CA2681878A1

CA2681878A1 - Genes encoding z,z-farnesyl diphosphate synthase and a sesquiterpene synthase with multiple products and uses thereof

Info

Publication number: CA2681878A1
Application number: CA002681878A
Authority: CA
Inventors: Christophe Sallaud; Denis Rontein; Alain Tissier
Original assignee: Philip Morris Products S.A.; Christophe Sallaud; Denis Rontein; Alain Tissier
Current assignee: Philip Morris Products SA
Priority date: 2007-04-03
Filing date: 2008-04-02
Publication date: 2008-11-27
Also published as: ES2426388T3; EP2132305A2; JP5369089B2; CN101688191A; US8629321B2; WO2008142318A3; WO2008142318A2; FR2914652B1; US20140154768A1; EP2132305B1; JP2010523099A; CN101688191B; FR2914652A1; US20100138954A1

Abstract

La présente invention concerne les gènes impliqués dans la voie de biosyn thèse de sesquiterpènes de type SB (alpha-santalène, épi-beta-santalène, cis -alpha-bergamotène, trans-alpha-bergamotène et endo-beta-bergamotène,) et de son précurseur le ZZ-farnesyl diphosphate (ZZ-FPP) impliquant une Z,Z-FPP s ynthase et une sesquiterpene SB synthase et leurs utilisations pour la produ ction de composés sesquiterpèniques de type SB.The present invention relates to the genes involved in the SB type sesquiterpenes biosynthesis pathway (alpha-santalene, epi-beta-santalene, cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene,) and its precursor ZZ-farnesyl diphosphate (ZZ-FPP) involving a Z, Z-FPP and a sesquiterpene SB synthase and their uses for the production of SB-type sesquiterpene compounds.

Description

GENES CODANT POUR LA Z,Z-FARNESYL DIPHOSPHATE SYNTHASE ET
UNE SESQUITERPENE SYNTHASE A PRODUITS MULTIPLES ET LEURS
UTILISATIONS
Domaine de l'Invenfion La présente invention se rapporte à deux gènes responsables de la synthèse d'un mélange de sesquiterpènes et leur utilisation pour la préparation de ces composés dans des organismes vivants tels que les bactéries, les levures, les cellules animales et les plantes.
Introduction Les terpènes sont des molécules présentes dans tous les organismes vivants tels que les bactéries, les champignons, les animaux, et les plantes. Ils forment la plus grande classe de molécules naturelles du monde vivant. Chez les plantes, ces molécules sont présentes dans le métabolisme primaire en tant qu'hormones (les gibbérellines, les cytokinines, les brassinostéroïdes et l'acide abscissique) ou en tant que composés impliqués dans la photosynthèse (caroténoïdes, chlorophylles, plastoquinones et phytol) ainsi que dans les processus de prénylation des protéines, et dans la structure des mcmbranes (stérols).
Cependant, les terpènoïdes issus du métabolisme secondaire représentent l'essentiel de la diversité structurale de cette classe de molécules. Les rôles des terpènoïdes dits secondaires se rangent essentiellement dans le domaine des interactions avec l'environnement comme par exemple l'attraction d'insectes bénéfiques pour la plante (pollinisation et prédateurs d'insectes phytophages), la défense contre les pathogènes et les insectes et la protection contre le stress photo-oxydatif (Tholl, 2006).

Les terpènes sont constitués de multiples d'unités isoprényles à 5 carbones.
Le nombre d'unités isoprényles permet de les classer en monoterpènes (composés à
dix atomes de carbone ou C 10), sesquiterpènes (C 15), diterpènes (C20), sesterterpènes (C25), triterpènes (C30), tetraterpènes (C40), et ainsi de suite. Les précurseurs universels de tous les terpènes sont l'isopentenyl diphosphate (IPP) et le diméthylallyl diphosphate (DMAPP). Deux voies distinctes conduisent à la forniation de l'IPP et du DMAPP. L'une, la voie du mévalonate (MEV) est localisée dans le cytoplasme des cellules eucaryotes alors que l'autre, la voie du méthyl-erythritol (MEP) n'existe que chez certaines bactéries et les plantes où elle est localisée dans le chloroplaste (Rodriguez-Concepcion et Boronat, 2002). GENES ENCODING Z, Z-FARNESYL DIPHOSPHATE SYNTHASE AND
A SESQUITERPENE SYNTHASE WITH MULTIPLE PRODUCTS AND THEIR
USES
Domain of Invenfion The present invention relates to two genes responsible for the synthesis a mixture sesquiterpenes and their use for the preparation of these compounds in of the living organisms such as bacteria, yeasts, animal cells and plants.
Introduction Terpenes are molecules found in all living organisms such as bacteria, fungi, animals, and plants. They form the larger class of natural molecules of the living world. In plants, these molecules are present in primary metabolism as hormones (gibberellins, cytokinins, brassinosteroids and abscisic acid) or as compounds involved in the photosynthesis (carotenoids, chlorophylls, plastoquinones and phytol) as well that in the Prenylation process of proteins, and in the structure of mcmbranes (Sterols).
However, terpenoids from secondary metabolism represent the essence of the structural diversity of this class of molecules. The roles of terpenoid so-called secondary are essentially in the field of interactions with the environment as for example the attraction of beneficial insects for the plant (pollination and predators phytophagous insects), defense against pathogens and insects and protection against photo-oxidative stress (Tholl, 2006).

Terpenes consist of multiple isoprenyl units with 5 carbons.
The number of isoprenyl units allows them to be classified as monoterpenes (compounds ten carbon atoms or C 10), sesquiterpenes (C 15), diterpenes (C20), sesterterpenes (C25), triterpenes (C30), tetraterpenes (C40), and so on. The precursors universal of all the terpenes are isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). Two distinct paths lead to the forniation of the PPI and the DMAPP. Moon, the mevalonate (MEV) pathway is localized in the cytoplasm of cells eukaryotes then than the other, the methyl-erythritol (MEP) route only exists in certain bacteria and plants where it is located in the chloroplast (Rodriguez-Concepcion and Boronat, 2002).

2 Toutes les étapes et tous les gènes codant les enzymes des étapes de ces deux voies sont connus chez un certain nombre d'organismes.

La première étape de la biosynthèse des terpènes à partir des précurseurs communs IPP et DMAPP est réalisée par des prényl diphosphate synthases (ou prényltransférases) qui vont par condensation d'un précurseur homoallylique, ,1'IPP, et d'un précurseur allylique (le DMAPP, le géranyl diphosphate, le farnésyldiphosphate ou encore le géranylgéranyldiphosphate), générer des chaînes de prényldiphosphates de longueur variable. Il existe deux grandes classes principales de prényldiphosphate synthases : les cis-prényltransférases ou Z-prényltransférases et les trans-prényltransférases ou E-prényltransférases. Les cis-prényltransférases conduisent à la formation d'une double liaison en configuration cis, alors que les trans-prényltransférases conduisent à la formation d'une double liaison en configuration trans (Koyama 1999). Ainsi, l'addition séquentielle de 2 unités d'IPP sur un DMAPP par une trans-farnésyldiphosphate synthase, ou E-FPS produit du E,E-farnésyldiphosphate (E,E-FPP, C15). La réaction d'élongation commence par la formation d'un cation allylique après l'élimination de l'ion diphosphate pour former un prényl allylique. Ensuite, l'addition d'un IPP se produit avec une élimination stéréospécifique d'un proton en position 2 pour former une nouvelle liaison C-C et une nouvelle double liaison dans le produit. La répétition de cette condensation stéréospécifique de l'IPP avec un prényl diphosphate allylique, conduit à la synthèse d'un prényl diphosphate de longueur de chaîne et de stéréochimie données spécifiques de chaque enzyme. En particulier, la longueur de la chaîne du produit final peut varier considérablement allant d'un C10 (géranyl diphosphate) jusqu'aux polyprenyldiphosphates précurseurs du latex naturel composés de plusieurs milliers d'atomes de carbone.

Comme mentionné plus haut, les prényltransférases peuvent être divisées en deux familles génétiques différentes selon la stéréochimie (E ou Z) de la double liaison formée après chaque cycle d'élongation (Poulter, 2006 ; Liang et al., 2002).

Les E-prényltransférases caractérisées à ce jour sont responsables de la synthèse de prényl phosphates à courte chaîne (ClO à C50) en configuration E. On peut citer par exemple la géranyl diphosphate synthase (GPS), la farnesyl diphosphate synthase (FPS), la géranyl geranyi diphosphate synthase (GGPS), l'octaprenyl diphosphate synthase (OPS), la solanesyl diphosphate synthase (SPS) et la decaprenyl diphosphate synthase (DPS) qui sont respectivement responsables de la synthèse du (E)-GPP (C10), (E,E)-FPP
(C15), 2 All the steps and all the genes encoding the enzymes of the steps of these two ways are known in a number of organisms.

The first step in the biosynthesis of terpenes from precursors common IPP and DMAPP is performed by prenyl diphosphate synthases (or prenyltransferases) which go by condensation of a homoallylic precursor,, IPP, and a precursor allyl (DMAPP, geranyl diphosphate, farnesyldiphosphate or the geranylgeranyldiphosphate), generate prenyldiphosphate chains of length variable. There are two major major classes of prenyldiphosphate synthases: the cis-prenyltransferases or Z-prenyltransferases and trans-prenyltransferases or E-prenyltransferases. Cis-prenyltransferases lead to the formation of a double binding in cis configuration, whereas trans-prenyltransferases lead to formation of a double bond in trans configuration (Koyama 1999). So, the bill sequential 2 units of IPP on a DMAPP by a trans-farnesyldiphosphate synthase, or E-FPS produces E, E-farnesyl diphosphate (E, E-FPP, C15). The reaction elongation begins with the formation of an allylic cation after the removal of the ion diphosphate to form an allylic prenyl. Then, the addition of an IPP occurs with a stereospecific elimination of a proton in position 2 to form a new connection C-C and a new double bond in the product. The repetition of this condensation stereospecificity of PPI with an allylic prenyl diphosphate, leads to the synthesis of a Prenyl diphosphate of chain length and stereochemistry data Specific each enzyme. In particular, the length of the final product chain can vary considerably from C10 (geranyl diphosphate) to polyprenyldiphosphates precursors of natural latex composed of several thousand atoms of carbon.

As mentioned above, prenyltransferases can be divided into two different genetic families according to the stereochemistry (E or Z) of the double formed link after each cycle of elongation (Poulter, 2006, Liang et al., 2002).

The E-prenyltransferases characterized to date are responsible for the synthesis of Prenyl short-chain phosphates (ClO to C50) in the E configuration.
quote by eg geranyl diphosphate synthase (GPS), farnesyl diphosphate synthase (FPS), geranyl geranyi diphosphate synthase (GGPS), octaprenyl diphosphate synthase (OPS), solanesyl diphosphate synthase (SPS) and decaprenyl diphosphate synthase (DPS) who are respectively responsible for the synthesis of (E) -GPP (C10), (E, E) -FPP
(C15),

3 (E,E,E)-GGPP (C20), (E,E,E,E,E,E,E)-OPP (C40), (E,E,E,E,E,E,E,E)-SPP (C45), et du (E, E,E,E,E,E,E,E,E)-DPP (C50). Il faut noter que le (E,E)-FPP est en général le substrat des prényltransférases responsables de la synthèse des chaînes à plus de 20 carbones. Le premier gène codant pour une (E)-prényl transférase caractérisé est celui de la FPS de rat (Clarke et al., 1987). L'alignement des séquences codant pour des E-prényltransférases a permis de mettre en évidence deux motifs conservés de type DDXXD. La structure tridimensionnelle d'une E-prényltransférase, déterminée aux rayons X pour la première fois sur une FPS (Tarshis et al., 1994), et les études de mutagenèse dirigée ont montré que les deux motifs DDXXD étaient impliqués dans la liaison avec les substrats et dans l'activité catalytique en résultant. Finalement, il a été démontré qu'un petit nombre d'acides aminés spécifiques, localisés en amont du premier motif DDXXD, déterminaient la longueur de l'élongation de la chaîne d'isoprényles synthétisée (Wang &
Ohnuma, 1999).

Le premier gène codant pour une Z-prényltransferase a été cloné chez Micrococus luteus (Shimizu et al., 1998). Il code pour une undecaprényltransférase (UPS) qui utilise le E-FPP comme substrat pour former un prényl diphosphate à 55 carbones qui possède une stéréochimie =de type Z,E. Cette molécule intervient dans la biosynthèse des peptidoglycanes de la paroi de certaines bactéries. Une séquence homologue a été
caractérisée chez Arabidopsis comme étant responsable de la synthèse d'isoprényl diphosphate en conformation Z,E de 100 à 130 carbones (Oh et al., 2000).
L'analyse des séquences en acides aminés de ces enzymes ne montre aucune homologie avec les séquences des E-prényltransferases (Koyama, 1999). En particulier, les Z-prényltransferases ne possèdent pas de motifs riches en acide aspartique (DDXXD). Sept régions conservées qui interviennent toutes plus ou moins dans la fixation du substrat et la catalyse de celui-ci ont été identifées. Toutes les Z-prényltransferases identifiées à ce jour synthétisent des prényls diphosphates ayant une longueur de chaîne supérieure ou égale à
55 carbones à l'exception d'une Z,E-FPS de Mvcobacteriuna tuberculosis qui utilise le E-GPP comme substrat pour former du Z,E-FPP (Schulbach et al., 2000). Une étude récente de mutagenèse dirigée sur l'UPS de M. luteus a permis d'identifier plusieurs acides aminés jouant un rôle clé dans le nombre de cycles d'élongation de la chaîne d'isoprényles synthétisée (Kharel et al., 2006).

Les isoprényles diphosphates sont les substrats d'une classe d'enzyme, les terpènes synthases, qui permettent la formation du squelette de base des terpènes cycliques ou 3 (E, E, E) -GGPP (C20), (E, E, E, E, E, E, E) -OPP (C40), (E, E, E, E, E, E, E, E) ) -SPP (C45), and (E, E, E, E, E, E, E, E, E) -DPP (C50). It should be noted that the (E, E) -FPP is generally the substrate of prenyltransferases responsible for the synthesis of chains over 20 carbons. The first gene coding for a (E) -prenyl transferase characterized is that of the rat SPF
(Clarke et al., 1987). The alignment of the coding sequences for E-prenyltransferases allowed to highlight two retained patterns of type DDXXD. The structure three-dimensional E-prenyltransferase determined by X-ray for the first on SPF (Tarshis et al., 1994), and directed mutagenesis studies showed that the two DDXXD motifs were involved in the binding with the substrates and in the catalytic activity resulting therefrom. Finally, it has been shown that a small number specific amino acids, located upstream of the first DDXXD pattern, determined the length of the elongation of the isoprenyl chain synthesized (Wang &
Ohnuma, 1999).

The first gene coding for a Z-prenyltransferase has been cloned in Micrococus luteus (Shimizu et al., 1998). It codes for a undecaprenyltransferase (UPS) who uses the E-FPP as a substrate to form a 55-carbon prenyl diphosphate which has a stereochemistry = Z type, E. This molecule is involved in the biosynthesis of peptidoglycans from the wall of certain bacteria. A homologous sequence summer characterized in Arabidopsis as being responsible for the synthesis of isoprenyl diphosphate in Z, E conformation of 100 to 130 carbons (Oh et al., 2000).
The analysis of amino acid sequences of these enzymes shows no homology with the sequences of E-prenyltransferases (Koyama, 1999). In particular, the Z-prenyltransferases do not possess patterns rich in aspartic acid (DDXXD). Seven conserved regions which all intervene more or less in the setting of the substrate and the catalysis of it have been identified. All Z-prenyltransferases identified so far synthesize prenyl diphosphates with higher chain length or equal to 55 carbons with the exception of a Z, E-FPS of Mvcobacteriuna tuberculosis which uses the E-GPP as a substrate to form Z, E-FPP (Schulbach et al., 2000). A study recent directed mutagenesis on the M. luteus UPS identified several amino acids playing a key role in the number of chain elongation cycles of isoprenyl synthesized (Kharel et al., 2006).

Isoprenyl diphosphates are substrates of an enzyme class, terpenes synthases, which allow the formation of the basic skeleton of terpenes cyclical or

4 acycliques en C10 (monoterpène), C15 (sesquiterpène), C20 (diterpène), et C30 (triterpène) (Cane 1999; McMillan and Beale, 1999; Wise and Croteau, 1999). La diversité
de réaction de ces enzymes est à l'originc de la diversité des squelettes terpéniques cycliques que l'on retrouve dans la nature. Quatre stéréoisomères du farnésyl diphosphate sont théoriquement possiblcs en fonction dc la configuration stéréochimiquc des doublcs liaisons en position 2 ou 6 de la molécule (E,E, Z,E, E,Z ou Z,Z). Cependant, à ce jour, toutes les sesquiterpènes synthases pour lesquelles les gènes ont été
caractérisés utilisent comme substrat le E,E-FPP. C'est le cas par exemple de la 5-épi-aristolochene synthase de tabac (Facchini & Chappell, 1992), de la (E)-alpha-bisabolene synthase d'Abies grandis (Bohlmann et al., 1998), de la germacrene A synthase de chicorée (Bouwmeester et al., 2002), de l'amorpha-4,1 1-diene synthase de l'armoise annuelle (Wallaart et al., 2001), de la germacrene C synthase de tomate (Colby et al., 1998), de la caryophyllene synthase de l'armoise annuelle (Cai et al., 2002), et de la valencène synthase d'orange (Sharon-Asa et al., 2003). Une étude récente a cependant montré qu'une sesquiterpène synthase de maïs (tps4) responsable de la synthèse d'un mélange de 14 sesquiterpènes acceptait le E,E-FPP
et le Z,E-FPP (Koliner et al., 2006), montrant ainsi que les sesquiterpènes synthases pouvaient utiliser d'autres isomères que le E,E-FPP comme substrat. Néanmoins, aucune sesquiterpène synthase clonée à ce jour n'utilise de Z,Z-FPP.

Les trichomes glandulaires de type VI de Solanum habrochaites (auparavant dénomniée Lycopersicum hirsutum) excrètent de grandes quantités de sesquiterpènes oléfines appartenant à deux classes distinctes. La classe 1 contient notamment la germacrène B et la classe II contient entre autres 1'alpha-santalène et l'alpha-bergamotène.
L'analyse de la ségrégation entre un génotype de tomate cultivée (Lycopersicon esculentum = Solanum lycopersicum) et un génotype dc tomate sauvage (Lycopersicon hirsutum = Solan.urn habrochaites) a permis de démontrer que la biosynthèse de ces deux classes différentes de sesquiterpènes était contrôlée par deux loci différents (SstlA et Sst2) localisés sur deux chromosomes différents (van der Hoeven et al. 2000). Le locus SstlA
est localisé sur le chromosome 6, et les gènes de ce locus sont responsables de l'accumulation des sesquiterpènes de classe I. L'allèle Sst2 de S.
habrochaites localisé sur le chromosome 8 contrôle l'accumulation de sesquiterpènes de classe Ii comme l'alpha-santalène mais aussi le cis-alpha-bergamotène, le trans-alpha-bergamotène, 1'epi-beta-santalène et le beta-bergamotène et d'autres composés mineurs non identifiés.
Tandis que les séquences codantes correspondant aux gènes localisés sur le locus Sst1-A
ont été

identifiées (van der Hoeven et al. 2000), celles localisées sur le locus Sst2 ne l'ont pas été.
Résumé de l'Invention 4 Acyclic C10 (monoterpene), C15 (sesquiterpene), C20 (diterpene), and C30 (Triterpene) (Cane 1999, McMillan and Beale 1999, Wise and Croteau 1999). The diversity reaction of these enzymes is at the origin of the diversity of skeletons terpene cyclical that we find in nature. Four stereoisomers of farnesyl diphosphate are theoretically possible according to the stereochemical configuration doubles bonds in position 2 or 6 of the molecule (E, E, Z, E, E, Z or Z, Z). However, nowadays, all the sesquiterpenes synthases for which the genes have been characterized use as substrate the E, E-FPP. This is the case, for example, with 5-epi-aristolochene synthase of tobacco (Facchini & Chappell, 1992), Abies (E) -alpha-bisabolene synthase grow up (Bohlmann et al., 1998), of chicacrene A synthase of chicory (Bouwmeester et al., 2002), of the amorpha-4.1 1-diene synthase of the annual sagebrush (Wallaart et al., 2001), tomato germacrene C synthase (Colby et al., 1998), caryophyllene synthase of annual sagebrush (Cai et al., 2002), and valencene orange synthase (Sharon-Asa and al., 2003). A recent study, however, has shown that a sesquiterpene synthase corn (tps4) responsible for the synthesis of a mixture of 14 sesquiterpenes accepted the E, E-FPP
and Z, E-FPP (Koliner et al., 2006), thus showing that sesquiterpenes synthases could use other isomers than E, E-FPP as substrate. However, any sesquiterpene synthase cloned to date does not use Z, Z-FPP.

Glandular trichomes type VI of Solanum habrochaites (previously denominated Lycopersicum hirsutum) excrete large quantities of sesquiterpenes olefins belonging to two distinct classes. Class 1 contains in particular the germacrene B and class II contains inter alia alpha-santalene and alpha-bergamotene.
The segregation analysis between a cultivated tomato genotype (Lycopersicon esculentum = Solanum lycopersicum) and a wild tomato genotype (Lycopersicon hirsutum = Solan.urn habrochaites) has shown that the biosynthesis of these two different classes of sesquiterpenes was controlled by two different loci (SstlA and Sst2) located on two different chromosomes (van der Hoeven et al., 2000). The SstlA locus is located on chromosome 6, and the genes of this locus are responsible of the accumulation of class I sesquiterpenes. The Sst2 allele of S.
habrochaites located on chromosome 8 controls the accumulation of class I sesquiterpenes as alpha santalene but also cis-alpha-bergamotene, trans-alpha-bergamotene, 1'epi-beta-santalene and beta-bergamotene and other unidentified minor compounds.
While the coding sequences corresponding to the genes located on the Sst1-A locus have been identified (van der Hoeven et al., 2000), those located on the Sst2 locus have not been.
Summary of the Invention

5 La présente invention se rapporte à deux gènes responsables de la synthèse d'un mélange de sesquiterpènes composé principalement d'alpha-santalène, d'épi-beta-santalène, de cis-alpha-bergamotène, de trans-alpha-bergamotène, et de endo-beta-bergamotène et de leur précurseur le Z,Z-farnesyl diphosphate (Z,Z-FPP) et leur utilisation pour la préparation de ces composés dans des organismes vivants tels que les bactéries, les levures, les cellules animales et les plantes.

Plus précisément, le présent document décrit l'identification et la caractérisation de deux gènes dc S. habrochaites responsables de la synthèse des sesquiterpènes de la classe II
(alpha-santalène, épi-beta-santalène, cis-alpha-bergamotène, trans-alpha-bergamotène et endo-beta-bergamotène entre autres) de S habrochaites que nous avons renommés sesquiterpènes de type SB (pour Santalène et Bergamotène) dans la suite du texte. Le premier gène code pour une Z,Z-farnesyl diphosphate synthase et le second pour une sesquiterpène synthase à produits multiples qui utilise le Z,Z-farnesyl diphosphate comme substrat. La production des protéines recombinantes correspondantes nous a pennis de démontrer que le profil sesquiterpènique obtenu in vitro est identique à celui du contrôlé
par le locus Sst2 de tomate.

