CA2656032C

CA2656032C - Process for culturing bacteria of the piscirickettsia genus

Info

Publication number: CA2656032C
Application number: CA2656032A
Authority: CA
Inventors: Trygve Meum Eliassen; Inge Tom Solbakk; Kirsten Trasdahl Haugseth; Marianne Bordevik; Anja Nygaard; Marit Rode
Original assignee: Pharmaq AS
Current assignee: Pharmaq AS
Priority date: 2006-06-29
Filing date: 2007-06-27
Publication date: 2017-06-13
Anticipated expiration: 2027-06-27
Also published as: WO2008002152A8; CL2007001893A1; GB2452892A; CA2656032A1; GB2452892B; GB0823188D0; WO2008002152A2; WO2008002152A3

Abstract

The present application provides processes for culturing bacteria belonging to the Piscirickettsia genus, processes for selecting/identifying such bacteria as well as processes for manufacturing vaccines. The invention further provides vaccine compositions and formulations and bacteria that are identified and/or cultured by a process according to the invention.

Description

2 PROCESS FOR CULTURING BACTERIA OF THE PISCIRICKETTSIA GENUS
FIELD OF INVENTION
The present invention relates to the identification and culturing of particular isolates of bacteria belonging to the Piscirickettsia genus and to vaccines based on these bacterial isolates.
BACKGROUND OF THE INVENTION
A novel disease of fish, Salmonid rickettsia' septicemia (SRS), or piscirickettsiosis, was observed in 1989 among choho salmon, Oncorhynchus kisutch (Walbaum) in Chile (Bravo & Campos 1989). The first signs of disease began 6-12 weeks after fish were transferred from fresh water to sea water, and cumulative mortality ranged from 30 to 90% (Bravo & Campos 1989). Anaemia caused by the systemic spread and replication of an intracellular bacterium was the principal characteristic of the disease (Cvitanich, Garate &Smith 1991). The gram-negative intracellular bacterium was initially referred to as rickettsia-like (Fryer et al. 1990;
Cvitanich et al. 1991) and was later grouped in the Gannmaproteobacteria and assigned to a new genus and species Piscirickettsla salmonis by Fryer, Lannan, Giovannoni &
Wood (1992).
Some non-salmonid fish have been confirmed to be infected with P. salmonis;
white seabass from California, USA (Chen et al. 2000) and European seabass (McCarthy et al. 2005).
In early studies, P. salmonis bacteria failed to grow on a number of artificial bacteriological media and the bacteria were thus considered to be obligate intracellular organisms. It was observed, however, that the bacteria are able to propagate on a number of cell lines of salmon and non-salmonid origin, i.e.
CHSE-214, CHH-1, CSE-119, TRG-2, EPC, and FHM (Cvitanich et al. 1991, Fryer et al.
1990 and 1992). More recent studies have shown that the bacteria have the ability to replicate in Sf-9 insect cells (Birkbeck et al. 2004). The organism is capable of replication between 10-21 C . P. salmonis produces a cytopathic effect causing cytoplasmic vacuolation and rounding of infected cells. P. salmonis is still capable of reproducing the disease after nine passes in cell culture when injected into salmon (House et al. 1999).
Initial attempts to utilize whole cell bacterins to protect salmon from P.
salmonis infection have shown variable results. In trials using formalin inactivated bacterin without adjuvant, Smith, etal. (1995 and 1997) demonstrated significant protection to natural challenges with the bacterium, while fish receiving adjuvant and bacterin in the same trial showed no protection, or a greater susceptibility to infection. In other trials increased survival was observed when coho salmon were injected with whole cell bacterins in oil and water adjuvants (Kuzyk etal.
2001a).
However, better protection was observed with a vaccine prepared with recombinant OspA alone or fused with T cell epitopes from tetanus toxin and measles fusion protein (Kuzyk et al. 2001b). Although there are commercial vaccines on the market today, piscirickettsiosis remains a major problem, in particular in the South American sainnonid farming industry.
Bacteria similar to P. salmonis have, and probably will, continue to be isolated from a number of new fish species over a wide geographic range including in more temperate sea water conditions. Together with closely related bacteria, P.
salmonis may have a wide host and geographical range, which clearly suggests that an efficient protection against infection with bacteria of the genus will be important for the fish farming industry.
However, with the current knowledge on processes for producing P. salmonis antigen for vaccines against piscirikettsiosis, the manufacturers would solely rely on culturing the bacteria on suitable cell lines. This clearly provides limitations for large-scale production, since large-scale culture of P. salmonis in eukaryotic cell lines is laborious and expensive, and is not considered profitable for the fish industry.
Hence, an improved process for the production of P. salmonis antigen for piscirickettsiosis vaccines would be advantageous, and in particular a more efficient and cost effective process would be very useful for the providers of vaccines for farmed fish.

3 SUMMARY OF THE INVENTION
A main aspect of the present invention pertains to a process for culturing a bacterium belonging to the Piscirickettsia genus wherein said bacterium is cultured in a substantially extracellular environment. A general feature of the process is the selection for bacteria that will reproduce in an extracellular environment.
In a related aspect, the invention provides a process for producing a vaccine comprising one or more steps of culturing a bacterium of the Piscirickettsia genus, wherein the bacterium is cultured in a substantially extracellular environment.
Another aspect of the invention provides a process for obtaining a bacterium belonging to the Piscirickettsia genus, which in some embodiments comprises the steps of:
a) providing a sample from a fish, which is infected with bacteria belonging to the Piscirickettsia genus;
b) inoculating into an essentially cell free culture medium bacteria from said sample or dilution series hereof, or bacteria from a spread plate culture established from said sample or dilution series hereof; and c) selecting a bacterium that propagate freely in the medium.
Yet another main aspect of the invention provides a bacterium of the Piscirickettsia genus, said bacterium having the ability to propagate in a substantially extracellular environment. In some embodiments the bacterium may be characterised as being one that is obtainable by the described process for obtaining a bacterium belonging to the Piscirickettsia genus.
A further important aspect pertains to a vaccine comprising a bacterium according to the invention. In a related aspect the vaccine is provided in the form of a feed.
Additional aspects of the invention relate to a bacterium according to the invention or a subunit hereof for use in veterinary medicine.

, CA 02656032 2013-03-28 3a Another aspect of the description provides a process for culturing a bacterium of the species Piscirickettsia salmonis comprising:
I. inoculating a culture medium with the bacterium;
II. subjecting the inoculated culture medium to conditions which allow thebacterium to multiply; and III. harvesting the bacterium from the culture medium;
wherein the culture medium does not contain any host cells.
Yet another aspect of the description provides a process for producing a vaccine comprising i) a step of culturing a bacterium of the species Piscirickettsia salmonis, comprising inoculating a culture medium with the bacterium, and subjecting the inoculated culture medium to conditions which allow the bacterium to multiply;
ii) harvesting the bacterium from the culture medium; and iii) disrupting or inactivating the bacterium;
wherein the culture medium does not contain any host cells.

4 A still further aspect relates to the use of a bacterium according to the invention or a subunit of said bacterium in the manufacture of a medicament for the prevention of infections with bacteria of the Piscirickettsia genus.
Finally, the invention provides a method for prevention of infections in fish with bacteria of the Piscirickettsia genus, said method comprising administering to the fish a vaccine according to the invention.
DETAILED DESCRIPTION OF THE INVENTION
Bacteria belonging to the Piscirickettsia genus, as represented by Piscirickettsia salmonis, have been identified as the causative agent of Salmonid rickettsial septicemia (SRS), or piscirickettsiosis. The bacteria were believed to be highly fastidious obligate intracellular bacteria in agreement with the finding that they replicate within membrane-bound cytoplasmic vacuoles in tissue culture cells or those of the host fish. The present invention, however, is based on the surprising finding that it is possible to obtain isolates of bacteria of the Piscirikettsia genus that are capable of growing in an extracellular environment.
Based on this unexpected finding it was possible to provide a process where bacteria belonging to the Piscirickettsia genus are cultured and harvested in process steps and under conditions that favour bacteria which are capable of growing in an extracellular or cell free environment. Thus, in its broadest sense, the invention therefore pertains to a process for culturing a bacterium belonging to the Piscirickettsia genus (Piscirickettsia spp.), and one of the advantages of the present process is that it comprises one or more steps during which bacteria that are capable of growing in an extracellular environment will be selected. In the process of the invention a selection pressure may be established by culturing the bacteria without any host cells or cells of non-mammalian origin or with a number of host cells that are considered inadequate to sustain intracellular growth of a sufficient number of bacteria. During the process, further steps selecting for extracellular bacterial growth may be conducted. These may include harvesting the cultured bacteria from the culture medium directly and under non-lysing conditions, i.e. conditions that are not set to cause lysis of cells of non-bacteral origin. Thus, whether some cells of non-bacterial origin are present in the culture medium is immaterial, as the process does not rely on the capacity of these cells to act as host cells for the bacteria.
Thus, in a main aspect, the invention pertains to a process for culturing a bacterium belonging to the Piscirickettsia genus (Piscirickettsia spp.) wherein the

