chimeras exhibit, in immunofluorescence, a Vesicular marking which is partially colocalized with a marker of late endosomes ..
This study made it possible to highlight the importance of the presence, or no, Cys 3 in the stability and targeting of CD8-CDTM chimeras. he seems that the absence of this cysteine residue promotes stability and targeting membrane of the studied chimeras as well as their presence in the exosomes.
These phenomena could be independent of the associated hyperpalmitoylation to the absence of Cys 3. Indeed, the pX2 AAC construction, which is no palmitoylated, is more stable than the three pX2 mutants possessing Cys 3 as well as Cys 1 and or Cys 2, which are palmitoylables. However, a differential implication of the palmitoylation in the stability and targeting of our chimeras should not to be excluded.
This study revealed the fundamental importance of tmD
BLV. Indeed, the deletion of all or part of tmD BLV seems to increase substantially the stability of the chimeras as well as their targeting at the level of plasma membrane. So amazingly, the presence of tmD BLV
promote the early degradation of chimeras. This degradation could to intervene in the system of control of alienation within cell compartments that are the RE and the TGN since the path of degradation lysosomal does not seem to be involved. The absence of inhibitory effects of transport Vesicular on the stability and exosomal targeting of CD8-CDTM chimeras so that their very partial colocalization with late endosomes, even for the the least stable chimeras, supports this hypothesis.
The main attraction of our work lies in the discovery of tools potentially effective for the development of a vaccination mode based on on the exosome display concept. Indeed, the chimeras pX4 --C and especially --A seem to have a molecular engine that allows for very effective peptide antigen (here CD8) to the exosomes. This engine would therefore be located in the cytoplasmic domain of the BLV TM protein.

Example 2 Identification of Amino Acids Involved in Targeting exosomal peptide CDTM
To clarify the exact nature of the engine located in the domain Cytoplasmic BLV TM Protein Prior to Initial Trials immunization, we studied the effect of 18 types of mutations in the cytoplasmic domain of the BLV TM protein (see Figure 19):
deletion of the 13 N-terminal residues and substitution of the 2 proline residues the first pattern PxxP (SEQ ID NO.:13 and SEQ ID NO .: 14; KM4 mutation);
deletion of the 13 N-terminal residues and substitution of the 2 proline residues the second pattern PxxP (SEQ ID NO.:15 and SEQ ID NO.:16; KM5 mutation);
deletion of the 13 N-terminal residues and substitution of the 2 proline residues the third PxxP motif (SEQ ID NO.:17 and SEQ ID NO: 18, KM8 mutation);
deletion of the 13 N-terminal residues and substitution of the first residue proline of the fourth motif PxxP (SEQ ID NO.:19 and SEQ ID NO.:20;
KM11 / 1), substitution of the 2 proline residues of the fourth PxxP motif (SEQ ID
NO.:21 and SEQ ID NO.:22; KM1 mutation 1/3);
deletion of the 13 N-terminal residues and substitution of the tyrosine residue of the first YxxL pattern (SEQ ID NO.:23 and SEQ ID NO: 24, KTMY mutation);
deletion of the 13 N-terminal residues and substitution of the tyrosine residue of the second YxxL pattern (SEQ ID NO.:25 and SEQ ID NO: 26, KM9 mutation);
deletion of the 13 N-terminal residues and substitution of the tyrosine residue of the third YxxL pattern (SEQ ID NO.:27 and SEQ ID NO.:28; KM13 mutation);
deletion of the 13 N-terminal residues and substitution of the serine residue finding before the first pattern YxxL (SEQ ID NO.:29 and SEQ ID NO .: 30, mutation S);
deletion of the 13 N-terminal residues and substitution of the acid residue glutamic before the second YxxL motif (SEQ ID NO.:31 and SEQ ID
NO. : 32; mutation E), deletion of the 13 N-terminal residues and substitution of the acid residue aspartic before the third YxxL pattern (SEQ ID NO.:33 and SEQ
ID
NO. : 34, mutation D), truncated sequence with 6 residues - deletion of the 13 N-terminal residues and 39 C-terminal residues (SEQ ID NO: 35 and SEQ ID NO: 36; KS5 mutation) ;
truncated sequence with 15 residues - deletion of the 13 N-terminal residues and C-terminal residues (SEQ ID NO: 37 and SEQ ID NO: 38, KS6 mutation);
truncated sequence with 21 residues - deletion of the 13 N-terminal residues and 24 C-terminal residues (SEQ ID NO: 39 and SEQ ID NO: 40; KS8 mutation);
truncated 26 residue sequence - deletion of 13 N-terminal residues and 19 C-terminal residues (SEQ ID NO.:41 and SEQ ID NO: 42, KS9 mutation);
truncated 31 residue sequence - deletion of the 13 N-terminal residues and 14 C-terminal residues (SEQ ID NO.:43 and SEQ ID NO .: 44, KS10 mutation);
truncated sequence at 37 residues - deletion of 13 N-terminal residues and C-terminal residues (SEQ ID NO: 45 and SEQ ID NO: 46, KS12 mutation);
truncated sequence at 41 residues - deletion of the 13 N-terminal residues and 4 C-terminal residues (SEQ ID NO: 47 and SEQ ID NO.48, KS14 mutation).
Substitution and deletion mutants were obtained by mutagenesis directed; the substituted residues have been replaced by an alanine residue.
The judgment of translation of deletion mutants was obtained by addition of a stop codon (TGA, TAG or TAA codon).
The DNA sequences coding for the 18 mutants, as well as the sequence Wild-type CDTM DNA in which only the 13 N-terminal residues were deleted (SEQ ID NO: 7; sequence called wild sequence below) were were subcloned downstream from a coding sequence for the CD8a ectodomain murine. The 19 chimeric genes obtained were then cloned into a vector viral expression. The recombinant vectors thus obtained were transfected in eukaryotic cells (HEK cells) to analyze targeting to the exosomes of the resulting chimeric proteins. 48 hours after, the expression Protein in cells was examined by Western Blot. In parallel, the exosomes were purified by ultracentrifugation to evaluate sorting of the chimeric protein in exosomes by FACS and western blot.
The results presented below highlight the need for two peptide motifs individually recognized in the literature for their interactions with proteins associated with the ESCRT machinery and the intermembrane transfer machinery (in particular the adapters of which AP3).