L'invention concerne les activités enzymatiques de la biosynthèse du Z,Z-FPP à
partir d'IPP et de DMAP d'une part, et d'un mélange de sesquiterpènes composé
principalement d'alpha-santalène, d'épi-beta-santalène, de cis-alpha-bergamotène, de trans-alpha-bergamotène et de endo-beta-bergamotène à partir de Z,Z-FPP, les séquences peptidiques responsables de ces activités et les séquences d'acide nucléique codant ces séquences peptidiques. L'invention concerne également des méthodes utilisant ces activités enzymatiques pour la production de ces composés ou de dérivés de ceux-ci.
La présente invention concerne donc une méthode de production d'un mélange de sesquiterpènes, principalement composés d'alpha-santalène, d'épi-beta-santalène, de cis-alpha-bergamotène, de trans-alpha-bergamotène et de endo-beta-bergamotène, à
partir de Z,Z-FPP dans une cellule ayant une source d'IPP et de DMAP, comprenant : The present invention relates to two genes responsible for the synthesis a mixture of sesquiterpenes composed mainly of alpha-santalene, epi-beta-santalene, of cis-alpha-bergamotene, trans-alpha-bergamotene, and endo-beta-bergamotene and of their precursor Z, Z-farnesyl diphosphate (Z, Z-FPP) and their use for preparation of these compounds in living organisms such as bacteria, yeasts, cells animals and plants.

More specifically, this document describes the identification and characterization of two S. habrochaites genes responsible for the synthesis of sesquiterpenes class II
(alpha-santalene, epi-beta-santalene, cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene among others) of S habrochaites that we have renamed sesquiterpenes of the SB type (for Santalene and Bergamotene) in the rest of text. The first gene codes for a Z, Z-farnesyl diphosphate synthase and the second for a sesquiterpene synthase with multiple products that uses Z, Z-farnesyl diphosphate as substrate. The production of the corresponding recombinant proteins has pennis demonstrate that the sesquiterpene profile obtained in vitro is identical to that of the controlled by the locus Sst2 of tomato.

The invention relates to the enzymatic activities of the biosynthesis of Z, Z-FPP to go of IPP and DMAP on the one hand, and a mixture of sesquiterpenes composed of mainly of alpha-santalene, epi-beta-santalene, cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene from Z, Z-FPP, the sequences peptide responsible for these activities and the nucleic acid sequences encoding these sequences peptide. The invention also relates to methods using these activities enzymes for the production of these compounds or derivatives thereof.
The present invention therefore relates to a method for producing a mixture of sesquiterpenes, mainly composed of alpha-santalene, epi-beta-santalene, of cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene, at from Z, Z-FPP in a cell having a source of IPP and DMAP, comprising:

6 a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un premier gène codant pour une Z,Z-FPS selon la présente invcntion et d'une construction portant une cassette d'expression comprenant un deuxième gène codant pour une sesquiterpène synthase dénommée SBS selon la présente invention ;
b) la culture de la cellule transformée dans des conditions appropriées pour l'expression desdits premier et deuxième gènes ; et, c) facultativement, la récolte du Z,Z-FPP ou des produits sesquiterpèniques de l'enzyme SBS ou de dérivés de ceux-ci contenus dans ladite cellule et/ou dans le milieu de culture.

La présente invention concerne une protéine isolée ou recombinante ayant une activité Z,Z-FPS. Cette protéine a de préférence une séquence présentant au moins 80 %
d'identité avec la SEQ ID No 2. Elle concerne aussi un acide nucléique comprenant une séquence nucléotidique codant pour une telle protéine, ou une séquence capable de s'hybrider à
celui-ci dans des conditions stringentes.

La présente invention concerne également une protéine isolée ou recombinante ayant une activité de type SB synthase et ayant une séquence présentant au moins 80 %
d'identité
avec la SEQ ID No 4. Elle concerne aussi un acide nucléique comprenant une séquence nucléotidique codant pour une telle protéine, ou une séquence capable de s'hybrider à
celui-ci dans des conditions stringentes.

La présente invention concerne une cassette d'expression comprenant un acide nucléique selon la présente invention, un vecteur comprenant une cassette d'expression ou un acide nucléique selon la présente invention, une cellule hôte comprenant un vecteur, une cassette d'expression ou un acide nucléique selon la présente invention, et un organisme transgénique non-humain comprenant une cellule, un vecteur, une cassette d'expression ou un acide nucléique selon la présente invention.
La présente invention concerne en outre une méthode de production du Z,Z-farnesyl diphosphate (Z,Z-FPP), ou de dérivés de ccux-ci à partir d'IPP et de DMAP dans une cellule ayant une source d'IPP et de DMAP, comprenant : 6 a) the introduction into said cell of a construction carrying a cassette expression comprising a first gene encoding a Z, Z-FPS according to the present invcntion and a construction bearing an expression cassette comprising a second gene encoding a sesquiterpene synthase referred to as SBS according to the present invention;
(b) the culture of the transformed cell under appropriate conditions to expressing said first and second genes; and, c) optionally, the harvest of Z, Z-FPP or sesquiterpene products from the SBS enzyme or derivatives thereof contained in said cell and / or in the culture centre.

The present invention relates to an isolated or recombinant protein having a activity Z, Z-FPS. This protein preferably has a sequence having at least 80%
identity with SEQ ID No. 2. It also relates to a nucleic acid comprising a sequence nucleotide coding for such a protein, or a sequence capable of to hybridize to this one under stringent conditions.

The present invention also relates to an isolated or recombinant protein having a SB synthase type activity and having a sequence having at least 80%
identity with SEQ ID No. 4. It also relates to a nucleic acid comprising a sequence nucleotide coding for such a protein, or a sequence capable of to hybridize to this one under stringent conditions.

The present invention relates to an expression cassette comprising an acid nucleic according to the present invention, a vector comprising an expression cassette or an acid nucleic acid according to the present invention, a host cell comprising a vector, a cassette expression or nucleic acid according to the present invention, and a organization transgenic non-human comprising a cell, a vector, a cassette expression or a nucleic acid according to the present invention.
The present invention further relates to a method for producing Z, Z-farnesyl diphosphate (Z, Z-FPP), or derivatives thereof from IPP and DMAP in a cell having a source of IPP and DMAP, comprising:

7 a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression avec une séquence nucléique codant une Z,Z-FPS selon la présente invention ;
b) la culture de la cellule transformée dans des conditions appropriées pour l'expression du gène ; et c) facultativement, la récolte du ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.

La présente invention concerne l'utilisation d'une protéine, d'un acide nucléique, d'une cellule hôte ou d'un organisme transgénique selon la présente invention pour la préparation de Z,Z~FPP ou des sesquiterpènes de type SB, tels que l'alpha-santalène, l'épi-beta-santalène, le cis-alpha-berganiotène, le trans-alpha-bergamotène et l'endo-beta-bergamotène, ou de dérivés de ceux-ci comme l'alpha-santalol, l'épi-beta-santalol, le cis-alpha-bergamotol, le trans-alpha-bergamotol et le beta-bergamotol.
La présente invention concerne une cellule ou un organisme transgénique non-humain, caractérisé en ce que la voie de synthèse des sesquiterpènes de classe II est bloquée par inactivation soit du gène codant pour une Z,Z-FPS selon la présente invention, soit du gène codant pour une SB synthase selon la présente invention, soit encore des deux gènes.
La présente invention concerne en outre l'utilisation d'un acide nucléique pour identifier des marqueurs moléculaires permettant d'introduire les séquences génomiques correspondantes dans d'autres espèces ou variétés de tomate cultivées (Solanum lycopersicum). Au titre de la présente invention, les séquences nucléotidiques et N 2 ou des variants de celles-ci peuvent également être utilisées comme marqueurs moléculaires pour l'introgression de ces séquences dans d'autres espèces ou variétés de tomates cultivées.

Ainsi, la présente invention concerne des marqueurs moléculaires comprenant tout ou partie d'un acide nucléique présentant au moins 80 % d'identité avec la SEQ ID
No 1 ou SEQ ID No 3 pour identifier un polymorphisme génomique entre S. habrochaites et des espèces de type Solanum sexuellement compatible avec S. habrochaites afin d'introduire les gènes correspondant dans ces espèces. Elle concerne également une méthode consistant WO 2008/142317 a) the introduction into said cell of a construction carrying a cassette expression with a nucleic acid sequence encoding a Z, Z-FPS according to the present invention.
invention;
(b) the culture of the transformed cell under appropriate conditions to gene expression; and (c) optionally, the harvest of the product or derivatives thereof contained in said cell and / or in the culture medium.

The present invention relates to the use of a protein, an acid nucleic, of a host cell or transgenic organism according to the present invention for the preparation of Z, Z ~ FPP or SB-type sesquiterpenes, such as alpha-santalene, epitope beta-santalene, cis-alpha-berganiotene, trans-alpha-bergamotene and endo-beta-bergamotene, or derivatives thereof such as alpha-santalol, epi-beta-santalol, cis-alpha-bergamotol, trans-alpha-bergamotol and beta-bergamotol.
The present invention relates to a non-transgenic cell or organism human, characterized in that the route of synthesis of class II sesquiterpenes is blocked by inactivation of either the gene encoding a Z, Z-FPS according to the present invention, either of the gene coding for an SB synthase according to the present invention, that is to say both Genoa.
The present invention further relates to the use of a nucleic acid to identify molecular markers to introduce genomic sequences in other varieties or varieties of tomato grown (Solanum lycopersicum). Under the present invention, the nucleotide sequences and N 2 or variants thereof can also be used as markers molecules for the introgression of these sequences into other species or varieties of cultivated tomatoes.

Thus, the present invention relates to molecular markers comprising everything or part of a nucleic acid having at least 80% identity with SEQ ID
No 1 or SEQ ID No. 3 to identify a genomic polymorphism between S. haplochaites and Solanum type species sexually compatible with S. habrochaites so to introduce the corresponding genes in these species. It also relates to a method consisting WO 2008/14231

8 PCT/FR2008/050576 à introduire les gènes zFPS et SBS dans une espèce non sexuellement compatible avec Solanum habrochaites par fusion de protoplastes.

La présente invention concerne aussi une méthode de production du Z,Z-farnesol par déphosphorylation du Z,Z-FPP par une phosphatase.

Lé2ende des Fieures Figure 1: Les stéréosiomères possibles du FPP. Tous les stéréoisomères du FPP
sont biosynthétisés à partir d'IPP et de DMAPP. A ce jour seules étaient connues la E,E-farnesyl diphosphate synthase (1) caractérisée dans de nombreux organismes, et la Z,E-farnesyl diphosphate synthase (2) de Mycobacterium tuberculosis (Schulbach et al., 2000).
(3) : Z,Z-farnesyl diphosphate synthase de tomate selon la présente invention ; (4) : E,Z-farnesyl diphosphate synthase : aucune enzyme ayant cette activité n'a été
décrite à ce jour.
Figure 2: Représentation schématique des ADN-T portant les transgènes Sh-zFPS
et Sh-SBS. Km : gène de résistance à la kanamycine ; 35S : promoteur du gène 35S du CaMV.
CBTS-ter : terminateur du gène CBTS; eCBTSl.O : promoteur de lkb du gène CBTS
fusionné avec l'amplificateur du promoteur 35S du CaMV. Sh-zFPS : phase codante du gène codant pour la zFPS de tomate (S. habrochaites LA1777) ; Sh-SBS : phase codante du gène codant pour la SB synthase de tomate (S. habrochaites LA1777); LB :
Bordure gauche du T-DNA; RB : Bordure droite du T-DNA; 35S-ter: Terminateur du gène 35S du CaMV; nos-ter : Terminateur du gène de la nopaline synthase d'Agrobacterium tumefasciens. Figure 2: fragment ADN-T du vecteur binaire pLIBRO64; Figure 2B:
fragment ADN-T du vecteur binaire pLIBRO65.

Figure 3: Analyse de l'expression du transgène Sh-SBS dans les feuilles de tabac transgéniques. L'expression a été mesurée par PCR quantitative en temps réel en utilisant des sondes fluorescente ( TAQ-MAN, ABI). L'une des sondes est spécifique du transgène Sh-SBS tandis que l'autre est spécifique d'un gène d'actine de tabac (gène contrôle). Les valeurs de l'axe des ordonnées représentent le rapport des puissances 2 des valeurs obtenues avec la sonde Sh-SBS sur celles obtenues avec la sonde actine(2sBs/2a t' ~ Ce rapport exprime le rapport d'expression du transgène Sh-SBS sur celui de l'actine. Les valeurs de l'axe des abscisses indiquent le numéro des lignées transgéniques.
Figure 8 PCT / FR2008 / 050576 to introduce zFPS and SBS genes into a non-sexually compatible species with Solanum habrochaites by fusion of protoplasts.

The present invention also relates to a method for producing Z, Z-farnesol by dephosphorylation of Z, Z-FPP by phosphatase.

Lé2ende des Fieures Figure 1: Possible stereomers of FPP. All the stereoisomers of the FPP
are biosynthesized from IPP and DMAPP. To date, only E, E-farnesyl diphosphate synthase (1) characterized in many organisms, and the Z, E-farnesyl diphosphate synthase (2) of Mycobacterium tuberculosis (Schulbach and al., 2000).
(3): Z, Z-farnesyl diphosphate synthase of tomato according to the present invention ; (4): E, Z-farnesyl diphosphate synthase: no enzyme with this activity has been described to date.
Figure 2: Schematic representation of T-DNAs carrying Sh-zFPS transgenes and Sh-SBS. Km: resistance gene to kanamycin; 35S: promoter of the 35S gene of the CaMV.
CBTS-ter: terminator of the CBTS gene; eCBTSl.O: lkb promoter of CBTS gene fused with CaMV 35S promoter enhancer. Sh-zFPS: phase coding gene encoding tomato zFPS (S. haplochaites LA1777); Sh-SBS: phase coding gene encoding tomato SB synthase (S. haplochaites LA1777); LB:
border left of T-DNA; RB: Right border of T-DNA; 35S-ter: Terminator of the gene 35S of CaMV; nos-ter: Terminator of the Agrobacterium nopaline synthase gene tumefaciens. Figure 2: T-DNA fragment of the binary vector pLIBRO64; Figure 2B:
T-DNA fragment of the binary vector pLIBRO65.

Figure 3: Analysis of the Sh-SBS transgene expression in the leaves of tobacco Transgenic. The expression was measured by quantitative PCR in real time using fluorescent probes (TAQ-MAN, ABI). One of the probes is specific to the transgene Sh-SBS while the other is specific for a tobacco actin gene (gene control). The values of the y-axis represent the ratio of the powers 2 of the values obtained with the Sh-SBS probe on those obtained with the actin probe (2sBs / 2a t ~ ~ This report expresses the expression ratio of the transgene Sh-SBS on that of actin. The X axis values indicate the number of transgenic lines.
figure

9 3A) Lignées de tabac transgéniques ayant intégré les transgènes Sh-zFPS et Sh-SBS
(pLIBRO-064) Figure 3B) Lignées de tabac transgéniques ayant intégré
uniquement le transgènc Sh-SBS (pLIBRO-065).

Figure 4: Profil GC/MS du (Z,Z)-farnesol superposé aux standard de farnesols (mélange d'isomères). Figure 4A : Le chromatogramme gris (m/z: 69) correspond au produit obtenu in vitro avec la protéine recombinante Sh-zFPS-6His. Sh-FPS-6His a été incubée avec du DMAPP et de l'IPP. Le produit isoprényl-diphosphate a été déphosphorylé en un alcool et purifié par chromatographie en phase liquide. Le pic n 1 correspond au Z,Z-farnesol. 1. Le chromatogranime noir (m/z: 69) correspond au standard farnesol constitué d'un mélange d'isomères (Z,E)-, (E,Z)-, et (E,E)-farnesol (Fluka). Le pic n 2 correspond à
un mélange de (Z,E)- et (E,Z)- farnesol et le pic n 3 au (E,E)-farnesol. Figure 4B : Spectre de masse du (Z,Z)-farnesol correspondant au pic n 1. Figure 4C : Spectre de masse du (Z,E)-et du (E,Z)-farnesol (mélange) correspondant au pic n 2. Figure 4D : Spectre de masse du (E,E)-farnesol. correspondant au pic n 3.

Figure 5: Profil GC/MS des tests d'activités in vitro réalisés avec les protéines recombinantes Sh-zFPS-6His et Sh-SBS-6His : Les deux enzymes recombinantes Sh-zFPS-6His et Sh-SBS-6His ont été incubées ensembles avec IPP et DMAPP. Le mélange réactionnel a été extrait au pentane et analysé par GC-MS. Figure 5A:
Chromatogramme du produit obtenu in vitro de la Sh-zFPS et Sh-SBS Le pic 2 est le produit majoritaire et correspond à l'alpha-santalène.. 1, cis-alpha-bergamotène ; 2, alpha-santalène; 3, trans-alpha-bergamotène; 4, épi-beta-santalène; 5, endo-beta-bergamotène. Figure 5B
: Spectre de masse correspondant au pic n 2 (à gauche) et structure de l'alpha-santalène (à droite).
Figure 6: Superposition des profils GC entre les produits obtenus in vitro avec les enzymes recombinantes Sh-zFPS-6His et Sh-SBS-6His, et l'exsudat de la lignée recombinante isôgénique de tomate TA517. Les tracés correspondent à l'ion extrait m/z 94.
En gris: oléfines produites in vitro par Sh-zFPS et Sh-KS. En noir: exsudat de la lignée isogénique TA517. 1, cis-alpha-bergamotène 2, alpha-santalène; 3, trans-alpha-bergamotène ; 4, épi-beta-santalène; 5, endo-beta-bergamotène.

Figure 7: Profil GC/MS des molécules volatiles émises par une plante transgénique (#3877) portant les transgènes Sh-zFPS et Sh-SBS. La plante transgénique #3877 a été

cultivée pendant 24 heures en atmosphère contrôlée dans une enceinte de culture. Les molécules volatiles émises par les plantes ont été piégées sur une matrice Super& Q
(Alltech) et analysées par GC/MS. Le chromatogramme (7A) montre plusieurs pics ayant des signatures m/z caractéristiques des sesquiterpènes de type SB. Les pics ont été
5 identifiés par comparaison de leur temps de rétention et de leur spectre de masse avec ceux de la lignée TA517 (7B). 1, cis-alpha-bergamotène 2, alpha-santalène; 3, trans-alpha-bergamotène ; 4, épi-beta-santalène; 5, endo-beta-bergamotène.

Figure 8 : Polymorphisme du gène zFPS entre S. lycopersicum (SZ) et S. habi-ochaites (Sh): 9 3A) Transgenic Tobacco Lines Incorporating Sh-zFPS and Sh-transgenes SBS
(pLIBRO-064) Figure 3B) Transgenic Tobacco Lines with Integrated only the transgene Sh-SBS (pLIBRO-065).

Figure 4: GC / MS profile of (Z, Z) -farnesol superimposed on farnesol standards (mixed isomers). Figure 4A: The gray chromatogram (m / z: 69) corresponds to product obtained in vitro with the recombinant protein Sh-zFPS-6His. Sh-FPS-6His was incubated with some DMAPP and IPP. The isoprenyl diphosphate product was dephosphorylated to a alcohol and purified by liquid chromatography. Peak 1 corresponds to Z, Z-farnesol. 1. The chromatogranime black (m / z: 69) corresponds to the standard farnesol consisting of a mixed isomers (Z, E) -, (E, Z) -, and (E, E) -farnesol (Fluka). Peak 2 corresponds to a mix of (Z, E) - and (E, Z) - farnesol and peak # 3 at (E, E) -farnesol. Figure 4B: Spectrum Mass of (Z, Z) -farnesol corresponding to peak n 1. Figure 4C: Mass spectrum of (Z, E) -and (E, Z) -farnesol (mixture) corresponding to peak No. 2. Figure 4D: Spectrum of mass of (E, E) -farnesol. corresponding to peak n 3.

Figure 5: GC / MS profile of in vitro activity tests performed with protein Recombinant Sh-zFPS-6His and Sh-SBS-6His: The two recombinant enzymes Sh-zFPS-6His and Sh-SBS-6His were incubated together with IPP and DMAPP. The mixture The reaction was extracted with pentane and analyzed by GC-MS. Figure 5A:
chromatogram in vitro product of Sh-zFPS and Sh-SBS Peak 2 is the product Majority and corresponds to alpha-santalene .. 1, cis-alpha-bergamotene; 2 alpha-santalene; 3, trans-alpha-bergamotene; 4, epi-beta-santalene; 5, endo-beta-bergamotene. Figure 5B
: Spectrum mass corresponding to peak n 2 (left) and structure of the alpha-Santalene (right).
Figure 6: Superposition of GC profiles between in vitro products with the recombinant enzymes Sh-zFPS-6His and Sh-SBS-6His, and the exudate of the lineage recombinant isosgenic tomato TA517. The plots correspond to the ion extract m / z 94.
In gray: olefins produced in vitro by Sh-zFPS and Sh-KS. In black: exudate of line isogenic TA517. 1, cis-alpha-bergamotene 2, alpha-santalene; 3, trans-alpha bergamotene; 4, epi-beta-santalene; 5, endo-beta-bergamotene.

Figure 7: GC / MS profile of volatile molecules emitted by a plant transgenic (# 3877) carrying Sh-zFPS and Sh-SBS transgenes. The transgenic plant # 3877 has been cultivated for 24 hours in a controlled atmosphere in an enclosure of culture. The volatile molecules emitted by the plants were trapped on a matrix Super & Q
(Alltech) and analyzed by GC / MS. Chromatogram (7A) shows several peaks having m / z signatures characteristic of SB type sesquiterpenes. The pics have been 5 identified by comparing their retention time and their spectrum of mass with those of line TA517 (7B). 1, cis-alpha-bergamotene 2, alpha-santalene; 3, trans-alpha-bergamotene; 4, epi-beta-santalene; 5, endo-beta-bergamotene.

Figure 8: Polymorphism of the zFPS gene between S. lycopersicum (SZ) and S. habi ochaites (Sh):

10 Le gène complet zFPS a été amplifié par PCR à partir d'ADN génomique de S.
lycopersicum, S. habrochaites et TA517. La séparation des produits PCR sur gel d'agarose à 0,8% permet d'identifier 3 bandes A, B, C d'une taille d'environ 3000, 2500 et 2000 nucléotides respectivement. Le produit PCR correspondant à la bande B est spécifique du génome S.h et correspond au gène zFPS présenté dans ce document. kb :
kilobases Abréviations et Définitions ARNm : acide ribonucléique messager ADN : acide désoxyribonucléique ADNc ADN complémentaire produit par transcription inverse à partir d'ARNm.
CaMV virus de la mosaïque du chou-fleur DMAPP : diméthylallyl diphosphate CBT-ol : cembratrien-ol CBTS : cembratrien-ol synthase GPP Geranyl diphosphate FPP : Farnesyl diphosphate GC : chromatographie gazeuse GGPP géranyl géranyl diphosphate ihpRNAi : intron hairpin ARN interférent IPP : isopentenyl diphosphate MS spectrométrie de masse PCR : "polymcrase chain reaction"
RACE "rapid amplification of eDNA ends" The zFPS complete gene was amplified by PCR from genomic S DNA.
lycopersicum, S. habrochaites and TA517. The separation of PCR products on gel agarose at 0.8% identifies 3 bands A, B, C with a size of about 3000, 2500 and 2000 nucleotides respectively. The PCR product corresponding to band B is specific Sh genome and corresponds to the zFPS gene presented in this document. kb:
kilobases Abbreviations and Definitions MRNA: messenger ribonucleic acid DNA: deoxyribonucleic acid Complementary cDNA cDNA produced by reverse transcription from mRNA.
CaMV mosaic virus cauliflower DMAPP: dimethylallyl diphosphate CBT-ol: Cembratrien-ol CBTS: Cembratrien-ol synthase GPP Geranyl diphosphate FPP: Farnesyl diphosphate GC: gas chromatography GGPP geranyl geranyl diphosphate ihpRNAi: intron hairpin interfering RNA
IPP: isopentenyl diphosphate MS mass spectrometry PCR: "polymcrase chain reaction"
RACE "rapid amplification of eDNA ends"

11 A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, V : Code standard des acides aminés selon la nomenclature universelle ,~&,-~,v-w3 ncbi nlm.nih.p,ov,%'I'axonomy/Utils,%Nvprint,gc.çgi?mode=t A,C,G,T, B,D,H,K,M,N,R,S,V,W,Y : Code standard des bases selon la nomenclature universelle w-,%-w3 ncbi.nlm.nih. =v/Taxonomyr`Utils/`vprintgc.cgi?modc=t RFLP : Restriction fragment length polymorphism Par Z,Z-farnesyl diphosphate synthase ou zFPS est entendue une enzyme capable de produire du Z,Z-farnesyl diphosphate ((2Z,6Z)-farnesyldiphosphate ou cis,cis-FPP), à
partir d'isopentenyl diphosphate (IPP) et de dimethyl allyl diphosphate (DMAP). Par a.ctivité Z,Z-FPS est entendue la production de Z,Z- Farnesyl.diphosphate à
partir de IPP et DMAPP. L'activité Z,Z-FPS peut être mesurée en mesurant l'apparition du Z,Z-farnesyl diphosphate.