5 bacterium is propagated or cultured in a substantially extracellular environment.
Thus, in the context of the present invention, the term "in a substantially extracellular environment" further refers to a culture of bacteria, wherein at least 10%, such as at least 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 95, 98, 99, 99.5 or 100% of the bacteria propagate freely in the medium.
In one embodiment of the process of the invention, the bacterium is propagated (cultured) substantially in the absence of cells of non-bacterial origin. It will be understood that cells of non-bacterial origin comprise vertebrate cells, such as cells that would otherwise be suitable as host cells for a bacterium belonging to the Piscirickettsia genus. Thus, within the scope of the present invention, is a process is provided wherein a bacterium belonging to the Piscirickettsia genus is cultured in a process that does not rely on the use of host cells.
In the present context the terms "in a substantially extracellular environment"
and "substantially in the absence of cells of non-bacterial origin" define a culture of bacteria, wherein bacteria are cultured to a TCID50 titre of at least 1 x bacteria/ml medium, such as at least 1 x 104, at least 5 x 104, at least 1 x 105, at least 5 x 105, at least 1 x 106, at least 5 x 106, at least 1 x 107, at least 5 x 107, at least 1 x 108, least 5 x 108, least 1 x 109, at least 2 x 109, at least 3 x 109, at least 4 x 109, at least 5 x 109, at least 6 x 109, at least 7 x 109, at least 8 x 109, at least 9 x 109, at least 1 x 1010, at least 2 x 1010, at least 3 x 1010, at least 4 x 1010, or such as at least 5 x 1010 bacteria/ml medium in the presence of at the most 105 cells of non-bacterial origin/ml culture medium, such as at the most 2 x 105, such as at the most 3 x 105, at the most 4 x 105, at the most 5 x 105, at the most, 6 x 105, at the most 7 x 105, at the most 8 x 105, at the most 9 x 105, or such as in the presence of at the most 1 x 106 cells of non-bacterial origin/m1 culture medium. The culture may be established by inoculating a culture with a volume of a stock solution corresponding preferably to 0.25 to 4%, more preferably 0.5 to 2%, most preferably 1% of the of the final volume of medium in said culture and having an optical density of between 2.5 and 3.5, such as an

6 optical density of 2.8 or 2.9. For this purpose the bacteria may be cultured in ventilated spinner flasks, preferably at 30-200 RPM and a temperature of 18.5 to 19.50C for a period of from 1-10 days, such as from 1 to 8 days, such as from to 5 days, such as from 2 to 4 days, such as from 2 to 3 days. Alternatively, P.salmonis can be grown in shaker flasks or in static cultures.
In an embodiment of the process of the invention, the process is one for culturing a bacterium belonging to the Piscirickettsia genus, wherein a substantial amount of the bacteria are propagated/cultured in an extracellular environment An initial step of the process according to the invention may involve establishing a stock suspension of bacteria from a selected bacterial isolate. It is contemplated that the stock suspension may be established by selecting bacteria from primary isolates that are capable of propagating in an extracellular environment.
The stock suspension may contain bacteria of the Piscirikettsia genus in amounts of 105, 106, 107, 108, 108, 1010, 1011 TCID50/ml. The TCID50 unit is defined as that dilution of a virus required to infect 50% of a given batch of inoculated cell cultures. The stock suspension can be frozen with a cryoprotectant such as DMSO, glycerol or others, and be kept for prolonged times at -80 C.
Thus, in a preferred embodiment, the process according to the invention thus comprises establishing a stock suspension by a process comprising the steps of:
a) providing a sample from a fish, which is infected with bacteria belonging to the Piscirickettsia genus;
b) inoculating into a culture medium, which is preferably essentially cell free, bacteria from said sample or dilution series hereof, or bacteria from a spread plate culture established from said sample or dilution series hereof;
and c) selecting bacteria that propagate freely in the medium.
In preferred embodiments of the present invention the bacterium belonging to the Piscirickettsia genus is a bacterium that has the ability to introduce the symptoms and disease of piscirickettsiosis in a fish. External symptoms of piscirickettsiosis include: dark colour, anorexia and lethargia, erratic swimming due to infections in

7 the brain, skin lesions that can progress to shallow ulcersas well as pale gills resulting from significant anaemia. Internal symptoms include swollen and discoloured kidney, an enlarged spleen, ascites in the peritoneum, haemorrhages on the visceral fat, stomach, swim bladder, and body musculature, as well as whitish or yellow, multifocal, coalescing, pyogranulomatous nodules found in the liver. Further internal symptoms in the liver include multifocal necrosis of hepatocytes, accompanied by a chronic inflammatory infiltrate of mononuclear cells, vascular and perivascular necrosis and intravascular coagulation resulting in fibrin thrombi within major vessels.
In the kidney and spleen, vascular changes similar to those in the liver may also be observed, and granulomatous inflammation also occurs in the interstitium and parenchyma of the kidney and spleen, respectively. Meningitis, endocarditis, peritonitis, pancreatitis, and branchitis may be observed with accompanying chronic inflammatory and vascular changes similar to those in the liver and haematopoietic organs.
High magnification examination of lesions reveals aggregates of the organism in the cytoplasm of degenerated hepatocytes and in macrophages. Infected macrophages are usually hypertrophied and replete with cellular debris. In tissue sections stained with haematoxylin and eosin, the organism appears as basophilic or amphophilic spheres, about 1 pm in diameter.
For the purpose of the present invention, a presumptive diagnosis of fish, which are infected with bacteria belonging to the Piscirickettsia genus, may be by visualization of the causative agent within macrophages or hepatocytes in histological sections or tissue imprints. As a means of confirmatory diagnosis, PCR
assays can also be conducted directly on isolated tissues (Marshal et al., 1998, Mauel et al. 1996) and thus PCR assays on tissues along with the observation of suspect organisms within macrophages or hepatocytes are suitable methods for confirmatory diagnosis. Bacteriological culture on cystein heart agar supplemented with 5% sheep blood can also be used as a means of diagnosis.
P.salmonis will usually appear as whitish streaks on the plate, and may also form single colonies.
Alternatively, Piscirickettsia spp. can be detected with Giemsa-stained tissue smears, followed by indirect immunofluorescent antibody test (IFAT), polymerase

8 chain reaction (PCR) with relevant primers and/or nucleic acid sequencing for positive identification.
These are techniques which are known by the skilled person in the art.
A series of standard monitoring methods and diagnostic methods for piscirickettsiosis have been developed by the World Organization for Animal Health as published in the Manual of Diagnostic tests for Aquatic Animals 2003, part 2, section 2.1, chapter 2.1.13.
Infected fish tissues suitable for examination in IFAT, PCR, tissue imprints and histology are kidney, liver and blood, collected from diseased fish during either overt or covert infections. Due to sensitivity of P.
salmonis to antibiotics in vitro, none should be used in media during collection of tissue or the culture of cells.
Similarly, the tissues mentioned above provide suitable sources for samples to be used in the process of isolating a bacterium of the Piscirickettsia genus and for establishing a stock suspension of Piscirickettsia spp. according to the present invention. Accordingly, preferred embodiments of the invention pertains to a process, wherein said sample is taken from a body tissue, a body fluid, a secretion or, preferably, from a tissue homogenate. In a further preferred embodiment the tissue homogenate has been clarified by centrifugation or filtration.
In a further preferred embodiment of the invention, the selected bacterium is further cultured over at least 1, such as at least 2, at least 3, at least 4, at least 5, at least 10, at least 11, at least 12, at least 13, at least 14, or at least 15 passages before a stock suspension is established.
As mentioned, the present invention pertains to a process of culturing a bacterium which is capable of introducing the symptoms and disease of piscirickettsiosis. For the purpose of determining whether a bacterium belonging to the Piscirickettsia genus may cause the disease and symptoms of piscirickettsiosis, experiments may be conducted in which Atlantic salmon weighing 20-40 grams are challenged intraperitoneally in fresh water with 10-fold dilutions of Piscirickettsia spp. cultures. Preferably, the cultures should have a titre of at least 105 TCID50/m1 Piscirickettsia spp. The fish should be observed daily for the next five weeks, and

9 should display the above-mentioned symptoms of piscirickettsiosis within this time.
As of present, bacteria of the species Piscirickettsia salmonis have been identified as causative agents of piscirickettsiosis. Accordingly, for the purpose of the present invention it may be preferred that the bacterium cultured in the process of the invention is of the species Piscirickettsia salmonis.
As described in the below Examples, stock suspensions have been established from a number of isolates of Piscirickettsia spp that have been selected for the ability to grow in an extracellular environment.
Samples from representative isolates have been deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 9 june 2006 under the following accession numbers: 06050901 (isolate AL10005), 06050902 (isolate AL10007), and 06050903 (isolate AL10008). A further representative sample has been deposited on 21 March 2007 under the accession number 07032110 (isolate AL10014).
In preferred embodiments of the invention relating to the process, said bacterium belonging to the Piscirickettsia genus thus has genotypic and/or phenotypic characteristics related to those of any of the bacteria which are deposited in the European Collection of Cell Culture (ECACC) Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 9 june 2006 under the following provisional accession numbers: 06050901 (isolate AL10005), 06050902 (isolate AL10007), 06050903 (isolate AL10008) or to those of the bacteria deposited on 21 March 2007 under the accession number 07032110 (isolate AL10014).
Specific genotypic characteristics which are often used for distinguishing between bacterial species and isolates are the sequences of their internal transcribed spacers (ITS) and the sequences of the genes coding for the 16S and 23S ribosomal RNAs. The ITS are non-coding regions of DNA sequence that separate genes coding for the 16S and 23S ribosomal RNAs. These ribosomal RNA
(rRNA) genes are relatively conserved across taxa and species while the spacers between them may be specific for particular species and isolates. The conservation of the rRNA genes allows for easy access to the ITS regions with "versatile" primers for polymerase chain reaction (PCR) amplification. The inventors have found that the isolates of bacteria belonging to the Piscirickettsia genus which are able to grow substantially in the absence of cells of non-bacterial origin have ITS
sequences 5 that can be as little as 95%, 96%, 97%, 98% or 99% identical to those of isolates that are obligate intracellular bacteria. Thus, a preferred embodiment of the invention relates to a process, wherein said bacterium belonging to the Piscirickettsia genus is characterised by having an internal transcribed spacer region which comprises a nucleic acid sequence which is more than 95%
identical