This is the first time that we bring experimental evidence that these two peptide motifs play, in synergy, a determining role in the targeting exosomal.
These results provide new and interesting information in inter-cellular signaling terms using exosomes. They thus allow to have in hand a well-defined tool to target proteins with the exosomes.
From an industrial point of view, they will facilitate the development of a new generation vaccine and a unique tool for screening therapeutic or therapeutic molecules of antibodies for example.

1- Obtaining molecular constructions A- Preparation of inserts by PCR:
The three substitution mutants S (Ser-Ala), D (Ac, Asp-Ala) and E
(Ac.Glut-Ala) were obtained by mutagenesis directed by a double PCR
using the following mutation primers - Primer S to A, meaning:
5 'CCCTAAACCCGATGCTGATTATCAGGCGTTGCTACCATCC 3' - Primer S to A, antisense:
5 'CGCGGATGGTAGCAACGCCTGATAATCAGCATCGGGTTTA 3' - Primer D towards A, meaning:
5 'CCACCAAGCCGGCATACATCAACCT 3' - Primer D towards A, antisense:
5 'TCGAAGGTTGATGTATGCCGGCTTGGT 3' - E-primer to A, meaning:
5 'GCTACCATCCGCGCCAGCGATCTAC 3' - E-to-A primer, antisense:
5 'GTAGATCGCTGGCGCGGATGGTA 3'.

The PCRs were performed using the Expand High Fidelity PCR system kit (Roche) which has an enzymatic mixture containing DNA polymerase Thermostable Taq and a thermostable Tgo DNA polymerase provided with a corrective activity (exonuclease activity 3'-5 ') which makes it possible to limit errors during the polymerization and to obtain fragments with straight ends. Two Reagent mixtures were prepared at 4 C:

A (25 μL): 10 ng of DNA to be amplified, 1 μL of 10 mM dNTP (200 μM final each), 1.5 μL of each of the two sense and antisense primers at 10 μM (300 nm) final), sterile water (qsp 25pL); and B (25pL): 5pL of Expand High Fidelity buffer 10X to 15mM in MgCl2 5 (1.5 mM final), 0.75 μL of High Fidelity enzyme mixture (final 2.6 μM), water sterile (qsp 25pL).
A and B were mixed at 4 C and then the following amplification cycles were realized:
denaturation of double-stranded DNA for 2 minutes at 94 ° C .;
10 - 4 denaturation cycles (94 C, 10 seconds), hybridization (50 C, 15 C) seconds) and elongation (72 C, 20 seconds);
- 25 cycles: 10 seconds at 94 C, 15 seconds at 64 C then 20 seconds at 72 C;
- final elongation of 7 minutes at 72 C.
The PCR product obtained was maintained at 4 ° C.

The DNA sequences coding for the 18 mutants, as well as the sequence Wild-type DNA were modified by PCR (site-directed mutagenesis) to are framed by particular restriction sites; the protocol indicated above implemented using two primers with the restrictions Xbal and Notl.

B- Cloning of PCRs products in TOPO-bluntll and controls Each of the 19 DNAs was ligated into a TOPO cloning vector (see Figure 20) of the Topo-blunt cloning kit (Invitrogen) for introduction into chemiocompetent bacteria. The transformed clones were selected and All the DNA sequences verified by sequencing.
a) Ligation in the plasmid and transformation in Top10 Each of the different PCR products was integrated into a plasmid TOPO-Bluntll already open and with straight ends carrying the resistance gene to the kanamycin. The chemiocompetent bacteria Top10 were transformed by These plasmids and cultured on a box of LB / agar (100 μg / ml of kanamycin). The TOPO-Bluntll plasmid without insert served as a negative control and another control (1 ng of plasmid PUC19) was used as a positive control of transformation. After culture, only the bacteria transformed by a plasmid containing the insert or PUC19 (positive control) developed in the presence of the selection agent (antibiotic).
b) Screening of good clones and sequencing:
Following cloning results, 2 to 10 colonies were amplified for carry out the extraction of the plasmid DNA. For each construction and each clone, we obtained a volume of plasmid DNA of about 100 μL
150 ng / uL. The absorption ratio at 260 nm / absorption at 280 nm gives each purification a value between 1.8 and 2 which testifies to the purity of the preparation (a value below 1.8 would indicate a protein contamination).
To ensure the presence of the insert in the plasmid, the DNAs Plasmids were digested with the restriction enzyme EcoRi which frames the sequences of interest. Visualization of these digestive products has been made on 2% agarose gel where the presence of a fragment (about 300 bp) constitutes the evidence of recombinant DNA.
Once the good clones have been identified, 2 to 4 μg of plasmid DNA from each mutant were sequenced to verify the integrity of each sequence interest and therefore the open reading frame. Mutations and restriction sites added were checked at the same time.