Par SB synthase ou SBS est entendue une enzyme capable de produire un mélange de sesquiterpènes principalement composé d'alpha-santalène, d'épi-beta-santalène, de cis-alpha-bergamotène, de trans-alpha-bergamotène et de endo-beta-bergamotène à
partir de Z,Z-FPP. Par activité de type SB est entendue la production de sesquiterpènes de type SB à partir de Z,Z- Farnesyl diphosphate. L'activité de type SB peut être mesurée en mesurant l'apparition d'un ou plusieurs sesquiterpènes de type SB. Un exemple de mesure d'activité de type SB est décrit dans les exemples.

Par sesquiterpène de type SB est entendue un mélange de sesquiterpènes principalement composé d'alpha-santalène, d'épi-beta-santalène, de cis-alpha-bergamotène, de trans-alpha-bergamotène et de endo-beta-bergamotène.

Conditions stringentes d'hybridation : Généralement, des conditions stringentes, pour un polynucléotide de taille et de séquence données, sont obtenues en opérant a une température inférieure d'environ 5 C a 10 C à la température de fusion (Tm) de l'hybride formé, dans le même mélange réactionnel, par ce polynucléotide et son complémentaire.
Des conditions stringentes d'hybridation pour un polynucléotide donné, peuvent être identifiées par l'homme du métier en fonction de la taille et de la composition en bases du polynucléotide concerné, ainsi que de la composition du mélange d'hybridation 11 A, R, N, D, C, Q, E, G, H, I, L, K, M, F, P, S, T, W, Y, V: Standard code of acids Amines according to the universal nomenclature , ~ &, - ~, v-w3 ncbi nlm.nih.p, ov,% 'I'axonomy / Utils,% Nvprint, gc.çgi? mode = t A, C, G, T, B, D, H, K, M, N, R, S, V, W, Y: Standard code of the bases according to the nomenclature universal w -,% - w3 ncbi.nlm.nih. = V / Taxonomyr`Utils / `vprintgc.cgi? MODC = t RFLP: Restriction fragment length polymorphism By Z, Z-farnesyl diphosphate synthase or zFPS is understood as an enzyme able to produce Z, Z-farnesyl diphosphate ((2Z, 6Z) -farnesyldiphosphate or cis, cis-FPP), to from isopentenyl diphosphate (IPP) and dimethyl allyl diphosphate (DMAP). By a.ctivity Z, Z-FPS is meant the production of Z, Z-Farnesyl.diphosphate to from IPP and DMAPP. Z, Z-FPS activity can be measured by measuring the onset of Z, Z-farnesyl diphosphate.

By SB synthase or SBS is meant an enzyme capable of producing a mix of sesquiterpenes mainly composed of alpha-santalene, epi-beta-santalene, of cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene from Z, Z-FPP. By SB activity is meant the production of sesquiterpenes of type SB from Z, Z-Farnesyl diphosphate. SB activity can be measured in measuring the appearance of one or more SB type sesquiterpenes. An example measurement SB-type activity is described in the examples.

By sesquiterpene type SB is meant a mixture of sesquiterpenes mainly alpha-santalene, epi-beta-santalene, cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene.

Stringent Conditions of Hybridization: Generally, Conditions stringentes, for a polynucleotide of given size and sequence, are obtained by operating a a lower temperature of about 5 C to 10 C at the melting temperature (Tm) of hybrid formed in the same reaction mixture by this polynucleotide and its complementary.
Stringent hybridization conditions for a given polynucleotide can to be identified by those skilled in the art depending on the size and composition in bases of polynucleotide concerned, as well as the composition of the hybridization mixture

12 (notamment pH et force ionique). Des conditions de forte stringence incluent une étape de lavage avec du tampon 0,2 x SSC à 65 C.
Les conditions d'hybridations de stringences décrites ci-dessus peuvent être adaptées par l'homme du métier pour les polynucléotides de taille plus grande ou plus petite, selon les enseignements appropriés connus de l'homme du métier, notamment décrit dans Sambrook et al., 1989, Molecular cloning, A laboratory Manual, Cold Spring Harbor ;
Maniatis et al., 1982, Molecular cloning, A laboratory Manual, Cold Spring Harbor Lab. CSH, N.
Y.
USA, ou l'une de ses récentes rééditions, et dans Ausubel et al., Eds., 1995, Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, N.
Y.).

Par hétérologue est entendu que le gène a été introduit par génie génétique dans la cellule. Il peut y être présent sous forme épisomale ou chromosomique.
L'origine du gène peut être différente de la cellule dans laquelle il est introduit. Cependant, le gène peut également provenir de la même espèce que la cellule dans laquelle il est introduit mais il est considéré comme hétérologue en raison de son environnement qui ne sera pas naturel.
Par exemple, le gène est dit hétérologue car il est sous le contrôle d'un promoteur autre que son promoteur naturel, il est introduit dans un endroit différent de celui-ci où il est situé
naturellement. La cellule hôte peut contenir une copie du gène endogène au préalable de l'introduction du gène hétérologue ou elle peut ne pas contenir de copie endogène.

Par pourcentage d'identité entre deux séquences d'acide nucléique ou d'acides aminés au sens de la présente invention, on cntend désigner un pourcentage de nucléotides ou de résidus d'acides aminés identiques entre les deux séquences à comparer, obtenu après le meilleur alignement, ce pourcentage étant purement statistique et les différences entre les deux séquences étant réparties au hasard et sur toute leur longueur. Le meilleur alignement ou alignement optimal est l'alignement pour lequel le pourcentage d'identité
entre les deux séquences à comparer, comme calculé ci- après, est le plus élevé. Les comparaisons de séquences entre deux séquences d'acide nucléique ou d'acides aminés sont traditionnellement réalisées en comparant ces séquences après les avoir alignées de manière optimale, ladite comparaison étant réalisée par segment ou par fenêtre de comparaison pour identifier et comparer les régions locales de similarité de séquence.
L'alignement optimal des séquences pour la comparaison peut être réalisé, outre manuellement, au moyen de l'algorithme d'homologie locale de Smith et Waterman (1981) 12 (in particular pH and ionic strength). Conditions of high stringency include a step of washing with 0.2 x SSC buffer at 65 C.
The stringency hybridization conditions described above can be adapted by those skilled in the art for larger or larger polynucleotides small, according to the appropriate teachings known to those skilled in the art, in particular described in Sambrook et al., 1989, Molecular cloning, A laboratory Manual, Cold Spring Harbor;
Maniatis et al., 1982, Molecular cloning, A laboratory Manual, Cold Spring Harbor Lab. CSH, N.
Y.
USA, or one of his recent reissues, and in Ausubel et al., Eds., 1995, Current Protocols in Molecular Biology, Chapter 2 (Greene Publishing and Wiley-Interscience, N.
Y.).

By heterologous is understood that the gene was introduced by genius genetics in the cell. It can be present in episomal or chromosomal form.
The origin of the gene may be different from the cell in which it is introduced. However, the gene can also come from the same species as the cell in which it is introduced but he is considered heterologous because of its environment that will not be natural.
For example, the gene is said to be heterologous because it is under the control of a sponsor other than its natural promoter, it is introduced in a different place from this one where it is located naturally. The host cell may contain a copy of the endogenous gene at prior to the introduction of the heterologous gene or it may not contain a copy endogenous.

By percentage identity between two nucleic acid sequences or of amino acids within the meaning of the present invention, a percentage of nucleotides or identical amino acid residues between the two sequences to be compared, obtained after the better alignment, this percentage being purely statistical and the differences between two sequences being randomly distributed over their entire length. The better alignment or optimal alignment is the alignment for which the percentage of identity between the two sequences to compare, as calculated below, is the highest. The comparisons of sequences between two nucleic acid sequences or amino acids are traditionally performed by comparing these sequences after having aligned optimally, said comparison being made by segment or by window of comparison to identify and compare local regions of similarity of sequence.
The optimal alignment of the sequences for the comparison can be realized, outraged manually, using Smith and Waterman's local homology algorithm (nineteen eighty one)

13 (Ad. App. Math. 2 : 482), au moyen de l'algorithme d'homologie locale de Neddleman et Wunsch (1970) (J. Mol. Biol. 48 : 443), au moyen de la méthode de recherche de similarité
de Pearson et Lipman (1988) (Proc. Natl. Acad. Sci. USA 85 : 2444), au moyen de logiciels informatiques utilisant ces algorithmes (GAP, BESTFIT, FASTA et TFASTA
dans le Wisconsin Genctics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI). Le pourcentage d'identité entre deux séquences d'acide nucléique ou d'acides aminés est déterminé en comparant ces deux séquences alignées de manière optimale par fenêtre de comparaison dans laquelle la région de la séquence d'acide nucléique ou d'acides aminés à comparer peut comprendre des additions ou des délétions par rapport à la séquence de référence pour un alignement optimal entre ces deux séquences. Le pourcentage d'identité est calculé en déterminant le nombre de positions identiques pour lesquelles le nucléotide ou le résidu d'acide aminé est identique entre les deux séquences, en divisant ce nombre de positions identiques par le nombre total de positions dans la fenêtre de comparaison et en multipliant le résultat obtenu par 100 pour obtenir le pourcentage d'identité entre ces deux séquences.

Description Détaillée de l'Invention La présente invention décrit donc pour la première fois les gènes codant pour les enzymes inipliquées dans la voie de synthèse de plusieurs sesquiterpènes. En particulier, la présente invention concerne la caractérisation d'une sesquiterpène synthase de tomate à
produits multiples (SB synthase) qui permet la production d'un mélange de sesquiterpènes dénommés composés de type SB et principalement composé d'alpha-santalène, d'épi-beta-santalène, de cis-alpha-bergamotène, de trans-alpha-bergamotène et de endo-beta-bergamotène à partir de Z,Z-FPP. En outre, elle concerne également la caractérisation de la Z,Z-farnesyl diphosphate synthase (zFPS) de tomate qui permet la production de Z,Z-FPP à
partir d'IPP et de DMAP. Ces enzymes peuvent être utilisées pour la production de sesquiterpènes de type SB ou de Z,Z-FPP, in vitro ou in vivo dans des organismes transgéniques ou des cellules ou micro-organismes recombinants. Les organismes transgéniques, cellules ou micro-organismes tels que les bactéries, les levures, les champignons, les cellules animales, d'insectes ou de plantes et les plantes ou animaux transgéniques sont considérés. Elles permettent également la production de composés dérivés du Z,Z-FPP comme le Z,Z-farnesol. Les procédés de la présente invention sont plus particulièrement applicables à la production de Z,Z-FPP dans des microorganismes (bactérie, levure) et de composés de type SB dans les plantes possédant des trichomes 13 (Math App Ad.2: 482), using the local homology algorithm of Neddleman and Wunsch (1970) (J. Mol Biol., 48: 443), using the search method of similarity Pearson and Lipman (1988) (Proc Natl Acad Sci USA 85: 2444), using of computer software using these algorithms (GAP, BESTFIT, FASTA and TFASTA
in the Wisconsin Genctics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI). The percentage identity between two acid sequences nucleic or of amino acids is determined by comparing these two aligned sequences of way optimal by comparison window in which the region of the sequence acid nucleic acid or amino acids to be compared may include additions or deletions compared to the reference sequence for optimal alignment between these two sequences. The identity percentage is calculated by determining the number of positions identical for which the nucleotide or the amino acid residue is identical between two sequences, dividing this number of identical positions by the number total of positions in the comparison window and multiplying the result obtained per 100 for get the percentage of identity between these two sequences.

Detailed Description of the Invention The present invention thus describes for the first time the genes coding for enzymes iniplicated in the synthetic route of several sesquiterpenes. In particular, this The invention relates to the characterization of a sesquiterpene synthase from tomato to products (SB synthase) which allows the production of a mixture of sesquiterpenes so-called SB compounds and mainly composed of alpha-santalene, epi-beta-santalene, cis-alpha-bergamotene, trans-alpha-bergamotene and endo-beta-bergamotene from Z, Z-FPP. In addition, it also concerns characterization of the Z, Z-farnesyl diphosphate synthase (zFPS) tomato that allows the production of Z, Z-FPP to from IPP and DMAP. These enzymes can be used for production of sesquiterpenes of the SB or Z type, Z-FPP, in vitro or in vivo in agencies transgenic or recombinant cells or microorganisms. The organisms transgenics, cells or micro-organisms such as bacteria, yeasts, mushrooms, animal cells, insects or plants and plants or animals transgenic are considered. They also allow the production of compounds Derivatives of Z, Z-FPP such as Z, Z-farnesol. The processes of this invention are more particularly applicable to the production of Z, Z-FPP in microorganisms (bacteria, yeast) and SB compounds in plants with trichomes

14 glanduleux de type sécréteurs. La production du mélange de sesquiterpènes de type SB ou de leurs dérivés peut également être diminuée ou supprimée dans des plantes, par exemple la tomate, par des techniques d'extinction de gènes ou par mutagenèse. En outre, les séquences identifiées dans la présente invention sont utiles pour l'identification et/ou le clonage de gènes codant pour des enzymes ayant les mêmes activités dans d'autres espèces d'organismes, en particulier de plantes. Enfin, des marqueurs moléculaires polymorphiques peuvent être identifiés à partir des acides nucléiques codant pour la zFPS et la SB synthase et permettront de suivre l'introduction des séquences génomiques fonctionnelles correspondantes dans d'autres espèces ou variétés de tomate cultivées (Solanum lycopersicum).
Le Z,Z-FPP est un substrat potentiel de sesquiterpènes synthases qui n'est pas disponible actuellement commercialement. Si la majorité des sesquiterpène synthases caractérisécs à
ce jour utilise le E,E-FPP, il est évident par ailleurs que l'absence de Z,Z-FPP disponible commercialement a très làrgement limité son utilisation à des fins expérimentales. La cadinène synthase de coton est le seul exemple qui décrit l'utilisation préférentielle du Z,Z-FPP par une sesquiterpène synthase (Heinstein et al., 1970). Dans ce cas le Z,Z-FPP a été
produit par synthèse chimique, et la Z,Z-FPP synthase décrite dans ce brevet fournit un moyen de produire cette molécule de manière aisée et peu coûteuse.
Par ailleurs, les sesquiterpènes de type SB contiennent l'alpha-santalène, lui-même précurseur direct de l'alpha-santalol. L'alpha-santalol est un des composants caractéristiques de l'huile essentielle de bois de santal. L'huile de bois de santal est extrèmement prisée en parfumerie et son coût a très fortement augmenté depuis 10 ans en raison d'une surexploitation du bois de santal, principalement en Inde. Cette surexploitation fait peser une menace sur la viabilité de la ressource naturelle de bois de Santal. L'alpha-santalol peut être obtenu à partir de l'alpha santalène par une simple hydroxylation.
La présente invention concerne donc une méthode de production de sesquiterpènes de type SB ou de dérivés de ceux-ci à partir de Z,Z-FPP dans une cellule ayant une source de DMAP et IPPP, comprenanl :
a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un premier gène codant pour une zFPS selon la présente invention et d'une construction portant une cassette d'expression comprenant un deuxième gène codant pour une SB synthase selon la présente invention;

b) la culture de la cellule transformée dans des conditions appropriées pour l'expression desdits premier et deuxième gènes ; et, c) facultativement, la récolte de sesquiterpènes de type SB ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
5 Dans un mode de réalisation particulier, les sesquiterpènes de type SB
produits sont récoltés à l'étape c). Dans un mode de réalisation préféré, les sesquiterpènes de type SB
produits sont sélectionnés parmi l'alpha-santalène, l'épi-beta-santalène, l'alpha-bergamotène, le beta-bergamotène, et l'endo-beta-bergamotène. Dans un autre mode de réalisation particulier, les sesquiterpènes de type SB produits sont les produits de départ 10 pour obtenir d'autres composés d'intérêt comme l'alpha-santalol. Dans un mode de réalisation préféré, les dérivés de sesquiterpènes de type SB sont sélectionnés parmi l'alpha-santalol, l'épi-beta-santalol, le cis-alpha-bergamotol, le trans-alpha-bergamotol et l' endo-beta-bergamotol. 14 glandular secretory type. The production of the mixture of sesquiterpenes SB type or of their derivatives can also be diminished or suppressed in plants, for example tomato, by gene extinguishing techniques or by mutagenesis. In In addition, sequences identified in the present invention are useful for identification and / or cloning of genes coding for enzymes having the same activities in other species organisms, especially plants. Finally, molecular markers polymorphic can be identified from the nucleic acids encoding zFPS and SB synthase and will track the introduction of genomic sequences functional in other varieties or varieties of tomato grown (Solanum lycopersicum).
Z, Z-FPP is a potential substrate for sesquiterpene synthases that is not available currently commercially. If the majority of sesquiterpene synthases characterized this day uses the E, E-FPP, it is also evident that the absence of Z, Z-FPP available commercially has very limited use of it for experimental. The cadinene synthase of cotton is the only example that describes the use preferential Z, Z-FPP by a sesquiterpene synthase (Heinstein et al., 1970). In this case the Z, Z-FPP has been produced by chemical synthesis, and the Z, Z-FPP synthase described in this patent provides a way to produce this molecule easily and inexpensively.
In addition, SB-type sesquiterpenes contain alpha-santalene, which is even direct precursor of alpha-santalol. Alpha-santalol is one of the components characteristics of the essential oil of sandalwood. Wood oil sandal is extremely popular in perfumery and its cost has greatly increased since 10 years in because of overexploitation of sandalwood, mainly in India. This overexploitation poses a threat to the viability of the resource natural wood of Sandalwood. Alpha-santalol can be obtained from alpha santalene by a simple hydroxylation.
The present invention thus relates to a method for producing sesquiterpenes of type SB or derivatives thereof from Z, Z-FPP into a cell having a source of DMAP and IPPP, including:
a) the introduction into said cell of a construction carrying a cassette expression system comprising a first gene coding for a zFPS according to the present invention invention and a construction carrying an expression cassette comprising a second gene encoding an SB synthase according to the present invention;

(b) the culture of the transformed cell under appropriate conditions to expressing said first and second genes; and, (c) optionally, the collection of SB-type sesquiterpenes or this one contained in said cell and / or in the culture medium.
In a particular embodiment, SB type sesquiterpenes products are harvested in step c). In a preferred embodiment, the sesquiterpenes SB type products are selected from alpha-santalene, epi-beta-santalene, alpha bergamotene, beta-bergamotene, and endo-beta-bergamotene. In another mode of particular achievement, the SB-type sesquiterpenes produced are the starting products To obtain other compounds of interest such as alpha-santalol. In one mode of preferred embodiment, the SB type sesquiterpenes derivatives are selected from alpha-santalol, epi-beta-santalol, cis-alpha-bergamotol, trans-alpha-bergamotol and endo-beta-bergamotol.

15 Dans un mode de réalisation particulier, la présente invention concerne une méthode de production de sesquiterpènes de type SB ou de dérivés de ceux-ci à partir de Z,Z-FPP dans une cellule ayant une source de DMAP et IPPP, comprenant :
a) la fourniture d'une cellule recombinante comprenant un premier gène hétérologue codant pour une zFPS selon la présente invention et un deuxième gène hétérologue codant pour une SB synthase selon la présente invention ;
b) la culture de la cellule dans des conditions appropriées pour l'expression desdits premier et deuxième gènes ; et, c) facultativement, la récolte de sesquiterpènes de type SB ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
Dans un mode de réalisation préféré, ladite cellule produit du Z,Z-FPP. Dans un autre mode de réalisation, le Z,Z-FPP est fourni à la cellule.

Dans un mode de réalisation particulier, les deux cassettes d'expression sont portées par une même construction. Dans un autre mode de réalisation, les deux cassettes d'expression sont portées par deux constructions distinctes.

La présente invention concerne une protéine isolée ou recombinante ayant une activité Z,Z-FPP synthase. En particulier, elle concerne un polypeptide isolé ou recombinant ayant une In a particular embodiment, the present invention relates to a method of production of SB-type sesquiterpenes or derivatives thereof from Z, Z-FPP in a cell having a source of DMAP and IPPP, comprising:
a) providing a recombinant cell comprising a first gene heterologous coding for a zFPS according to the present invention and a second gene heterologous coding for an SB synthase according to the present invention;
b) cell culture under appropriate conditions for expression said first and second genes; and, (c) optionally, the collection of SB-type sesquiterpenes or this one contained in said cell and / or in the culture medium.
In a preferred embodiment, said cell produces Z, Z-FPP. In another embodiment, the Z, Z-FPP is supplied to the cell.

In a particular embodiment, the two expression cassettes are worn by the same construction. In another embodiment, the two cassettes expression are carried by two distinct constructions.

The present invention relates to an isolated or recombinant protein having a activity Z, Z-FPP synthase. In particular, it relates to an isolated polypeptide or recombinant having a

16 activité de Z,Z-FPP synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 2. De préférence, le polypeptide présente au moins 95% d'identité avec la SEQ ID No 2. Dans un mode de réalisation particulier, le polypeptide comprend ou consiste en la séquence SEQ ID No 2. Ce polypeptide peut également comprendre une séquence additionnelle permettant de faciliter la purification de l'enzyme, par exemple une séquence étiquette comprenant plusieurs acides aminés histidine consécutifs.

La présente invention concerne également un acide nucléique isolé comprenant une séquence nueléotidique codant un polypeptide ayant une activité de Z,Z-FPP
synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99%
d'identité
avec la SEQ ID No 2 ou une séquence capable de s'hybrider à celui-ci dans des conditions stringentes. Un exemple d'acide nucléique est l'acide nucléique comprenant ou consistant en une séquence présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99%
d'identité
avec la SEQ ID No 1 ou une séquence complémentaire de celle-ci. La présente invention concerne un acide nucléique isolé capable de s'hybrider dans des conditions de forte stringence à un acide nucléique qui code un polypeptide ayant une activité de Z,Z-FPP
synthase et la séquence dudit polypeptide présentant au moins 95% ou 98%
d'identité avec la SEQ ID No 2. Dans un mode de réalisation particulier, l'acide nucléique comprend ou consiste en la séquence SEQ ID No 1. La présente invention concerne également une cassette d'expression, un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique selon la présente invention.