10 to the sequence:
GTATAAGTAAAGATTCCTTGATrAATI-TAGGGITA IIIIIATMCGATTGAGATGTATM
TATGTTTTGATTGATAAATGGGAATAA IIIIIAGTTTATTTAATTAACGAGTCTTGGTAATT
TTTGAAAACCGGTGTTGAGATATAGTITTGATTGGITTTAGTTAATAGATTTTAGATTTATT
GATATAAGAC !III' GGGGTTATATGATCAAGTGAATAAGTGCAT (SEQ ID. NO. 1).
In further specific embodiments said bacterium belonging to the Piscirickettsia genus is characterised by having an 16S rRNA gene which comprises a nucleic acid sequence which is at least 97% identical to the sequence:
GTATAAGTAAAGATTCCTI-GATTAATITAGGGTTA __ IIIIiATTITCGATTGAGATGTATTTT
TATGTTTTGATTGATAAATGGGAATAA I I I I I AGTTTATTTAATTAACGAGTCTTGGTAATT
TTTGAAAACCGGIGTTGAGATATAGTTITGATTGGTTTTAGTTAATAGATTTTAGATTTATT
GATATAAGACI __ I Ii IGGGGTrATATGATCAAGTGAATAAGTGCAT (SEQ ID. NO. 1), such as at least 97,0%, at least 97,2%, at least 97,3%, at least 97,4%, at least 97,5%, at least 97,6%, such as at least 97,7%, at least 97,8%, at least 97,9%, at least 98%, at least 99%%, at least 100%, identical to said sequence.
The term "sequence identity" indicates a quantitative measure of the degree of homology between two amino acid sequences or between two nucleic acid sequences of equal length. If the two sequences to be compared are not of equal length, they must be aligned to give the best possible fit, allowing the insertion of gaps or, alternatively, truncation at the ends of the polypeptide sequences or nucleotide sequences. The sequence identity can be calculated as N-f , wherein Ndif is the total number of non-identical residues in the two sequences when aligned and wherein Nref is the number of residues in one of the sequences.
Hence, the DNA sequence AGTCAGTC will have a sequence identity of 75% with

11 the sequence AATCAATC (Ndif=2 and Nref=8). A gap is counted as non-identity of the specific residue(s), i.e. the DNA sequence AGTGTC will have a sequence identity of 75%
with the DNA sequence AGTCAGTC (Ndif=2 and Nref=8).
With respect all embodiments of the invention relating to nucleotide sequences, the percentage of sequence identity between one or more sequences may also be based on alignments using the clustalW
software (http:/www.ebi.ac.uk/clustalW/index.html) with default settings. For nucleotide sequence alignments these settings are: Alignment=3Dfull, Gap Open 10.00, Gap Ext.
0.20, Gap separation Dist. 4, DNA weight matrix: identity (IUB).
Alternatively, and as illustrated in the examples, nucleotide sequences may be analysed using programme DNASIS Max. This service is based on the two comparison algorithms called Smith-Waterman (SW) and ParAlign. The first algorithm was published by Smith and Waterman (1981) and is a well established method that finds the optimal local alignment of two sequences. The other algorithm, ParAlign, is a heuristic method for sequence alignment; details on the method is published in Rognes (2001). Default settings for score matrix and Gap penalties as well as E-values were used.
In further preferred embodiments of the present invention, said bacterium belonging to the Piscirickettsia genus is characterised by having an internal transcribed spacer region which comprises the sequence of SEQ ID NO: 1.
The bacterium belonging to the Piscirickettsia genus may be further characterised by having a 16S rRNA
gene which comprises a nucleic acid sequence which is at least 95,0% identical to the sequence of. SEQ
ID. NO. 2, such as at least 95,1%, at least 95,2%, at least 95,3%, at least 95,4%, at least 95,5%, at least 95,6%, such as at least 95,7%, at least 95,8%, at least 95,9%, at least 96%, at least 97%, at least 98%, at least 99%, or such as at least 99.5% identical to the sequence of SEQ ID.
NO. 2. In particular embodiments the 16S rRNA gene comprises a sequence which is identical to that of an isolate of obligate intracellular bacteria of the Piscirickettsia salmonis species. Accordingly, in an embodiment of the process according to the invention, said bacterium belonging to the Piscirickettsia genus may be further characterised by having a 16S rRNA

12 gene, which comprises the sequence ATCCATAGCTGGTTTGAGAGAATGGCCAGCCACACTGGGACTGAGACACGGCCCAGACT
CCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGGAACCCTGATCCAGCAAT
GCCACGTGTGTGAAGAAGGCCTTAGGGTIGTAAAGCAL I i I CAGCGGGGAGGAAGGTAA
GCTAATTAATACTTGGCTTAATTGACGTTACCTGCAGAAGAAGCACCGGCTAACTCCGTG
CCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAG
GGCGCGTAGGCGGAAGATTAAGTTGGATGTGAAATCCCAGGGCTCAACCTTGGAACTGC
ATCCGAAACTGGTATTCTAGAGTATGGTAGAGGAAAGTGGTTTCGCAGGTGTA (SEQ ID
NO: 2).
The sequences of the 16S rRNA of a bacterium belonging to the Piscirickettsia genus may be amplified in a nested PCR procedure using primers according to Mauel et al, 1996. These primers amplify a conserved region of the Piscirickettsia salmonis 16S rRNA gene. For amplification of a 283 base pair sequence from the ITS region, primers according to Marshall etal., 1998 are used.
Other specific genotypic characteristics comprise a Pulsed Field Gel Electrophoresis PFGE band pattern as shown in Figure 2 for isolate AL 10007 (accession number 06050902). Specific phenotypic characteristics comprise a band pattern similar to that seen with AL 10005 (accession number 06050901) when performing Western blotting with an anti-P.salmonis antibody.
In the presently most preferred embodiment(s), said bacteria belonging to the Piscirickettsia genus is any of the bacteria, which are deposited deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 9 june 2006 under the following accession numbers: 06050901 (isolate AL10005), 06050902 (isolate AL10007) and 06050903 (isolate AL10008) or the bacteria which are deposited on 21 March 2007 under the accession number 07032110 (isolate AL10014).
A bacterial stock suspension as described above provides a source of bacteria for the bacterial culture that is eventually established for production of the bacterium belonging to the Piscirickettsia genus. In the process of the present invention it may however be preferred to culture the bacteria of the stock suspension in one or more pre-cultures before eventually transferring the cells to the production

13 culture. In particular, this is relevant when production of the bacteria is performed in large scale, such as in industrial scale.
In further preferred embodiments relating to the process of the invention, the bacterium is propagated at a temperature of between 10 and 25 C, preferably at a temperature of between 12 and 23 C, more preferably of between 15 and 22 C, even more preferably of between 17 and 21 C, still more preferably of between 18 and 20 C and most preferably at a temperature of between 18.5 and 19.5 C.
In equally preferred embodiments, the bacterium is propagated at a pH of between 5.5 and 8.0, more preferably of between 5.7 and 7.0, even more preferably of between 5.9 and 6.8, still more preferably of between 6.1 and 6.6, and most preferably between 6.2 and 6.5.
It is contemplated that higher titres of bacteria may be obtained when the pH
in the culture is tightly controlled. Suitable means for controlling the pH include automatic addition of acid or base or Na2HCO3 and CO2.
Various different culture media may be used in the process according to the invention, including many commercially available media. For industrial scale production of the bacteria belonging to the Piscirikettsia genus it will in most cases be desirable to optimise the process to give a maximum output and for this and other purposes, it may be preferred to culture the bacteria in a nutrition rich medium.
More specifically, it may be preferred that the medium contains one or more compounds selected from the group consisting of proteins, amino acids, carbohydrates, fatty acids, lipids and micronutrients.
In further preferred embodiments the medium is a medium for insect cells; in the currently medium as described by Godwin and Whitford, 1993. Alternatively the Sf-900 III medium may be used. As of present, both media are commercially available from Invitrogen.
In specific embodiments of the invention the process comprises the steps of:
a) inoculating a first pre-culture with a working seed suspension or stock suspension of a bacterium belonging to the Piscirickettsia genus and

14 culturing the bacterium under the above-mentioned conditions until reaching an optical density (0.D.600,m) of at least 0.7, such as at least 0.8, such as at least 0.9 such as at least 1, such as at least 2, such as at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7, such as at least 8, such as at least 9 or such as at least 10;
b) transferring a suspension of the bacterium to a second pre-culture and culturing the bacterium under the above-mentioned conditions until reaching an optical density(O.D.60onm) of at least 0.7, such as at least 0.8 such as at least 0.9 such as at least 1, such as at least 2, such as at least 3, such as at least 4, such as at least 5, such as at least 6, such as at least 7, such as at least 8, such as at least 9 or such as at least 10;
c) transferring a suspension of the bacterium to a production culture, culturing the bacterium until reaching an optical density (0.a600nm) of minimum 3; and harvesting the bacterium.
In preferred embodiments, the bacterial cells are harvested from the production culture after incubation for a period of 2-8 days, such as from 3-7 days or such as from 4-6 days, when an optical density (0.D.600nm) of from 4-20 is reached, such as when an optical density of from 5-

15 is reached, when an optical density of from 6-13 is reached, when an optical density of from 6-14 is reached or preferably when an optical density of from 6-15 is reached.
In equally preferred embodiments the invention provides a process, wherein a) said first pre-culture is inoculated with a volume of stock suspension corresponding to 0.1% or more (preferably 0.25 to 4%, more preferably 0.5 to 2%) of the volume of medium in said first pre-culture; and/or b) said second pre-culture is inoculated with a volume of first pre-culture corresponding to 0.1%
or more (preferably 0.25 to 4%, more preferably 0.5 to 2%) of medium in said second pre-culture in order to obtain a production culture; and/or c) said production culture is inoculated with a volume of said second pre-culture corresponding to 0.1% or more (preferably 0.25 to 4%, more preferably 0.5 to 2%) of medium volume in said production culture.