C- Obtaining the chimeric genes in a cloning vector pKSII
Each of the 19 sequences (1 wild and 18 mutated) was placed downstream of a sequence coding for the mouse CD8a ectodomain, to give 19 constructions.
a) Preparation of a cloning vector pKSII-CD8 The vector pKSII-CD8a (see FIG. 22) was digested successively with Xbal and Notl restriction enzymes to accommodate the inserts.
The digestions carried out, the plasmid was dephosphorylated, precipitated with ethanol and purified on 0.8% agarose gel.
b) Preparation of the inserts The different inserts framed by the Xbal-Notl restriction sites have summer digested by the same restriction enzymes as the plasmid so that it this can integrate them.

c) Obtaining chimeric plasmids by cloning The DNAs were inserted into the linearized plasmid pKSII-CD8a The digested inserts were purified on 2.5% agarose gel. Their reintegration in the vector pKSII-CD8a was performed by the ligation technique in the gel.
A fragment of virgin gel served as a negative control of ligation.
Having used the same restriction enzymes for the vector and inserts, they therefore have complementary XbaI and NotI cohesive sites:
Plasmid and inserts should be able to establish links between them. It is a enzyme, ligase, which catalyzes the formation of a phosphodiester bond between a 3'-OH end and a 5'-phosphate end of two nucleic acids.
Once the ligation step is complete, DH5a bacteria are transformed by these plasmids carrying the ampicillin resistance gene. After culture of the different bacteria transformed at 37 C on LB / agar (50 μg / ml of ampicillin) and comparison with the negative controls, we note the development of settlements only in cells transformed by the products of ligation into presence of CDTM insert. This suggests that the colonies obtained were well transformed by a vector containing an insert between the XbaI and NotI sites.
d) Screening:
To confirm the obtaining of the chimeric plasmids, various clones of each mutant were screened by digesting the plasmid DNA by both XhoI / NotI enzymes and after migration of gel digestion products agarose 0.8%. This double digestion excises the entire chimeric gene created, that is, say with the CD8a in phase with the CDTM
For each clone and construct (pKSII-CD8a-CDTM mutated or wild), a first band at 2.9 kbp corresponding to the cut of the linearized plasmid pKSII. A second band was spotted at around 950pb ;
it corresponds to the gene coding for mutated or unmutated CD8α CDTM chimeras.

D- Obtaining the chimeric genes in the expression vector retroviral pLPCX:
The expression vector pKSII, if it is easy to handle by its size and its restriction sites, does not allow protein expression in the cell eukaryotes. So we chose pLPCX (Clontech Laboratories Inc., see 23), which makes it possible to introduce a gene as much by transfection as by transduction using a retroviral vector.
Each chimeric gene was excised from the plasmid pKSII between the XhoI sites.
Notl to be purified by 2% agarose gel extraction using kit Nucleospin Extract II (Macherey-Nagel).
The expression vector pLPCX has also been previously digested by the couple of Xhol-Notl enzymes, dephosphorylated and precipitated with isopropanol (this step eliminates the short DNA fragment (less than 100bp) located enter Xhol and NotI released during digestion).
Ligation of the chimeric genes with pLPCX was performed using T4 DNA ligase (Biolabs) (insert / vector ratio of about 3/1 molecule to molecule).
Chemo-competent bacteria Stbl2 (MAX Efficiency StbI2TM Competent Cells, Invitrogen) were transformed by these ligation products. A
witness positive (1 ng of plasmid pUC19) and a negative control (pLPCX ligated without insert) were prepared in parallel. After bacterial culture at 30 C on middle agar containing 50 μg / mL ampicillin, only the bacteria transformed with the positive control or by ligation products with inserts were developed.
To be able to carry out the screening and to have a consequent amount of DNA
plasmid required for transfections into eukaryotic cells, Midipreprations were performed. The presence of the inserts in the plasmid summer checked on agarose gel 2% after digestion with XhoI then NotI. For each construction (mutated pLPCX-CD8a-CDTM and wild, see Figure 24) a 6.3kbp band corresponding to the linearized pLPCX and a 950bp band corresponding to the excised chimeric genes.

2- Expression and analysis of targeting to exosomes:
A- Transfections in HEH 293T cells:
To ensure transfection of HEK 293T eukaryotic cells and estimate the percentage of transduced cells, the cells are transfected speak plasmid containing the LacZ gene and incubated in an X-Gal solution.
First to the eye and after observation under a light microscope (magnification X40) we found that more than 50% of the cells were stained blue which proves that the great majority have been transduced by the plasmid LacZ.
The same conditions have been met for transfection of our genes chimeras, it is likely that more than 50% of the cells were transduced by the chimeric genes.
In parallel, twenty simultaneous transfections in HEK 293T cells have been made. They correspond to each of the plasmids as well as to a negative control (pLPCX-CD8 without CDTM) B- Expression of chimeric proteins in the cell and targeting to exosomes a) Western blot analysis:
Cellular and exosomal lysates from transfections were analyzed by migration on a 10% SDS-PAGE gel, followed by transfer to a PVDF membrane (polyvinylidene difluoride, Immobilon-P, Millipore). These membranes then summer revealed with a rabbit anti-CD TM primary serum followed by an antibody secondary anti-rabbit IgG coupled to peroxidase. After revelation, these antibodies are removed and the transfer membranes revealed the same way but using anti-CD8a rabbit serum.
The results are shown in Figures 25 and 26.
Comparison of expression levels of chimeras in cells and exosomes:
It is found that the cell lysates reveal only a weak expression chimeric proteins. On the other hand, the presence of certain proteins chimeras in exosomes is sometimes very strong.
Besides the levels of expression, the major difference that we notice between cellular proteins and exosomal proteins is the presence of 2 to 3 bands for cells and only one for exosomes. This comes from the fact than the cell contains non-glycosylated and more or less glycosylated forms.
Alone the correctly glycosylated form is found in exosomes.
= Western blot analysis of exosomal targeting of positive controls (CD8a) CDTM) and negative (CD8a alone):
With the anti-CDTM serum, a 31 kDa migrating band is present in the exosomal lysate of the wild-type CD8a-CD TM control whereas it is absent in the lysate of cells transfected with the negative control. This band is characteristic of the expected chimeric protein.
With the anti-CD8a serum, the negative control CD8a alone shows a band to 27kDa which corresponds to the exosomal expression and targeting of CD8a devoid of CDTM. As before, a 31 kDa migrating band is present in the exsomal lysate of the wild-type CD8a-CD TM control. The difference intensity between the 31 kDa and 27 kDa bands indicates that the CD8a is much more 5 targeted on exosomes when it is merged with CDTM
Western blot analysis of targeting variations of mutated CD8a-CD TMs:
Only results obtained with anti-CD8a serum are comparable between them. The results obtained with anti-CD TM serum are only used to confirm the precedents. According to the mutation of the coding sequence for the 10 CDTM, these results show a variation in expression and targeting of the chimeric proteins to exosomes. This is particularly clear for mutations that strongly inhibit the targeting of proteins on exosomes.
The mutants concerned are the mutants KM8, KM13, D and KS8.
From these observations it can be concluded that the PSAP motif (KM8 mutant) and the DY motif (at the last YxxL motif (mutants KM13 and D)) are important for exosomal targeting.