Les acides nucléiques peuvent être des ADN génomiques, des ADN complémentaires (ADNc) ou des ADN synthétiques. Ils peuvent être sous forme simple chaîne ou en duplexe ou un mélange des deux. Dans le cadre de la présente invention, les acides nucléiques transcrits sont de préférence des ADNc dénués d'introns. Les acides nucléiques transcrits peuvent être des molécules synthétiques ou semi-synthétiques, recombinantes, éventuellement amplifiées ou clonées dans des vecteurs, modifiées chimiquement ou comprenant des bases non naturelles. Il s'agit typiquement de molécules d'ADN
isolées, synthétisées par des techniques recombinantes bien connues en soi de l'homme du métier.
La présente invention concerne également un polypeptide isolé ou recombinant ayant une activité dc SB synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 16 Z activity, Z-FPP synthase and whose sequence has at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No. 2. Preferably, the polypeptide present at least 95% identity with SEQ ID No. 2. In one embodiment particular, the polypeptide comprises or consists of the sequence SEQ ID No. 2. This polypeptide can also include an additional sequence to facilitate the purification of the enzyme, for example a label sequence comprising several acids amino consecutive histidine.

The present invention also relates to an isolated nucleic acid comprising a Nucleotide sequence encoding a polypeptide having Z, Z-FPP activity synthase and whose sequence has at least 80%, 85%, 90%, 95%, 97%, 98% or 99%
identity with SEQ ID No. 2 or a sequence capable of hybridizing to it in terms stringent. An example of a nucleic acid is the nucleic acid comprising or consisting in a sequence of at least 80%, 85%, 90%, 95%, 97%, 98% or 99%
identity with SEQ ID No. 1 or a complementary sequence thereof. The current invention an isolated nucleic acid capable of hybridizing under strong nucleic acid stringency which encodes a polypeptide having a Z, Z-FPP
synthase and the sequence of said polypeptide having at least 95% or 98%
identity with SEQ ID No. 2. In a particular embodiment, the nucleic acid understands or consists of the sequence SEQ ID No. 1. The present invention also relates to a expression cassette, a vector, a host cell or an organism transgenic comprising a nucleic acid according to the present invention.

The nucleic acids can be genomic DNAs, complementary DNAs (CDNA) or synthetic DNAs. They can be in simple string form or in duplex or a mixture of both. In the context of the present invention, acids Transcribed nuclei are preferably cDNAs lacking introns. Acids nucleic transcripts can be synthetic or semi-synthetic molecules, recombinant, possibly amplified or cloned into vectors, chemically modified or comprising unnatural bases. These are typically DNA molecules isolated synthesized by recombinant techniques well known per se of humans of career.
The present invention also relates to an isolated or recombinant polypeptide having a SB synthase activity and whose sequence has at least 80%, 85%, 90%, 95%, 97%,

17 98% ou 99% d'identité avec la SEQ ID No 4. Dans un mode de réalisation particulier, le polypeptide comprend ou consiste en la séquence SEQ ID No 4. Dans ce cas, la présente invention concerne un polypeptide isolé ou recombinant ayant une activité de SB
synthase et dont la séquence présente au moins 95% d'identité avec la SEQ ID
No 4. Ce polypeptide peut également comprendre une séquence additionnelle permettant dc faciliter la purification de l'enzynle, par exemple une séquence étiquette comprenant plusieurs acides aminés histidine consécutifs.

La présente invention concerne également un acide nucléique isolé comprenant une séquence nucléotidique codant un polypeptide ayant une activité de SB synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 4 ou une séqucnce capable de s'hybrider à celui-ci dans des conditions stringentes. Un exemple d'acide nucléique est l'acide nucléique comprenant ou consistant en une séquence présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99%d'identité
avec la SEQ ID No 3 ou une séquence complémentaire de celle-ci. La présente invention concerne un acide nucléique isolé capable de s'hybrider dans des conditions de forte stringence à un acide nucléique qui code un polypeptide ayant une activité de SB
synthase et la séquence dudit polypeptide présentant au moins 95% ou 98%
d'identité avec la SEQ ID No 4. Dans un mode de réalisation particulier, l'acide nucléique comprend ou consiste en la séquence SEQ ID No 3. La présente invention concerne également une cassette d'expression, un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique selon la présente invention.

La présente invention concerne tout particulièrement un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique comprenant une séquence hétérologue codant un polypeptide ayant une activité de SB synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ
ID No 4 et un acide nucléique comprenant une séquence hétérologue codant un polypeptide ayant une activité de Z,Z-FPP synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 2. Dans un mode de réalisation particulier de l'invention, l'organisme transgénique est une plante, et en particulier une plante à trichomes.

WO 2008/142317 98% or 99% identity with SEQ ID No. 4. In one embodiment particular, the polypeptide comprises or consists of the sequence SEQ ID No. 4. In this case, the present The present invention relates to an isolated or recombinant polypeptide having SB
synthase and whose sequence has at least 95% identity with SEQ ID
No. 4. This polypeptide may also comprise an additional sequence allowing dc facilitate the purification of the enzynle, for example a label sequence comprising many consecutive histidine amino acids.

The present invention also relates to an isolated nucleic acid comprising a nucleotide sequence encoding a polypeptide having SB synthase activity and whose sequence has at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the SEQ ID No. 4 or a sequence capable of hybridizing to it in terms stringent. An example of a nucleic acid is the nucleic acid comprising or consisting in a sequence having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No. 3 or a complementary sequence thereof. The current invention an isolated nucleic acid capable of hybridizing under strong nucleic acid stringency which encodes a polypeptide having a SB
synthase and the sequence of said polypeptide having at least 95% or 98%
identity with SEQ ID No. 4. In a particular embodiment, the nucleic acid understands or consists of the sequence SEQ ID No. 3. The present invention also relates to a expression cassette, a vector, a host cell or an organism transgenic comprising a nucleic acid according to the present invention.

The present invention particularly relates to a vector, a cell host or transgenic organism comprising a nucleic acid comprising a sequence heterologous polypeptide encoding a polypeptide having SB synthase activity and whose sequence present at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the SEQ
ID No 4 and a nucleic acid comprising a heterologous sequence encoding a polypeptide having an activity of Z, Z-FPP synthase and whose sequence has at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No. 2. In a mode of production of the invention, the transgenic organism is a plant, and particular a trichome plant.

WO 2008/1423

18 PCT/FR2008/050576 La présente invention concerne également un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique comprenant une séquence hétérologue codant un polypeptide ayant une activité de SB synthase et dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 4.
La présente invention concerne en outre un vecteur, une cellule hôte ou un organisme transgénique comprenant un acide nucléique comprenant une séquence hétérologue codant un polypeptide ayant une activité de Z,Z-FPP synthase, de préférence dont la séquence présente au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ
ID No 2.

La présente invention concerne une méthode de production d'un mélange de sesquiterpènes de type SB ou de dérivés de ceux-ci à partir d'IPP et de DMAP
comprenant la mise en contact d'IPP et de DMAP avec une Z,Z-FPP synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ
ID
No 3 et une SB synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 4 dans des conditions appropriées et la récolte d'un mélange de sesquiterpène de type SB ou de dérivés de celui-ci obtenus. Elle concerne l'utilisation d'une Z,Z-FPP synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 2 et d'une SB synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 4 pour la préparation d'un mélange de sesquiterpène de type SB ou de dérivés de celui-ci à partir de d'IPP et de DMAP.

La présente invention concerne une méthode de production de Z,Z-FPP ou de dérivés de celui-ci à partir d'IPP et de DMAP comprenant la mise en contact d'IPP et de DMAP avec une Z,Z-FPP synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 2 dans des conditions appropriées et la récolte du Z,Z-FPP ou de dérivés de celui-ci obtenus. Facultativement, la méthode comprend en outre l'incubation du Z,Z-FPP obtenu avec une phosphatase alkaline d'intestin de veau et la récolte du Z,Z-farnesol. La présente invention concerne l'utilisation d'une Z,Z-FPP synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 2 pour la préparation de Z,Z-FPP ou de dérivés de celui-ci à partir d'IPP et de DMAP. 18 PCT / FR2008 / 050576 The present invention also relates to a vector, a host cell or a organization transgenic composition comprising a nucleic acid comprising a heterologous sequence encoding a polypeptide having SB synthase activity and whose sequence is present at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No. 4.
The present invention further relates to a vector, a host cell or a organization transgenic composition comprising a nucleic acid comprising a heterologous sequence encoding a polypeptide having Z, Z-FPP synthase activity, preferably sequence present at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the SEQ
ID No 2.

The present invention relates to a method for producing a mixture of SB-type sesquiterpenes or derivatives thereof from IPP and DMAP
comprising bringing IPP and DMAP into contact with a recombinant Z, Z-FPP synthase or purified with at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the SEQ
ID
No. 3 and a recombinant or purified SB synthase having at least 80%, 85%, 90%
95%, 97%, 98% or 99% identity with SEQ ID No. 4 under conditions appropriate and harvesting a mixture of sesquiterpene SB type or derivatives thereof obtained. She relates to the use of a recombinant or purified Z, Z-FPP synthase presenting at less than 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No 2 and a Recombinant or purified SB synthase having at least 80%, 85%, 90%, 95%, 97%
98% or 99% identity with SEQ ID No. 4 for the preparation of a mixture of SB-type sesquiterpene or derivatives thereof from IPP and DMAP.

The present invention relates to a method for producing Z, Z-FPP or derived from the latter from IPP and DMAP including the contacting of IPP and DMAP with a recombinant or purified Z, Z-FPP synthase having at least 80%, 85%, 90%
95%, 97%, 98% or 99% identity with SEQ ID No. 2 under conditions appropriate and harvesting Z, Z-FPP or derivatives thereof. Optionally, the method further comprises incubating the Z, Z-FPP obtained with an alkaline phosphatase of calf intestine and harvest of Z, Z-farnesol. The present invention regards the use recombinant or purified Z, Z-FPP synthase having at least 80%, 85%, 90%
95%, 97%, 98% or 99% identity with SEQ ID No. 2 for the preparation of Z, Z-FPP or derivatives thereof from IPP and DMAP.

19 La présente invention concerne une méthode de production d'un mélange de sesquiterpènes de classe II ou de dérivés de ceux-ci à partir de Z,Z-FPP
comprenant la mise en contact du Z,Z-FPP avec une SB synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité avec la SEQ ID No 4 dans des conditions appropriées et la récolte d'un mélange de sesquiterpène de type SB
ou de dérivés de ceux-ci obtenus. Elle concerne l'utilisation d'une SB synthase recombinante ou purifiée présentant au moins 80%, 85%, 90%, 95%, 97%, 98% ou 99% d'identité
avec la SEQ ID No 4 pour la préparation d'un mélange de sesquiterpène de classe II ou de dérivés de ceux-ci à partir de Z,Z-FPP.

De manière générale, une cassette d'expression comprend tous les éléments nécessaires à
la transcription et traduction du gène en une protéine. Notamment, elle comprend un promoteur, éventuellement un amplificateur, un terminateur de transcription et les éléments permettant la traduction.

Le promoteur est adapté à la cellule hôte. Par exemple, si la cellule est procaryote, le promoteur peut être sélectionné parmi les promoteurs suivants : Lacl, LacZ, pLacT, ptac, pARA, pBAD, les promoteurs d'ARN polymérase de bactériophage T3 or T7, le promoteur de la polyhèdrine, le promoteur PR ou PL du phage lambda. Si la cellule est eucaryote et animale, le promoteur peut être sélectionné parmi les promoteurs suivants :
promoteur précoce du cytomegalovirus (CMV), promoteur de la thymidine kinase du virus de l'herpes simple (herpes simplex virus, HSV), promoteur précoce ou tardif du virus simian 40 (SV40), le promoteur de la métallothionéine-L de souris, et les régions LTR
(long terminal repeat) de certains rétrovirus. De manière générale, pour le choix d'un promoteur adapté, l'homme du métier pourra avantageusement se référer à
l'ouvrage de Sambrook et Russell (2000) ou encore aux techniques décrites dans l'ouvrage d'Ausubel et al. (2006) Le vecteur peut être un plasmide, un phage, un phagemide, un cosmide, un virus, un YAC, un BAC, un plasmide pTi d'Agrobacterium, etc. Le vecteur peut comprendre de préférence un ou plusieurs éléments sélectionnés parmi une origine de réplication, un site de clonage multiple et un marqueur. Le marqueur peut être un gène rapporteur qui engendre un signal détectable. Le signal détectable peut être un signal fluorescent, une coloration, une émission de lumière. Le marqueur pourra donc être GFP, EGFP, DsRed, la beta-galactosidase, la beta-glucosidase, la luciférase, etc. Le marqueur est de préférence un marqueur de sélection procurant à la cellule une résistance à un antibiotique ou un herbicide. Par exemple, le gène peut être un gène de résistance à la kanamycine, 5 néomycine, etc. Dans un mode de réalisation préféré, le vecteur est un plasmide. Des exemples de vecteurs procaryotes figurent dans la liste suivante qui n'est pas exhaustive :
pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pbsks, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pBR322, et pRIT5 (Pharmacia), pET (Novagen) et pQE-30 (QIAGEN). Des 10 exemples de vecteurs eucaryotes figurent dans la liste suivante qui n'est pas exhaustive :
pWLNEO, pSV2CAT, pPICZ, pcDNA3.1 (+) Hyg (Invitrogen), pOG44, pXTI, pSG
(Stratagene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia);. Les vecteurs viraux peuvent être de manière non-exhaustive des adénovirus, des AAV, des HSV, des lentivirus, etc. De préférence, le vecteur d'expression est un plasmide ou un 15 vecteur viral.

La cellule hôte peut être un procaryote, par exemple Escherichia coli, Bacillus subtilis, Streptomyces sp, et Pseudomoiaas sp ou un eucaryote. L'eucaryote peut être un eucaryote inférieur comme une levure (par exemple, Saccharomyces cerevisiae) ou un champignon 19 The present invention relates to a method for producing a mixture of Class II sesquiterpenes or derivatives thereof from Z, Z-FPP
including putting in contact with Z, Z-FPP with recombinant or purified SB synthase having at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with SEQ ID No 4 in appropriate conditions and harvesting a SB-type sesquiterpene mixture or derivatives thereof. It concerns the use of an SB synthase recombinant or purified with at least 80%, 85%, 90%, 95%, 97%, 98% or 99% identity with the SEQ ID No. 4 for the preparation of a class II sesquiterpene mixture or derivatives of these from Z, Z-FPP.

In general, an expression cassette includes all the elements necessary to the transcription and translation of the gene into a protein. In particular, she includes a promoter, possibly an amplifier, a transcription terminator and the elements allowing translation.

The promoter is adapted to the host cell. For example, if the cell is prokaryotic, the promoter may be selected from the following promoters: Lacl, LacZ, pLacT, ptac, pARA, pBAD, bacteriophage T3 or T7 RNA polymerase promoters, the polyhedrin promoter, the PR or PL promoter of phage lambda. If the cell is eukaryotic and animal, the promoter can be selected from the promoters following:
cytomegalovirus (CMV) early promoter, thymidine kinase promoter of the virus herpes simplex virus (HSV), an early or late promoter of virus simian 40 (SV40), the promoter of mouse metallothionein-L, and the LTR regions (long terminal repeat) of some retroviruses. In general, for the choice of a adapted promoter, the person skilled in the art may advantageously refer to the book Sambrook and Russell (2000) or the techniques described in the book from Ausubel and al. (2006) The vector may be a plasmid, a phage, a phagemid, a cosmid, a virus, a YAC, a BAC, a plasmid pTi of Agrobacterium, etc. The vector may include preference one or more elements selected from an origin of replication, a cloning site multiple and a marker. The marker can be a reporter gene that generates a signal detectable. The detectable signal may be a fluorescent signal, a staining, a light emission. The marker can therefore be GFP, EGFP, DsRed, beta-galactosidase, beta-glucosidase, luciferase, etc. The marker is preferably a selection marker providing the cell with resistance to an antibiotic or one herbicide. For example, the gene may be a resistance gene to kanamycin Neomycin, etc. In a preferred embodiment, the vector is a plasmid. of the examples of prokaryotic vectors are listed in the following list which is not exhaustive:
pQE70, pQE60, pQE-9 (Qiagen), pbs, pD10, phagescript, psiX174, pbluescript SK, pBSKS, pNH8A, pNH16A, pNH18A, pNH46A (Stratagene); ptrc99a, pKK223-3, pKK233-3, pDR540, pBR322, and pRIT5 (Pharmacia), pET (Novagen) and pQE-30 (QIAGEN). of the Examples of eukaryotic vectors are given in the following list which is not not exhaustive:
pWLNEO, pSV2CAT, pPICZ, pcDNA3.1 (+) Hyg (Invitrogen), pOG44, pXTI, pSG
(Stratagene); pSVK3, pBPV, pCI-neo (Stratagene), pMSG, pSVL (Pharmacia); The viral vectors may be non-exhaustively adenoviruses, AAV, HSV, lentivirus, etc. Preferably, the expression vector is a plasmid or a Viral vector.

The host cell may be a prokaryote, for example Escherichia coli, Bacillus subtilis, Streptomyces sp, and Pseudomoiaas sp or a eukaryote. Eukaryote can be a eukaryotic as a yeast (eg, Saccharomyces cerevisiae) or a mushroom

20 filamenteux (par exemple du genre Aspergillus) ou un eucaryote supérieur comme une cellule d'insecte, de mammifère ou de plante. La cellule peut être une cellule mammifère, par exemple une cellule COS, CHO (US 4,889,803 ; US 5,047,335). Dans un mode de réalisation particulier, la cellule est non-humaine et non-embryonnaire. La cellule peut être isolée, par exemple dans un milieu de culture. Les cellules peuvent également être comprises dans des organismes, par exemple des animaux non-humains transgéniques ou des plantes transgéniques.

La présente invention concerne donc une méthode de production de Z,Z-FPP ou de dérivés de celui-ci à partir d'IPP et de DMAP dans une cellule ayant une source d'IPP
et de DMAP, comprenant :
a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une Z,Z-FPP synthase selon la présente invention ; Filamentous (eg Aspergillus) or higher eukaryotic like a insect, mammal or plant cell. The cell can be a cell mammal, for example a COS cell, CHO (US 4,889,803; US 5,047,335). In a mode of particular realization, the cell is non-human and non-embryonic. The cell can be isolated, for example in a culture medium. Cells can also to be included in organisms, for example non-human animals transgenic or transgenic plants.

The present invention therefore relates to a method for producing Z, Z-FPP or derivatives of it from IPP and DMAP in a cell with a PPI source and of DMAP, comprising:
a) the introduction into said cell of a construction carrying a cassette expression comprising a gene coding for a Z, Z-FPP synthase according to the present invention;

21 b) la culture de la cellule transformée dans des conditions appropriées pour l'expression du gène ; et, c) facultativement, la récolte du Z,Z-FPP ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.
Dans un mode de réalisation particulier, le Z,Z-FPP produit est récolté à
l'étape c). Dans un autre mode de réalisation particulier, le Z,Z-FPP produit est le produit de départ pour obtenir un autre composé d'intérêt comme le Z,Z-farnesol. Par exemple, le Z,Z-FPP peut être transformé en Z,Z-farnesol par une phosphatase. Ainsi, la méthode peut comprendre en outre à l'étape a) l'introduction d'une construction portant une cassette d'expression comprenant un gène codant pour une phosphatase, permettant ainsi la récolte de Z,Z-farnesol à l'étape c). La présente invention concerne donc une méthode de production de Z,Z-FPP ou de dérivés de celui-ci à partir d'IPP et de DMAP dans une cellule recombinante ayant une source d'IPP et de DMAP et comprenant un gène hétérologue codant pour une Z,Z-FPP synthase selon la présente invention. La présente invention concerne ainsi une méthode de production de Z,Z-FPP dans une cellule recombinante ayant une source de DMAP et IPPP, comprenant :
a) la fourniture d'une cellule recombinante comprenant un gène hétérologue codant pour une zFPS selon la présente invention ;
b) la culture de la cellule dans des conditions appropriées pour l'expression dudit gène ; et, c) facultativement, la récolte du Z,Z-FPP ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.

La présente invention concerne donc une méthode de production d'un mélange de sesquiterpènes de type SB ou de dérivés de ceux-ci à partir de Z,Z-FPP dans une cellule ayant une source de ZZ-FPP, comprenant :
a) l'introduction dans ladite cellule d'une construction portant une cassette d'expression comprenant un gène codant pour une SB synthase selon la présente invention ;
b) la culture de la cellule transformée dans des conditions appropriées pour l'expression du gène ; et, c) facultativement, la récolte d'un mélange de sesquiterpène de type SB ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture. 21 (b) the culture of the transformed cell under appropriate conditions to gene expression; and, c) optionally, the harvest of Z, Z-FPP or derivatives thereof contained in said cell and / or in the culture medium.
In a particular embodiment, the Z, Z-FPP produced is harvested at step c). In one Another particular embodiment, the Z, Z-FPP produced is the product of leave for get another compound of interest like Z, Z-farnesol. For example, the Z, Z-FPP can be transformed into Z, Z-farnesol by a phosphatase. So the method can understand in in addition to step a) the introduction of a construction carrying a cassette expression comprising a gene coding for a phosphatase, thus allowing the harvest of Z, Z-farnesol in step c). The present invention therefore relates to a method of production of Z, Z-FPP or derivatives thereof from IPP and DMAP in a cell recombinant having a source of IPP and DMAP and comprising a gene heterologous coding for a Z, Z-FPP synthase according to the present invention. The current invention thus concerns a method for producing Z, Z-FPP in a cell recombinant having a source of DMAP and IPPP, including:
a) providing a recombinant cell comprising a heterologous gene encoding for zFPS according to the present invention;
b) cell culture under appropriate conditions for expression said uncomfortable ; and, c) optionally, the harvest of Z, Z-FPP or derivatives thereof contained in said cell and / or in the culture medium.

The present invention therefore relates to a method for producing a mixture of SB-type sesquiterpenes or derivatives thereof from Z, Z-FPP in a cell having a ZZ-FPP source, comprising:
a) the introduction into said cell of a construction carrying a cassette expression system comprising a gene encoding an SB synthase according to the present invention.
invention;
(b) the culture of the transformed cell under appropriate conditions to gene expression; and, (c) optionally, the harvest of a SB-type sesquiterpene mixture or derivatives of it contained in said cell and / or in the culture medium.

22 Dans un mode de réalisation particulier, le mélange de sesquiterpène de type SB produit est récolté à l'étape c). Dans un autre mode de réalisation particulier, le mélange de sesquiterpèncs de type SB produit est le produit de départ pour obtenir d'autres composés d'intérêt comme l'alpha-santalol. La présente invention concerne donc une méthode de production d'un mélange de sesquiterpène de type SB ou de dérivés de ceux-ci à
partir de Z,Z-FPP dans une cellule recombinante ayant une source de Z,Z-FPP et comprenant un gène hétérologue codant pour une SB synthase selon la présente invention. La présente invention concerne ainsi une méthode de production de sesquiterpènes de type SB ou de dérivés de ceux-ci à partir de Z,Z-FPP dans une cellule recombinante ayant une source de Z,Z-FPP, comprenant :
a) la fourniture d'une cellule recombinante comprenant un gène hétérologue codant pour une SB synthase selon la présente invention ;
b) la culture de la cellule dans des conditions appropriées pour l'expression dudit gène ; et, c) facultativement, la récolte de sesquiterpènes de type SB ou de dérivés de celui-ci contenus dans ladite cellule et/ou dans le milieu de culture.

La cellule peut également être partie d'un organisme multicellulaire, par exemple une plante ou un animal non-humain. Dans ce cas, la présente invention concerne une méthode de préparation d'un organisme multicellulaire comprenant :
a) l'introduction dans une cellule de l'organisme d'une construction portant une cassette d'expression comprenant un premier gène codant pour une Z,Z-FPP
synthase selon la présente invention et d'une construction portant une cassette d'expression comprenant un deuxième gène codant pour une SB synthase selon la présente invention ; et, b) la reconstitution d'un organisme à partir de ladite cellule et la sélection des organismes transgéniques exprimant les deux gènes introduits.
Dans un mode de réalisation, l'organisme est un animal non-humain. Par exemple, l'organisme peut être une souris, un rat, un cobaye, un lapin, etc. Dans un autre mode de réalisation préféré, l'organisme est une plante, de préférence une plante à
trichomes glanduleux.