To the person of skills within the field of bacterial fermentation it will be apparent that the process of the present invention may be performed by culturing the bacterium by batch fermentation, by fed-batch fermentation as well as by continuous fermentation. At present batch fermentation is preferred, also when using the process of the invention for culturing a bacterium of the Piscirickettsia genus at industrial scale.
At present, a batch volume of 100 ¨ 5000 litres of medium is contemplated.
Preferred batch sizes are from 200 ¨ 4000 litres of medium, such as from 300 ¨ 3000 litre of medium, or such as from 450 ¨ 2000 litres of medium.
In a second main aspect the present invention provides a process for producing a vaccine comprising one or more steps of culturing a bacterium of the Piscirickettsia genus, wherein the bacterium is propagated or cultured in a substantially extracellular environment. It is to be understood that the process for producing a vaccine may be characterised by any of the features described above in relation to the process for culturing a bacterium belonging to the Piscirickettsia genus.
The process for producing a vaccine may further comprise steps of harvesting the bacterium from the culture medium as well as steps of concentrating and/or disrupting, and inactivating the bacterium.
It will be known to the skilled person that inactivated bacteria can be attained in general by chemical or by physical means. Chemical inactivation can be carried out by treatment of the bacteria for example, but not limited to, with enzymes, with formaldehyde, beta-propiolactone, or ethyleneimine or derivative thereof, with organic solvents (e.g. TritonTm or TweenTm). Physiochemical inactivation can advantageously be carried out by subjecting the bacteria to energy-rich radiation, such as UV
light, gamma irradiation or X-rays. If necessary the inactivation agent can be neutralized; for example formaldehyde-inactivated preparations can be neutralized with thiosulphate. If required, the pH is subsequently returned to about 7.
Inactivation of bacteria by means of physical stress, using e.g. heat or a French Press, provides a suitable starting material for the manufacturing of a vaccine. Thus, a bacterin need not necessarily be in the form of inactivated whole cells; the cells may be disrupted.
=

16 In certain embodiments the process may include a step of attenuating the bacterium. Thus, in some embodiments according to the invention the bacteria have been attenuated. Several approaches for obtaining attenuated bacteria are available to the skilled person. An attenuated strain of a bacteria belonging to the Piscirickettsia genus may be generated for instance by passing the bacteria through culture a number of times, or deleting or mutating a gene involved in a biosynthetic pathway.
In preferred embodiments of the invention the step for concentrating the bacterium comprises the use of filtration techniques selected from the group consisting of: continuous cross flow filtration, diafiltration, centrifugation, or any combination hereof.
In further preferred embodiments relating to the process for producing a vaccine, a concentration factor is obtained that is larger than 0 and less than or equal to 12, such as from 1.2 to 11, from 1.4 to 10, from 1.6 to 9, from 1.8 to 8, from 2 to 7, from 2.25 to 6, from 2.5 to 5, or such as from 2.75 to 4. In a presently preferred embodiment, the concentration factor for a suspension of inactivated bacteria belonging to the Piscirickettsia genus is 2-6. The concentration factor is calculated from the total amount of antigen suspension fed to the system, divided on the product recovery including hold-up volume in the filtration unit. The "hold-up volume" is the volume of concentrate of bacteria belonging to the Piscirickettsia genus remaining in the filtration unit after collection of the concentrate.
While the vaccine may be based for instance on whole bacteria as described above it may according to some embodiments relating to the invention be preferred to develop a vaccine based on subunits of the bacterium of the Piscirickettsia genus.
Therefore, in some embodiments, the process comprises one or more steps for isolation and/or purification of a subunit the bacteria.
In the context of the present invention the term "subunit" refers to any component of the bacteria which alone or in combination with others is capable of eliciting an immune response. In the present context particularly suitable subunits are those that are capable of eliciting a protective immune response.
Particular examples of subunits that may be suitable in the present context are

17 lipopolysaccarides, proteins or peptides which are able to elicit an antibody response in fish, mice or rabbits.
In the present context, the expression a "protective immune response" refers to an immune response which results in a relative percent survival of vaccinated fish of at least 20. The relative percent survival, {1- (% mortalities in vaccinated group/% mortalities in control group)}*100, may be determined in experiments wherein a group of at least 20 fish of a relevant species is immunized intraperitoneally with 0.05 ¨ 0.5 ml of an antigen preparation and compared to a group of fish which have received phosphate buffered saline (PBS). The fish are challenged intraperitoneally after 350-600 degree days with an appropriate amount of bacteria belonging to the Piscirickettsia genus, such as 1,33 x 104 TCID50 Piscirickettsia salmonis isolate AL10007. The bacteria are titrated by end point dilution by the method of Karber (1931).
The appropriate dose must be determined for each experiment by doing a pre challenge of the same stock of fish with dilutions of challenge material. The fish are followed for 30-40 days, and the number of mortalities in each group recorded The skilled person will be aware of the suitable means and measures for purification of subunits of interest. In particular embodiments of the invention the subunit is isolated or purified in a process comprising one or more steps of chromatography, in particular one or more steps of affinity chromatography. In general, a lot of guidance is provided to the skilled person by publications in the field on how to develop and perform chromatographic purification of the relevant substances. In particular the skilled person may consult publications such as "Protein purification methods; a practical approach" Eds. ELV Harris and S Angal, published in the Practical Approach Series, series editors D
Rickwood & BD Hames, IRL Press, Oxford 1989, and "Affinity Chromatography;
Principles and Methods, Edition AB, Published by Amersham Pharmacia Biotech.
A third main aspect of the present invention pertains to a process for obtaining a bacterium belonging to the Piscirickettsia genus. In general the process involves culturing a bacterium belonging to the Piscirickettsia genus under conditions that favour bacteria which are capable of growing substantially in the absence of cells of non-bacterial origin as explained above. In preferred embodiments, said

18 process for obtaining a bacterium belonging to the Piscirickettsia genus comprises the steps of:
a) providing a sample from a fish, which is infected with bacteria belonging to the Piscirickettsia genus;
b) inoculating into an essentially cell free culture medium bacteria from said sample or dilution series hereof, or bacteria from a spread plate culture on a Cystein Heart Agar supplemented with 5% sheep blood, established from said sample of step (a) or dilution series hereof; and c) selecting a bacterium that propagate freely in the culture medium.
In the present context the term "essentially cell free culture medium" refers to a culture medium comprising at the most 105 cells of non-bacterial origin/m1 culture medium, such as at the most 2 x 105, such as at the most 3 x 105, at the most x 105, at the most 5 x 105, at the most, 6 x 105, at the most 7 x 105, at the most 8 x 105, at the most 9 x 105, or such as in the presence of at the most 1 x cells of non-bacterial origin/nil culture medium. It will be understood that an "essentially cell free medium" will support growth of a bacterium belonging to the Piscirickettsia genus to the desired titres in a "substantially extracellular environment" and "substantially in the absence of cells of non-bacterial origin" as herein before defined.
It is a further characteristic of the process that said sample may be taken from a body tissue, a body fluid, a secretion or from a tissue homogenate.
A further aspect of the invention pertains to a bacterium of the Piscirickettsia genus, said bacterium having the ability to propagate in a substantially extracellular environment.
In the present context the term "ability to propagate in a substantially extracellular environment" means that the bacteria will grow in a suitable culture medium ¨ as for instance the Sf-900 II SFM medium with no supplements. It is to be understood that the bacteria will grow to a titre of at least 1 x 104, at least 5 x 104, at least 1 x 105, at leats 5 x 105, at least 1 x 106, at least 5 x 106, at least 1 x 107, at least 5 x 107, at least 1 x 108, least 5 x 108, least 1 x 109, at least 2 x 109, at least 3 x 109, at least 4 x 109, at least 5 x 109, at least 6 x 109, at least 7

19 X 109, at least 8 x 109, at least 9 x 109, at least 1 x 1010 in a culture without cells of non-bacterial origin, established by inoculating a volume of a stock solution corresponding preferably to 0.25 to 4%, more preferably 0.5 to 2%, most preferably 0.1%) of the of the final volume of medium in said first culture and having an optical density of between 2.5 and 3.5, such as an optical density of 2.8 or 2.9. For this purpose the bacteria may be cultured for in ventilated spinner flasks at between 50 and 500 RPM and a temperature of 18.5 to 19.50C for a period of from 1-10 days, such as from 1 to 8 days, such as from 2 to 5 days, such as from 2 to 4 days, such as from 2 to 3 days.
In preferred embodiments of the invention the bacterium is one that is obtainable by a process as described above. In particular the bacterium is obtainable by a process comprising the steps of:
a) providing a sample from a fish, which is infected with bacteria belonging to the Piscirickettsia genus;
b) inoculating into a culture medium, which is preferably essentially cell free, bacteria from said sample or dilution series hereof, or bacteria from a spread plate culture established from said sample or dilution series hereof;
and c) selecting bacteria that propagate freely in the medium.
In further embodiments of the invention the bacterium is one which is in fact obtained by a process as described above.
In preferred embodiments of this aspect the bacterium is one which is capable of introducing the above-described symptoms and disease of piscirickettsiosis, and wherein said bacteria have genotypic and/or phenotypic characteristics related to those of the above mentioned deposited isolates.
Use of sequences of genes encoding ribosomal RNAs and the internal transcribed spacers for characterisation of the bacterium according to the invention has been explained above. Accordingly, for the present aspect of the invention it may be preferred that the bacterium belonging to the Piscirickettsia genus is characterised by having an internal transcribed spacer region which comprises a nucleic acid sequence which is more than 95% identical to the sequence of SEQ ID. NO. 1.