b) Quantification of chimeric proteins on FAC exosomes The presence of the chimeric proteins has also been sought by a cytofluorometry analysis (FACscan) using a monoclonal antibody Fluorescent.

After fixation of exosomes on latex beads (IDC beads (Interfacial Dynamics Corporation) ultraclean aldehyde / sulfate Latex), chimeric proteins present on the surface of the exosomes were labeled with a monoclonal antibody anti-CD8a mice coupled to fluorescein (antibody 53-6.7 from Pharmingen) and analyzed by cytofluorimeter (FACScan).
The results obtained are particularly clear for the KM8 mutants, KM13 and D, which reveal the importance of mutated amino acids for targeting of the chimeric proteins on exosomes (see Figures 26 and 27). These results confirm the impact of PSAP, D and Y motifs (of the DYxxL motif) in targeting of the 30 proteins to the exosomes already revealed by the results of westerns blots.

Conclusion:
In this study, we constructed chimeric genes to express the mutated or fused CDTM pilot peptide fused with the CD8a mouse. These mutations on amino acids or motifs of the CDTM were aimed at identifying amino acids and important consensus in exosomal targeting.
The different chimeric genes have been integrated into a vector retroviral expression to transfect HEK 293T eukaryotic cells to to obtain the expression of these chimeric proteins. The bands observed in Western blot suggest that, like the native CD8a protein, these proteins are differently glycosylated as they pass through the Golgi apparatus. only the Properly glycosylated proteins would end up in the exosomes. These proteins have undergone the appropriate post-translational modifications, condition essential to the expression of conformational epitopes essential to the future development of vaccine immunity or screening of molecules therapeutic.
However, these glycosylations, which are more or less present, lead to of multiple diffuse bands that hampered us during the quantification compared proteins. To overcome this problem, it will be necessary to treat the lysates with a endoglycosylase to observe a single band on gel.
From these results, the PSAP and DY patterns (from the last YxxL) are essential for the expression and targeting of chimeric proteins to exosomes. These results are unpublished and are interesting both from of only from the point of view of industrial application.
It is likely that the PSAP reason is responsible for an interaction with the Tsg101 protein from the ESCRT complex. As for the DYxxL motif, it could be involved in the interaction with the ALIX protein of the ESCRT complex. So, for the first time, experimental data suggest that the ESCRT complex would be involved in the formation of exosomes.