La présente invention concerne donc une méthode de production d'un mélange de sesquiterpènes de type SB comprenant la fourniture d'un organisme multicellulaire 22 In a particular embodiment, the mixture of sesquiterpene type SB product is harvested in step c). In another particular embodiment, the mix of product SB type sesquiterpèncs is the starting product to get other compounds of interest like alpha-santalol. The present invention thus relates to a method of production of a SB-type sesquiterpene mixture or derivatives thereof at from Z, Z-FPP in a recombinant cell having a source of Z, Z-FPP and including a heterologous gene encoding an SB synthase according to the present invention. The present The invention thus relates to a method for producing sesquiterpenes of the type SB or derivatives thereof from Z, Z-FPP in a recombinant cell having a source of Z, Z-FPP, comprising:
a) providing a recombinant cell comprising a heterologous gene encoding for an SB synthase according to the present invention;
b) cell culture under appropriate conditions for expression said uncomfortable ; and, (c) optionally, the collection of SB-type sesquiterpenes or this one contained in said cell and / or in the culture medium.

The cell may also be part of a multicellular organism, for example example a plant or a non-human animal. In this case, the present invention relates to a method for preparing a multicellular organism comprising:
a) the introduction into a cell of the body of a construction bearing a expression cassette comprising a first gene coding for a Z, Z-FPP
synthase according to the present invention and a construction carrying a cassette expression comprising a second gene coding for an SB synthase according to the present invention; and, (b) the reconstitution of an organism from that cell and the selection of the transgenic organisms expressing the two introduced genes.
In one embodiment, the organism is a non-human animal. By example, the body can be a mouse, a rat, a guinea pig, a rabbit, etc. In one other way of preferred embodiment, the organism is a plant, preferably a plant with trichomes glandular.

The present invention therefore relates to a method for producing a mixture of SB type sesquiterpenes including the provision of an organism multicellular

23 transgénique exprimant une Z,Z-FPP synthase selon la présente invention et une SB
synthase selon la présente invention et la récolte d'un mélange de sesquiterpènes de type SB produit ou de dérivés de ceux-ci dans lesdits organismes transgéniques.

La méthode permet de faire produire un mélange de sesquiterpène de type SB à
des organismes ne produisant pas ces composés ou d'augmenter la quantité d'un mélange de sesquiterpène de type SB produit par des organismes le produisant déjà.

La présente invention concerne une méthode de préparation d'un organisme multicellulaire comprenant :
a) l'introduction dans une cellule de l'organisme d'une construction portant une cassette d'expression comprenant un gène codant pour une Z,Z-FPP synthase selon la présente invention; et b) la reconstitution d'un organisme à partir de ladite cellule et la sélection des organismes transgéniques exprimant le gène introduit.

La présente invention concerne également une méthode de production de Z,Z-FPP
ou de dérivés de celui-ci comprenant comprenant la fourniture d'un organisme multicellulaire transgénique exprimant une Z,Z-FPP synthase selon la présente invention etla récolte du Z,Z-FPP produit ou de dérivés de celui-ci dans lesdits organismes transgéniques.

Dans un mode de réalisation, l'organisme est un animal non-humain. Par exemple, l'organisme peut être une souris, un rat, un cobaye, un lapin, etc. Dans un autre mode de réalisation préféré, l'organisme est une plante, de préférence une plante à
trichomes glanduleux. La méthode permet de faire produire du Z,Z-FPP à des organismes ne produisant pas ce composé ou d'augmenter la quantité de Z,Z-FPP produit par des organismes.

La présente invention concerne une méthode de préparation d'un organisme multicellulaire comprenant :
a) l'introduction dans une cellule de l'organisme d'une construction portant une cassette d'expression comprenant un gène codant pour une SB synthase selon la présente invention ; et 23 transgenic expressing a Z, Z-FPP synthase according to the present invention and a SB
synthase according to the present invention and the harvest of a mixture of sesquiterpenes of type SB produces or derivatives thereof in said transgenic organisms.

The method makes it possible to produce an SB-type sesquiterpene mixture at of the organisms that do not produce these compounds or increase the amount of a mix of SB-type sesquiterpene produced by organisms already producing it.

The present invention relates to a method for preparing an organism multicellular comprising:
a) the introduction into a cell of the body of a construction bearing a expression cassette comprising a gene coding for a Z, Z-FPP synthase according to the present invention; and (b) the reconstitution of an organism from that cell and the selection of the transgenic organisms expressing the introduced gene.

The present invention also relates to a method for producing Z, Z-FPP
or derivatives thereof including the provision of an organism multicellular transgenic expressing a Z, Z-FPP synthase according to the present invention and harvest of Z, Z-FPP product or derivatives thereof in said organisms Transgenic.

In one embodiment, the organism is a non-human animal. By example, the body can be a mouse, a rat, a guinea pig, a rabbit, etc. In one other way of preferred embodiment, the organism is a plant, preferably a plant with trichomes glandular. The method makes it possible to produce Z, Z-FPP to organisms that do not not producing this compound or increasing the amount of Z, Z-FPP produced by of the organizations.

The present invention relates to a method for preparing an organism multicellular comprising:
a) the introduction into a cell of the body of a construction bearing a expression cassette comprising a gene coding for an SB synthase according to the present invention; and

24 b) la reconstitution d'un organisme à partir de ladite cellule et la sélection des organismes transgéniques exprimant le gène introduit.
La présente invention concerne une méthode de production d'un mélange de sesquiterpène de type SB ou de dérivés de ceux-ci comprenant la fourniture d'un organisme multicellulaire transgénique exprimant une SB synthase selon la présente invention et la récolte d'un mélange de sesquiterpène de type SB produit ou de dérivés de ceux-ci dans lesdits organismes transgéniques.
Dans un mode de réalisation, l'organisme est un animal non-humain. Par exemple, l'organisme peut être une souris, un rat, un cobaye, un lapin, etc. Dans un autre mode de réalisation préféré, l'organisme est une plante, de préférence une plante à
trichomes sécréteurs. La méthode permet de faire produire un mélange de sesquiterpènes de type SB
à des organismes ne produisant pas ce composé ou d'augmenter la quantité d'un mélange de sesquiterpènes de type SB produit par des organismes.

L'invention est notamment applicable à toutes les plantes de familles possédant des trichomes glanduleux, par exemple les Astéracées (tournesol, etc.), Solanacées (tomate, tabac, pomme de terre, poivron, aubergine, etc.), Cannabacées (ex Cannabis sativa) et Lamiacées (menthe, basilic, lavande, thym, etc.). Elle est particulièrement adaptée aux plantes de la famille des Solanacées, telles que par exemple des genres Nicotiana, Solanum, Capsicum, Petunia, Datura, Atropa, etc., et en particulier des genres Solanum et Nicotiana comme par exemple la tomate cultivée (Solanum lycopersicum), la tomate sauvage Solanuni habrochaites, le tabac cultivé (Nicotiana tabacum), et le tabac sylvatique (Nicotiana sylvestris). De manière non limitative, l'invention peut s'appliquer aux plantes des genres suivants : Populus, Nicotiana, Cannabis, Pharbitis, Apteria, Psychotria, Mercurialis, Chrysanthemum, Polypodiuin, Pelargonium, Mimulus, Matricaria, Monarda, Solanum, Achillea, Valeriana, Ocimum, Medicago, Aesculus, Plumbago, Pityrogramma, Phacelia, Avicennia, Tamarix, Frankenia, Limonium, Foeniculum, Thymus, Salvia, Kadsura, Beyeria, Humulus, Mentha, Artemisia, Nepta, Geraea, Pogostemon, Majorana, Cleome, Cnicus, Parthenium, Ricinocarpos, Hymennaea, Larrea, Primula, Phacelia, Dryopteris, Plectranthus, Cypripedium, Petunia, Datura, Mucuna, Ricinus, Hypericum, Myoporum, Acacia, Diplopeltis, Dodonaea, Halgania, Cyanostegia, Prostanthera, Anthocercis, Olearia, Viscaria. De préférence, la plante est une plante de la famille des Asteracées, Cannabacées, Solanacées ou Lamiacées. Dans un mode de réalisation encore plus préféré, la plante appartient aux genres Solanum ou Nicotiana, de préférence Solanum esculentum, Solanum habrochaites, Nicotiana tabacum ou Nicotiana sylvestris.

Dans ce mode de réalisation, les gènes sont placés sous le contrôle d'un promoteur 5 permettant une expression, de préférence spécifique, dans les trichomes de la plante. De tels promoteurs existent et sont connus par l'homme du métier (Tissier et al., 2004).

Au sens de l'invention, on entend par promoteur "spécifique" un promoteur principalement actif dans un tissu ou un groupe cellulaire donné. Il est entendu qu'une expression 10 résiduelle, généralement plus faible, dans d'autres tissus ou cellules ne peut être entièrement exclue. Une caractéristique particulière de l'invention réside dans la capacité
de construire des promoteurs spécifiques des cellules sécrétrices des trichomes glanduleux, permettant une modification de la composition des sécrétions foliaires de la plante, et notaminent d'y exprimer les gènes de la présente invention permettant de préparer le 15 mélange de sesquiterpène de type SB. Ainsi, le Z,Z-FPP, et le mélange de sesquiterpènes de type SB ou des dérivés de ceux-ci peuvent être récoltés au niveau des trichomes de ces plantes, en particulier dans l'exsudat des trichomes par extraction avec un solvant ou encore par distillation.

20 Par exemple, il a été montré qu'une séquence régulatrice de 1852 pb, située en amont de l'ATG du gène CYP71DI6, permet de diriger l'expression du gène rapporteur uidA
spécifiquement dans les cellules sécrétrices de trichomes de tabac (demande US2003/0100050 A1, Wagner et al., 2003). D'autre part, plusieurs séquences promotrices extraites de différentes espèces ont été identifiées comme étant capables de diriger 24 (b) the reconstitution of an organism from that cell and the selection of the transgenic organisms expressing the introduced gene.
The present invention relates to a method for producing a mixture of sesquiterpène SB-type or derivatives thereof including the supply of an organism multicellular transgenic expressing an SB synthase according to the present invention and the collection of a sesquiterpene mixture of SB type produced or derivatives thereof here in said transgenic organisms.
In one embodiment, the organism is a non-human animal. By example, the body can be a mouse, a rat, a guinea pig, a rabbit, etc. In one other way of preferred embodiment, the organism is a plant, preferably a plant with trichomes secretory. The method makes it possible to produce a mixture of sesquiterpenes SB type to organisms that do not produce this compound or to increase the amount of a mixed SB-type sesquiterpenes produced by organisms.

The invention is particularly applicable to all plants of families possessing glandular trichomes, eg Asteraceae (sunflower, etc.), Solanaceae (tomato, tobacco, potato, pepper, eggplant, etc.), Cannabaceae (ex Cannabis sativa) and Lamiaceae (mint, basil, lavender, thyme, etc.). She is particularly adapted to plants of the family Solanaceae, such as for example genera Nicotiana, Solanum, Capsicum, Petunia, Datura, Atropa, etc., and in particular genera Solanum and Nicotiana such as the cultivated tomato (Solanum lycopersicum), the tomato wild Solanuni habrochaites, cultivated tobacco (Nicotiana tabacum), and the sylvatic tobacco (Nicotiana sylvestris). Without limitation, the invention may apply to plants of the following genera: Populus, Nicotiana, Cannabis, Pharbitis, Apteria, Psychotria, Mercurialis, Chrysanthemum, Polypodiuin, Pelargonium, Mimulus, Matricaria, Monarda, Solanum, Achillea, Valeriana, Ocimum, Medicago, Aesculus, Plumbago, Pityrogramma, Phacelia, Avicennia, Tamarix, Frankenia, Limonium, Foeniculum, Thymus, Salvia, Kadsura, Beyeria, Humulus, Mentha, Artemisia, Nepta, Geraea, Pogostemon, Majorana, Cleome, Cnicus, Parthenium, Ricinocarpos, Hymennaea, Larrea, Primula, phacelia, Dryopteris, Plectranthus, Cypripedium, Petunia, Datura, Mucuna, Ricinus, Hypericum Myoporum, Acacia, Diplopeltis, Dodonaea, Halgania, Cyanostegia, Prostanthera, Anthocercis, Olearia, Viscaria. Preferably, the plant is a plant of the family of Asteraceae, Cannabaceae, Solanaceae or Lamiaceae. In one embodiment again more preferred, the plant belongs to the genera Solanum or Nicotiana, from Solanum preference esculentum, Solanum haplochaites, Nicotiana tabacum or Nicotiana sylvestris.

In this embodiment, the genes are placed under the control of a sponsor Allowing expression, preferably specific, in the trichomes of the plant. Of such promoters exist and are known to those skilled in the art (Tissier et al.
2004).

For the purposes of the invention, the term "specific promoter" is intended to mean a promoter mainly active in a given tissue or cell group. It is understood that expression Residual, usually lower, in other tissues or cells may be completely excluded. A particular characteristic of the invention lies in the capacity to build specific promoters of the secretory cells of glandular trichomes, allowing a modification of the composition of the foliar secretions of the plant, and particular to express the genes of the present invention allowing to prepare the SB-type sesquiterpene mixture. Thus, the Z, Z-FPP, and the mixture of sesquiterpenes type SB or derivatives thereof can be harvested at the level of trichomes of these plants, particularly in the exudate trichomes by extraction with a solvent or still by distillation.

For example, it has been shown that a regulatory sequence of 1852 bp, located upstream the ATG of the CYP71DI6 gene, makes it possible to direct the expression of the uidA reporter gene specifically in the secretory cells of tobacco trichomes (request US2003 / 0100050 A1, Wagner et al., 2003). On the other hand, several sequences promoters extracted from different species have been identified as being able to lead

25 l'expression d'un gène hétérologue dans les trichomes de tabac.
Gène Nom du gène Plantes Références Abréviation LTP3 Cotton Liu et al., 2000, BBA, 1487:106111 LTP6 Cotton Hsu et al., 1999, Plant science, 143:6370 wax9D Lipid transfer protein B. oleracea Pyce and Kolattukudy, 1995, Plant J.
7:4559 LTPI Arabidopsis Thoma et al., 1994, Plant Physiol. 105 CYC71D16 CBToI hydroxylase Tobacco Wang et al., 2002, J.of Exp. Bot. The expression of a heterologous gene in tobacco trichomes.
Gene Gene name Plants References Abbreviation LTP3 Cotton Liu et al., 2000, BBA, 1487: 106111 LTP6 Cotton Hsu et al., 1999, Plant science, 143: 6370 wax9D Lipid transfer protein B. oleracea Pyce and Kolattukudy, 1995, Plant J.
7: 4559 LTPI Arabidopsis Thoma et al., 1994, Plant Physiol. 105 CYC71D16 CBToI Tobacco hydroxylase Wang et al., 2002, J.of Exp. Bot.

26 Dans un mode de réalisation préféré de la présente invention, le promoteur utilisé dans la cassette est dérivé des gènes NsTPS-02a, 02b, 03, et 04 de l'espèce Nicotiana sylvestris possédant une forte similarité de séquence avec CYC-2 (CBT-ol cyclase; NID :
AF401234). Ces séquences promotrices sont plus amplement décrites dans la demande de brevet W02006040479 (Tissicr et al., 2004).

Parmi les séquences terminateurs préférées, on peut citer le terminateur NOS
(Bevan et al., 1983), et le terminateur du gène d'histone (EPO 633 317).

Dans un mode de réalisation particulier, la cassette d'expression peut comprendre une séquence permettant d'augmenter l'expression ( amplificateur ), par exemple certains éléments du pronioteur CaMV35S et de gènes de l'octopine synthase (US 5 290 924). De préférence, les éléments activateurs du promoteur CaMV35S sont utilisés.

L'introduction des constructions portant un ou les deux gènes de l'invention dans une cellule ou un tissu végétal, y compris une graine ou plante, peut être réalisée par toute technique connue de l'honune du métier, y compris sous forme épisomale ou chromosomique. Les techniques de transgenèse végétale sont bien connues dans le donia.ine, et comprennent par exemple l'utilisation de la bactérie Agrobacterium tumefaciens, l'électroporation, des techniques biolistiques, la transfection par un vecteur viral notamment, et toute autre technique connue de l'homme du métier.

Une technique communément utilisée repose sur l'utilisation de la bactérie Agrobacterium tuinefaciens, qui consiste essentiellement à introduire la construction d'intérêt (acide nucléique, cassette, vecteur, etc.) dans la bactérie A. tumefaciens, puis à
mettre en contact cette bactérie transformée avec des disques de feuilles de la plante choisie.
L'introduction de la cassette d'expression dans la bactérie est typiquement réalisée en utilisant comme vecteur le plasmide Ti (ou T-DNA), qui peut être transféré dans la bactérie par exemple par choc thermique ou par électroporation. L'incubation de la bactérie transformée avec les disques foliaires permet d'obtenir le transfert du plasmide Ti dans le génome des cellules des disques. Ceux-ci peuvent éventuellement être cultivés dans des conditions appropriées pour reconstituer une plante transgéniquc dont les cellules comprennent la construction de l'invention. Pour plus de détails ou des variantes de mise en oeuvre de la technique de 26 In a preferred embodiment of the present invention, the promoter used in the cassette is derived from the NsTPS-02a, 02b, 03, and 04 genes of the Nicotiana species sylvestris having strong sequence similarity with CYC-2 (CBT-ol cyclase; NID:
AF401234). These promoter sequences are more fully described in the request Patent WO2006040479 (Tissicr et al., 2004).

Among the preferred terminator sequences, mention may be made of the NOS terminator (Bevan et al., 1983), and the terminator of the histone gene (EPO 633 317).

In a particular embodiment, the expression cassette can understand a sequence to increase the expression (amplifier), for example some elements of the CaMV35S pronator and octopine synthase genes (US 5,290 924). Of preferably, the activating elements of the CaMV35S promoter are used.

The introduction of constructs carrying one or both genes of the invention in cell or plant tissue, including a seed or plant, may be carried out by any technique known to the person skilled in the art, including in episomal form or chromosome. Plant transgenesis techniques are well known in the donia.ine, and include for example the use of the bacterium Agrobacterium tumefaciens, electroporation, biolistic techniques, transfection by a vector particularly viral, and any other technique known to those skilled in the art.

A commonly used technique relies on the use of the bacterium Agrobacterium tuinefaciens, which essentially consists of introducing the construction of interest (acid nucleic acid, cassette, vector, etc.) in the A. tumefaciens bacterium, then get in touch this bacterium transformed with leaf discs of the chosen plant.
The introduction of the expression cassette in the bacterium is typically performed in using as vector the Ti plasmid (or T-DNA), which can be transferred into the bacteria for example by thermal shock or electroporation. Incubation of the transformed bacterium with the leaf discs makes it possible to obtain the transfer of the Ti plasmid into the genome cells some discs. These can possibly be grown under conditions appropriate to reconstitute a transgenic plant whose cells include the construction of the invention. For more details or variants of implementation of the technical

27 transformation par A. tumefaciens, on peut se référer par exemple à Horsch et al. (1985) ou Hooykaas and Schilperoort (1992).

Ainsi, dans un mode de réalisation particulier, la cassette d'expression ainsi constituée est inséréc entre les bordures gauche et droite de l'ADN de transfert (T-DNA) d'un plasmide Ti désarmé pour le transfert dans des cellules végétales par Agrobacterium tumefaciens. Le T-DNA comprend également un gène dont l'expression confère une résistance à un antibiotique ou un herbicide et qui permet la sélection des transformants.

Une fois régénérées, les plantes transgéniques peuvent être testées pour l'expression hétérologue des gènes de la présente invention ou la production d'un mélange de sesquiterpènes de type SB, de Z,Z-FPP ou de Z,Z-farnesol dans les trichomes.
Ceci peut être réalisé en récoltant l'exsudat des feuilles et en testant la présence du produit d'intérêt dans cet exsudat. L'analyse des volatiles émis par la plante peut également permettre d'identifier les dits composés. Ceci peut également être fait en analysant la présence d'une ou des enzymes hétérologues de la présente invention dans les feuilles et, plus particulièrement, dans les cellules de trichome (par exemple en analysant les ARNm ou l'ADN génomique au moyen de sondes ou d'amorces spécifiques). Les plantes peuvent éventuellement être sélectionnées, croisées, traitées, etc. pour obtenir des plantes présentant des niveaux d'expression améliorés.

Un autre objet de l'invention réside également dans une plante ou graine comprenant un acide nucléique, une cassette d'expression ou un vecteur tels que définis précédemment.

Un autre objet de l'invention concerne l'utilisation d'un acide nucléique de la présente invention comme marqueurs moléculaires pour permettre d'introduire les séquences génomiques correspondantes de S. habrochaites dans d'autres espèces ou variétés de tomate cultivée (S. lvcopersicurn) sexuellement compatibles. En effet, ces marqueurs permettent de contrôler l'introduction des séquences génomiques correspondantes de S.
habrochaites dans d'autres espèces ou variétés de tomate cultivée (S.
lycopersicunt) sexuellement compatibles et ainsi, par exemple, d'identifier et de sélectionner les individus issus d'un croisement entre l'espèce sauvage et une espèce cultivée dans lesquels l'introgression des acides nucléiques de la présente invention a eu lieu.
L'utilisation des acides nucléiques de la présente invention comme marqueurs moléculaires peut être 27 transformation by A. tumefaciens, one can refer for example to Horsch and al. (1985) or Hooykaas and Schilperoort (1992).

Thus, in a particular embodiment, the expression cassette as well as constituted is inserted between the left and right borders of the transfer DNA (T-DNA) of a plasmid Ti disarmed for transfer into plant cells by Agrobacterium tumefaciens. The T-DNA also includes a gene whose expression confers resistance to a antibiotic or herbicide and which allows the selection of transformants.

Once regenerated, transgenic plants can be tested for expression heterologous gene of the present invention or the production of a mixture of sesquiterpenes of SB, Z, Z-FPP or Z, Z-farnesol type in trichomes.
This can to be achieved by harvesting leaf exudate and testing for the presence of product of interest in this exudate. The analysis of the volatiles emitted by the plant can also to permit to identify said compounds. This can also be done by analyzing the presence of or heterologous enzymes of the present invention in the leaves and, more particularly in trichome cells (for example by analyzing the MRNA or genomic DNA using specific probes or primers). Plants can possibly selected, crossed, processed, etc. to obtain plants with improved expression levels.

Another object of the invention is also a plant or seed including a nucleic acid, an expression cassette or a vector as defined previously.

Another subject of the invention relates to the use of a nucleic acid of the current molecular markers to enable the introduction of the sequences genomics of S. haplochaites in other species or varieties of cultivated tomato (S. lvcopersicurn) sexually compatible. Indeed, these markers allow to control the introduction of genomic sequences corresponding of S.
habrochaites in other species or varieties of cultivated tomato (S.
lycopersicunt) sexually compatible and thus, for example, to identify and select individuals from a cross between the wild species and a species grown in which introgression of the nucleic acids of the present invention has occurred.
The use of nucleic acids of the present invention as molecular markers can to be

28 réalisée par toute technique connue de l'homme du métier. Par exemple, une technique communément utilisée repose sur l'identification d'un polymorphisme de bande (RFLP) entre deux génomes digérés par différentes enzynies de restriction par hybridation moléculaire avec les acides nucléiques de la présente invention. Un autre exemple, consiste à rechercher un polymorphisnle en utilisant la technique de PCR pour amplifier sur les génomes à comparer tout ou partie d'un acide nucléique de la présente invention à partir d'amorces complémentaires de l'acide nucléique de la présente invention pour identifier après amplification PCR un polymorphisme de taille entre les deux génomes. Le polymorphisme peut également être révélé après digestion desdits produits PCR
par une ou des enzymes de restriction qui feront apparaître des fragments de taille différente entre les génomes comparés.