In further specific embodiments said bacterium belonging to the Piscirickettsia genus is characterised by having an internal transcribed spacer region which comprises a nucleic acid sequence which is at least 95,0% identical to the sequence of SEQ ID. NO. 1, such as at least 95,1%, at least 95,2%, at least 95,3%, at least 95,4%, at least 95,5%, at least 95,6%, such as at least 95,7%, at least 95,8%, at least 95,9%, at least 96%, at least 97%, at least 98%, at least 99%, or such as at least 90.5% identical to the sequence of SEQ ID. NO. 1.
In further preferred embodiments said bacterium may be characterised by having an internal transcribed spacer region which comprises the sequence of SEQ ID NO: 1.
Additionally, said bacterium belonging to the Piscirickettsia genus is characterised by having a 16S rRNA
gene which comprises a nucleic acid sequence which is at least 95,0% identical to the sequence of SEQ
ID. NO. 2, such as at least 95,1%, at least 95,2%, at least 95,3%, at least 95,4%, at least 95,5%, at least 95,6%, such as at least 95,7%, at least 95,8%, at least 95,9%, at least 96%, at least 97%, at least 98%, at least 99%, or such as at least 99.5% identical to the sequence of SEQ ID.
NO. 2.
In further specific embodiments said bacterium may be characterised by having a 16S rRNA gene, which comprises the sequence of SEQ ID NO: 2.
In the currently most preferred embodiment of this aspect of the invention the bacterium is any of the representative isolates that have been deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Potion Down, Salisbury, Wiltshire (UK), SP4 OJG UK
on the 9 june 2006 under the following accession numbers: 06050901 (isolate AL10005), 06050902 (isolate AL10007) and 06050903 (isolate AL10008), or the isolate which has been deposited on 21 March 2007 under the accession number 07032110 (isolate AL10014).
Yet another main aspect of the invention pertains to a vaccine comprising a bacterium of the invention or a subunit of the bacterium. Within the scope of this aspect are vaccines based on concentrated and/or disrupted and/or inactivated bacteria. In certain aspects the vaccine may be based on attenuated bacteria.

In further preferred embodiments, the vaccine comprises an amount of antigen, which is higher than 0.05 mg/ml, such as from 0.05 to 5 mg/ml, from 0.1 to 4.5 mg/ml, from 0.2 to 4 mg/ml, from 0.3 to 3.5 mg/ml, from 0.4 to 3 mg/ml, from 0.4 to 3 mg/ml, from 0.5 to 2.5 mg/ml, from 0.6 to 2 mg/ml, from 0.7 to 1.5 mg/ml, or such as from 0.8 to 1 mg/ml.
In further preferred embodiments the vaccine is in a formulation comprising an adjuvant. Examples of adjuvants frequently used in fish and shellfish farming are muramyldipeptides, lipopolysaccharides, several glucans and glycans, mineral oil and Carbopoi . An extensive overview of adjuvants suitable for fish and shellfish vaccines is given in the review paper by Jan Raa (1996).
The vaccine of the invention may further comprise a suitable pharmaceutical carrier. In a currently preferred embodiment the vaccine is formulated as an emulsion of water in oil.
The vaccine may also comprise a so-called "vehicle". A vehicle is a device to which the antigen adheres, without being covalently bound to it. Such vehicles are i.a. biodegradable nano/micro-particles or ¨capsules of PLGA
(poly-lactide-co-glycolic acid), alginate or chitosan, liposomes, niosomes, micelles, multiple emulsions and macrosols, all known in the art. A special form of such a vehicle, in which the antigen is partially embedded in the vehicle, is the so-called ISCOM (European patents EP 109.942, EP 180.564 and EP
242.380.
In addition, the vaccine may comprise one or more suitable surface-active compounds or emulsifiers, e.g.
Cremophore, Tween and Span . Also adjuvants such as interleukin, CpG and glycoproteins may be used.
It is to be understood that the vaccine may further be in a formulation comprising an antigen from a bacterial source other than a bacterium of the Piscirickettsia genus, an antigenic material obtained from a viral source, an antigenic material obtained from a parasitical source, and/or an antigenic material obtained from a fungal source.
In particular embodiments of the invention said antigen from a bacterial source other than bacterium of the Piscirickettsias genus is selected from the group consisting of live, attenuated or killed bacteria of the species, but not limiting to, Aeromonas sp, Vibrio sp. Listonella sp., Moritella viscosa, Photobacterium damsela, Flavobacterium sp., Yersinia sp. Renibacterium sp. Streptococcus sp., Lactococcus sp., Leuconostoc sp., Bifidobacterium sp., Pediococcus sp., Brevibacterium sp., Edwarsiella sp. Francisella sp. Pseudomonas sp., Cytophaga sp., Nocardia sp., Mycobacerium sp., subunits of these bacteria, and any combination hereof.
Other specific embodiments pertain to a vaccine, wherein the antigenic material obtained from a viral source contained within the formulation is selected from the group consisting of Glycoprotein of Viral Hemorrhagic Septicemia Virus (VHSV);
nucleoprotein of Viral Hemorrhagic Septicemia Virus (VHSV); glycoprotein of Infectious Hematopoietic Necrosis virus (IHNV); inactivated Pancreatc Necrosis Virus; VP1, VP2, VP3 or nucleoprotein structural proteins of Infectious Pancreatic Necrosis Virus (IPNV); G protein of Spring Viremia of Carp (SVC); and a membrane-associated protein, tegunnin or capsid protein or glycoprotein of Channel Catfish Virus (CCV); and antigenic material obtained from ISA virus.
Further embodiments pertain to a vaccine, wherein said viral source is selected from the group consisting of pancreatic disease virus (SPDV), Iridovirus, Infectious Salmon Anaemia virus (ISAV), and heart and skeletal muscle inflammation virus.
In preferred embodiments said parasitic source is selected from the group consisting of Lepeophtheirus Sp., Caligus Sp., and khthyophthirius Sp.
In other preferred embodiments the vaccine comprises an antigenic material obtained from a fungal source wherein said fungal source is selected from the group consisting of Saprolegnia Sp., Branchiomyces sanguinis, Branchiomyces demigrans and kthyophonus hoferi.
In a presently most preferred embodiment the vaccine comprises antigenic amterial from Vibrio ordalii and Infectious Pancreatic Necrosis virus.
The vaccine according to the invention may in particular be formulated for administration to a fin fish. More specifically the vaccine may be (formulated) for administration to a telostei. The teleostei include, but are not limited to salmonids, basses, breams, cods, snappers, flatfish, catfish, yellowtails and tilapias.
In further embodiments of the invention the vaccine is formulated for administration by a route selected from the group consisting of: Bath, immersion, intraperitoneal injection, intramuscular injection and oral administration.
Optionally, the vaccine would be administered to young fish in the fresh-water stage..
In preferred embodiments of the invention the vaccine is one that is obtainable or one that is actually obtained by a process as described above.
In a further aspect, the present invention provides a feed comprising the vaccine according to the invention, said feed may for example be pelleted or extruded feed.
Further aspects of the invention pertain to a bacterium according to the invention or a subunit hereof for use in veterinary medicine.
Other aspects pertain to a bacterium according to the invention or a subunit of said bacteria in the manufacture of a medicament for the prevention of infections with bacteria of the Piscirickettsia genus. In particular a medicament comprising a bacterium according to the invention or a subunit hereof is relevant for the prevention of infections with Piscirickettsia salmonis or other species of the Piscirickettsia genus, hereunder for the prevention of piscirickettsiosis.
Finally, other aspects of the invention pertain to a method for prevention of infections in fish with bacteria of the Piscirickettsia genus, said method comprising administering to the fish a vaccine according to the invention.
With respect to the above description of the various aspects of the present invention and of the specific embodiments of these aspects it should be understood that any feature and characteristic described or mentioned above in connection with one aspect and/or one embodiment of an aspect of the invention also apply by analogy to any or all other aspects and/or embodiments of the invention described.