EXAMPLE 3: Targeting Transmembrane Domain Receptors to the exosomes.
Membrane receptors are major targets for the development of therapeutic molecules. In general, high screening debit of drugs in particular with multiple domain receptors membrane expressed on cells in culture. In addition to the difficulties to obtain a strong expression of receptors on the surface of cells, this technique leads to robotization difficulties. But it's currently the only solution, since the use of purified recombinant receptors is for the moment technically unthinkable.
In this context, exosomes carrying receptors, in particular multi-domain receivers would be easy to use and well suitable for screening because of their stability and ease of handling.
The present study aimed to produce exosomes carrying single or multi-transmembrane domains, in particular the CxCR4 receptor (chemokine receptor SDS-1 (CXCL-12) and HIV) and the CD4 receptor (HIV receptor).
Three chimeric genes have been synthesized. They have, at the 3 'end, the CDTM-BLV peptide of sequence SEQ ID. NO .: 8, and at the 5 'end, a DNA
coding for the human CxCR4 receptor, for a version of the CxCR4 receptor truncated part C-terminal with 307 amino acids (CxCR4 (307)) or for a version of the C4 terminal truncated CD4 receiver including 403 amino acids (CD4 (403)).
The CD4 and CxCR4 receptors comprise respectively one and seven transmembrane domains.
The three chimeric genes were cloned into an expression vector retroviral pLPCX. These different plasmids were transfected into cell human eukaryotes HEK293T in order to observe the expression of different chimeric proteins in these cells as well as their sorting towards the exosomes.
The cloning and subcloning strategy used is similar to that described for example 2:
DNAs encoding the CxCR4, CxCR4 (307) and CD4 (403) receptors as well as that coding for the CDTM pilot peptide are amplified by PCR in using primers with restriction site sequences that one wish to integrate at each end amplified fragments (the fragments CxCR4, CxCR4 (307) and CD4 (403) will be flanked 5 'by the EcoRI site and 3 ' by Xbal website and CDTM / BLV will be flanked in 5 'by the Xbal site and in 3' by the site Not I).
The inserts thus produced are cloned into amplification vectors Topo (see Figure 20). The plasmids obtained are then digested with restriction enzymes and analyzed on 1.5% agarose gel, then sequenced to to check the integrity of their sequence.
The CDTM / BLV insert is then excised from the Topo vector by digestion enzymatic using the Xbal / Notl couple and then subcloned into the vector amplification pKS2 (see Figure 21). The recombinant pKS2 vector as well as the Recombinant Topo vectors containing the CxCR4, CxCR4 (307) and CD4 inserts (403) are then digested with restriction enzymes EcoRI and Xbal, in order to of able to subclone the CxCR4, CxCR4 (307) and CD4 (403) fragments into the amplification vector pKS2, said fragments being placed in 5 'of the sequence coding for the CDTM peptide The different constructs thus obtained are excised from the plasmids recombinant pKS2 by digestion with the enzyme pair EcoRI / NotI and then cloned in the retroviral expression vector pLPCX (see FIG. 22). The obtained vectors (see Figure 28) are verified by enzymatic digestion in using the EcoRl / Xbal enzyme pair.
The different plasmids pLPCX are transfected into cells human eukaryotes HEK293T to express chimeric proteins CxCR4 / CDTM, CxCR4 (307) / CDTM and CD4 (403) / CDTM.
An extract of the total cellular proteins (100 μg) and the proteins of a suspension of exosomes produced by each batch of transfected cells are then migrated in SDS-PAGE (10%) in the presence or absence of 3-mercaptoethanol. The proteins of interest are revealed by Western Blot thanks to the use of a rabbit anti-CD TM primary serum and antibodies secondary anti Rabbit IgG coupled to peroxidase. The revelation of the antibodies is achieved in darkroom and using an ECL solution. Finally the imprint protein of each sample is revealed by staining with Coomassie blue.
The results are shown in Figures 29-31.
It is observed that the CxCR4 / CDTM, CxCR4 (307) / CDTM and CD4 chimeras (403) / CDTM are expressed in cell protein extracts (see figure 29).
Several bands characterize the CxCR4 / CDTM chimera: 36, 42, 62 and 87 kDa. The expression of the wild-type CxCR4 receptor is in fact characterized by several isoforms, especially in HEK293T cells; bands 34, 40, 47, 62, 73 and 80 kDa can be identified (Sloane JA, et al.). The sizes CxCR4 / CDTM chimera bands in the HEK293T are due the presence of the pilot peptide (CDTM domain) in the CxCR4 / CDTM chimera. Of even, the bands 30, 42, 60 and 83 kDa reveal the presence of the chimeric CxCR4 (307) / CDTM. The variation in size of the bands representing the different isoforms of this chimera is explained by the fact that the CxCR4 receptor is truncated. The chimera CD4 (403) / CDTM, it is characterized by a band clearly visible by 53 kDa.
In addition these chimeras are all sorted towards exosomes like the shows the presence of bands 36, 42, 62 and 87 kDa (for CxCR4 / CDTM); 30, 38, 48, and 83 kDa (for CxCR4 (307) / CDTM) and the 53 kDa band (for CD4 (403) / CDTM) (see Figure 30).
The Coomassie blue revelation of the different protein imprints shows that total protein amounts of exosomal origin (Figure 31B) used during these experiments are significantly lower than the quantities of total protein of cellular origin (Figure 31A) while the signal in Western blot is equivalent. It is found that all the proteins present in the lysate Control cell are not sorted towards the exosomes. The chimeras CxCR4 / CDTM and CD4 (403) / CDTM are addressed very strongly towards the exosomes. In contrast, the CD4 (403) / CDTM chimera is sorted almost completely to exosomes.

Conclusion Transfection of HEK293T cells with different pLPCX plasmids allowed the expression of the CxCR4 / CDTM-BLV, CxCR4 (403) / CDTM-BLV chimeras and CD4 (403) / CDTM-BLV. Western blot analysis revealed their presence in cell lysates.
As expected, several isoforms of the CxCR4 / CDTM-BLV chimeras and CxCR4 (307) / CDTM-BLV are expressed in transfected HEK293T cells with plasmids pLPCX CxCR4 / CDTM-BLV and pLPCX CxCR4 (307) / CDTM-BLV.
The chimeras CxCR4 / CDTM-BLV and CxCR4 (307) / CDTM-BLV are efficiently sorted towards the exosomes and it seems like these fusion proteins are shared equal parts in cells and exosomes.

In addition, the presence of the CD4 (403) / CDTM-BLV chimera is observed in HEK293T cells transfected with plasmid pLPCX CD4 (403) / CDTM-BLV.
It seems that the CDTM-BLV pilot peptide favors a very important sorting of the CD4 (403) / CDTM-BLV chimera to the exosomes.
The results described above show that the CDTM-BLV pilot peptide is able to sort indifferently proteins in single or multiple domains transmembrane to exosomes.
We know that it is very difficult to work on these receptors in solution because if they are not integrated in a plasma membrane, they do not keep their 10 native structure. Currently the studies carried out on these proteins are often made from stable cell lines expressing receptors interest. he However, it is constraining in terms of time and economy to acquire, cultivate and to maintain those lineages that can die at any time if they are bad processed. That is why the use of exosomes carrying receivers to Multiple transmembrane domains for their studies represents a solution interesting because the exosomes have all the advantages of a cell for these studies without the disadvantages since they are not alive.
Exosomes in the membrane of which proteins are integrated recombinants and in particular proteins comprising multiple domains 20 transmembrane could be used in vaccinology and as a tool of screening.

BIBLIOGRAPHY
Alberts B, Bray D, Lewis J, Raff M, Roberts K, Watson JD (1995). "Molecular Biology of the Cell (3rd Ed.) "Garland, NY.

Cann AJ, Churcher MJ, Boyd M, O'Brien W, Zhao JQ, Zack J, Chen IS (1992).
"The region of the envelope gene of human immunodeficiency virus type 1 responsible for determination of cell tropism, J Virol 1992, 66 (1): 305-9.