Une fois le polymorphisme identifié, cette information est utilisée, par exemple, pour identifier les individus d'une population F2 issus d'un croisement entre S.
habrochaites et une variété de tomate dans laquelle l'introgression des acides nucléiques de la présente invention est souhaitée.

Un autre objet de l'invention concerne l'introduction des séquences génomiques de S.
habrochaites codant pour la zFPS et la SB synthase dans des espèces non compatibles sexuellement par fusion de cellules, notamment de protoplastes. Les techniques de fusion de protoplastes sont connus de l'honime du métier (Zimmermann et al., 1981, Bates et al., 1983), et permettent de créer des cellules hybrides contenant des chromosomes appartenant aux deux espèces fusionnées. Lors de la fusion dcs chromosomes ou fragments de chromosome des deux espèces sont éliminés. Les cellules hybrides ayant conservé le ou les fragments chromosomiques contenant les gènes de la présente invention peuvent alors être sélectionnées par PCR en utilisant des amorces spécifiques du gène codant pour la zFPS
(SEQ ID N 1) ou de celui codant pour la SB synthase (SEQ ID N 2) ou des deux à
la fois.
La présente invention concerne enfin une cellule ou un organisme transgénique non-humain, caractérisé en ce que la voie de synthèse d'un mélange de sesquiterpène de type SB est bloquée par inactivation du gène codant pour une Z,Z-FPP synthase selon la présente invention ou du gène codant pour une SB synthase selon la présente invention ou des deux gènes. L'expression de ces gènes peut être bloquée par de nombreuses techniques disponibles et connues par l'homme du métier. Les gènes peuvcnt être délétés, mutés (par 28 performed by any technique known to those skilled in the art. For example, a technical commonly used is based on the identification of a band polymorphism (RFLP) between two genomes digested by different restriction enzynies by hybridization molecular with the nucleic acids of the present invention. Another example, consists to look for a polymorphism using the PCR technique to amplify on the genomes to compare all or part of a nucleic acid of this invention from complementary primers of the nucleic acid of the present invention for identify after PCR amplification a size polymorphism between the two genomes. The polymorphism can also be revealed after digestion of said PCR products by one or restriction enzymes that will reveal fragments of size different between compared genomes.

Once the polymorphism is identified, this information is used by example, for identify individuals from an F2 population from a cross between S.
habrochaites and a tomato variety in which the introgression of nucleic acids from the current invention is desired.

Another subject of the invention concerns the introduction of genomic sequences from S.
habrochaites coding for zFPS and SB synthase in non-native species compatible sexually by fusion of cells, especially protoplasts. The techniques fusion protoplasts are known to those skilled in the art (Zimmermann et al., 1981, Bates et al.
1983), and allow to create hybrid cells containing chromosomes belonging to the two merged species. When merging chromosomes or fragments of chromosome of both species are eliminated. Hybrid cells having kept the chromosomal fragments containing the genes of the present invention may then to be selected by PCR using primers specific for the gene coding for the zFPS
(SEQ ID No. 1) or that coding for SB synthase (SEQ ID No. 2) or both that time.
The present invention further relates to a transgenic cell or organism no-human, characterized in that the synthesis route of a mixture of sesquiterpene type SB is blocked by inactivation of the gene coding for a Z, Z-FPP synthase according to the present invention or the gene coding for an SB synthase according to the present invention.
invention or of both genes. Expression of these genes can be blocked by many techniques available and known to those skilled in the art. The genes can be deleted, mutated (by

29 exemple par mutagenèse chimique par Ethyl Methane Sulfonate ou par rayonnements ionisants) ou interrompus (mutagenèse insertionnelle). Par ailleurs, le blocage de l'expression de ces gènes peut également être réalisé par extinction de gènes en exprimant un transcrit inhibiteur. Le transcrit inhibiteur est un ARN qui peut se présenter sous la forme d'un ARN double brin, d'un ARN antisens, d'un ribozyme, d'un ARN capable de fornier une triple hélice, et qui a une certaine complémentarité ou spécificité avec le transcrit du gène à bloquer.

La présente invention concerne également un acide nucléique capable de diminuer ou de supprimer l'expression d'un gène codant une Z,Z-FPP synthase. En effet, un ARN
inhibiteur qui peut se présenter sous la forme d'un ARN double brin, d'un ARN
antisens, d'un ribozyme, d'un ARN capable de former une triple hélice, et qui a une certaine complémentarité ou spécificité avec le gène codant Z,Z-FPP synthase peut être préparé sur la base de l'enseignement de la présente invention. Ainsi, la présente invention concerne un ARN inhibiteur du gène codant une Z,Z-FPP synthase comprenant au moins 21, 29 example by chemical mutagenesis by ethyl methane sulphonate or by radiation ionizing) or interrupted (insertional mutagenesis). Moreover, blocking the expression of these genes can also be achieved by gene silencing expressing an inhibitory transcript. The inhibitory transcript is an RNA that can present under the form of a double-stranded RNA, an antisense RNA, a ribozyme, an RNA capable of of fornicate a triple helix, and which has some complementarity or specificity with the transcribes the gene to block.

The present invention also relates to a nucleic acid capable of decrease or suppress the expression of a gene encoding a Z, Z-FPP synthase. Indeed, an RNA
inhibitor which may be in the form of a double-stranded RNA, an RNA
antisense, of a ribozyme, an RNA capable of forming a triple helix, and which has a some complementarity or specificity with the gene encoding Z, Z-FPP synthase may be prepared on the basis of the teaching of the present invention. Thus, this invention an inhibitory RNA of the gene encoding a Z, Z-FPP synthase comprising at least 21,

30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 1 ou d'une séquence complémentaire de celle-ci. De même, elle concerne l'utilisation d'un polynucléotide comprenant au moins 21, 30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 1 ou d'une séquence complémentaire de celle-ci pour inhiber l'expression du gène codant une Z,Z-FPP synthase. L'inhibition de cette enzyme peut être utile pour stopper ou ralentir la voie de synthèse du mélange de sesquiterpène de type SB
et rendre l'IPP et le DMAP disponible pour une autre voie de synthèse d'intérêt nécessitant un apport en Z,Z-FPP. Par exemple, l'inhibition de cette enzyme peut pennettre d'augmenter le taux de production germacrene B par les cellules glandulaires des trichomes de feuilles de tomate. La présente invention concerne donc des cellules ou des organismes transgéniques dans lesquels le gène codant une Z,Z-FPP synthase a été
inactivé.
L'inactivation peut être effectuée par des techniques d'ARN interférent, de délétion de gène, de mutation chimique ou d'inactivation par recombinaison homologue.
Ainsi le taux de Z,Z-FPP ou du mélange de sesquiterpène de type SB peut être diminué dans ces cellules ou organismes transgéniques.

En outre, la présente invention concerne également un acidc nucléique capable de diminuer ou de supprimer l'expression d'un gène codant une SB synthase. En effet, un ARN
inhibiteur qui peut se présenter sous la forme d'un ARN double brin, d'un ARN
antisens, d'un ribozyme, d'un ARN capable de former une triple hélice, et qui a une certaine complémentarité ou spécificité avec le gène codant une SB synthase peut être préparé sur la base de l'enseignement de la présente invention. Ainsi, la présente invention concerne un ARN inhibiteur du gène codant une SB synthase comprenant au moins 30, 40, 50, 60, 5 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 3. De même, elle concerne l'utilisation d'un polynucléotide comprenant au moins 21, 30, 40, 50, 60, 70, 80, 90 ou 100 nucléotides consécutifs de la SEQ ID No 3 pour inhiber l'expression du gène codant une SB synthase. L'inhibition de cette enzyme peut être utile pour stopper la voie de synthèse d'un mélange de sesquiterpène de type SB et rendre le Z,Z-FPP disponible pour une autre 10 voie de synthèse d'intérêt nécessitant un apport en ce composé, par exemple pour préparer des dérivés du Z,Z-FPP, par exemple, le Z,Z farnesol, ou d'autres sesquiterpènes qui sont le produit de synthases utilisant le Z,Z-FPP comme substrat.

La présente invention concerne donc des cellules ou des organismes transgéniques dans 15 lesquels le gène codant une SB synthase est inactivé. L'inactivation peut être effectuée par des techniques d'ARN interférent, de délétion de gène, de mutation chimique ou d'inactivation par recombinaison homologue. Ainsi le taux du mélange de sesquiterpènes de type SB peut être diminué dans ces cellules ou organismes transgéniques.

20 La présente invention concerne également une méthode d'identification ou de clonage d'autres gènes codant une Z,Z-FPP synthase ou une SB synthase provenant d'une autre espèce dans laquelle une sonde présentant au moins 15, 30, 50, 75, 100, 200 ou nucléotides consécutifs de la séquence SEQ ID No 1 ou 3, respectivement, est préparée et utilisée pour identifier ou sélectionner dans un échantillon une séquence nucléotidique 25 capable de s'hybrider à ladite sonde. L'échantillon peut être par exemple une banque génomique ou de cDNA provenant d'un ou plusieurs organismes. La méthode peut comprendre une étape supplémentaire de caractérisation de la séquence identifiée ou sélectionnée. Cette étape supplémentaire peut comprendre le clonage, et/ou le séquençage, et/ou un alignement de séquence, et/ou un test d'activité enzymatique.
D'autres aspects et avantages de la présente invention apparaîtront à la lecture des exemples qui suivent, qui doivent être considérés comme illustratifs et non limitatifs. 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 1 or a sequence complementary to it. Similarly, it concerns the use of a polynucleotide comprising at least 21, 30, 40, 50, 60, 70, 80, 90 or 100 nucleotides consecutive SEQ ID No. 1 or a complementary sequence thereof to inhibit the expression of gene encoding a Z, Z-FPP synthase. Inhibition of this enzyme may be helpful for stop or slow down the synthesis pathway of the SB-type sesquiterpene mixture and make the IPP and the DMAP available for another synthetic route of interest requiring a Z input, Z-FPP. For example, inhibition of this enzyme may allow increase the germacrene B production rate by the glandular cells of trichomes leaves tomato. The present invention thus relates to cells or organisms transgenic genes in which the gene encoding a Z, Z-FPP synthase has been inactivated.
Inactivation can be performed by interfering RNA, deletion gene, chemical mutation or inactivation by homologous recombination.
So the rate of Z, Z-FPP or SB-type sesquiterpene mixture may be decreased in these cells or transgenic organisms.

In addition, the present invention also relates to a nucleic acidc able to decrease or to suppress the expression of a gene encoding an SB synthase. Indeed, a RNA
inhibitor which may be in the form of a double-stranded RNA, an RNA
antisense, of a ribozyme, an RNA capable of forming a triple helix, and which has a some complementarity or specificity with the gene encoding an SB synthase can be prepared on the basis of the teaching of the present invention. Thus, this invention an inhibitory RNA of the gene encoding an SB synthase comprising at least 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 3. Likewise, it concerned the use of a polynucleotide comprising at least 21, 30, 40, 50, 60, 70, 80, 90 or 100 consecutive nucleotides of SEQ ID No. 3 for inhibiting gene expression coding a SB synthase. Inhibition of this enzyme may be helpful in stopping the pathway of synthesis of a sesquiterpene mixture of SB type and make the Z, Z-FPP available for another Synthetic route of interest requiring an addition of this compound, for example to prepare derivatives of Z, Z-FPP, for example, Z, Z farnesol, or others sesquiterpenes that are the product of synthases using Z, Z-FPP as substrate.

The present invention thus relates to cells or organisms transgenic in Which gene encoding an SB synthase is inactivated. Inactivation can be carried out by interfering RNA, gene deletion, chemical mutation, or inactivation by homologous recombination. So the rate of the mixture of sesquiterpenes SB type can be decreased in these cells or transgenic organisms.

The present invention also relates to a method of identifying or cloning other genes encoding Z, Z-FPP synthase or SB synthase from a other species in which a probe having at least 15, 30, 50, 75, 100, 200 or consecutive nucleotides of the sequence SEQ ID No. 1 or 3, respectively, is prepared and used to identify or select in a sample a sequence nucleotide 25 capable of hybridizing to said probe. The sample can be for example a bank genomic or cDNA derived from one or more organisms. The method can understand an additional stage of characterization of the sequence identified or selected. This additional step may include cloning, and / or sequencing, and / or sequence alignment, and / or enzymatic activity assay.
Other aspects and advantages of the present invention will be apparent from reading examples that follow, which should be considered as illustrative and not limiting.

31 Exemples Synthèse d'ADNc de feuilles de tomate (S. habrochaites) Des ARNm ont été extraits à partir de feuilles de tomate (Solanum habrochaites = L.
Hirsutuni LA1777) en utilisant un kit d'extraction d'ARN totaux (RNeasy minikit, Qiagen). Lès ADNc correspondants ont été synthétisés par transcription inverse à partir d'une amorce polyT en utilisant une transcriptase inverse (Roche, Cat. N 03 531 317) dans les conditions réactionnelles préconisées par le fabriquant.

Clonage des séquences codantes pour la Z,Z-FPP synthase (Sh-zFPS) et la SB
synthase (Sh-SBS) de tomate Solanum habrochaites.

Les séquences nucléotidiques codantes et complètes pour les deux gènes Sh-zFPS
et Sh-SBS ont été clonées à partir des informations publiques de séquences de la banque d'EST
de trichomes de feuilles de tomate de S. habrochaites (Van der Hoeven, et al., 2000, unpublished,) obtenu sur le site du SGN ( SOL Genomics Network , http://www.sgn.cornell.edu/).
Les séquences de Sh-zFPS (SEQ ID N 1) et Sh-SBS (SEQ ID N 3) ont été obtenues par PCR à partir des ADNc de feuilles de tomate en utilisant les amorces 5'-ACCATGGGTTCTTTGGTTCTTCAATGTTGGA-3' (SEQ ID No 5) et 5'-ACTCGAGATATGTGTGTCCACCAAAACGTCTATG-3' (SEQ ID No 6) pour la séquence ID N 1 et les amorces 5'-TCCATGGTAGTTGGCTATAGAAGCACAATCA-3' (SEQ ID No 7) et 5'-TCTCGAGCATAAATTCAAATTGAGGGATTAATGA-3' (SEQ
ID No 8) pour la séquence ID N 3. Des sites d'enzymes de restriction (Nco1 et Xhol) ont été ajoutés à l'extrémité 5' des amorces pour faciliter le clonage du cDNA en aval d'un promoteur. L'amplification par PCR a été réalisée avec 0,5 unité de Taq polymérase (Eurogentec) dans le tampon fourni par le fabriquant. Le produit PCR a été
purifié sur une colonne Qiaquick (Qiagen) et cloné par ligation avec une T4 DNA ligase (NEB) dans le vecteur de clonage pGEM-T (Promega). Les clones correspondant à la séquence attendue ont été sélectionnés après séquençage complet des inserts.
La séquence nucléotidique Sh-zFPS (SEQ ID N 1) a une longueur de 912 bases et code pour une protéine (SEQ ID N 2) de 303 acides aminés. Un domaine protéique conservé de type cis (Z)-isoprényles diphosphate synthases (cis-IPPS) ou également annoté
undécaprényle synthase ([JPPS) a été identifié in silico avec le système CCD (NCBI, Marchler-Bauer A, Bryant SH (2004). Les séquences similaires en acide aminé à
Sh-zFPS 31 Examples Synthesis of tomato leaf cDNA (S. habrochaites) MRNAs were extracted from tomato leaves (Solanum habrochaites = L.
Hirsutuni LA1777) using a total RNA extraction kit (RNeasy Minikit, Qiagen). The corresponding cDNAs were synthesized by reverse transcription from of a polyT primer using reverse transcriptase (Roche, Cat N 03 531,317) under the reaction conditions recommended by the manufacturer.

Cloning of coding sequences for Z, Z-FPP synthase (Sh-zFPS) and SB
synthase (Sh-SBS) tomato Solanum haplochaites.

The coding and complete nucleotide sequences for the two Sh-zFPS genes and Sh-SBS were cloned from public information sequences of the EST bank trichomes of tomato leaves of S. habrochaites (Van der Hoeven, et al.

unpublished,) obtained from the SGN website (SOL Genomics Network, http://www.sgn.cornell.edu/).
The sequences of Sh-zFPS (SEQ ID No. 1) and Sh-SBS (SEQ ID No. 3) were obtained by PCR from tomato leaf cDNAs using 5 'primers ACCATGGGTTCTTTGGTTCTTCAATGTTGGA-3 '(SEQ ID NO 5) and 5'-ACTCGAGATATGTGTGTCCACCAAAACGTCTATG-3 '(SEQ ID No 6) for the sequence ID N 1 and primers 5'-TCCATGGTAGTTGGCTATAGAAGCACAATCA-3 ' (SEQ ID No. 7) and 5'-TCTCGAGCATAAATTCAAATTGAGGGATTAATGA-3 '(SEQ
ID No. 8) for the sequence ID No. 3. Restriction enzyme sites (Nco1 and Xhol) have were added to the 5 'end of the primers to facilitate cloning of the cDNA into downstream of a promoter. PCR amplification was performed with 0.5 units of Taq polymerase (Eurogentec) in the buffer provided by the manufacturer. The PCR product has been purified on a Qiaquick column (Qiagen) and cloned by ligation with a T4 DNA ligase (NEB) in the cloning vector pGEM-T (Promega). Clones corresponding to the sequence expected were selected after complete sequencing of the inserts.
The nucleotide sequence Sh-zFPS (SEQ ID No. 1) has a length of 912 bases and code for a protein (SEQ ID No. 2) of 303 amino acids. A protein domain preserved from type cis (Z) -isoprenyl diphosphate synthases (cis-IPPS) or also annotated undecaprenyl synthase ([JPPS] has been identified in silico with the system CCD (NCBI, Marchler-Bauer A, Bryant SH (2004). Similar amino acid sequences Sh-zFPS

32 ont été recherchées dans la banque de protéine SwissProt et GenBank en utilisant le programme BlastP (Altschul et al., 1997). Les meilleurs pourcentages d'identité ont été
obtenus avec des séquences de plantes ayant une homologie avec des undécaprényles diphosphate synthases mais dont les fonctions n'ont pas été démontrées (Tab.
1). Par exemple, Sh-zFPS possède un pourcentage d'identité de 42% et 39% avec des UPPS
putatives d'Arabidopis thaliana BAA97345 et AA063349 respectivement. On peut noter également que la séquence Sh-zFPS possède un très faible degré d'identité (24 %) avec la Z,E-FPS de Micrococcus tuberculosis (053434).

...............................................................................
...............................................................................
................... .a/à..........
Organisme PID Fonction identité
....................
................................,..............................................
...............................................................................
...............
Arabidopsis thaliana BAA97345 Putative UPPS 42 Arabidopsis thaliana AA063349 Putative UPPS 39 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Arabidopsis thaliana AA042764 Putative UPPS 39 Anabaena sp. PCC 7120 DP58563 Putative UPPS 37 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Oryza sativa NP915561 Putative UPPS 36 ...........__ ....................._....._...............,.......___........._......._.._..._ .............._...........
"S nëchccôccüs elongatus Q8DI29 Putative UPPS 35 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Micrococcus luteus 082827 Putative UPPS 34 .............................
Gloeobacer violaceus Q7NPE7 Putative UPPS 32 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Micrococcus tuberculosis P60479 UPPS 30 . .. . . . . . . . .. . . . . . . . . . . . . . . .. . .. . . .. . . . . . . .
.. .
Micrococcus tuberculosis 053434 E,Z-FPS 24 ........................................~...,,......,............,............, .~...........................,..,....,...........................,.......,.....
....................................
Tableau 1: Séquences présentant le meilleur pourcentage d'identité (%
identité) obtenu par recherche d'homologie avec le programme BlastP 2.2.13 (Altschul et al., 1997) contre les banque de SwissProt et de GenBank avec la séquence Sh-zFPS.

La séquence nucléotidique Sh-SBS (SEQ ID N 3) a une longueur de 2334 bases et code pour une protéine (SEQ ID N 4) de 777 acides aminés. Un domaine protéique conservé de terpène eyclase (cd00684.2) a été identifié in silico avec le système CCD
(NCBI, Marchler-Bauer A, Bryant SH (2004). Les séquences similaires en acide aminé à
Sh-SBS
ont été recherchées dans la banque de protéine SwissProt et GenBank en utilisant le programme BlastP (Altschul et al., 1997). A l'exception d'une séquence de tabac de fonction inconnue (60% d'identité), les meilleurs homologies ont été obtenues avec des diterpènes synthases de plantes (Tab. 2) avec un pourcentage d'identité
d'environ 40 à
45% avec des séquences codant pour des kaurène synthases de différentes plantes (Arabidopsis thaliana, Cucurbita maxima, Stevia rebaudiana, Oryza sativa). Sh-SBS 32 have been sought in the SwissProt and GenBank protein library in using the BlastP program (Altschul et al., 1997). The best percentages identity have been obtained with plant sequences having a homology with undécaprényles diphosphate synthases but whose functions have not been demonstrated (Tab.
1). By for example, Sh-zFPS has a 42% identity percentage and 39% with UPPS
putative Arabidopis thaliana BAA97345 and AA063349 respectively. We can to note that the Sh-zFPS sequence has a very low degree of identity (24 %) with the Z, E-FPS of Micrococcus tuberculosis (053434).

.................................................. .............................
.................................................. .............................
................... .a / to ..........
PID organization Identity function ....................
................................, ................. .............................
.................................................. .............................
...............
Arabidopsis thaliana BAA97345 Putative UPPS 42 Arabidopsis thaliana AA063349 Putative UPPS 39 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Arabidopsis thaliana AA042764 Putative UPPS 39 Anabaena sp. PCC 7120 DP58563 Putative UPPS 37 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Oryza sativa NP915561 Putative UPPS 36 ...........__ ....................._....._............... ...... .___........._......._.._..._ .............._...........
"S echccccccs elongatus Q8DI29 Putative UPPS 35 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Micrococcus luteus 082827 Putative UPPS 34 .............................
Gloeobacer violaceus Q7NPE7 Putative UPPS 32 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
.
Micrococcus tuberculosis P60479 UPPS 30 . .. . . . . . . .. . . . . . . . . . . . . . .. .. . .. . . . . . .
..
Micrococcus tuberculosis 053434 E, Z-FPS 24 ........................................ ~ ... ,, .... .., ............ ............
. ~ ........................... .. .... ............ ............... ......., .....
....................................
Table 1: Sequences with the highest percentage of identity (%
identity) obtained by homology search with the BlastP 2.2.13 program (Altschul et al., 1997) against the banks SwissProt and GenBank with the Sh-zFPS sequence.

The nucleotide sequence Sh-SBS (SEQ ID No. 3) has a length of 2334 bases and code for a protein (SEQ ID N 4) of 777 amino acids. A protein domain preserved from terpene eyclase (cd00684.2) has been identified in silico with the CCD system (NCBI, Marchler-Bauer A, Bryant SH (2004). Similar amino acid sequences Sh-SBS
have been sought in the SwissProt and GenBank protein library in using the BlastP program (Altschul et al., 1997). With the exception of a sequence of tobacco of Unknown function (60% identity), the best homologies were obtained with some diterpenes synthases of plants (Table 2) with a percentage of identity from about 40 to 45% with sequences coding for kaurene synthases of different plants (Arabidopsis thaliana, Cucurbita maxima, Stevia rebaudiana, Oryza sativa). sh-SBS

33 possède également des homologies plus faible (26 à 33% d'identité) avec des terpènes synthases de fonction connue comme l'abietadiene synthase et la taxadiène synthase et et l'alpha-bisabolènc synthase.