When an object according to the present invention or one of its features or characteristics is referred to in singular this also refers to the object or its features or characteristics in plural. As an example, when referring to "a vaccine" It is to be understood as referring also to one or more vaccines.
Throughout the present specification the word "comprise", or variations such as "comprises" or "comprising", will be understood to imply the inclusion of a stated element, integer or step, or group of elements, integers or steps, but not the exclusion of any other element, integer or step, or group of elements, integers or Steps.
The scope of the claims should not be limited by the preferred embodiments set forth in the examples, but should be given the broadest interpretation consistent with the description as a whole. The following examples are offered by way of illustration and are not intended to limit the invention in any way.
The invention will now be described in further details in the following non-limiting examples and figure 1 to 4.
BRIEF DESCRIPTION OF THE DRAWINGS
Figure 1: Data from experiment conducted to reveal the ability of P. salmonis to grow on traditional bacterial media.
Figure 2: Pulsed Field Electrophoresis gel showing a band pattern of the AL
10005 isolate of P. salmonis.
Figure 3: 00600 nm values for fermentation with and without pH control collected from experiments conducted in order to investigate if the use of controlled pH batch fermentation would increase the production of P. salmonis, Figure 4: Cumulative /ci mortality of fish Injected either with PBS or with a vaccine containing inactivated Pisdric.kettsia salmonis cultured by the method according to the invention.

EXAMPLES
5 Example 1. Isolation of P. salmonis from fish without the use of host cells.
Liver samples from moribund Atlantic salmon diagnosed with P. salmonis were aseptically removed and homogenised. The homogenate was diluted in SF900II
10 cell culturing medium and centrifuged at 2000 x g to remove liver tissue.
The clarified homogenate was inoculated in a dilution series in SF900II medium and incubated as static cultures at 18 degrees C. Bacterial growth could be observed within a few days. The bacterial suspension was identified to be P. salmonis by imnnunoflourescens microscopy using monoclonal antibodies as described in 15 example 2.
Example 2. Identification of P. salmonis isolate.
The bacterial isolate was verified to be P. salmonis using a commercial kit "SRS

20 Fluorotest Directo" from Bios Chile, Chile. The kit is based on FITC-conjugated monoclonal antibodies against P salmonis. Positive controls were slides with P.
salmonis, fixed in methanol/acetone and frozen at -20 C. Negative controls were slides with Aeromonas salmonicida, fixed in methanol/acetone and frozen at -20 C. Positive samples were observed as containing spherical fluorescent bacteria 25 when viewed in a fluorescence microscope set at the appropriate wavelength.
Example 3: Propagation of P. salmonis without host cells.
Example 3 illustrates multiple passages of P. salmonis in spinner flasks, without the presence of host cells initiated from a frozen stock.
All the bacterial cultures were grown in SF900II media from Invitrogen with no supplements. The cultures were cultivated in ventilated spinner flasks at 75 rpm and 20 degrees C. The growth was monitored by 0D600 nm measurement and titration according to K rber, 1931 of the cultures.
The results shown in Table 1 clearly demonstrate the ability of P. salmon's to replicate without the presence of host cells. After approximately 6 days post resuscitation the bacteria reaches a typical growth pattern, and was sub cultured every 3-5th day. Maximum 0D600 values of more than 7 were reached within 4-5 days.
Table 1. Passage of P. sal in spinner flasks without Sf-9 cells in SF-900 II
medium Passage Days Inoculum, OD Titre p.i.
1st 0 1%
6 2.9 2nd 0 1% (OD 2.9) 2 1.1 4.22 x 109 3 2.4 3.83 x 109 3rd 0 1% (OD 2.4) 3 4.5 3.16 x 1019 4 7.1 2.15 x 1019 5 7.8 2.37 x 109 7 7.4 4th 0 1% (OD 4.5) 1 0.5 2 1.9 4.64 x 109 3 4,3 1.10 x 1019 4 7.2 1.47 x 1019 5th 0 2 1% (OD 1.9) 1.5 4.22 x 109 5 6.2 4.22 x 109 6th 0 _______ 1% (OD 1.5) 3 4.4 2.87 x 1010 7.8 7th 0 1% (OD 4.4) 2 2.0 8.25 x 108 8th 0 1% (OD 2.0) 2 2.6 1.62 x 1010 Example 4: Growth of P. salmonis in different media 5 This experiment was conducted to reveal the ability of P. salmonis to grow on traditional bacterial media. Shaker flasks with different media compositions were prepared according to Table 2. The flasks were inoculated 1:100 with passage 2 P.
salmonis from a spinner flask. The cultures were incubated at 20 degrees C and with 100 rpm. 0D600 was measured daily. The results, which are presented in Figure 1, demonstrate that P. salmonis has the ability to replicate using tradition&
bacterial media, but the bacterial yield is higher when SF900II insect cell media is used.
Table 2: Medium composition Gram/litre Yeast Extract 15 15 15 15 Casein 5 5 5 5 MgSO4x 7H20 0,4 0,4 0,4 0,4 NaCI 10 10 10 10 KCI 0,8 0,8 0,8 0,8 K2HPO4 0,3 0,3 0,3 0,3 Glyserol 85 % 10 Sucrose 10 5 Maltose 10 5 SF900II 50 ml pH adjusted to 6.2 6.2 6.2 6.2 -Growth OD
Start OD
Day 3, 0,62 0,13 0,15 0,30 0,29 Day 4, 2,09 0,84 0,61 1,85 1,95 Day 5, 2,50 2,16 2,19 2,24 2,34 Day 6, 2,85 4,16 2,60 2,58 2,61 Day 7, 2,82 5,72 2,74 2,28 2,53 Example 5: 16S rRNA and ITS gene analysis, Pulsed field Gel Electrophoresis (PFGE) analysis of Piscirickettsia salmonis Objective:
To analyse parts of both the spacer region between the 16S and 235 genes (internal transcribed spacer, ITS) and the 16S rRNA gene to be able to differentiate between species.
Method:
DNA was isolated from P.salmonis isolate AL10005, corresponding to the isolate deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 OJG UK on the 9 june 2006 under the accession number 06050901 (grown with and without Sf-9 cells), and isolate LF-89 (ATCC VR1361).
Primers were chosen to amplify parts of the 16S gene and the ITS using PCR.
The PCR products were then sent for sequencing for comparison with known sequences in a gene bank.

16S rRNA:
Universal bacterial 16S primers were used in a first PCR, and then specific P.salmonis primers were used in a nested PCR to amplify a 467hp PCR product of the 16S rRNA gene according to Mauel, 1996.
ITS:
Specific P. salmonis primers were used to amplify a 236bp PCR product according to Marshall et al, 1998 The PCR products were sent to GATC Biotech for sequencing. The sequences were analysed using programme DNASIS Max. This service is based on the two comparison algorithms called Smith-Waterman (SW) and ParAlign. The first algorithm was published by Smith and Waterman (1981) and is a well established method that finds the optimal local alignment of two sequences The other algorithm, ParAlign, is a heuristic method for sequence alignment; details on the method is published in Rognes (2001). Default settings for score matrix and Gap penalties as well as E-values were used.
Result:
= 16S rRNA from AL10005 grown in Sf-9 cells:
ATCCATAGCTGGTTTGAGAGAATGGCCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG
GAGGCAGCAGTGGGGAATATTGGACAATGGGGGAAACCCTGATCCAGCAATGCCACGTGTGTGAAG
AAGGCCTTAGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGTAAGCTAATTAATACTTGGCTTAATT
GACGTTACCTGCAGAAGAAGCACCGGCTAACTCCGTGCCAGCAGCCGCGGTAATACGGAGGGTGC
GAGCGTTAATCGGAATTACTGGGCGTAAAGGGCGCGTAGGCGGAAGATTAAGTTGGATGTGAAATC
CCAGGGCTCAACCTTGGAACTGCATCCGAAACTGGTATTCTAGAGTATGGTAGAGGAAAGTGGTTTC
GCAGGTG (SEQ ID NO. 2) = 16S rRNA from AL10005 grown without cells:
ATCCATAGCTGGTTTGAGAGAATGGCCAGCCACACTGGGACTGAGACACGGCCCAGACTCCTACGG
GAGGCAGCAGTGGGGAATATTGGACAATGGGGGGAACCCTGATCCAGCAATGCCACGTGTGTGAA
GAAGGCCTTAGGGTTGTAAAGCACTTTCAGCGGGGAGGAAGGTAA

GCTAATTAATACTIGGCTTAATTGACGTTACCTGCAGAAGAAGCACCGGCTAACTCCGTG
CCAGCAGCCGCGGTAATACGGAGGGTGCGAGCGTTAATCGGAATTACTGGGCGTAAAG
GGCGCGTAGGCGGAAGATTAAGTTGGATGTGAAATCCCAGGGCTCAACCTTGGAACTGC
ATCCGAAACTGGTATTCTAGAGTATGGTAGAGGAAAGTGGMCGCAGGTGTA (SEQ ID
5 NO. 2) = 16S rRNA from LF-89:
The sequence deposited in PubMed for the 16S rRNA gene of LF-89 (accession number U36941) was used for comparison with AL10005. Analysing the 16S rRNA
10 sequences in Paralign show that these sequences match the LF89 16S rRNA
gene between base pair 275 and 667, and the homology is 100%. The match with the EM-90 16S rRNA gene (accession number U36940) was 97%.
= ITS from AL10005 grown in Sf-9 cells:

TATGTTITGATTGATAAATGGGAATAATTITTAGTTTATTTAATTAACGAGTCTIGGTAATT
TTTGAAAACCGGTGTTGAGATATAGTTTTGATTGGTTTTAGTTAATAGATITTAGATTTATT
GATATAAGACTTTTTGGGGTTATATGATCAAGTGAATAAGTGCAT (SEQ ID NO. 1) 20 = ITS from AL10005 grown without cells:
GTATAAGTAAAGATTCCTTGATTAATTTAGGGTTAIIIIIATTTTCGATTGAGATGTATTTT
TATGTTTTGATTGATAAATGGGAATAATTITTAGTTTATTTAATTAACGAGTCTIGGTAATT
TTTGAAAACCGGTGTTGAGATATAGTTTTGATTGGTTTTAGTTAATAGATITTAGATTTATT
GATATAAGAC __ I I I I I GGGGTTATATGATCAAGTGAATAAGTGCAT (SEQ ID NO. 1) = ITS from LF89 grown in CHSE cells:
TTTAGGGTTAiiiiiAGtttacgttgagatgTAiiiiiATGTCTTGATTGATTATTAGAAATAATT
TTTAGTTTATTTAATTAACGAGTCTIGGTAAiiiiIGAAAACCGGTGTTGAGATATAGTTTT
GATTGGTATTAGTTAATAGATTITAGATTTATTGATATAAGACIiiiiGGGGTTATATGATC
AAGTGAATAAGTGCa (SEQ ID NO. 3) Comparison of the LF89 sequence with the AL10005 sequence show a 95%
homology. Comparison with the Chilean isolate EM-90 ITS (accession nr U36944) show a 100% homology between EM-90 ITS and AL 10005 ITS.

Conclusion This shows that Piscirickettsia salmonis isolates able to grow without the support of eukaryotic cells can be as little as 95% similar to the type strain LF-89.
PFGE analysis Preparation of chromosomal DNA plugs and pulse field gel electrophoresis (PFGE).
P.salmonis, strain AL 10007, was cultured in Sf 900-11 medium. Bacterial culture was concentrated by centrifugation (4000 x g, 10 min, 4 C), re-suspended and diluted in Cell Suspension Buffer (1M Tris, 0,5M EDTA, pH= 8.0). 25 pl Proteinase K (20 mg/ml) were added to 0, 5 ml cell suspension. Cells were embedded into 0.5 % agarose plugs by mixing the suspension 1:1 (v/v) with SeaKem Gold agarose (1 % in (w/v) in TE [1M Tris, 0,5M EDTA, pH= 8.0] ) and 5 % sodium dodecyl sulphate (20%).
The plugs were treated with lysis buffer (1M Tris, 0,5M EDTA, pH= 8.0) and 0, % Proteinase K (20 mg/ml) at 54 C for 2 hours. The plugs were washed two times with purified water for 10 minutes at 50 C and two times with TE buffer for 15 minutes at 50 C. Barn I, Xho I, Xba I, Ecori I, Age I, Mlu I, Rsr II, Sma I, Nc0 I, Sac II, Kpn I, Afl III were used for restriction endonuclease digestion in accordance with the instructions of the manufacturers. The fragments were resolved by PFGE in SeaKem Gold agarose (1%) by using the CHEF Mapper XA
system (Bio-Rad). The following parameters were used: running time 24 h;
temperature, 14 C; Voltage gradient, 6.0 V/cm, included angle, 120 ; an initial pulse time of 0.1 s and a final pulse time of 15 s. The gel was stained with ethidium bromide (0.1p1/m1) for 30 min, distained in distilled water for 3x 30 minutes and photographed under UV light.
Results A photo of the PFGE gel is shown in figure 2.
Lanes:
Lan 1 2 3 4 5 6 7 8 9 10 11 12 13 14 e Enz ma Bann Xh Xb Eco Ag MI Rsr Sm Nc Sac Kp Afl mar yme rke HI oI a RI el uI II al oI II nI III ker Lane 8 and 9 where DNA from AL 10007 is treated with enzymes Rsr I or Sma I
displays how a PFGE band pattern from Piscirickettsia sp able to grow without the support of eukaryotic cells may appear.
Example 6: Fermentor culture In order to investigate if the use of controlled pH batch fermentation would increase the production of P. salmonis, fermentation with and without pH
control was initiated. 0D600 nm was used to follow the production of bacteria and total protein was used to determined the final concentration of the cultures. The cultures were grown using SF900II media with no supplements in a lab scale fernnentor with 1.51 working volume. The temperature was 20 degrees C.
Stirring speed was kept between 100-400 rpm with aeration.
The pH was maintained using automatically addition of Sodium Hydroxide or Phosphoric acid.
The results from this experiment are presented in Figure 3 which clearly demonstrates that the bacterial yields are increased when cultured in a batch fermentor with a stabile pH of 6.5. Maximum 0D600 values of more than 13 were reached within 5 days of cultivation.
Example 7: Detailed description of each step in the production process for Piscirickettsia salmonis without the support of eukaryotic cells.
P.sal.-01: Pre-culture no. 1 A flask containing 50-125 ml medium is inoculated with Working Seed suspension at a ratio of 0.5-2% of medium volume. The flask is incubated at a temperature of 19 2 C

for 4-7 days or longer. The Optical Density (0D600nm) of the culture at the moment of harvest will be at least 1.
The culture is transferred aseptically to the seed fermenter.
P.sal.-02: Pre-culture no. 2 A fermenter containing 7-9 litres of medium is inoculated with a suspension of pre-culture no. 1 at a ratio of 0.5-2% of medium volume. The culture is incubated at a temperature of 19 2 C for a period of 2-4 days or longer until the culture has an Optical Density (0D600nm) of at leastl.
During fermentation pH is adjusted to 6.2-6.5 with sodium hydroxide or phosphoric acid. Polypropylene glycol solution or 10% Pluronic (Polyoxyethylene-polyoxypropylene Block Copolymer) solution is added automatically to control foaming.
The culture is transferred aseptically to the main fermenter.
P.sal.-03: Production culture A fermenter containing 450 - 2000 litres of medium is inoculated with a suspension of pre-culture no. 2 at a ratio of 0.5-2% of medium volume. The culture is incubated at a temperature of 19 2 C. At regular intervals samples are taken to ensure that the culture is harvested in the logarithmic phase of the growth curve. The Optical Density (0D600,,,, ) of the culture at the moment of harvest will be between 6-14. This value is normally obtained after incubation for 3-6 days.
During fermentation pH is adjusted to 6.2-6.5 with sodium hydroxide or phosphoric acid. Polypropylene glycol solution or 10% Pluronic (Polyoxyethylene-polyoxypropylene Block Copolymer) is added automatically to control foaming.

The bacterial suspension is immediately inactivated.
P.sal.-04: Inactivation Formaldehyde solution (35 per cent) is added to the culture to a final concentration of 0.2% formaldehyde. The inactivant is thoroughly mixed with the bacterial suspension, which is then immediately transferred aseptically to the sterile inactivation tank. The culture is kept at a temperature of 19 2 C during a period of 90 minutes under continuous agitation.
The inactivated bacterial suspension is transferred aseptically to the holding tank where the suspension is cooled.
P.sal.-05: Concentration The inactivated P. salmonis suspension is concentrated by continuous cross flow filtration followed by diafiltration, using microfilters with a pore size of 0.2 urn.
During the processing all solutions in and out of the system are monitored by weight. The control of this mass balance ensures that the required concentration factor is achieved.
During the diafiltration (2-3 x with PBS) the ingredients of the growth medium is partly substituted PBS.
The consistency is assured by the total protein measurement after concentration. This total protein is used to calculate the exact amount of concentrated antigen to be used in the vaccine.
Example 8: Immunisation of fish, and challenge with Piscirickettsia salmonis, Vaccines Piscirickettsia salmonis, isolate AL 10015 was grown in Sf900 II medium to an OD
of 12.7 and inactivated with formalin. After inactivation, the antigen was diafiltrated and concentrated against PBS, resulting in an antigen solution with a protein content of 17.9 mg/ml. The antigen was formulated in mineral oil together 5 with inactivated Vibrio ordalii and Infectious Pancreatic Necrosis virus.
The Piscirickettsia salmonis antigen dose was 2.2 mg/ml vaccine.
Vaccination and challenge trial Groups of 50 fish with an average weight of 34.6 grams were immunized 10 intraperitoneally with a vaccine containing inactivated Piscirickettsia salmonis, Vibrio ordalii and Infectious Pancreatic Necrosis virus or phosphate buffered saline (PBS). The fish were kept at 12 C and challenged intraperitoneally after 45 days with 1,33 x 104 TCID50 Piscirickettsia salmonis, isolate AL10007. The fish were followed for 42 days, and the number of mortalities in each group recorded.
Results Figure 4 shows the cumulative % mortality of fish injected either with PBS or with a vaccine containing inactivated Piscirickettsia salmonis grown as described.
The antigen was concentrated In the control group, 77.1% of the fish died, while 27.6 % of the fish died in the group vaccinated with a vaccine containing inactivated Piscirickettsia salmonis, Vibrio ordalii and Infectious Pancreatic Necrosis virus. This gives a relative % survival ({1-(%dead vaccinated group/% dead in control group)}*100) in the vaccinated group of 64.2. This experiment clearly shows that a vaccine produced with Piscirickettsia salmonis produced as described in this patent, mixed with other antigens reduced mortality against and elicits protection against piscirickettsiosis.
Example 9. Growth of Piscirickettsia salmonis on cystein heart agar supplemented with 5% sheep blood.
AL 10005 was inoculated onto cystein heart agar supplemented with 5% sheep blood. After one week incubation on 20 C, bacterial growth was observed as whitish lines on the plates.