30 Chaput N, Taïeb J, Schartz N, André F, Angevin E, Zitvogel L. (2004).
"Exosomes-based immunotherapy." Cancer Immunol Immunother; 53: 234-239.
Colino, J. and Snapper CM (2006). Journal of Immunology, 177: 37576 From Gassart A, Geminard C, Hoekstra D, Vidal M. (2004). "Exosome secretion: the art of reutilizing nonrecycled proteins. "Traffic.; 5: 896-903.
Delamarre L, Rosenberg AR, Spades C, Pham D, Callebaut I, Dokhelar MC.
(1996). "The HTLV-I envelope glycoproteins: structure and functions." J Acquire Immune Defic Syndr Hum Retrovirol; 13 Suppl 1: S85-91.

Delcayre, A., et al. 2005, Blood Cells Mol Dis 35: 158; Thery C. et al., (2002);
Nature Immunology 3: 1156.

Delcayre A, The Pecq JB. (2006) "Exosomes as a novel therapeutic nanodevices."
Curr Op in Mol Ther .; 8: 1464-1471.

Gould SJ, Booth A, Hildret JE. (2003) "The Trojan exosome hypothesis." proc Natl Acad Sci USA .; 100: 10592-10597.

Herbein G, Coaquette A, Perez-Bercoff D, Pancino G. (2002) "Macrophage activation and HIV infection: Can the trojan horse turn into a fortress?
mol Med .; 2: 723-738.

Levine AJ. (1992). "Viruses" (Scientific American Library, No. 37). WH
Freeman / Scientific American Library O Pornillos, Garrus J, Sundquist WI. (2002). "Mechanism of enveloped RNA
budding virus. "Trends Eye Biol., 2: 12: 569-579.

Raposo G, Moore M, Innes D, Leijenderkker R, Leigh-Brown A, Benaroch P, Geuze H. (2002). "Human macrophage accumulate HIV-1 particles in MHC II
3: 718-729.

Sloane JA, et al. (2005). Marked structural and functional heterogeneity in CxCR4: Separation of HIV-1 and SDF-lalpha responses. Immunology and Eye Biology; 83: 129-143.

Straub OC, Levy D. (1999). "Bovine immunodeficiency virus and analogies with human immunodeficiency virus. "Leukemia.; 13 Suppl 1: S106-9.

Zitvogel L, Regnault A, Lozier A, Wolfers J, Tenza D, Raposo G, Amigorena S. (1998). "Dendritic cell-derived exosomes elicit potent immune antitumour In vivo responses. "Nat. Med., 4: 594-600.

Claims (48)