................................~.......,......................-...........~...................~...............................................
.................................~.............. .%. ......
Organisme PID Fonction identité
...............................................................................
......................................................................... .
.......................................
Nicotiana tabacum AAS98912 Putative terpene s.......... nthase 60 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
Arabidopsis thaliana AAC39443 Kaurene synthase 44 Lactuca sativa BAB12441 Putative kaurene s thase 43 . . . . . . . . . . . . . . . . . . . Kaurene. . . . . . . . . . . . . . . .
.s. ynthase. . . . . . . . . . . . . . . . . . . . . . . .43. . . . . . . . .
. . . . .
Cucurbita maxima Q39548 ..... ..
...........................................................ABE87878............
.. ......................Putat. i.ve.. ....terpene..... .. ..... ......
......synthase.. ..... ............ 43............
Medica roncatula.... .. .. .. ...
got ..._...._._..._ .........u ................._..................................~......._..................
._............_............................_......._ Stevi arebadi ..ana AAD34294 Kaurene synthase 42 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . 11, . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . .
Oryza sativa AAQ72559 Kaurene synthase 41. .. .. .. .
Hordeum vulgare AAT49066 Kaurene synthase 36 . . . . . . . . . . . . . . . . . : . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
Abies grandis AAC24192 Alpha-bisabolene synthase 33 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
Abies grandis AAB05407 Abietadiene synthase 27 Tâxüs bsccata .........................................2211347A
Il~.....................................Tâxâdiene s nthàse.........26........
.
...............................................................................
...............................................................................
....................................................
Tableau 2: Séquences présentant le meilleur pourcentage d'identité (%
identité) obtenu par recherche d'homologie avec le programme BlastP 2.2.13 (Altschul et a1., 1997) contre les banques de SwissProt et de GenBank avec la séquence Sh-SBS.

Production des protéines recombinantes Sh-zFPS et Sh-SBS

Les séquences nucléiques codant pour Sh-zFPS et Sh-SBS (séquences ID N 1 et 3 respectivement) ont été introduites séparément dans le vecteur d'expression pET-30b (Novagen). Pour permettre la purification des protéines recombinantes, les codons STOP
de ces séquences ont été supprimés afin de créer une protéine de fusion avec une queue de six histidines à l'extrémité C-terminale. Les vecteurs Sh-zFPS-pET30b et Sh-SBS-pET30b ainsi obtenus ont été introduits par électroporation dans des cellules d'Escherichia coli modifiées pour l'expression de protéines recombinantes (BL21-CodonPlus, Stratagene).
Pour la production des protéines, les cultures (500 ml) de E. coli sont initiées à 37 C
jusqu'à une densité optique de 0,5 à 600 nm. A ce stade, la température de culture est abaissée à 16 C et de l'éthanol (1%, v/v) est ajouté dans les milieux. Après une heure d'incubation, l'IPTG est ajouté au milieu à une concentration de 1 mM pour induire l'expression de la protéine recombinante. La culture est alors incubée pour une durée de 18 heures. La culture est arrêtée par centrifugation des cellules à 4 C. Le culot cellulaire est 33 also has lower homologies (26 to 33% identity) with terpenes synthases of function known as abietadiene synthase and taxadiene synthase and and alpha-bisabolen synthase.

~ ................................ ....... ......... .............-~ ~ ................... .................. ........... .............................
................................. ~ ...............% . ......
PID organization Identity function .................................................. .............................
.................................................. ........................
.......................................
Nicotiana tabacum AAS98912 Putative terpene s .......... nthase 60 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
Arabidopsis thaliana AAC39443 Kaurene synthase 44 Lactuca sativa BAB12441 Putative kaurene s thase 43 . . . . . . . . . . . . . . . . . . . Kaurene. . . . . . . . . . . . . . . .
.s. ynthase. . . . . . . . . . . . . . . . . . . . . . . .43. . . . . . . . .
. . . . .
Cucurbita maxima Q39548 ..... ..
.................................................. ......... ............ ABE87878 .. ...................... Putat. i.ve .. .... terpene ..... .. ..... ......
...... synthase .. ..... ............ 43 ............
Medica roncatula .... .. .. .. ...
got ..._...._._..._ ......... u ................._................................ .. ~ ......._..................
._............_............................_...... ._ Stevi arebadi ..ana AAD34294 Kaurene synthase 42 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . 11,. . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . .
Oryza sativa AAQ72559 Kaurene synthase 41. .. .. ...
Hordeum vulgare AAT49066 Kaurene synthase 36 . . . . . . . . . . . . . . . . . :. . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
Abies grandis AAC24192 alpha-bisabolene synthase 33 . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .
. . . . . . . . . . . . . .
Abies grandis AAB05407 Abietadiene synthase 27 Txxs bsccata ......................................... 2211347A
It ~ ..................................... Tâxâdiene s nthàse ........ .26 ........
.
.................................................. .............................
.................................................. .............................
.................................................. ..
Table 2: Sequences with the highest percentage of identity (%
identity) obtained by search for homology with the BlastP 2.2.13 program (Altschul et al., 1997) against the banks SwissProt and GenBank with the Sh-SBS sequence.

Production of Sh-zFPS and Sh-SBS Recombinant Proteins The nucleic sequences coding for Sh-zFPS and Sh-SBS (sequences ID N 1 and 3 respectively) were introduced separately into the expression vector pET-30b (Novagen). To enable the purification of recombinant proteins, the STOP codons of these sequences were deleted in order to create a fusion protein with a tail of six histidines at the C-terminus. The vectors Sh-zFPS-pET30b and Sh-SBS-pET30b thus obtained were introduced by electroporation into cells Escherichia coli modified for the expression of recombinant proteins (BL21-CodonPlus, Stratagene).
For the production of proteins, cultures (500 ml) of E. coli are initiated at 37 C
up to an optical density of 0.5 to 600 nm. At this point, the temperature of culture is lowered to 16 C and ethanol (1%, v / v) is added to the media. After one o'clock incubation, IPTG is added to the medium at a concentration of 1 mM for induce the expression of the recombinant protein. The culture is then incubated for a duration of 18 hours. The culture is stopped by centrifugation of the cells at 4 C.
cell pellet is

34 repris dans un tampon phosphate 200mM. Les cellules sont lysées à la presse de French (OP = 19 bar). Lcs lysats sont centrifugés à 15.000xg. Les sumageants contenant les protéines solubles sont dessalés sur colonne PD10 (Amersham), équilibrés avec un tampon phosphate (pH 7, 50 mM), puis appliqués sur une résine d'affinité nickel-nitrilotriacétique (Ni-NTA, Qiagen). Le protocole d'élution du fabricant est strictement suivi.
Les fractions les plus enrichies en protéines Sh-zFPS-6His et Sh-SBS-6His sont identifiées par gel SDS-PAGE, puis dessalées sur PD10 équilibrées avec un tampon (Hepes 50 mM, pH 7.8, KCl 100 mM). Un facteur d'enrichissement d'environ 20 a été obtenu pour les deux protéines par rapport à la fraction protéique brute.

Test d'activité enzymatique in vitro des protéines recombinantes Sh-zFPS et Sh-SBS
Les tests d'activité sont réalisés dans un tampon ayant la composition suivante : Hepes 50 mM, pH 7.8, KCl 100 mM, MgC12 7.5 mM, glycérol 5% (w/v), et DTT 5 mM. Pour les tests d'activité, 25 ou 50 g de protéines provenant de la fraction enrichie ont été incubés avec les substrats IPP, DMAPP, GPP, FPP, GGPP (Sigma), seuls ou en combinaison, à une concentration de 65 M chacun à 32 C pendant 2 heures.

Pour les tests réalisés avec Sh-zFPS-6His, les produits de la réaction sont ensuite déphosphorylés par ajout de 20 unités de phosphatase alkaline d'intestin de veau (New England Biolabs) pendant 1 heure à 37 C. Les terpènes alcools, produits de la déphosphorylation, sont ensuite extraits par un mélange chloroforme:méthanol:eau (0,5:1:0,4). Les phases aqueuses et organiques sont séparées par ajout d'eau (0,5 vol) et de chloroforme (0,5 vol), et centrifugées (2.000xg). Les phases organiques sont prélevées et séchées sous courant d'azote gazeux, reprises dans du pentane et analysées par chromatographie gazeuse couplée à un spectromètre de masse (GC-MS 5973N, Agilent Technologies). Les terpènes alcools sont identifiés par comparaison de leur spectre de masse avec ceux de la base de données du National Institute of Standards and Technology (NIST), et par superposition des temps de rétention avec des standards de geraniol, farnesol et geranylgeraniol (Fluka).

Pour les tests réalisés avec Sh-SBS-6His, les terpènes produits dans la réaction sont directement extraits (à 3 reprises) des mélanges réactionnels avec du pentane (volume à
volume). Les 3 extraits pentanes sont rassemblés, concentrés sous courant d'azote gazeux, et analysés par GC-MS. Les terpènes produits sont identifiés par interrogation de la base de données NIST et comparaison avec un chromatogramme d'extrait d'exsudat de Solanum habrochaites.

La protéine recombinante Sh-zFPS-6His a été incubée avec les substrats IPP+DMAPP ou 5 IPP+GPP (cf. tableau 1). Seule la première combinaison (IPP+DMAPP) conduit, après déphosphorylation, à la formation d'un terpène alcool unique de 15 atomes de carbones (C15), dont le spectre de masse permet de l'identifier comme un farnesol par comparaison avec le spectre standard présent dans la base de données NIST (figure 4). Le temps de rétention a été comparé à un standard de farnesol contenant un mélange des 4 isomères du 10 farnesol (E,E-farnesol ; E,Z-farnesol ; Z,E farnesol et Z,Z-farnesol). Le famesol produit par Sh-zFPS-6His a un temps de rétention identique à celui du Z,Z-farnesol La protéine recombinante Sh-SBS-6His a été incubée avec les substrats GPP, FPP
et GGPP. Quel que soit le substrat utilisé, aucun nouveau terpène n'a pu être détecté, signifiant que l'enzyme est inactive sur les substrats trans-allyliques (tableau 1).

Enzl Enz2 Substrat IPP Proâults Sh-zFPS absent DMAP IPP A"
Sh-zFPS absent E-GPP IPP
absent Sti-SBS E-GPP No absent Sh-SBS EE-FPP No absent Sh-SBS E,F,E=GGPP No Sh-zFPS Sh-SBS DMAPP IPP B,C,D,E,F
Sh-zFPS Sh-SBS GPP IPP -15 * : après déphosphorylation Tableau 3 : Résumé des tests d'activité enzymatique obtenus in vitro avec les protéines recombinantes Sh-zFPS-6His et Sh-SBS-6His en fonction de différents substrats isoprénoiques utilisés. A, Z,Z-farnesol, B, alpha-santalène; C, epi-beta-santalène; D, endo-beta-bergamotène; E, cis-alpha-bergamotène; F, trans-alpha-bergamotène.

20 Les enzymes Sh-zFPS-6His et Sh-SBS-6His ont été incubées ensemble avec les substrats DMAPP et IPP ou GPP et IPP. Le produit de la réaction n'a pas été traité à la phosphatase, mais extrait avec du pentane dans lequel toute oléfine est soluble. Avec le DMAPP et l'1PP
comme substrats, l'analyse chromatographique de l'extrait révèle la présence de plusieurs composés terpéniques (Fig. 5). Le profil GC a été comparé à celui de l'exsudat de la lignée 25 de tomate TA517. Cette lignée est une lignée quasi-isogénique obtenue à
partir des parents S. lycopersicum et S. habrochaites (Monforte and Tanksley, 2000). La lignée possède un fragment d'introgression de S. habrochaites responsable de la biosynthèse des sesquiterpènes de classe II (van der Hoeven et al., 2000). Les deux profils GC
sont identiques ce qui confirme que les enzymes recombinantes ont une activité
strictement identique à celles présentes dans la tomate (Fig. 6). Le composé majoritaire (Fig. 5, pie 2) est identifié comme l'alpha-santalène par comparaison de son temps de rétention et son spectre de masse avec celui de l'extrait d'exsudat de tomate TA517. Par ordre de quantités décroissantes, l'alpha-santalène (pic 4), l'endo-beta-bergamotène (pic 5), et l'alpha-bergamotène (pic 1) ont également été identifiés. L'enzyme Sh-SBS-6His est donc une enzynle dont l'activité conduit à la formation de plusieurs produits.

Il peut être conclu que Sh-zFPS est une enzyme qui agit sur l'IPP et le DMAPP
pour produire un composé phosphorylé de type farnesyl diphosphate. Le temps de rétention est identique au standard (Z,Z)-farnesol indiquant que le farnesyldiphosphate produit par Sh-zFPS est caractérisé par une configuration de type Z,Z. L'inactivité de Sh-zFPS-6His sur le E-geranyl diphosphate en combinaison avec l'IPP indique que cette molécule n'est pas un produit intermédiaire de Sh-zFPS-6His et produit au moins une liaison de type Z en combinant un DMAPP et un IPP. Sh-SBS est actif uniquement sur le composé
farnesyldiphosphate produit par l'enzyme Sh-zFPS, mais produit au moins 4 sesquiterpènes clairement identifiés dont le majoritaire est l'alpha-santalène. Enfin, la présence d'une extension en C-terminale par un spacer et 6 histidines, ne modifie en rien l'activité de l'enzyme par rapport aux enzymes natives de la plante d'origine (Fig. 3).

Expression des gènes Z,Z-FPP synthase (Sh-zFPS) et la SB synthase (Sh-SBS) dans le tabac Un promoteur de tabac spécifique des trichomes (eCBTS02, Tissier et al., 2004) a été
cloné en amont des séquences codantes Sh-zFPS et Sh-SBS pour former les constructions eCBTS1.0-Sh-zFPS [#1] et eCBTS1.0-Sh-SBS [#2]. Ces deux constructions ont été
introduites dans un même vecteur binaire pour la transforma.tion par Agrobacterium, contenant un gène de résistance à la kanamycine pour donner le vecteur binaire pLIBRO-064 (Fig. 2A). La construction #2 a également été introduite de manière indépendante dans un vecteur binaire pLIBRO-065 (Fig. 2B). Les vecteurs ont été introduits dans la souche d'Agrobacterium LBA4404 par électroporation. Les souches contenant les différents vecteurs ont été utilisées pour réaliser la transformation génétique de N.
sylvestris par la méthode des disques foliaires (Horsch et al., 1985).

Les T-DNA portant les transgènes ont été introduits par transformation génétique dans une lignée transgénique de N. sylvestris (lignée source ihpCBTS) dont l'expression du gène CBTS a été inhibée par ARN interférence (Tissier et al., 2005). Dans cette lignée, la quantité de CBT-diol des feuilles est très réduite. N. sylvestris, un tabac sauvage ne produit pas de sesquitcrpènes équivalents à ceux de la tomate. Environ 25 plantes résistantes à la kanamycine ont été obtenues pour chaque construction. La présence des transgènes dans chaque plante a été confirmée par PCR à partir d'ADN génomique de feuilles. Le niveau d'expression des transgènes dans les feuilles a été vérifié par PCR
quantitative en temps réel à partir de mRNA de feuilles de tabac. Le niveau d'expression du transgène Sh-SBS a été comparé à celui d'un gène actine dont l'expression est constitutive dans les feuilles de tabac. Les résultats sont présentés sur la figure 3 en exemple. Ils indiquent que les lignées sélectionnées expriment toutes le transgène à des niveaux variables de 1 à 50 pour la construction pLIBRO-064 et de 1 à 10 pour la construction pLIBRO-065 par rapport au gène d'actine.

Les sesquiterpènes oléfiniques étant des molécules volatiles, les molécules volatiles émises par les plantes ont été analysées en atmosphère contrôlée dans une enceinte de culture. Une partie de l'atmosphère a été captée dans un circuit de dérivation contenant un filtre SuperQ (Altech) ayant la capacité d'adsorber les molécules terpéniques oléfiniques. Les molécules ont ensuite été éluées avec 1 ml de pentane et analysées par GC/MS.
Un exemple de profil chromatographique des nlolécules volatiles émises par une plante transgénique est présenté sur la figure 7. Il montre que la lignée #3877 exprimant les gènes Sh-zFPS et Sh-SBS contient plusieurs nouveaux pics possédant une signature aux ions moléculaires 93, 94, 121 et 204 caractéristiques des sesquiterpènes de cette classe. Le profil chromatographique a été comparé à celui obtenu à partir de l'exsudat de la lignée de toniate TA517 qui produit naturellement ces composés (Fig. 7). Les deux profils sont identiques et les spectres de masse de chacun des pics sont identiques à ceux des pics de la lignée TA517. Les plantes qui expriment les deux transgènes Sh-zFPS et Sh-SBS
produisent de l'alpha-santalène, de l'épi-beta-santalène, du cis-alpha-bergamotène, du trans-alpha-bergamotène et de l'endo-beta-bergamotène tandis que les lignées transgéniques ayant intégré le gène Sh-SBS seul ne produisent aucun de ces composés. Ces résultats indiquent que la présence des deux gènes est nécessaire à la synthèse des sequiterpènes de type SB. Ils confirment les résultats obtenus in vitro avec les enzymes recombinantes. En conclusion, les gènes Sh-zFPS et Sh-SBS sont responsables de la biosynthèse des sesquiterpènes de tomate localisés au niveau du locus Sst2 décrit par van der Hoeven et al., 2000.

Polymorphisme génétique du gène zFPS entre S. lycopersicum et S. habrochaites.
Le gène complet zFPS a été amplifié par PCR à partir d'ADN génomique de S.
lycopersicum, S. habrochaites et TA517 en utilisant les amorces ACCATGGGTTCTTTGGTTCTTCAATGTTGGA (SEQ ID No 9) et ACTCGAGATATGTGTGTCCACCAAAACGTCTATG (SEQ ID No 10). Deux produits ont été amplifiés dans les deux génomes indiquant qu'il existe au moins deux copies du gène dans les deux génomes (Fig. 8). L'un des deux produits qui possède une taille d'environ 3000 nucléotide (bande A) est commun aux deux génomes. Le second produit possède une taille d'environ 2000 nucléotides (bande C) chez S. lycopersicum et d'environ 2500 nucléotides (bande B) chez S. habrochaites. La lignée TA517 montre un profil identique à celui de S. habrochaites. Ces résultats indiquent que le gène B
spécifique de S.
habrochaites a été introduit dans la lignée TA517. Le séquençage du produit B
a permis de confirmer qu'il correspond au gène zFPS présenté dans ce document. Ce résultat montre également que le gène zFPS de S. habrochaites peut être introduit dans S.
lycopersicuin en utilisant le polymorphisme qui existe entre les deux génomes pour ce gène.

Références Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schâffer, Jinghui Zhang, Zheng Zhang, Webb Miller, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs", Nucleic Acids Res.
25:3389-3402.
Bates GW, Gaynor JJ, Shekhawat NS. (1983) Fusion of Plant Protoplasts by Electric Fields. Plant Physiol. 72:1110-1113..
Bohlmann J, Crock J, Jetter R, Croteau R. (1998) Terpenoid-based defenses in conifers: cDNA cloning, characterization, and functional expression of wound-inducible (E)-alpha-bisabolene synthase from grand fir (Abies grandis). Proc Natl Acad Sci U S A.
1998 95:6756-6761.
Bouwmeester HJ, Kodde J, Verstappen FW, Altug IG, de Kraker JW, Wallaart TE.
(2002) Isolation and characterization of two germacrene A synthase cDNA clones from chicory. Plant Physiol. 29:134-144.
Cai Y, Jia JW, Crock J, Lin ZX, Chen XY, Croteau R. (2002) A cDNA clone for beta-caryophyllene synthase from Artemisia annua. Phytochemistry. 61:523-529.

Cane DE. (1999) Sesquiterpene biosynthesis: Cyclization mechanisms. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids, Vol. 2, D.D. Cane, cd (Amsterdam, The Netherlands;Elsever), pp.155-200.
Carman RM, Duffield AR (1993) The Biosynthesis of Labdanoids - the Optical Purity ofNaturally-Occurring Manool and Abienol. Aust. J. Chem. 46: 1105-1114.
Clarke CF, Tanaka RD, Svenson K, Wamsley M, Fogelman AM, Edwards PA
(1987) Molecular cloning and sequence of a cholesterol-repressible enzyme related to prenyltransferase in the isoprene biosynthetic pathway. Mol. Cell. Bio17: 3138-3146.
Colby SM, Crock J, Dowdle-Rizzo B, Lemaux PG, Croteau R. Germacrene C
synthase from Lycopersicon esculentum cv. VFNT cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase (1998) Proc Natl Acad Sci 95:2216-2221.
Facchini PJ, Chappell J. Gene family for an elicitor-induced sesquiterpene cyclase in tobacco (1992) Proc Natl Acad Sci 89(22):11088-11092.
Heinstein PF, Herman DL, Tove SB, Smith FH. Biosynthesis of gossypol.
Incorporation of inevalonate-2-14C and isoprenyl pyrophosphates (1970) J.
Biol. Chem.
245: 4658-4665.
Horsch RB, Rogers SG, Fraley RT (1985) Transgenic plants. Cold Spring Harb Symp Quant Biol. 50: 433-437.
Kharel Y, Takahashi S, Yamashita S, Koyama T. (2006) Manipulation of prenyl chain length determination mechanism of cis-prenyltransferases. FEBS J.
273:647-657.
Kollner TG, O'Maille PE, Gatto N, Boland W, Gershenzon J, Degenhardt J. (2006) Two pockets in the active site of maize sesquiterpene synthase TPS4 carry out sequential parts of the reaction scheme resulting in multiple products. Arch Biochem Biophys.
448:83-92.
Koyama T (1999) Molecular analysis of prenyl chain elongation enzymes. Biosci.
Biotechnol. Biochem. 63:1671-1676.
Liang PH, Ko TP, Wang AH. (2002) Structure, mechanism and function of prenyltransferases. (2002) 269:3339-3354.
Marchler-Bauer A, Bryant SH (2004), "CD-Search: protein domain annotations on the fly.", Nucleic Acids Res.32(W)327-331.
McMillan J., and Beale M.H. (1999) Dipterpene biosynthesis. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids Vol. 2, D.D.
Cane, cd (Amsterdam, The Netherlands;Elsever), pp.217-243.

Monforte AJ, Tanksley SD (2000) Development of a set of near isogenic and backcross recombinant inbred lines containing most of the Lycopersicon hirsutum genome in an L. esculentum background: A tool for gene mapping and gene discovery.
Genomic 43:803-813.
5 Oh SK, Han KH, Ryu SB, Kang H. (2000) Molecular cloning, expression, and functional analysis of a cis-prenyltransferase from Arabidopsis thaliana.
Implications in rubber biosynthesis. J Biol Chem. 275:18482-18488.
Poulter DC (2006) Famesyl Diphosphate Synthase. A Paradigm for Understanding Structure and Function Relationships in E-polyprenyl Diphosphate Synthases.
Phytochem 10 review 5:17-26.
Rodriguez-Concepcion M, Boronat A. (2002) Elucidation of the methylerythritol phosphate pathway for isoprenoid biosynthesis in bacteria and plastids. A
metabolic milestone achieved through genomics. Plant Physiol. 130(3):1079-89.
Sharon-Asa L, Shalit M, Frydman A, Bar E, Holland D, Or E, Lavi U, Lewinsohn 15 E, Eyal Y. (2003) Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstpsl, a key gene in the production of the sesquiterpene aroma compound valencene. Plant J. 2003 36:664-74.
Shimizu N, Koyama T, Ogura K. (1998) Molecular cloning, expression, and purification of undecaprenyl diphosphate synthase. No sequence similarity between E- and 20 Z-prenyl diphosphate synthases. J Biol Chem.273:19476-19481.
Schulbach MC, Brennan PJ, Crick DC. (2000) Identification of a short (C15) chain Z-isoprenyl diphosphate synthase and a homologous long (C50) chain isoprenyl diphosphate synthase in Mycobacterium tuberculosis. J Biol Chem. 275:22876-22881.
Tarshis LC, Yan M, Poulter CD, Sacchettini JC. (1994) Crystal structure of 25 recombinant farnesyl diphosphate synthase at 2.6-A resolution. Biochemistry 33:10871-10877.
Tholl D. (2006) Terpene synthases and the regulation, diversity and biological roles of terpene metabolism Curr Opin Plant Biol. 9:297-304.
Thompson,J.D., Gibson,T.J., Plewniak,F., Jeanmougin,F. and Higgins,D.G. (1997) 30 The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24:4876-4882.
Tissier A, Sallaud C, Rontein D (2004) Promoteurs végétaux et utilisations PCT/FR
05/02530.