REFERENCES
"Affinity Chromatography; Principles and Methods", Edition AB, Published by Amersham Pharmacia Biotech.
Birkbeck T. H. etal. 2004, Infection and Immunity, Vol 72, 6, 3693-3694.
Bravo S & Campos M, 1989, Fish Health Section Newsletter, American Fisheries Society 17, 3.
Cvitanich, Garate & Smith, 1991, J. Fish Diseases, Vol. 14, 121-145.
Fryer J. L. et al., 1990, Fish Pathology, Vol. 25, 2, 107-114.
Fryer J. L. et al., 1992, International Journal of Systematic Bacteriology, Vol. 42, 1, 120-126.
Godwin, G.P. and Whitford, W., 1993, Focus 15, 44.
House ML, Bartholomew JL, Winton JR and Fryer, 1999, Diseases of Aquatic Organisms 35, 107-113.
Jan Raa, 1996, Reviews in Fisheries Science 4(3): 229-228 karber, G, 1931, Beitrag zur Kollektiven Behandlung Pharmakologischer Reihenversuche. Arch. Exp. Pathol. Pharmakol. 162:480-483.
Kuzyk M. A. et al., 2001a, J. Mol. Microbiol. Biotechnol. Vol. 3, 1, 83-93.
Kuzyk M. A. et al., 2001b, Vaccine, Vol 19, 2337-2344.
Marshall S., Heath S., Henriquez V. & Orrego C., 1998, Minimally invasive detection of Piscirickettsia salmonis in cultivated salmonids via the PCR.
App!.
Environ. Microbiol., 64, 3066-3069.
Mauel M. J., Giovannoni S.J. & Fryer J.L., 1996, Development of polymerase chain reaction assays for detection, identification, and differentiation of Piscirickettsia salmonis. Dis. Aquat. Org., 26, 189-195.
McCarthy U, Steiropoulos, Thompson KD, Adams A, Ellis AE and Ferguson HW,2005, Diseases of Aquatic Organisms 64, 107-119.
"Protein purification methods; a practical approach" Eds. ELV Harris and S
Angal, published in the Practical Approach Series, series editors D Rickwood & BD
Hames, IRL Press, Oxford 1989.
Rognes T, 2001, ParAlign: a parallel sequence alignment algorithm for rapid and sensitive database searches, Nucleic Acids Research, 29, 1647-1652.
Smith TF and Waterman MS, 1981, Identification of common molecular sub-sequences.
Journal of Molecular Biology, 147, 195-197.

Smith PA, Lannan CN, Garces LH, Jarpa M, Larenas J, Caswell-Reno P, Whipple M
and Fryer JL, 1995, Bulletin of the European Fish Pathologists 15, 137-141.
Smith P. A., Contreras JR, Larenas 33, Aguillon JC,Garces LH, Perez B and Fryer JL, 1997, Dev. Biol. Stand. Vol. 90, 161-166.
World Organization for Animal Health as published in the Manual of Diagnostic tests for Aquatic Animals 2003, part 2, section 2.1, chapter 2.1.13

Claims

38

1. A process for culturing a bacterium of the species Piscirickettsia salmonis comprising:
inoculating a culture medium with said bacterium;
subjecting the inoculated culture medium to conditions which allow said bacterium to multiply; and harvesting the bacterium from said culture medium;
wherein said culture medium does not contain any host cells.

2. The process according to claim 1, wherein said bacterium has an internal transcribed spacer region comprising a nucleic acid sequence which is more than 96% identical to the full length of the sequence set forth in SEQ ID NO: 1.

3. The process according to claim 1 or 2, wherein said bacterium has a 16S
rRNA
sequence comprising a nucleic acid sequence which is at least 95% identical to the full length of the sequence set forth in SEQ ID NO: 2.

4. The process of any one of claims 1-3, wherein said bacterium is selected from the group consisting of the bacteria of which samples are deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 0JG UK on the 9 june 2006 under the following accession numbers: 06050901, 06050902 and 06050903 and the bacteria of which a sample is deposited on 21 March 2007 under the accession number 07032110 (isolate AL10014).

5. The process of any one of claims 1-4, wherein said bacterium of the species Piscirickettsia salmonis is capable of introducing the symptoms and disease of piscirickettsiosis in Atlantic salmon weighing 20-40 grams and being kept in fresh water, within a period of 5 weeks after a culture of said bacterium having a titre of at least 10 5 TCID50/ml is injected intraperitoneally into the salmon.

6. The process of claim 5, wherein the culture of said bacterium has been diluted 10-fold prior to being injected.

7. The process of any one of claims 1-6, comprising establishing a preculture of said bacterium of the species Piscirickettsia salmonis, transferring said bacterium from the preculture to a production culture and harvesting said bacterium from the production culture, when the production culture has reached an optical density (O.D.600nm) of 4-20.

8. The process of any one of claims 1-7, wherein said bacterium of the species Piscirickettsia salmonis is cultured at a temperature of between 10 and 25°C.

9. The process of any one of claims 1-8, wherein the bacterium of the species Piscirickettsia salmonis is propagated at a pH of between 5.5 and 8Ø

10. The process of any one of claims 1-9, wherein said culture medium is a nutrition rich medium.

11. The process of any one of claims 1-10, wherein said culture medium containsg one or more compounds selected from the group consisting of proteins, amino acids, carbohydrates, fatty acids, lipids and micronutrients.

12. The process of any one of claims 1-11, wherein the bacterium of the species Piscirickettsia salmonis is cultured by batch fermentation, by fed-batch fermentation or by continuous fermentation.

13. A process for producing a vaccine comprising i) a step of culturing a bacterium of the species Piscirickettsia salmonis, comprising inoculating a culture medium with said bacterium, and subjecting the inoculated culture medium to conditions which allow said bacterium to multiply;
ii) harvesting the bacterium from the culture medium; and iii) disrupting or inactivating the bacterium;
wherein said culture medium does not contain any host cells.

14. The process of claim 13, wherein said bacterium has an internal transcribed spacer region comprising a nucleic acid sequence which is more than 96%
identical to the full length of the sequence set forth in SEQ ID NO: 1.

15. The process according to claim 13 or 14, wherein said bacterium has a 16S
rRNA sequence comprising a nucleic acid sequence which is at least 95%
identical to the full length of the sequence set forth in SEQ ID NO: 2.

16. The process according to any one of claims 13-15, wherein the bacterium is selected from the group consisting of:

i) the bacteria of which samples are deposited under the Budapest Treaty with the European Collection of Cell Culture (ECACC), Health Protection Agency, Porton Down, Salisbury, Wiltshire (UK), SP4 0JG UK on the 9 June 2006 under the following accession numbers: 06050901, 06050902 and 06050903 and the bacteria of which a sample is deposited on 21 March 2007 under the accession number 07032110.

17. The process according to any one of claims 13 to 16, wherein said bacterium is cultured as defined in any one of claims 6 to 11.

18. The process according to any one of claims 13 to 17, said process comprising a further step of concentrating the bacterium.

19. The process according to claim 18, wherein said step for concentrating the bacterium comprises the use of at least one filtration technique selected from the group consisting of: continuous cross flow filtration, diafiltration, centrifugation, and separation.

20. A vaccine comprising a disrupted or inactivated bacterium of the species Piscirickettsia salmonis and a suitable pharmaceutical carrier, wherein said vaccine contains no material derived from host cells, and is obtained by a process as defined in any one of claims 13-19.

21. The vaccine according to claim 20, said vaccine comprising an amount of Piscirikettsia salmonis antigen, which is higher than 0.05 mg/ml.

22. The vaccine according to any one of claims 20-21, in a formulation comprising an adjuvant.

23. The vaccine according to any one of claims 20-22 in a formulation comprising inactivated Vibrio ordalii.

24. The vaccine according to any one of claims 20-23, in a formulation comprising inactivated Infectious Pancreatic Necrosis Virus (IPNV).

25. The vaccine according to any one of claims 20-24, said vaccine being formulated for administration to a fin fish.

26. The vaccine according to any one of claims 20-25, said vaccine being formulated for administration by a route selected from the group consisting of:
Bath, immersion, intraperitoneal injection, intramuscular injection and oral administration.

27. A feed comprising a vaccine according to any one of claims 20-26.

28. A vaccine comprising a disrupted or inactivated bacterium of the species Piscirickettsia salmonis and a suitable pharmaceutical carrier, wherein said vaccine contains no material derived from host cells.

29. The vaccine according to claim 28, said vaccine comprising an amount of Piscirikettsia salmonis antigen, which is higher than 0.05 mg/ml.

30. The vaccine according to claim 28 or 29, in a formulation comprising an adjuvant.

31. The vaccine according to any one of claims 28-30, in a formulation comprising inactivated Vibrio ordalii.

32. The vaccine according to any one of claims 28-31, in a formulation comprising inactivated Infectious Pancreatic Necrosis Virus (IPNV).

33. The vaccine according to any one of claims 28-32, said vaccine being formulated for administration to a fin fish.

34. The vaccine according to any one of claims 28-33, said vaccine being formulated for administration by a route selected from the group consisting of:
Bath, immersion, intraperitoneal injection, intramuscular injection and oral administration.

35. A feed comprising a vaccine according to any one of claims 28-34.