87 1. Polypeptide allowing the secretion of a peptide or polypeptide of interest to which it is associated, in association with vesicles membranous, when expressed in a eukaryotic cell, characterized in that comprises or consists of a mutated derivative of the cytoplasmic domain (CD) of the protein Transmembrane (TM) of Bovine Leukemia Virus (BLV), SEQ Sequence ID NO: 6, where said mutated derivative (a) is defined by the substitution, deletion and / or insertion of one or many residue (s) in the cytoplasmic domain (CD) sequence of the protein Bovine Leukemia Virus (BLV) Transmembrane (TM) Sequence ID NO: 6, b) comprises at least one PxxP motif and at least one YxxL motif, in where P represents a proline residue, Y represents a tyrosine residue, x represents any residue, and L represents a leucine residue;
c) retains the ability of the CD domain of the BLV TM protein to address the peptide or polypeptide of interest with which it is associated with vesicles membrane;
d) includes a sequence that has at least 60% identity with the sequence of SEQ ID NO: 8 complete; and e) has undergone a deletion, or substitution with an alanine residue, of the residue cysteine of the PCP sequence contained in the sequence of SEQ ID NO: 6. The polypeptide of claim 1, wherein said mutated derivative of CD domain comprises or consists of the sequence of SEQ ID NO: 8 deleted from the PCP sequence. The polypeptide of claim 1 or 2, wherein said derivative mutated CD domain comprises or consists of the sequence SEQ ID NO: 10 or SEQ ID NO: 12. 4. The polypeptide according to any one of claims 1 to 3, wherein wherein the sequence of said CD domain mutated derivative is from 30 to 70 residues. The polypeptide according to any one of claims 1 to 4, wherein which said mutated CD domain derivative lacks the sequence KCLTSRLLKLLRQ. Polypeptide according to any one of claims 1 to 5, in which said sequence of said mutated domain CD derivative is identical to less 70%, at least 80%, at least 90% or at least 95% at the sequence of SEQ ID
NO: 8. Polypeptide according to any one of claims 1 to 6, characterized in that in addition to said deletion of the cysteine residue of the sequence PCP contained in the sequence of SEQ ID NO: 6, said mutated derivative has undergone a deletion of all of said PCP sequence. The polypeptide of any one of claims 1 to 7 which further comprises said peptide or polypeptide of interest and a domain membrane with the ability to anchor in the lipid bilayer of a cellular membrane. Polypeptide according to any one of claims 1 to 8, characterized in that said membrane vesicles are exosomes. Polynucleotide encoding a polypeptide according to any one of Claims 1 to 9. 11. Immunogenic composition which comprises a polynucleotide according to claim 10, and a carrier, diluent or a pharmaceutically acceptable carrier acceptable. The immunogenic composition of claim 11 for use in the prophylaxis and / or treatment of a bacterial, viral infection, parasitic, or tumor. 13. Membrane vesicle comprising a polypeptide according to one of any of claims 1 to 9. 14. Membrane vesicle comprising a chimeric polypeptide which understands or consists of the following areas:
(i) a peptide or polypeptide of interest;
(ii) a membrane domain with the ability to anchor in the bilayer lipid of a cell membrane; and (iii) the cytoplasmic domain (CD) of the membrane protein (TM) of the bovine leukemia virus (BLV) or a mutated derivative of this CD domain, said mutated derivative having a capacity for addressing said polypeptide chimeric membrane vesicles of eukaryotic cells and / or to the cellular compartment (s) involved in the formation of these membrane vesicles, and the sequence of said mutated derivative:
- being defined by the substitution, deletion and / or insertion of one or several residue (s) in the sequence of said CD domain, and being at least 60% identical to the sequence of SEQ ID NO: 8, provided that the sequence of said mutated derivative comprises at least one PxxP pattern and at least one YxxL pattern, wherein P represents a residue proline, Y represents a tyrosine residue, x represents any residue and L represents a leucine residue, and provided that when said domain (iii) comprises or consists of the CD domain of the BLV TM protein of sequence SEQ ID NO: 6, said domain (ii) does not include and does not consist of the membrane domain of the protein BLV TM, which has the sequence SEQ ID NO: 4. Membrane vesicle according to claim 14, characterized in that that said peptide or polypeptide of interest is exposed, in part or in whole, to outside said membrane vesicle. Membrane vesicle according to claim 14, characterized in that in addition to said chimeric polypeptide, it further comprises a fragment said peptide or polypeptide of interest comprising or consisting of one or more epitope (s) of said peptide or polypeptide of interest, said fragment being anchored in the membrane of said membrane vesicle via the domain membrane of a molecule of the major histocompatibility complex type I
or type II with which it is associated. 17. Membrane vesicle according to any one of claims 14 to 16, characterized in that said domains (i) to (iii) are positioned successively in the following order, from the N-terminus to the end C-terminus in the polypeptide: peptide or polypeptide of interest - domain Membrane - CD domain or mutated derivative of CD domain. 18. Membrane vesicle according to any one of claims 14 at 17, characterized in that said chimeric polypeptide further comprises at least least one binding molecule linking two successive domains. Membrane vesicle according to claim 18, characterized in that said binding molecule is a peptide or a polypeptide. Membrane vesicle according to claim 18 or 19, characterized in that the nucleotide sequence encoding said binding molecule includes or consists of a restriction site. 21. Membrane vesicle according to any one of the claims 14 to 20, characterized in that the sequence of said mutated derivative of CD domain is devoid of the sequence KCLTSRLLKLLRQ and / or lacking the sequence CFP. 22. Membrane vesicle according to any one of claims 14 21, characterized in that the sequence of said mutated domain CD derivative is at least 70%, or at least 80%, or at least 90% or at least 95%
to the sequence of SEQ ID NO: 8. 23. Membrane vesicle according to any one of claims 14 at 22, characterized in that the sequence of said CD domain comprises, or the sequence of said mutated CD domain derivative comprises or consists of:
PxxPxxxxPxxPxxxYxxLxPxxPExYxxLxPxxPDYxxL;
PxxPx n PxxPx n YxxLx n PxxPEX n YxxLx n PxxP DYxxL;
PxxPxxxxPxxPxxxYxxLxPxxPExYxxLxPxxPDYxxLxxxx; or PxxPx n PxxPx n YxxLx n PxxPEX n YxxLx n PxxPDYxxLxxxx n where x and xn respectively represent any residue and a or more residue (s). 24. Membrane vesicle according to any one of claims 14 at 23, characterized in that said CD domain is of SEQ ID NO: 6. 25. Membrane vesicle according to any one of claims 14 at 24, characterized in that said mutated domain CD derivative comprises or consists of the sequence SEQ ID NO: 8, SEQ ID NO: 10 or SEQ ID NO: 12. 26. Membrane vesicle according to any one of claims 14 at 25, characterized in that said membrane domain comprises or consists of the transmembrane domain of the BLV TM protein and the sequence of said domain mutated derivative CD lacks the sequence KCLTSRLLKLLRQ
and / or the PCP sequence. 27. Membrane vesicle according to any one of claims 14 at 26, characterized in that said domain (iii) is:
the sequence of SEQ ID NO: 8, or a sequence that:
is at least 60% identical with the sequence of SEQ ID NO: 8, - is devoid of the sequence KCLTSRLLKLLRQ, and which - consists of:
i. the sequence which, in the sequence of SEQ ID NO: 8, extends from the PSAP pattern to the YxxL pattern that follows it in C-terminal part, or ii. the sequence i. amended by substitution or deletion of one or several amino acids (s) between said two motifs. 28. Membrane vesicle according to any one of claims 14 at 27, characterized in that said peptide or polypeptide of interest comes from a pathogenic organism, a virus, a bacterium, a parasite, an agent pathogen, a tumor antigen, a cytoplasmic antigen, a receptor of ligand, a receptor with multiple membrane domains, a receptor seven transmembrane domains, a cytokine receptor, a receptor, a cytokine or a fragment thereof. 29. Membrane vesicle according to any one of claims 14 at 28, characterized in that said peptide or the polypeptide of interest is selected among the ectodomain of the hemagglutinin (HA) of an influenza virus, the ectodomain of the HA protein of the H5N1 avian influenza virus, a fragment comprising or consisting of one or more epitopes of this ectodomain of HA. 30. Membrane vesicle according to any one of claims 14 at 29, characterized in that said chimeric polypeptide further comprises a import signal peptide in the endoplasmic reticulum. 31. Membrane vesicle according to any one of claims 14 at 30, characterized in that said eukaryotic cell is a HEK293 cell, a T lymphocyte, a B lymphocyte, a mast cell, a dendritic cell, a cell from Langerhans. 32. Membrane vesicle according to any one of claims 14 at 31, characterized in that the sequence of said mutated domain CD derivative is devoid of the PC sequence and / or the CP sequence. 33. Membrane vesicle according to any one of claims 14 at 32, characterized in that the sequence of said mutated domain CD derivative is consisting of 30 to 70 residues. 34. Membrane vesicle according to any one of claims 14 at 33, characterized in that it is an exosome. 35. Pharmaceutical composition whose active ingredient comprises one or several vesicle (s) membrane (s) according to any one of the claims 13 to 34 or a polypeptide according to any one of claims 1 to 9, and a carrier, diluent or pharmaceutically acceptable carrier. 36. An immunogenic composition whose active ingredient comprises a or more vesicle (s) membrane (s) according to any one of Claims 14 to 34, or a polynucleotide encoding a polypeptide chimeric as defined in any one of claims 14 to 34 and a carrier, diluent or pharmaceutically acceptable carrier. 37. Immunogenic composition according to claim 36, for use for the prophylaxis and / or treatment of a bacterial, viral infection, parasitic, or tumor. 38. Tolerogenic composition, the active ingredient of which comprises one or several vesicle (s) membrane (s) according to any one of the claims 13 to 34, and a carrier, diluent or a pharmaceutically acceptable carrier acceptable. 39. Tolerogenic composition according to claim 38, for use in prophylaxis and / or treatment of asthma. 40. Recombinant cell producing exosomes, characterized in that that it is recombined with one or more polynucleotide (s) according to the claim 10 or with one or more polynucleotide (s) encoding a chimeric polypeptide as defined in any one of claims 14 at 34, or that it has absorbed a membrane vesicle according to any one of Claims 13 to 34. 41. In vitro use of a polypeptide according to any one of Claims 1 to 9 or a chimeric polypeptide as defined in one of any of claims 14 to 34, or a polynucleotide encoding a such polypeptide, to address a peptide or polypeptide of interest to vesicles membranes of eukaryotic cells that have internal vesicles of secretion and which are culturable, capable of exocytosis and modifiable genetically, and / or to the cell compartment (s) involved in the formation of these membrane vesicles, and to allow the secretion of said peptide or polypeptide of interest in association with said vesicles membrane by said eukaryotic cells. 42. Use of one or more vesicle (s) membrane (s) according to claim 15 or 16, for the in vitro detection of specific partners capable of interacting with said peptide or polypeptide of interest or with a fragment of said peptide or polypeptide. 43. Process for the in vitro production of membrane vesicles comprising a peptide or polypeptide of interest, said method comprising the following steps:
a) the introduction of one or more polynucleotide (s) according to the claim 10, which encodes (s) a polypeptide comprising said peptide or polypeptide of interest, in an exosome-producing cell, or contacting a exosome producing cell with one or more vesicle (s) membrane (s) according to any one of claims 13 to 34, which comprises (s) a polypeptide comprising said peptide or polypeptide of interest, b) culturing said exosome producing cell;
c) the recovery of membrane vesicles produced by said cell producing exosomes. 44. Process for preparing a polyclonal serum directed against one or several peptide (s) or antigenic polypeptide (s) of interest expressed in the membrane vesicle surface, comprising the steps of:
(a) the administration, where appropriate repeated, to a non-human animal of membrane vesicles according to any one of claims 14 to 34 or comprising a polypeptide according to claim 9, a composition immunogen according to any one of claims 11, 12, 36 and 37, of a polynucleotide according to claim 10 or a polynucleotide encoding a chimeric polypeptide as defined in any one of claims 14 at 34, with or without an adjuvant; and (b) the recovery of formed antibodies capable of recognizing the peptide (s) or antigenic polypeptide (s) of interest. 45. Process for the preparation of monoclonal antibodies directed against a or more peptide (s) or antigenic polypeptide (s) expressed on the surface of membrane vesicles, comprising the following steps:

a) fusion, with myeloma cells, of spleen cells previously obtained from a human or non-human host to which administered membrane vesicles according to any one of claims 14 to 34 or comprising a polypeptide according to claim 9, a immunogenic composition according to any one of claims 11, 12, 36 and 37, a polynucleotide according to claim 10 or a polynucleotide encoding for a chimeric polypeptide as defined in any one of the claims at 34, if necessary in combination with an adjuvant and, where appropriate, repeated administration;
b) the cultivation and selection of hybridomas under conditions allowing antibody production;
c) the recovery of the monoclonal antibodies directed against the peptide (s) or antigenic polypeptide (s) of interest. 46. Process preparation of monoclonal antibodies directed against a or more peptide (s) or antigenic polypeptide (s) expressed on the surface of membrane vesicles, comprising the following steps:
a) the immortalization of antibody-producing cells from cells haematopoietic previously obtained in a human or non-human host to which membrane vesicles have been administered according to any one of claims 14 to 34 or comprising a polypeptide according to claim 9, a immunogenic composition according to any one of claims 11, 12, 36 and 37, a polynucleotide according to claim 10 or a polynucleotide encoding for a chimeric polypeptide as defined in any one of the claims at 34, if necessary in combination with an adjuvant and, where appropriate, repeated administration;
b) culture and selection of immortalized cells under conditions allowing the production of antibodies;
c) the recovery of the monoclonal antibodies directed against the peptide (s) or antigenic polypeptide (s) of interest. 47. Method for in vitro screening of molecules interacting with a peptide or a polypeptide of interest or with a fragment of said peptide or a polypeptide of interest, said method comprising:
a) contacting membrane vesicles according to claim 15 or 16 with one or more molecules likely to interact with said peptide or polypeptide of interest;
b) the detection of a possible interaction between said peptide or polypeptide of interest or a fragment of said peptide or polypeptide of interest and said or said molecules. 48. Use of a membrane vesicle according to claim 15 or 16 to produce in vitro monoclonal antibodies, vaccinating or not vaccines directed against the peptide or polypeptide of interest or fragment said peptide or polypeptide of interest.