Tissier A, Sallaud C, Rontein D (2005) Système de production de terpènes dans les plantes Demande de brevet France FR 05 00855.
van Der Hoeven RS, Monforte AJ, Breeden D, Tanksley SD, Steffens JC. (2000) Free in PMC Genetic control and evolution of sesquiterpene biosynthesis in Lycopersicon esculentum and L. hirsutum. Plant Cell. 12:2283-2294.
Wallaart TE, Bouwmeester HJ, Hille J, Poppinga L, Maijers NC (2001) Amorpha-4,11 -diene synthase: cloning and functional expression of a key enzyme in the biosynthetic pathway of the novel antimalarial drug artemisinin. Planta. 212:460-465.
Wang K, Ohnuma SI (1999) Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution 24 :445-451.
Wise ML, Croteau RA (1999). Monoterpene biosynthesis. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids Vol. 2, D.D.
Cane, ed (Amsterdam, The Netherlands;Elsever), pp.97-153.
Zimmermann U, Scheurich P. (1981) High frequency fusion of plant protoplasts by electric fields. Planta 151:26-32 34 taken up in a 200 mM phosphate buffer. The cells are lysed to the press of French (OP = 19 bar). The lysates are centrifuged at 15,000xg. The supernatants containing the soluble proteins are desalted on PD10 column (Amersham), balanced with a tampon phosphate (pH 7, 50 mM) and then applied to a nickel-nickel nitrilotriacetic (Ni-NTA, Qiagen). The manufacturer's elution protocol is strictly followed.
Fractions the most enriched proteins Sh-zFPS-6His and Sh-SBS-6His are identified by SDS-gel PAGE, then desalted on PD10 equilibrated with buffer (50 mM Hepes, pH 7.8, KCI
100 mM). An enrichment factor of about 20 was obtained for both protein compared to the crude protein fraction.

In vitro enzymatic activity assay of recombinant Sh-zFPS and Sh-proteins SBS
The activity tests are carried out in a buffer having the composition next: Hepes 50 mM, pH 7.8, 100 mM KCl, 7.5 mM MgCl2, 5% glycerol (w / v), and 5 mM DTT. For the activity tests, 25 or 50 g of protein from the enriched fraction were incubated with the substrates IPP, DMAPP, GPP, FPP, GGPP (Sigma), alone or in combination, at a concentration of 65 M each at 32 C for 2 hours.

For tests carried out with Sh-zFPS-6His, the products of the reaction are then dephosphorylated by adding 20 units of alkaline phosphatase calf (New England Biolabs) for 1 hour at 37 C. Terpenes alcohols, products of the dephosphorylation, are then extracted by a mixture chloroform: methanol: water (0.5: 1: 0.4). The aqueous and organic phases are separated by adding water (0.5 vol) and chloroform (0.5 vol), and centrifuged (2.000xg). The organic phases are taken and dried under a stream of nitrogen gas, taken up in pentane and analyzed by gas chromatography coupled to a mass spectrometer (GC-MS 5973N, Agilent Technologies). The terpenes alcohols are identified by comparison of their spectrum of mass with those from the National Institute of Standards and Technology (NIST), and by superimposing retention times with standards of geraniol, farnesol and geranylgeraniol (Fluka).

For tests carried out with Sh-SBS-6His, the terpenes produced in the reaction are directly extracted (3 times) reaction mixtures with pentane (volume to volume). The 3 pentane extracts are pooled, concentrated under current nitrogen gas, and analyzed by GC-MS. The terpenes produced are identified by interrogation from the base of NIST data and comparison with a chromatogram of exudate extract from Solanum habrochaites.

The recombinant protein Sh-zFPS-6His was incubated with the substrates IPP + DMAPP or 5 PPI + GPP (see Table 1). Only the first combination (IPP + DMAPP) leads, after dephosphorylation, to the formation of a single alcohol terpene of 15 atoms carbons (C15), whose mass spectrum makes it possible to identify it as a farnesol by comparison with the standard spectrum present in the NIST database (Figure 4). The time to retention was compared to a standard of farnesol containing a mixture of 4 isomers of Farnesol (E, E-farnesol, E, Z-farnesol, Z, E farnesol and Z, Z-farnesol). The famesol produced by Sh-zFPS-6His has a retention time identical to that of Z, Z-farnesol Recombinant Sh-SBS-6His protein was incubated with GPP, FPP substrates and GGPP. Whatever the substrate used, no new terpene could be detected meaning that the enzyme is inactive on trans-allylic substrates (Table 1).

Enzl Enz2 Substrate IPP Proâults Sh-zFPS absent DMAP IPP A "
Sh-zFPS absent E-GPP IPP
absent Sti-SBS E-GPP No absent Sh-SBS EE-FPP No absent Sh-SBS E, F, E = GGPP No Sh-zFPS Sh-SBS DMAPP IPP B, C, D, E, F
Sh-zFPS Sh-SBS GPP IPP -15 *: after dephosphorylation Table 3: Summary of enzymatic activity tests obtained in vitro with protein Recombinant Sh-zFPS-6His and Sh-SBS-6His according to different substrates isoprenoid used. A, Z, Z-farnesol, B, alpha-santalene; C, epi-beta-santalene; D, endo-beta-bergamotene; E, cis-alpha-bergamotene; F, trans-alpha-bergamotene.

The enzymes Sh-zFPS-6His and Sh-SBS-6His were incubated together with the substrates DMAPP and IPP or GPP and IPP. The reaction product was not treated at phosphatase but extracted with pentane in which any olefin is soluble. With the DMAPP and the 1PP
As substrates, the chromatographic analysis of the extract reveals the presence to several terpene compounds (Fig. 5). The GC profile has been compared to that of exudate of the lineage Tomato TA517. This line is a quasi-isogenic line obtained at from parents S. lycopersicum and S. habrochaites (Monforte and Tanksley, 2000). Line has an introgression fragment of S. habrochaites responsible for biosynthesis of class II sesquiterpenes (van der Hoeven et al., 2000). Both GC profiles are identical, which confirms that the recombinant enzymes have an activity strictly identical to those present in the tomato (Fig. 6). The majority compound (Fig. 5, pie 2) is identified as alpha-santalene by comparing its time of retention and its mass spectrum with that of TA517 tomato exudate extract. By order in quantities decreasing alpha-santalene (peak 4), endo-beta-bergamotene (peak 5), and alpha-bergamotene (peak 1) have also been identified. The enzyme Sh-SBS-6His is therefore an enzynle whose activity leads to the formation of several products.

It can be concluded that Sh-zFPS is an enzyme that acts on PPI and DMAPP
for produce a phosphorylated compound of the farnesyl diphosphate type. Time to retention is identical to standard (Z, Z) -farnesol indicating that farnesyldiphosphate produced by Sh-zFPS is characterized by a configuration of type Z, Z. The inactivity of Sh-zFPS-6His on the E-geranyl diphosphate in combination with IPP indicates that this molecule is not a intermediate product of Sh-zFPS-6His and produces at least one Z in combining a DMAPP and an IPP. Sh-SBS is active only on the compound farnesyldiphosphate produced by the enzyme Sh-zFPS, but produces at least 4 clearly identified sesquiterpenes, the majority of which are alpha-santalene. Finally, presence of a C-terminal extension by a spacer and 6 histidines, does not change anything the activity of the enzyme compared to the native enzymes of the original plant (Fig. 3) Expression of Z, Z-FPP synthase (Sh-zFPS) and SB synthase (Sh-SBS) genes in the tobacco A tobacco promoter specific for trichomes (eCBTS02, Tissier et al., 2004) has been cloned upstream of the Sh-zFPS and Sh-SBS coding sequences to form the constructions eCBTS1.0-Sh-zFPS [# 1] and eCBTS1.0-Sh-SBS [# 2]. These two constructions were introduced into the same binary vector for transformation by Agrobacterium, containing a kanamycin resistance gene to give the binary vector pLIBRO-064 (Fig. 2A). Building # 2 has also been introduced so independent in a binary vector pLIBRO-065 (Figure 2B). Vectors have been introduced in strain of Agrobacterium LBA4404 by electroporation. Strains containing the different vectors were used to carry out the genetic transformation of N.
sylvestris by the leaf disc method (Horsch et al., 1985).

T-DNA carrying the transgenes were introduced by transformation genetics in a transgenic line of N. sylvestris (source line ihpCBTS) whose expression of the gene CBTS was inhibited by RNA interference (Tissier et al., 2005). In this lineage, the CBT-diol amount of the leaves is very small. N. sylvestris, a tobacco Wild does not produce no sesquitcrpenes equivalent to those of the tomato. About 25 plants resistant to kanamycin were obtained for each construct. The presence of transgenes in each plant was confirmed by PCR from genomic leaf DNA. The level transgene expression in the leaves was verified by PCR
quantitative in time real from mRNA of tobacco leaves. The level of expression of the transgene Sh-SBS has compared to that of an actin gene whose expression is constitutive in the leaves of tobacco. The results are shown in Figure 3 as an example. They indicate that the lineages selected all express the transgene at variable levels from 1 to 50 for the construction pLIBRO-064 and from 1 to 10 for the construction pLIBRO-065 by report to actin gene.

Since olefinic sesquiterpenes are volatile molecules, the molecules volatile emitted by the plants were analyzed in a controlled atmosphere in an enclosure of culture. A
part of the atmosphere was captured in a bypass circuit containing a filtered SuperQ (Altech) with the ability to adsorb terpene molecules olefin. The The molecules were then eluted with 1 ml of pentane and analyzed by GC / MS.
A
example of a chromatographic profile of volatile molecules emitted by a plant transgenic is shown in Figure 7. It shows that the lineage # 3877 expressing the genes Sh-zFPS and Sh-SBS contains several new peaks with a signature to ions Molecular 93, 94, 121 and 204 characteristics of the sesquiterpenes of this classroom. The chromatographic profile was compared to that obtained from the exudate of the line of TA517 which produces these compounds naturally (Fig. 7). Both profiles are identical and the mass spectra of each of the peaks are identical to those peaks of the line TA517. Plants that express both Sh-zFPS and Sh-SBS transgenes produce alpha-santalene, epi-beta-santalene, cis-alpha-bergamotene, from trans-alpha-bergamotene and endo-beta-bergamotene while the lineages transgenics that have integrated the Sh-SBS gene alone do not produce any of these compounds. These results indicate that the presence of both genes is necessary for the synthesis of sequiterpenes of SB type. They confirm the results obtained in vitro with enzymes Recombinant. In conclusion, the Sh-zFPS and Sh-SBS genes are responsible for the biosynthesis of tomato sesquiterpenes located at the Sst2 locus described by van der Hoeven et al., 2000.

Genetic polymorphism of the zFPS gene between S. lycopersicum and S. habrochaites.
The zFPS complete gene was amplified by PCR from S. genomic DNA.
lycopersicum, S. habrochaites and TA517 using primers ACCATGGGTTCTTTGGTTCTTCAATGTTGGA (SEQ ID No 9) and ACTCGAGATATGTGTGTCCACCAAAACGTCTATG (SEQ ID NO: 10). Two products were amplified in both genomes indicating that there are at least two copies of gene in both genomes (Fig. 8). One of the two products that has a cut about 3000 nucleotide (A band) is common to both genomes. The second product has a size of about 2000 nucleotides (band C) in S. lycopersicum and about 2500 nucleotides (band B) in S. habrochaites. The TA517 line shows a profile identical to that of S. habrochaites. These results indicate that the B gene specific of S.
habrochaites was introduced in the TA517 line. Sequencing of product B
allowed to confirm that it corresponds to the zFPS gene presented in this document. This result watch also that the zFPS gene of S. habrochaites can be introduced into S.
lycopersicuin en using the polymorphism that exists between the two genomes for this gene.

References Altschul, Stephen F., Thomas L. Madden, Alejandro A. Schaffer, Jinghui Zhang, Zheng Zhang, Miller Webb, and David J. Lipman (1997), "Gapped BLAST and PSI-BLAST: a new generation of protein database search programs, Nucleic Acids Res.
25: 3389-3402.
Bates GW, Gaynor JJ, Shekhawat NS. (1983) Fusion of Plant Protoplasts by Electric Fields. Plant Physiol. 72: 1110-1113 ..
Bohlmann J, Crock J, Jetter R, Croteau R. (1998) Terpenoid-based defenses in conifers: cDNA cloning, characterization, and functional expression of wound-inducible (E) -alpha-bisabolene synthase from grand fir (Abies grandis). Proc Natl Acad Sci US A.
1998 95: 6756-6761.
Bouwmeester HJ, Kodde J, Verstappen FW, Altug IG, Kraker JW, Wallaart TE.
(2002) Isolation and characterization of two germacrene synthase cDNA clones from chicory. Plant Physiol. 29: 134-144.
Cai Y, Jia JW, Crock J, ZX Lin, Chen XY, Croteau R. (2002) A cDNA clone for beta-caryophyllene synthase from Artemisia annua. Phytochemistry. 61: 523-529.

Cane DE. (1999) Sesquiterpene biosynthesis: Cyclization mechanisms. in comprehensive natural products chemistry, isoprenoids including carotenoids and steroids, Flight. 2, DD Cane, CD (Amsterdam, The Netherlands, Elsever), pp.155-200.
Carman RM, Duffield AR (1993) The Biosynthesis of Labdanoids - the Optical Purity of Natural-Occurring Manool and Abienol. Aust. J. Chem. 46: 1105-1114.
Clarke CF, Tanaka RD, Svenson K, Wamsley M, Fogelman AM, Edwards PA
(1987) Molecular cloning and sequence of a cholesterol-repressible enzyme related to prenyltransferase in the isoprene biosynthetic pathway. Mol. Cell. Bio17: 3138-3146.
Colby SM, Crock J, Dowdle-Rizzo B, Lemaux PG, Croteau R. Germacrene C
synthase from Lycopersicon esculentum cv. VFNT cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase (1998) Proc Natl Acad Sci 95: 2216-2221.
Facchini PJ, Chappell J. Gene family for an elicitor-induced sesquiterpene cyclase in tobacco (1992) Proc Natl Acad Sci 89 (22): 11088-11092.
Heinstein PF, Herman DL, SB Tove, Smith FH. Biosynthesis of gossypol.
Incorporation of 2-valentalate-2-14C and isoprenyl pyrophosphates (1970) J.
Biol. Chem.
245: 4658-4665.
Horsch RB, Rogers SG, Fraley RT (1985) Transgenic plants. Cold Spring Harb Symp Quant Biol. 50: 433-437.
Kharel Y, Takahashi S, Yamashita S, Koyama T. (2006) Manipulation of prenyl chain length determination mechanism of cis-prenyltransferases. FEBS J.
273: 647-657.
Kollner TG, O'Maille PE, Gatto N, Boland W, Gershenzon J, Degenhardt J. (2006) Two pockets in the active site of maize sesquiterpene synthase TPS4 carry out sequential parts of the reaction resulting from multiple products. Arch Biochem Biophys.
448: 83-92.
Koyama T (1999) Molecular analysis of prenyl chain elongation enzymes. Biosci.
Biotechnol. Biochem. 63: 1671-1676.
Liang PH, Ko TP, Wang AH. (2002) Structure, mechanism and function of prenyltransferases. (2002) 269: 3339-3354.
Marchler-Bauer A, Bryant SH (2004), "CD-Search: protein domain annotations on the fly. ", Nucleic Acids Res.32 (W) 327-331.
McMillan J., and Beale MH (1999) Dipterpene biosynthesis. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids Flight. 2, DD
Cane, cd (Amsterdam, The Netherlands, Elsever), pp.217-243.

Monforte AJ, Tanksley SD (2000).
recombinant backcross inbred lines containing most of the Lycopersicon hirsutum genome in an L. esculentum background: A tool for gene mapping and gene discovery.
Genomic 43: 803-813.
5 Oh SK, Han KH, Ryu SB, Kang H. (2000) Molecular cloning, expression, and Functional analysis of a cis-prenyltransferase from Arabidopsis thaliana.
Implications in rubber biosynthesis. J Biol Chem. 275: 18482-18488.
Poulter DC (2006) Famesyl Diphosphate Synthase. A Paradigm for Understanding Structure and Function Relationships in E-polyprenyl Diphosphate Synthases.
Phytochem Review 5: 17-26.
Rodriguez-Concepcion M, Boronat A. (2002) Elucidation of methylerythritol phosphate pathway for isoprenoid biosynthesis in bacteria and plastids. AT
metabolic milestone achieved through genomics. Plant Physiol. 130 (3): 1079-1089.
Sharon-Asa L, Shalit M, Frydman A, Bar E, Holland D, Gold E, Lavi U, Lewinsohn 15 E, Eyal Y. (2003) Citrus fruit flavor and aroma biosynthesis: isolation, functional characterization, and developmental regulation of Cstpsl, a key gene in the production of the sesquiterpene aroma compound valencene. Plant J. 2003 36: 664-74.
Shimizu N, Koyama T, Ogura K. (1998) Molecular cloning, expression, and purification of undecprenyl diphosphate synthase. No sequence similarity between E- and Z-prenyl diphosphate synthases. J Biol Chem.273: 19476-19481.
Schulbach MC, Brennan PJ, Crick DC. (2000) Identification of a short (C15) chain Z-isoprenyl diphosphate synthase and homologous long (C50) chain isoprenyl diphosphate synthase in Mycobacterium tuberculosis. J Biol Chem. 275: 22876-22881.
LC Tarshis, Yan M, Poulter CD, Sacchettini JC. (1994) Crystal structure of Recombinant farnesyl diphosphate synthase at 2.6-A resolution. Biochemistry 33: 10871-10877.
Tholl D. (2006) Terpene synthases and regulation, diversity and biological Search of terpene metabolism Curr Opin Plant Biol. 9: 297-304.
Thompson, JD, Gibson, TJ, Plewniak, F., Jeanmougin, F. and Higgins, DG (1997) The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Research 24: 4876-4882.
Tissier A, Sallaud C, Rontein D (2004) Plant promoters and uses PCT / FR
05/02530.

Tissier A, Sallaud C, Rontein D (2005) Terpenes production system in the plants French patent application FR 05 00855.
Van Der Hoeven RS, Monforte AJ, Breeden D, SD Tanksley, Steffens JC. (2000) Free in PMC Genetic control and evolution of sesquiterpene biosynthesis in Lycopersicon esculentum and L. hirsutum. Plant Cell. 12: 2283-2294.
Wallaart TE, Bouwmeester HJ, Hille J, Poppinga L, Maijers NC (2001) Amorpha-4,11 -diene synthase: cloning and functional expression of a key enzyme in the biosynthetic pathway of the novel antimalarial drug artemisinin. Planta. 212: 460-465.
Wang K, Ohnuma SI (1999) Chain-length determination mechanism of isoprenyl diphosphate synthases and implications for molecular evolution 24: 445-451.
Wise ML, Croteau RA (1999). Monoterpene biosynthesis. In comprehensive natural products chemistry, isoprenoids including carotenoids and steroids Flight. 2, DD
Cane, ed (Amsterdam, The Netherlands, Elsever), pp.97-153.
Zimmermann U, Scheurich P. (1981) High frequency fusion of plant protoplasts by electric fields. Planta 151: 26-32

Claims

1- Method for producing SB-type sesquiterpenes or derivatives thereof from Z, Z-FPP in a cell having a source of DMAP and IPP, comprising:
a) the introduction into said cell of a construction carrying a cassette expression comprising a first gene coding for a zFPS having at least less than 80% identity with the SEQ ID No 2 and a construction carrying a expression cassette comprising a second gene encoding an SB synthase having at least 80% identity with SEQ ID No. 4;
(b) the culture of the transformed cell under appropriate conditions to expressing said first and second genes; and, (c) optionally, the collection of SB-type sesquiterpenes or this one contained in said cell and / or in the culture medium.

2- Isolated or recombinant protein having Z, Z-FPP synthase activity and a sequence having at least 80% identity with SEQ ID No. 2.

3- Protein according to claim 2, characterized in that its sequence corresponds to the SEQ ID No. 2.

4- Isolated or recombinant protein having SB synthase activity and having a sequence having at least 80% identity with SEQ ID No. 4.

Nucleic acid comprising a nucleotide sequence coding for a protein according to claims 2 to 4.

6- Expression cassette comprising a nucleic acid according to claim 5.

A vector comprising a nucleic acid according to claim 5 or a cassette expression system according to claim 6.

8- Host cell comprising a nucleic acid according to claim 5, a cassette expression system according to claim 6, or a vector according to claim 7.

9- Non-human transgenic organism comprising a nucleic acid according to claim 5, an expression cassette according to claim 6, a vector according to the claim 7, or a cell according to claim 8.

10-transgenic organism according to claim 9, characterized in that the body is a plant with dwarf trichomes, preferably of the genus Nicotiana or Solanum.

11- Method of producing Z, Z-farnesyl diphosphate (Z, Z-FPP), or derivatives of those-from IPP and DMAP in a cell with a source of IPP and DMAP
comprising:
a) the introduction into said cell of a construction carrying a cassette expression with a nucleic acid sequence encoding a protein according to claim 2 or 3;
(b) the culture of the transformed cell under appropriate conditions to gene expression; and (c) optionally, the harvest of the product or derivatives thereof contained in said cell and / or in the culture medium.

12- Use of a protein according to claims 2 to 4, an acid nucleic according to the claim 5, a host cell according to claim 8 or an organism transgenic material according to claim 9 or 10 for the preparation of Z, Z-FPP, alpha santalene, epi-beta-santalene, alpha-bergamotene, beta-bergamotene, and endo-beta-bergamotene or derivatives thereof such as alpha-santalol, epi-beta-santalol, alpha-bergamotol, beta-bergamotol and Z, Z-farnesol.

13- Non-human transgenic cell or organism, characterized in that the way of SB-type sesquiterpene synthesis is blocked by inactivation of the gene coding for a protein according to claim 2 or 3, or gene encoding a protein according to claim 4 or both genes.

14- Use of molecular markers comprising all or part of an acid nucleic having at least 80% identity with SEQ ID No 1 or SEQ ID No 3 for identify a genomic polymorphism between S. habrochaites and species like Solanum sexually compatible with S. habrochaites to control introgression of genes corresponding in these species.

15. Use according to claim 14, characterized in that the molecular markers include nucleic sequences corresponding to SEQ ID Nos. 9 and 10.

16-. Method of introducing the zFPS gene encoding a zFPS
presenting at less than 80% identity with SEQ ID No. 2 and the SBS gene encoding an SB
synthase having at least 80% identity with SEQ ID No 4 in a non-native species sexually compatible with Solanum habrochaites by fusion of protoplasts.

17- Method of producing Z, Z-farnesol by dephosphorylation of Z, Z-FPP
got according to the method of claim 11 by a phosphatase.